KR20160121023A - Composition containing paeoniflorin for preventing or treating infertility - Google Patents

Composition containing paeoniflorin for preventing or treating infertility Download PDF

Info

Publication number
KR20160121023A
KR20160121023A KR1020150050388A KR20150050388A KR20160121023A KR 20160121023 A KR20160121023 A KR 20160121023A KR 1020150050388 A KR1020150050388 A KR 1020150050388A KR 20150050388 A KR20150050388 A KR 20150050388A KR 20160121023 A KR20160121023 A KR 20160121023A
Authority
KR
South Korea
Prior art keywords
composition
present
paeoniflorin
infertility
preventing
Prior art date
Application number
KR1020150050388A
Other languages
Korean (ko)
Other versions
KR101697915B1 (en
Inventor
하기태
최희정
Original Assignee
부산대학교 산학협력단
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 부산대학교 산학협력단 filed Critical 부산대학교 산학협력단
Priority to KR1020150050388A priority Critical patent/KR101697915B1/en
Publication of KR20160121023A publication Critical patent/KR20160121023A/en
Application granted granted Critical
Publication of KR101697915B1 publication Critical patent/KR101697915B1/en

Links

Images

Classifications

    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/70Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7042Compounds having saccharide radicals and heterocyclic rings
    • A61K31/7048Compounds having saccharide radicals and heterocyclic rings having oxygen as a ring hetero atom, e.g. leucoglucosan, hesperidin, erythromycin, nystatin, digitoxin or digoxin
    • AHUMAN NECESSITIES
    • A23FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23LFOODS, FOODSTUFFS, OR NON-ALCOHOLIC BEVERAGES, NOT COVERED BY SUBCLASSES A21D OR A23B-A23J; THEIR PREPARATION OR TREATMENT, e.g. COOKING, MODIFICATION OF NUTRITIVE QUALITIES, PHYSICAL TREATMENT; PRESERVATION OF FOODS OR FOODSTUFFS, IN GENERAL
    • A23L33/00Modifying nutritive qualities of foods; Dietetic products; Preparation or treatment thereof
    • A23L33/10Modifying nutritive qualities of foods; Dietetic products; Preparation or treatment thereof using additives

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Animal Behavior & Ethology (AREA)
  • Engineering & Computer Science (AREA)
  • Food Science & Technology (AREA)
  • Polymers & Plastics (AREA)
  • Molecular Biology (AREA)
  • Medicinal Chemistry (AREA)
  • Mycology (AREA)
  • Epidemiology (AREA)
  • Nutrition Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Coloring Foods And Improving Nutritive Qualities (AREA)
  • Acyclic And Carbocyclic Compounds In Medicinal Compositions (AREA)
  • Medicines Containing Plant Substances (AREA)

Abstract

The present invention relates to a composition for preventing or treating sterility. The present invention further relates to a composition for promoting pregnancy or a composition for enhancing ovular endometrial implantation ability. More specifically, the present invention relates to a composition for preventing or treating sterility, containing paeoniflorin as an active ingredient. The present invention further relates to a composition for promoting pregnancy, or to a composition for enhancing implantation ability. According to the present invention, paeoniflorin increases expression of a leukocyte inhibitory factor (LIF), and promotes fusion between embryo-derived trophoblastic cell and maternal endometrial cell, thereby increasing implantation efficiency in a fertilized egg. Therefore, paeoniflorin can be useful in fields for preventing or treating sterility.

Description

패오니플로린을 유효성분으로 포함하는 불임증 예방 또는 치료용 조성물{Composition containing paeoniflorin for preventing or treating infertility}[0001] The present invention relates to a composition for preventing or treating infertility comprising, as an active ingredient,

본 발명은 불임증 예방 또는 치료용 조성물, 임신촉진용 조성물, 또는 착상능 증진용 조성물에 관한 것으로, 더욱 상세하게는 패오니플로린(paeoniflorin)을 유효성분으로 포함하는 불임증 예방 또는 치료용 조성물, 임신촉진용 조성물, 또는 난자의 자궁 내 착상능 증진용 조성물에 관한 것이다.
The present invention relates to a composition for preventing or treating infertility, a composition for promoting pregnancy or a composition for improving fertility, and more particularly, to a composition for preventing or treating infertility comprising paeoniflorin as an active ingredient, Or a composition for enhancing the intrauterine implantability of an oocyte.

일반적인 경우 결혼 후 원만한 부부관계를 갖는 부부의 약 85% 정도가 1년 내에 임신이 되는 반면, 불임이란 1년이 지나도록 임신이 되지 않는 상태를 말한다. 남녀 공통의 불임 원인으로는 유전적인 결함, 환경적인 결함, 그리고 내분비 계통의 이상, 면역학적 원인 등이 있는데 남성 불임증의 원인으로는 정자 및 정액의 결함이 가장 큰 원인으로 전체 비율의 약 30% 정도를 차지하고 있다. In general, about 85% of married couples who have a marital relationship after marriage become pregnant within a year, whereas infertility refers to a condition that does not become pregnant after one year. The cause of male infertility is genetic defects, environmental defects, abnormalities of endocrine system, and immunological causes. Male infertility is caused by sperm and semen defects which account for about 30% Respectively.

여성의 경우에는 남성에 비하여 불임증의 원인이 훨씬 다양하고 복잡하다. 여성 불임증의 원인으로는 배란장애, 자궁관의 이상, 폐쇄, 폐색 또는 협착에 의한 수정란의 이송장애, 자궁 또는 자궁목의 이상 등이 있다. 여기서 자궁에서 기원한 여성 불임증에는 자궁의 선천 이상과 난자의 비착상이 원인이 된다.In women, the cause of infertility is much more varied and complicated than in men. Causes of female infertility include ovulation disorders, abnormalities of the uterine tube, obstruction of transfer of embryos due to obstruction, obstruction or stenosis, abnormal uterine or cervical incision. Female infertility originating in the uterus is caused by congenital abnormalities of the uterus and invasion of the oocyte.

현재 불임증을 해결하는 치료 방법으로는 인공 수정(intrauterine insemination, IU, 자궁내 정자 주입), 시험관 아기와 배아 시술(In vitro fertilization-embryo transfer, IVF-ET, 체외수정)을 통하여 임신을 직접 유도하는 방법이 있다. 이러한 보조생식술 분야는 많은 진보에도 불구하고 그 성공률은 10~30%로 낮으며, 시술 실패에 따른 가족의 정신적, 금전적 고통이 유발되고 있는 단점이 있다. 더욱이 인공 수정 및 시험관 아기와 배아 시술에서 수정이 이루어졌다고 해도 수정된 배아가 모체의 자궁 내막에 착상에 착상하지 못하면 임신은 성공하지 못한다. 현재 의료기술로는 착상 장애 치료제 개발 및 시술은 미흡한 실정이며, 착상 효율을 증가시킬 수 있는 불임치료제 개발이 요구되고 있다.Currently, infertility treatment methods include intrauterine insemination (IU), in vitro fertilization-embryo transfer (IVF-ET), and in vitro fertilization There is a way. Despite much progress, the success rate of this assisted reproductive technology is low to 10 ~ 30%, and there is a disadvantage that the mental and financial troubles of the family are caused by the failure of the procedure. Furthermore, even if fertilization has been done in artificial fertilization and in vitro fertilization, fertilization is not successful if the fertilized embryo fails to conceive in the endometrium of the mother. Currently, development and treatment of implantation disorder treatment are not enough as medical technology, and development of infertility treatment that can increase implantation efficiency is required.

착상(Implantation)이란 수정된 배아가 자궁내벽에 붙어 태아가 모체로부터 산소 및 영양분을 받을 수 있는 상태를 말한다. 수정란의 착상과정은 수정란의 투명대가 제거되는 부화(hatching), 수정란과 자궁 내피의 느슨한 상호작용인 부착(apposition), 수정란과 자궁내피의 강한 결합인 접착(adhesion), 결합한 수정란이 자궁내막으로 뚫고 들어가는 침투(invasion) 등의 일련의 과정을 통하여 이루어진다.Implantation refers to a state in which a fertilized embryo is attached to the lining of the uterus to allow the fetus to receive oxygen and nutrients from the mother. The fertilization process of the embryo is performed by hatching, which removes the zona pellucida, apposition, which is a loose interaction between the embryo and the endometrium, adhesion which is a strong bond between the embryo and the endometrium, And invasion through the process.

이러한 착상과정은 다양한 사이토카인이나 성장인자들이 관여하여 조절되며, 특히 인터루킨-6(IL-6) 종류의 사이토카인인 백혈병억제인자(leukemia inhibitory factor; LIF)의 발현이 중요하다. LIF 유전자가 결손된 생쥐의 경우 부착(apposition)까지는 정상적으로 진행되다가 접착(adhesion) 과정부터 결함이 발생하여 착상과 임신이 되지 않는다(Nature. 359(6390):76-9; Endocrinology 150(6):2915-2923). 또한 LIF의 수용체(LIF-R)에 대한 길항제(antagonist)를 이용하여 LIF의 기능을 억제하면 착상이 일어나지 않는(PNAS 104(49):19357-19362) 등 LIF는 착상과정에 가장 핵심적 인자이다. The expression of leukemia inhibitory factor (LIF), which is a cytokine of interleukin-6 (IL-6), is important. In mice lacking the LIF gene, normal progression to apposition occurs, and defects are generated from the adhesion process, and conception and pregnancy do not occur (Nature 359 (6390): 76-9; Endocrinology 150 (6): 2915-2923). In addition, LIF is the most important factor in the process of implantation, since it inhibits the function of LIF by using an antagonist to the receptor of LIF (LIF-R) (PNAS 104 (49): 19357-19362).

한편, 패오니플로린(Paeoniflorin)은 한약재명으로 작약으로 불리는 함박꽃과의 여러해살이 식물인 함박꽃(Paeonia lactiflora Pall.)의 뿌리에서 추출된 배당체(Tetrahedron 25(9):1825-38)이다.On the other hand, Paeoniflorin is a glycoside (Tetrahedron 25 (9): 1825-38) extracted from the root of Paeonia lactiflora Pall.

패오니플로린의 효능에 대해서는 난소의 안드로젠 생산을 억제한다는 보고(Am J Chin Med, 19(1):73-78), 허혈 증상이 있는 쥐모델에서 말초 신경과 뇌의 염증반응을 저해하여 뇌졸중에 대한 뇌신경 보호작용(PLoS One 7(11):e49701)과 미세교세포의 활성화를 선택적으로 억제함으로써 모르핀에 대한 내성을 약화시킨다는 보고(Eur J Pain. doi : 10.1002 / ejp.617, 2014) 등이 있다.In the rat model with ischemic symptoms, it inhibited the inflammatory response of the peripheral nerves and the brain, and therefore, (Eur J Pain. Doi: 10.1002 / ejp.617, 2014) that selectively inhibit the activation of microcyst cells and the neurochemical protection function (PLoS One 7 (11): e49701) .

또한 패오니플로린은 인간의 간세포암종에서 암의 침윤과 전이를 저해하고(Bratisl Lek Listy 115(7):427-33), 피부염, 대장염을 억제하는 효과 및 항산화와 항염증 효과가 있다고 알려져 있으나(Imflamm Res. 62(12):1035-44; Am J Physiol Gastrointest Liver Physiol. 306(1):G27-36; Planta Med 79(14):1319-23), 현재까지 패오니플로린이 임신과 관련한 효과가 있다는 보고는 발표된 바 없다.In addition, it is known that lafonipline inhibits the invasion and metastasis of cancer in human hepatocellular carcinoma (Bratisl Lek Listy 115 (7): 427-33), inhibits dermatitis and colitis, and has antioxidant and antiinflammatory effects (1): G27-36; Planta Med 79 (14): 1319-23), and to date, the effects of loniflorin on pregnancy There has been no report that there is.

본 발명자들은 임신 촉진 및 불임 치료에 효과적인 물질을 연구하던 중, 패오니플로린(paoniflorin)이 백혈구억제인자(LIF)의 발현을 증가시키고, 모체의 자궁내막세포와 태아유래 영양막의 결합을 촉진시켜 수정란의 착상 효율을 증가시킴으로써 여성 불임증의 예방 또는 치료 효과가 있음을 확인하여 본 발명을 완성하였다.
The present inventors have been studying effective substances for promoting pregnancy and infertility, and have found that paoniflorin increases the expression of leukocyte inhibitory factor (LIF) and promotes the binding of maternal endometrial cells to fetal-derived nutrient membranes, The present inventors completed the present invention by confirming that there is an effect of preventing or treating female infertility.

본 발명의 목적은 패오니플로린(paeoniflorin)을 유효성분으로 포함하는 불임증의 예방 또는 치료용 조성물을 제공하는 것이다.It is an object of the present invention to provide a composition for preventing or treating infertility comprising paeoniflorin as an active ingredient.

또한, 본 발명의 목적은 패오니플로린을 유효성분으로 포함하는 임신촉진용 조성물을 제공하는 것이다.It is also an object of the present invention to provide a composition for promoting pregnancy comprising corniflorin as an effective ingredient.

또한, 본 발명의 목적은 패오니플로린을 유효성분으로 포함하는 난자의 자궁 내 착상능 증진용 조성물을 제공하는 것이다.
It is also an object of the present invention to provide a composition for enhancing the intrauterine implantability of an oocyte comprising corniflorin as an effective ingredient.

상기 목적을 달성하기 위하여, 본 발명은 패오니플로린(paeoniflorin)을 유효성분으로 포함하는 불임증 예방 또는 치료용 약학적 조성물을 제공한다.In order to achieve the above object, the present invention provides a pharmaceutical composition for preventing or treating infertility comprising paeoniflorin as an active ingredient.

또한, 본 발명은 패오니플로린을 유효성분으로 포함하는 불임증 예방 또는 개선용 식품 조성물을 제공한다.The present invention also provides a food composition for preventing or ameliorating infertility comprising lanoflurane as an effective ingredient.

또한, 본 발명은 패오니플로린을 유효성분으로 포함하는 임신촉진용 약학적 조성물을 제공한다.In addition, the present invention provides a pharmaceutical composition for promoting pregnancy which comprises corniflorin as an active ingredient.

또한, 본 발명은 패오니플로린을 유효성분으로 포함하는 임신촉진용 식품 조성물을 제공한다.In addition, the present invention provides a food composition for promoting pregnancy comprising lanoflurane as an effective ingredient.

또한, 본 발명은 패오니플로린을 유효성분으로 포함하는 난자의 자궁 내 착상능 증진용 약학적 조성물을 제공한다.The present invention also provides a pharmaceutical composition for enhancing the intrauterine implantability of an oocyte comprising corniflorin as an active ingredient.

또한, 본 발명은 패오니플로린을 유효성분으로 포함하는 난자의 자궁 내 착상능 증진용 식품 조성물을 제공한다.
In addition, the present invention provides a food composition for enhancing the ability of an oocyte to promote in utero implantation, which comprises corniflorin as an effective ingredient.

본 발명에 따른 패오니플로린(paeoniflorin)은 백혈구억제인자(LIF)의 발현을 증가시키고, 모체 자궁내막세포와 태아유래 영양막 세포의 결합을 촉진시켜 여성 자궁 내에서 착상 효율을 증가시킴으로써 불임증의 예방 또는 치료에 유용하게 활용될 수 있다.
The paeoniflorin according to the present invention increases the expression of leukocyte inhibitory factor (LIF) and promotes the binding of maternal endometrial cells to fetal-derived trophoblast cells to increase fertilization efficiency in female uterus, thereby preventing or preventing infertility It can be useful for treatment.

도 1 은 작약에 포함된 단일 화합물들에 의한 LIF 단백질의 발현 증가를 웨스턴 블랏 방법으로 확인한 결과를 나타낸 도이다.
도 2는 패오니플로린의 인간 자궁내막 유래 세포인 이시카와 세포(Ishikawa cell)에 대한 세포 독성을 MTT 실험방법으로 확인한 결과를 나타낸 도이다.
도 3은 패오니플로린의 농도에 따른 LIF mRNA 발현의 증가를 RT-PCR 방법으로 확인한 결과를 나타낸 도이다.
도 4는 패오니플로린의 농도에 따른 LIF 단백질 발현의 증가를 웨스턴 블랏 방법으로 확인한 결과를 나타낸 도이다.
도 5는 패오니플로린이 자궁내막유래 세포인 이시카와 세포와 태아유래 영양막세포인 자 세포(JAR cell)의 부착을 증가시키는 정도를 형광현미경으로 확인한 사진이다.
도 6은 패오니플로린이 자궁내막유래 세포인 이시카와 세포와 태아유래 영양막세포인 자 세포(JAR cell)의 부착을 증가시키는 정도를 평가한 결과이다.
Brief Description of the Drawings Fig. 1 is a graph showing the results of Western blot analysis for the increase of LIF protein expression by single compounds contained in peony root.
Fig. 2 is a chart showing the cytotoxicity of Ishikawa cells, which are human endometrial cells derived from lioniflurin, by MTT assay.
FIG. 3 is a graph showing the results of confirming the increase of LIF mRNA expression according to the concentration of the onion florin by the RT-PCR method.
FIG. 4 is a graph showing the results of Western blot analysis for the increase of LIF protein expression according to the concentration of the onion flourine.
Fig. 5 is a photograph showing the degree of increase of adherence between Ishikawa cells, endometrial-derived cells, and JAR cells, fetal-derived trophoblast cells, by fluorescence microscopy.
Fig. 6 shows the results of evaluating the degree of increase of adherence between laryngeal inflorescence-derived cell Ishikawa cells and fetal-derived trophoblast-derived JAR cells.

본 발명은 패오니플로린(paeoniflorin)을 유효성분으로 포함하는 불임증 예방 또는 치료용 조성물을 제공한다.The present invention provides a composition for preventing or treating infertility comprising paeoniflorin as an active ingredient.

또한, 본 발명은 패오니플로린을 유효성분으로 포함하는 임신촉진용 조성물을 제공한다.The present invention also provides a composition for promoting pregnancy comprising corniflorin as an active ingredient.

또한, 본 발명은 패오니플로린을 유효성분으로 포함하는 난자의 자궁 내 착상능 증진용 조성물을 제공한다.The present invention also provides a composition for enhancing the intrauterine implantability of an oocyte comprising corniflorin as an active ingredient.

상기 조성물은 약학적 조성물 또는 식품 조성물을 포함한다.
The composition comprises a pharmaceutical composition or a food composition.

이하, 본 발명에 대해 상세히 설명한다.Hereinafter, the present invention will be described in detail.

본 발명의 패오니플로린(paeoniflorin; C23H28O11)은 분자량 480의 물질로서, 하기 화학식 1로 표시된다.The paeoniflorin (C 23 H 28 O 11 ) of the present invention has a molecular weight of 480 and is represented by the following formula (1).

[화학식 1][Chemical Formula 1]

Figure pat00001
Figure pat00001

상기 패오니플로린은 시판되는 물질을 구입하여 사용할 수 있으며, 또는 작약 또는 모란 등의 목단과에 속하는 식물의 뿌리로부터 공지의 방법으로 분리 및 정제하여 사용하거나, 패오니플로린을 최소 50중량% 이상 포함하는 상기 식물의 뿌리 추출물로 대체하여 사용할 수 있다.The above-mentioned lophosphorins can be purchased and used on the market, or they can be separated and purified from the roots of plants belonging to the family Thunb. Such as peony root or peony, or by using at least 50% by weight of laminin Can be used in place of the root extract of the plant.

상기 패오니플로린(paeoniflorin)은 약학적으로 허용 가능한 염의 형태일 수 있다. 상기 염으로는 약학적으로 허용되는 것이면 특별히 한정되지 않으며, 예를 들어 염산, 황산, 질산, 인산, 불화수소산, 브롬화수소산, 포름산, 아세트산, 타르타르산, 젖산, 시트르산, 푸마르산, 말레산, 숙신산, 메탄술폰산, 벤젠술폰산, 톨루엔술폰산, 나프탈렌술폰산 일 수 있다.The paeoniflorin may be in the form of a pharmaceutically acceptable salt. The salt is not particularly limited as long as it is pharmaceutically acceptable so long as it is pharmaceutically acceptable and includes, for example, hydrochloric acid, sulfuric acid, nitric acid, phosphoric acid, hydrofluoric acid, hydrobromic acid, formic acid, acetic acid, tartaric acid, lactic acid, citric acid, fumaric acid, Sulfonic acid, benzenesulfonic acid, toluenesulfonic acid, and naphthalenesulfonic acid.

본 발명에서 용어, “불임”은 피임을 시행하지 않는 부부가 정상적인 부부관계에도 불구하고 1년 이내에 임신에 도달하지 못한 상태를 의미한다. The term " infertile " in the present invention means a state in which a couple who does not have contraception fails to reach the pregnancy within one year despite the normal marital relationship.

본 발명에서 용어, “임신”은 난자와 정자의 결합으로 만들어진 수정란이 자궁에 착상하여 태아로 발육하는 과정으로, 정상적인 임신 과정은 수정, 착상 및 태아 발달의 순서로 진행된다.In the present invention, the term " pregnancy " refers to a process in which an embryo created by combining an oocyte and a sperm is implanted into the uterus and develops into a fetus. The normal pregnancy process proceeds in the order of fertilization, implantation and fetal development.

본 발명에서 용어, “착상”은 수란관 상부에서 난자와 정자가 만나 수정란이 형성된 후, 수정란이 자궁으로 이동하는 동안 난할이 이루어져 포배 상태로 자궁 내벽에 붙어 태아가 모체로부터 산소 및 영양분을 받을 수 있는 상태를 의미한다. 이 때 포배와 자궁내막 상피세포는 세포 표면의 다양한 수용체들을 통해 부착 및 접착이 이루어지며, 이후 영양막이 자궁내막을 침투하면서 착상이 이루어진다.In the present invention, the term " implantation " refers to a method in which the embryo and sperm meet at the upper part of the oviduct and the fertilized egg is formed, and then the embryo is transferred to the uterus, State. At this time, blastocysts and endometrial epithelial cells are attached and adhered through various receptors on the cell surface, and then the nutrient penetrates into the endometrium and is implanted.

본 발명의 “불임증”은 여성 불임증(Female infertility)인 것이 바람직하다.The term " infertility " of the present invention is preferably female infertility.

상기 여성 불임증은 난자의 착상 장애(Nonimplantation of ovum), 무배란과 관련된 여성 불임증(Female infertility associated with anovulation), 자궁관에서 기원한 여성 불임증(Female infertility of tubal origin), 자궁관의 선천 이상과 관련된 경우(Associated with congenital anomaly of tube), 자궁관의 폐쇄(Tubal block), 자궁관의 폐색(Tubal occlusion), 자궁관의 협착(Tubal stenosis), 자궁에서 기원한 여성 불임증(Female infertility of uterine origin), 자궁의 선천 이상과 관련된 경우(Associated with congenital anomaly of uterus), 자궁목에서 기원한 여성 불임증(Female infertility of cervical origin), 남성 요인과 관련된 여성 불임증(Female infertility associated with male factors), 기타 요인에서 기원한 여성 불임증(Female infertility of other origin) 및 상세불명의 여성 불임증(Female infertility, unspecified) 등을 포함하나, 이에 한정되지 않으며, 바람직하게는 난자의 착상장애에 의한 불임증이다.The female infertility can be classified into two categories: nonimplantation of ovum, female infertility associated with anovulation, female infertility of tubal origin originating from the uterine tube, Tubal occlusion, Tubal stenosis, Female infertility of the uterine origin, Infertility of the uterus, Infertility of the uterus, Infertility associated with male factors, female infertility associated with cervical origins, female infertility associated with male factors, and other factors related to congenital anomaly of uterus. But are not limited to, female infertility of other origin and unspecified female infertility (unspecified) Preferably from an infertility due to failure of the egg implantation.

상기 "난자의 착상장애(Nonimplantation of ovum)"는 여성 불임증의 대표적인 원인으로, 착상 시 수정란이 세포분열을 하면서 이동하여 자궁 속에 들어와 배반포 단계에 이르면 자궁내막에 파묻혀 자리를 잡게 되는데, 배아가 착상할 자궁내막의 두께가 충분치 않거나 손상으로 인해 경직될 경우 착상이 되기가 어려우며 자궁벽의 유착 등으로 공간이 부족할 경우 유산되는 경우가 많다. 자연유산, 계류유산, 임신중절수술, 자궁내막염, 골반결핵 및 자궁 내 장치 등으로 유발된 자궁 내 염증에 의해 자궁내막이 유착되거나, 자궁근종 폴립 등으로 자궁형태변형이나 자궁내막에 면역학적 과민반응이 생기거나, 선천적 자궁기형 호르몬 분비이상으로 자궁내막형성이 불완전할 경우 착상에 장애가 발생한다.The above-mentioned "Nonimplantation of ovum" is a representative cause of female infertility. When fertilized, the embryo moves while dividing cells into the uterus, and when it reaches the stage of blastocyst, it is buried in the endometrium and seated. If the thickness of the endometrium is not enough, or if it is stiff due to injury, it is difficult to be implanted, and if the space is short due to adhesion of the uterine wall, it is often aborted. Endometrial hyperplasia due to intrauterine inflammation caused by spontaneous abortion, mastectomy, abortion, endometritis, pelvic tuberculosis and intrauterine device, or uterine myopathy, Or if the uterine endometrium is incomplete due to congenital abnormal uterine hormone secretion.

본 발명의 일 실시예에 따르면, 패오니플로린은 세포 내 백혈병억제인자(leukemia inhibitory factor; LIF)의 발현을 증가시키는 활성을 가지고 있어, 모체 자궁내막세포와 태아유래 영양막 세포의 결합을 촉진시키고 수정란의 착상을 효과적으로 유도하는 우수한 효과를 가지고 있다. 따라서 패오니플로린은 불임증의 예방 또는 치료, 임신촉진 및 난자의 자궁 내 착상능 증진을 위한 의약품 및 건강기능식품으로 유용하게 사용될 수 있다.
In accordance with one embodiment of the present invention, the present invention provides a method for inhibiting the expression of leukemia inhibitory factor (LIF) And thus has an excellent effect of effectively inducing the implantation of the implant. Therefore, loniflorin can be usefully used as medicines and health functional foods for the prevention or treatment of infertility, promotion of pregnancy, and improvement of fertilization ability of oocyte in uterus.

이에 본 발명은 패오니플로린(paeoniflorin)을 유효성분으로 포함하는 불임증 예방 또는 치료용 약학적 조성물을 제공한다.Accordingly, the present invention provides a pharmaceutical composition for preventing or treating infertility comprising paeoniflorin as an active ingredient.

본 발명에 따른 약학적 조성물은 상기 유효성분 외에도 제형, 사용방법 및 사용목적에 따라 추가성분, 즉, 약학적으로 허용되거나 영양학적으로 허용되는 담체, 부형제, 희석제 또는 부성분을 추가로 포함할 수 있다.The pharmaceutical composition according to the present invention may further contain, in addition to the above-mentioned active ingredients, additional ingredients, that is, pharmaceutically acceptable or nutritionally acceptable carriers, excipients, diluents or subcomponents depending on the formulation, method of use and purpose of use .

보다 상세하게는 상기 조성물은 상기 유효성분 외에 추가로 영양제, 비타민, 전해질, 풍미제, 착색제, 충진제, 펙트산 및 그의 염, 알긴산 및 그의 염, 유기산, 보호성 콜로이드 증점제, pH 조절제, 안정화제, 방부제, 글리세린, 알코올, 탄산음료에 사용되는 탄산화제 등을 추가로 함유할 수 있다.More specifically, the composition may further contain, in addition to the active ingredient, a nutrient, a vitamin, an electrolyte, a flavoring agent, a coloring agent, a filler, a pectic acid and a salt thereof, an alginic acid and a salt thereof, an organic acid, a protective colloid thickening agent, Preservatives, glycerin, alcohols, carbonating agents used in carbonated beverages, and the like.

상기 담체, 부형제 및 희석제로는 통상의 것을 모두 사용 가능하고, 예를 들어 락토즈, 덱스트로즈, 수크로스, 솔비톨, 만니톨, 자일리톨, 에리스리톨, 말티톨, 전분, 아카시아 고무, 알지네이트, 젤라틴, 칼슘 포스페이트, 칼슘 실리케이트, 셀룰로즈, 메틸 셀룰로즈, 미정질 셀룰로스, 폴리비닐 피롤리돈, 물, 메틸히드록시벤조에이트, 프로필히드록시벤조에이트, 탈크, 마그네슘 스테아레이트, 광물유, 칼슘카보네이트, 덱스트린, 프로필렌글리콜, 리퀴드 파라핀 및 생리식염수로 이루어진 군에서 선택된 1 이상 일 수 있으나, 이에 한정되는 것은 아니다. 상기 성분들은 유효성분 즉, 패오니플로린에 독립적으로 또는 조합하여 추가될 수 있다.Examples of the carrier, excipient and diluent include lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, acacia rubber, alginate, gelatin, calcium phosphate , Calcium silicate, cellulose, methylcellulose, microcrystalline cellulose, polyvinylpyrrolidone, water, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate, mineral oil, calcium carbonate, dextrin, propylene glycol, Paraffin, and physiological saline, but is not limited thereto. The components can be added to the active ingredient, i.e., the onion florin, either independently or in combination.

본 발명의 약학적 조성물은 정제, 환제, 산제, 과립제, 캡슐제, 현탁제, 내용액제, 유제, 시럽제, 멸균된 수용액, 비수성용제, 현탁제, 유제, 동결건조제제 및 좌제로 이루어진 군으로부터 선택되는 어느 하나의 제형을 가질 수 있다.The pharmaceutical composition of the present invention may be selected from the group consisting of tablets, pills, powders, granules, capsules, suspensions, solutions, emulsions, syrups, sterilized aqueous solutions, non-aqueous solvents, suspensions, emulsions, freeze- Or < / RTI >

본 발명의 약학적 조성물은 개체에 다양한 경로로 투여될 수 있다. 예를 들어 본 발명의 조성물은 정맥내, 복강내, 근육내, 동맥내, 구강, 심장내, 골수내, 경막내, 경피, 장관, 피하, 설하 또는 국부 투여할 수 있으며, 이에 한정되지 않는다.The pharmaceutical composition of the present invention may be administered to the individual by various routes. For example, the compositions of the present invention may be administered by intravenous, intraperitoneal, intramuscular, intraarterial, oral, intracardiac, intramedullary, intradermal, transdermal, intestinal, subcutaneous, sublingual or topical administration.

본 발명의 약학적 조성물의 치료상 유효 투여량은 대상체의 종, 체중, 연령 및 개별 상태, 치료되는 장애 또는 질환, 또는 이들의 중증도에 따라 달라진다. 숙련된 전문의, 임상의 또는 수의사는 장애 또는 질환의 진행을 예방, 치료 또는 억제하는데 필요한 각 유효 성분의 유효량을 용이하게 결정할 수 있으며, 상기 투여량은 어떠한 의미로든 본 발명의 범위를 한정하는 것은 아니다.
The therapeutically effective dose of the pharmaceutical composition of the present invention will vary depending upon the species, body weight, age and individual condition of the subject, the disorder or disease being treated, or their severity. A skilled artisan, clinician, or veterinarian can readily determine the effective amount of each active ingredient required to prevent, treat, or inhibit the progression of the disorder or disease, and the dosage amount in any way defines the scope of the invention no.

또한, 본 발명은 패오니플로린을 유효성분으로 포함하는 불임증 예방 또는 개선용 식품 조성물을 제공한다.The present invention also provides a food composition for preventing or ameliorating infertility comprising lanoflurane as an effective ingredient.

본 발명의 식품 조성물은 식품학적으로 허용된 담체와 혼합하여 식품 조성물로서 제공될 수 있다. 상기 패오니플로린은 전체 식품 조성물에 대해 0.01 내지 99.99% 중량비로 포함되는 것이 바람직하나, 이에 한정되지 않는다.The food composition of the present invention can be provided as a food composition by mixing with a pharmaceutically acceptable carrier. The above-mentioned lonifurin is preferably contained in a weight ratio of 0.01 to 99.99% with respect to the total food composition, but is not limited thereto.

본 발명의 유효성분을 식품 또는 음료 첨가물로 사용할 경우, 상기 합성 또는 추출물로부터 분리된 것을 그대로 첨가하거나 다른 식품 또는 식품 성분과 함께 사용될 수 있고, 통상적인 방법에 따라 적절하게 사용될 수 있다. 상기 유효성분의 혼합양은 그의 사용목적(예방, 건강 또는 치료적 처치)에 따라 적절하게 조절하여 결정될 수 있다. When the active ingredient of the present invention is used as a food or beverage additive, it may be added as it is or may be used together with other food or food ingredients, and may be appropriately used according to a conventional method. The amount of the active ingredient to be mixed may be determined by suitably adjusting the amount of the active ingredient according to its intended use (prevention, health or therapeutic treatment).

건강 및 위생을 목적으로 하거나 또는 건강 조절을 목적으로 하는 장기간의 섭취인 경우, 본 발명의 식품 조성물은 안전성 면에서 아무런 문제가 없기 때문에, 장기간 복용이 가능하다. For long-term consumption intended for health or hygiene purposes or for health control purposes, the food composition of the present invention has no problem in terms of safety and can be taken for a long period of time.

상기 식품의 종류에는 특별한 제한은 없다. 상기 물질을 첨가할 수 있는 식품의 예로는 육류, 소시지, 빵, 초콜릿류, 캔디류, 스넥류, 과자류, 피자, 라면, 기타 면류, 껌류, 아이스크림류를 포함한 낙농제품, 각종 스프, 음료수, 차, 드링크제, 알코올 음료 및 비타민 복합제 등이 있다. 음료수로 제형화할 경우에 상기 식품 조성물 이외에 첨가되는 액체 성분은 한정되지 않으나, 통상의 음료와 같이 여러 가지 향미제 또는 천연 탄수화물 등을 추가 성분으로서 함유할 수 있다. 상술한 천연 탄수화물의 예는 모노사카라이드(예를 들면, 포도당, 과당 등), 디사카라이드(예를 들면, 말토오스, 수크로오스 등) 및 폴리사카라이드(예를 들면, 덱스트린, 시클로덱스트린 등과 같은 통상적인 당), 및 자일리톨, 소르비톨, 에리스리톨 등의 당 알코올이다. 상기 천연 탄수화물의 비율은 본 발명의 조성물 100 ㎖ 당 일반적으로 약 1 내지 20 g, 바람직하게는 약 5 내지 12 g이다. 상술한 것 이외의 향미제로서 천연 향미제(타우마린, 스테비아 추출물) 및 합성 향미제(예를 들면, 사카린, 아스파르탐 등)를 사용할 수 있다.There is no particular limitation on the kind of the food. Examples of the food to which the above substances can be added include meat, sausage, bread, chocolate, candy, snack, confectionery, pizza, ramen, other noodles, gums, dairy products including ice cream, various soups, drinks, tea, , Alcoholic beverages and vitamin complexes. When formulated into beverage, the liquid ingredient to be added in addition to the above-mentioned food composition is not limited, but may include various flavors or natural carbohydrates such as ordinary beverages as an additional ingredient. Examples of the above-mentioned natural carbohydrates include, but are not limited to, monosaccharides (e.g., glucose and fructose), disaccharides (e.g., maltose, sucrose and the like), and polysaccharides (e.g., dextrin, cyclodextrin, Phosphorus), and sugar alcohols such as xylitol, sorbitol and erythritol. The ratio of the natural carbohydrate is generally about 1 to 20 g, preferably about 5 to 12 g per 100 ml of the composition of the present invention. Natural flavors (taumarin, stevia extract) and synthetic flavorings (e.g., saccharin, aspartame, etc.) other than those described above can be used.

본 발명의 식품 조성물은 여러 가지 영양제, 비타민, 광물(전해질), 합성 풍미제 및 천연 풍미제 등의 풍미제, 착색제 및 증진제 (치즈, 초콜릿 등), 펙트산 및 그의 염, 유기산, 보호성 콜로이드 중점제, pH 조절제, 안정화제, 방부제, 글리세린, 알코올, 탄산음료에 사용되는 탄산화제 등을 함유할 수 있다. 또한 본 발명의 식품 조성물은 과일 및 야채 음료의 제조를 위한 과육을 함유할 수 있다. 이러한 성분은 단독으로 또는 조합으로 사용될 수 있으며, 이러한 첨가제의 비율은 조성물 전체 중량당 0.001 내지 50 중량부의 범위에서 선택되는 것이 일반적이다.
The food composition of the present invention can be used as a flavoring agent such as various nutrients, vitamins, minerals (electrolytes), synthetic flavors and natural flavors, colorants and enhancers (cheese, chocolate etc.), pectic acid and salts thereof, PH adjusters, stabilizers, preservatives, glycerin, alcohols, carbonating agents used in carbonated drinks, and the like. The food composition of the present invention may also contain pulp for the production of fruit and vegetable drinks. These components may be used singly or in combination, and the proportion of such additives is generally selected in the range of 0.001 to 50 parts by weight based on the total weight of the composition.

또한, 본 발명은 패오니플로린을 유효성분으로 포함하는 임신촉진용 약학적 조성물을 제공한다.In addition, the present invention provides a pharmaceutical composition for promoting pregnancy which comprises corniflorin as an active ingredient.

또한, 본 발명은 패오니플로린을 유효성분으로 포함하는 임신촉진용 식품 조성물을 제공한다.In addition, the present invention provides a food composition for promoting pregnancy comprising lanoflurane as an effective ingredient.

또한, 본 발명은 패오니플로린을 유효성분으로 포함하는 난자의 자궁 내 착상능 증진용 약학적 조성물을 제공한다.The present invention also provides a pharmaceutical composition for enhancing the intrauterine implantability of an oocyte comprising corniflorin as an active ingredient.

또한, 본 발명은 패오니플로린을 유효성분으로 포함하는 난자의 자궁 내 착상능 증진용 식품 조성물을 제공한다.In addition, the present invention provides a food composition for enhancing the ability of an oocyte to promote in utero implantation, which comprises corniflorin as an effective ingredient.

상기 약학적 조성물 또는 식품 조성물은 상술한 패오니플로린을 유효성분으로 포함하는 약학적 제제 또는 식품 제제를 포함하기 때문에, 상술한 본 발명의 조성물과 중복된 내용은 중복된 내용의 기재에 의한 본 명세서의 과도한 복잡성을 피하기 위하여 그 기재를 생략한다.
Since the pharmaceutical composition or the food composition includes a pharmaceutical preparation or a food preparation containing the above-mentioned lioniflurane as an active ingredient, the contents overlapping with the composition of the present invention described above can be used in the present specification The description thereof is omitted in order to avoid excessive complexity.

이하, 본 발명을 실시예, 실험예 및 제제예에 의해 상세히 설명한다.Hereinafter, the present invention will be described in detail with reference to Examples, Experimental Examples and Preparation Examples.

단, 하기 실시예, 실험예 및 제제예는 본 발명을 예시하는 것일 뿐, 본 발명의 내용이 하기 실시예, 실험예 및 제제예에 한정되는 것은 아니다.
However, the following Examples, Experimental Examples and Preparation Examples are merely illustrative of the present invention, and the content of the present invention is not limited to the following Examples, Experimental Examples and Preparation Examples.

실시예 1 : 패오니플로린을 포함한 작약 단일 화합물 구입Example 1: Purchase of a monocotyledonous compound containing a loniflorin

작약에 포함된 것으로 잘 알려진 하기 6종의 단일 화합물 Sigma사로부터 구입하였다.Were purchased from Sigma, a single compound of the following six well known to be included in the peony.

: Gallic acid(G7384), (±)-catechin (C1788), (+)-catechin hydrate (C1251), Methyl gallate (Methyl 3,4,5-trihydroxybenzoate) (274194), Paeoniflorin (P0038), Paeonol(2'-hydroxy-4'-methoxyacetophenone) (H35803)
: Gallic acid (G7384), (±) -catechin (C1788), (+) - catechin hydrate (C1251), Methyl gallate (Methyl 3,4,5-trihydroxybenzoate) 274194, Paeoniflorin '-hydroxy-4'-methoxyacetophenone) (H35803)

실험예 1 : 작약에 포함된 단일 화합물들의 백혈병억제인자(이하, LIF) 단백질의 발현 비교EXPERIMENTAL EXAMPLE 1 Expression Comparison of Leukemia Inhibitor (hereinafter referred to as LIF) Protein of Single Compounds Contained in Peony

상기 실시예 1에서 구입한 작약의 단일 화합물들의 처리 농도에 따른 LIF 단백질의 발현 정도를 확인하기 위하여, 종래에 공지된 방법에 따라 웨스턴 블랏을 수행하였다. 먼저 각 단일 화합물들을 이시카와 세포(Ishikawa cell)에 각 50 μΜ의 농도로 처리하고 24시간 동안 세포를 배양한 다음, 세포에서 단백질을 추출하였다. 상기 추출된 단백질을 SDS-PAGE를 통해 단백질을 크기 별로 분리하였다. LIF 단백질 발현량을 분석하기 위해 상기 분리된 단백질을 전기적인 방법으로 니트로셀룰로스(nitrocellulose) 막에 이동시킨 후 첫 번째로 상기 분리된 단백질을 LIF에 특이적인 항체(SantaCruz사)에 결합시키고, 두 번째로 HRP가 부가된 2차 항체와 순차적으로 결합시킨 후, ECL 용액을 이용하여 감광시켜 LIF 단백질 발현량을 분석하였다. 밴드의 강도를 덴시토미트리를 이용하여 측정하고 LIF 단백질의 발현량 및 대조 표준인 GAPDH 단백질 발현량의 비율을 확인하였으며, 그 결과를 도 1에 나타내었다.Western blotting was performed according to a conventionally known method in order to confirm the expression level of the LIF protein according to the treatment concentration of the single compounds of Peony root purchased in Example 1 above. First, each single compound was treated with Ishikawa cells at a concentration of 50 μM and the cells were cultured for 24 hours, and proteins were extracted from the cells. The extracted proteins were separated by size by SDS-PAGE. In order to analyze the amount of LIF protein expression, the separated protein was electrophoretically transferred to a nitrocellulose membrane. Then, the separated protein was first bound to an antibody specific for LIF (Santa Cruz), and the second , Followed by secondary immunization with HRP, followed by sensitization with ECL solution to analyze the amount of LIF protein expressed. The intensity of the band was measured using Densitomycetes and the ratio of the expression level of LIF protein and the expression level of GAPDH protein as a control standard was confirmed. The results are shown in FIG.

도 1에 나타낸 바와 같이, 단일 화합물들 중 패오니플로린에 의해 LIF 단백질의 발현이 증가함을 확인하였다.
As shown in Fig. 1, it was confirmed that the expression of LIF protein was increased by the lopinflorin among the single compounds.

실험예 2 : 패오니플로린의 독성 확인Experimental Example 2: Determination of toxicity of lanofurin

상기 실시예 1에서 구입한 패오니플로린의 세포에 대한 독성여부를 확인하기 위하여, 패오니플로린을 인간 자궁내막 유래 세포인 이시카와 세포(Ishikawa cell)에 각각 0, 1, 10, 50, 100, 500 μΜ의 농도로 처리하고 이시카와 세포의 생존능을 종래 공지된MTT 실험방법으로 측정하였다. 살아있는 세포는 대조군과 비교하여 백분율로 나타내었으며, 그 결과를 도 2에 나타내었다. To confirm the toxicity of the lion florin purchased in Example 1, lanoflurane was added to Ishikawa cells, which are the endometrial cells derived from human endometrium, at 0, 1, 10, 50, 100, 500 mu] m and the viability of Ishikawa cells was measured by a conventionally known MTT assay method. The viable cells were expressed as percentage compared to the control group, and the results are shown in Fig.

도 2에 나타낸 바와 같이, 패오니플로린을 500 μΜ의 농도까지 처리하여도 이시카와 세포는 90 내지 100%가 생존하였는바, 패오니플로린은 유의미한 세포 독성이 없다는 것을 확인하였다. 이하 실험에서는 독성이 없는 50 μM이하의 농도를 사용하였다.
As shown in Fig. 2, 90% to 100% of the Ishikawa cells survived even when the lonifurin was treated to a concentration of 500 μM, confirming that the lonifurin had no significant cytotoxicity. In the following experiments, concentrations of 50 μM or less without toxicity were used.

실험예 3 : 패오니플로린의 농도에 따른 백혈병억제인자(LIF) mRNA의 발현량 비교Experimental Example 3: Comparison of expression levels of leukemia inhibitory factor (LIF) mRNA according to the concentration of the onion florin

상기 실시예 1에서 구입한 패오니플로린의 처리 농도에 따른 LIF mRNA의 발현 정도를 확인하기 위하여, 패오니플로린을 이시카와 세포(Ishikawa cell)에 각각 0, 10, 30, 50 μΜ의 농도로 처리하고 24시간 동안 세포를 배양하였다. 상기 배양된 세포에서 RNA를 추출하여 LIF에 특이적인 프라이머를 이용하여 변성(denaturation) 과정으로 95℃에서 30초, 어닐링(annealing) 과정으로 60℃에서 30초, 연장(extension) 과정으로 72℃에서 30초를 35회 반복하는 RT-PCR을 수행함으로써 LIF mRNA 발현량을 확인하였다. 상기 LIF프라이머의 서열은 정방향은 5'- ACGCCACCTGTGCCATACGC -3'이며, 역방향은 5'- GATGTCGGCGGTGGCGTTGA -3' 이고, β-actin 프라이머의 서열은 정방향은 5'- CAAGAGATGGCCACGGCTGCT -3'이며, 역방향은 5'- TCCTTCTGCATCCTGTCGGCA -3' 이다. 상기 RT-PCR을 통해 증폭된 DNA를 전기 영동하여 자외선(UV) 하에 촬영한 후, 밴드의 강도를 덴시토미트리(densitometry)를 이용하여 측정하고, LIF mRNA의 발현량 및 대조 표준으로서 β-actin mRNA의 발현량의 비율을 확인하였으며, 그 결과를 도 3에 나타내었다. To confirm the expression level of LIF mRNA according to the treatment concentration of lophosphorin purchased in Example 1, lophosphorin was treated at Ishikawa cell at a concentration of 0, 10, 30 and 50 μM, respectively Cells were cultured for 24 hours. RNA was extracted from the cultured cells and subjected to denaturation at 95 ° C for 30 seconds using an LIF specific primer, annealing at 60 ° C for 30 seconds, extension at 72 ° C RT-PCR was performed by repeating 30 seconds 35 times to confirm the amount of LIF mRNA expression. The sequences of the LIF primers are 5'-ACGCCACCTGTGCCATACGC -3 'in the forward direction and 5'-GATGTCGGCGGTGGCGTTGA -3' in the reverse direction, 5'-CAAGAGATGGCCACGGCTGCT -3 'in the forward direction and 5'- CAAGAGATGGCCACGGCTGCT -3' - TCCTTCTGCATCCTGTCGGCA -3 '. The DNA amplified by the RT-PCR was electrophoresed and photographed under ultraviolet light (UV). The intensity of the band was measured using densitometry. The expression level of LIF mRNA and the expression level of β-actin The ratio of mRNA expression was confirmed, and the results are shown in Fig.

도 3에 나타낸 바와 같이, 패오니플로린의 농도 의존적으로 유의하게 LIF mRNA의 발현이 증가함을 확인하였다.
As shown in FIG. 3, it was confirmed that the expression of LIF mRNA was significantly increased depending on the concentration of the onion flourine.

실험예 4 : 패오니플로린의 농도에 따른 LIF 단백질 발현량 비교EXPERIMENTAL EXAMPLE 4: Comparison of LIF Protein Expression According to Concentration of Paoniflorin

상기 실시예 1에서 구입한 패오니플로린의 처리 농도에 따른 LIF 단백질 발현을 확인하기 위하여, 종래 공지된 방법에 따라 웨스턴 블랏을 수행하였다. 먼저 패오니플로린을 이시카와 세포에 각각 0, 10, 30, 50 μΜ의 농도로 처리하고 24시간 동안 배양한 다음, 세포에서 단백질을 추출하였다. 상기 추출된 단백질을 SDS-PAGE를 통해 단백질을 크기 별로 분리하였다. LIF 단백질 발현량을 분석하기 위해 상기 분리된 단백질을 전기적인 방법으로 니트로셀룰로스(nitrocellulose) 막에 이동시킨 후 첫 번째로 상기 분리된 단백질을 LIF에 특이적인 항체(SantaCruz사)에 결합시키고, 두 번째로 HRP가 부가된 2차 항체와 순차적으로 결합시킨 후, ECL 용액을 이용하여 감광시켜 LIF 단백질 발현량을 분석하였다. 밴드의 강도를 덴시토미트리를 이용하여 측정하고 LIF 단백질의 발현량 및 대조 표준인 GAPDH 단백질 발현량의 비율을 확인하였으며, 그 결과를 도 4에 나타내었다.Western blotting was performed according to a conventionally known method in order to confirm LIF protein expression according to the treatment concentration of the lophosphorin purchased in Example 1 above. First, lofrinafine was treated with Ishikawa cells at concentrations of 0, 10, 30, and 50 μM, respectively, and cultured for 24 hours. Proteins were then extracted from the cells. The extracted proteins were separated by size by SDS-PAGE. In order to analyze the amount of LIF protein expression, the separated protein was electrophoretically transferred to a nitrocellulose membrane. Then, the separated protein was first bound to an antibody specific for LIF (Santa Cruz), and the second , Followed by secondary immunization with HRP, followed by sensitization with ECL solution to analyze the amount of LIF protein expressed. The intensity of the band was measured using Densitomycetes and the ratio of the expression level of LIF protein and the expression level of GAPDH protein as a control standard was confirmed. The results are shown in FIG.

도 4에 나타낸 바와 같이, 패오니플로린의 농도 의존적으로 LIF 단백질의 발현이 증가함을 확인하였다.
As shown in FIG. 4, it was confirmed that the expression of LIF protein was increased depending on the concentration of the onion flourine.

실험예 5 : 패오니플로린이 처리된 이시카와 세포에 대한 자 세포(JAR cell)의 부착능 확인Experimental Example 5: Confirmation of adherence of JAR cell to Ishikawa cells treated with corniflorin

상기 실시예 1에서 구입한 패오니플로린이 처리된 자궁내막 유래 이시카와 세포에 대한 태아 유래 영양막 세포인 자 세포의 부착능을 확인하기 위하여, 인간 자궁내막유래 세포인 이시카와 세포를 80% 군집(confluence)이 되도록 단일층으로 배양시킨 후, 배양된 세포에 상기 실시예 1에서 구입한 50 μΜ 농도의 패오니플로린을 처리하였다. 그 후, 72시간 동안 배양시켜 이시카와 세포가 100% 군집이 되도록 하였다. 그 다음 미리 배양된 태아 유래 세포인 자 세포를 배양접시에서 떼어내어 이시카와 세포와 자 세포가 단일 세포가 되도록 잘 현탁시켰다. 여기에 디에이피아이(DAPI; 4',6-diamidino-2-phenylindole)를 이용하여 세포핵을 형광 염색시킨 후 이시카와 세포의 단일층에 뿌리고, 약 60 rpm의 속도로 교반하면서 37℃에서 30분간 배양기에서 배양하였다. 그 후에 부착되지 않은 세포는 인산염완충용액(PBS)으로 2회 세척하여 제거하고, 부착된 세포는 3.7% 포르말린 용액을 이용하여 고정하였다. 고정된 세포를 형광현미경으로 확인하여 사진으로 촬영하였으며, 그 결과를 도 5에 나타내었다. 그 후 DAPI에 의해 형광을 발하는 바닥의 이시카와 세포에 부착된 자 세포의 개수를 측정하고, 5개 이상의 다른 영역의 사진에서 계수된 세포의 총 수를 약물을 처리하지 않은 대조군과 비교한 다음, 3회 반복한 값의 평균과 표준편차를 도 6에 나타내었다.In order to confirm the adherence of the embryo-derived trophoblast-derived Ischikawa cells to the endophytic-derived Ishikawa cells treated with the coronary fibroblasts purchased in Example 1, Ishikawa cells, which are human endometrial cells derived from embryos, were confluent (80% confluence) , And the cultured cells were treated with the 50 μM concentration of the onion flour purchased in Example 1 above. Thereafter, the cells were cultured for 72 hours so that Ishikawa cells became 100% clusters. Then, pre-cultured embryo-derived cells were detached from the culture dish and suspended well so that the Ishikawa cells and the sperm cells became single cells. The nuclei were fluorescently stained with DAPI (4 ', 6-diamidino-2-phenylindole), sprayed onto a single layer of Ishikawa cells, and incubated at 37 ° C for 30 minutes in an incubator Lt; / RTI > The unattached cells were then washed twice with phosphate buffered saline (PBS) and the adhered cells were fixed with a 3.7% formalin solution. Fixed cells were photographed by fluorescence microscopy and the results are shown in FIG. The number of sperm cells attached to the Ishikawa cells at the bottom of the fluorescence by DAPI was then measured and the total number of cells counted in photographs of 5 or more different areas was compared with the untreated control group, The mean and standard deviation of the repeated values are shown in FIG.

도 5 및 6에 나타낸 바와 같이, 패오니플로린을 처리한 경우 대조군에 비하여 이시카와 세포에 대한 자 세포의 부착능이 약 2.5배 정도 유의하게 증가하였음을 확인하였다.
As shown in Figs. 5 and 6, it was confirmed that the adherence of sion cells to Ishikawa cells was about 2.5 times higher than that of the control group when treated with lanofluorine.

이상의 실험 결과를 통하여, 패오니플로린을 이용하면 수정란의 착상에 관여하는 핵심적인 사이토카인인 LIF의 발현이 촉진됨을 확인하고, 자궁내막세포와 태아유래 영양막의 결합이 촉진됨을 확인하였으며, 이를 통해 패오니플로린을 불임증 예방 또는 치료용 조성물, 임신촉진용 조성물, 난자의 자궁 내 착상능 증진용 조성물로 이용할 수 있음을 확인하였다.
From these results, we confirmed that the use of lafoniplin promotes the expression of LIF, a key cytokine involved in embryo implantation, and promotes the binding of endometrial cells to fetal-derived trophoblasts. It has been confirmed that oniflorin can be used as a composition for preventing or treating infertility, a composition for promoting pregnancy, and a composition for enhancing the fertility of oocytes in uterus.

이하 본 발명의 약학적 조성물 및 식품 조성물의 제제예를 설명하나, 본 발명을 한정하고자 함이 아닌 단지 구체적으로 설명하고자 함이다.
Hereinafter, the pharmaceutical composition of the present invention and the preparation example of the food composition will be described, but the present invention is not intended to be limited but is specifically described.

제제예 1. 약학적 조성물의 제조 Formulation Example 1. Preparation of a pharmaceutical composition

1-1. 산제의 제조1-1. Manufacture of Powder

패오니플로린 20 mgPaoniflorin 20 mg

유당 100 mgLactose 100 mg

탈크 10 mgTalc 10 mg

상기의 성분들을 혼합하고 기밀포에 충진하여 산제를 제조한다.
The above components are mixed and filled in airtight bags to prepare powders.

1-2. 정제의 제조1-2. Manufacture of tablets

패오니플로린 10 mgPaoniflorin 10 mg

옥수수전분 100 mgCorn starch 100 mg

유당 100 mgLactose 100 mg

스테아린산 마그네슘 2 mgMagnesium stearate 2 mg

상기의 성분들을 혼합한 후 통상의 정제의 제조방법에 따라서 타정하여 정제를 제조한다.
After mixing the above components, tablets are prepared by tableting according to the usual preparation method of tablets.

1-3. 캡슐제의 제조1-3. Preparation of capsules

패오니플로린 10 mgPaoniflorin 10 mg

결정성 셀룰로오스 3 mgCrystalline cellulose 3 mg

락토오스 14.8 mgLactose 14.8 mg

마그네슘 스테아레이트 0.2 mgMagnesium stearate 0.2 mg

통상의 캡슐제 제조방법에 따라 상기의 성분을 혼합하고 젤라틴 캡슐에 충전하여 캡슐제를 제조한다.
The above components are mixed according to a conventional capsule preparation method and filled in gelatin capsules to prepare capsules.

1-4. 주사제의 제조1-4. Injection preparation

패오니플로린 10 mgPaoniflorin 10 mg

만니톨 180 mg180 mg mannitol

주사용 멸균 증류수 2974 mgSterile sterilized water for injection 2974 mg

Na2HPO42H2O 26 mgNa 2 HPO 4 2H 2 O 26 mg

통상의 주사제의 제조방법에 따라 1 앰플당 (2 ml) 상기의 성분 함량으로 제조한다.
(2 ml) per 1 ampoule in accordance with the usual injection preparation method.

1-5. 액제의 제조1-5. Manufacture of liquid agent

패오니플로린 20 mgPaoniflorin 20 mg

이성화당 10 g10 g per isomer

만니톨 5 g5 g mannitol

정제수 적량Purified water quantity

통상의 액제의 제조방법에 따라 정제수에 각각의 성분을 가하여 용해시키고 레몬향을 적량 가한 다음 상기의 성분을 혼합한 다음 정제수를 가하여 전체를 정제수를 가하여 전체 100 ml로 조절한 후 갈색병에 충진하여 멸균시켜 액제를 제조한다.
Each component was added and dissolved in purified water according to the usual liquid preparation method, and the lemon flavor was added in an appropriate amount. Then, the above components were mixed, and purified water was added thereto. The whole was added with purified water to adjust the total volume to 100 ml, And sterilized to prepare a liquid preparation.

제제예 2. 식품 조성물의 제조Formulation Example 2. Preparation of Food Composition

2-1. 건강식품의 제조2-1. Manufacture of health food

패오니플로린 20 mgPaoniflorin 20 mg

비타민 혼합물 적량Vitamin mixture quantity

비타민 A 아세테이트 70 μg Vitamin A acetate 70 μg

비타민 E 1.0 mgVitamin E 1.0 mg

비타민 B1 0.13 mgVitamin B1 0.13 mg

비타민 B2 0.15 mg0.15 mg of vitamin B2

비타민 B6 0.5 mgVitamin B6 0.5 mg

비타민 B12 0.2 μg Vitamin B12 0.2 μg

비타민 C 10 mgVitamin C 10 mg

비오틴 10 μg Biotin 10 μg

니코틴산아미드 1.7 mgNicotinic acid amide 1.7 mg

엽산 50 μg Folic acid 50 μg

판토텐산 칼슘 0.5 mgCalcium pantothenate 0.5 mg

무기질 혼합물 적량Mineral mixture quantity

황산제1철 1.75 mg1.75 mg of ferrous sulfate

산화아연 0.82 mg0.82 mg of zinc oxide

탄산마그네슘 25.3 mgMagnesium carbonate 25.3 mg

제1인산칼륨 15 mgPotassium monophosphate 15 mg

제2인산칼슘 55 mgSecondary calcium phosphate 55 mg

구연산칼륨 90 mgPotassium citrate 90 mg

탄산칼슘 100 mgCalcium carbonate 100 mg

염화마그네슘 24.8 mgMagnesium chloride 24.8 mg

상기의 비타민 및 미네랄 혼합물의 조성비는 비교적 건강식품에 적합한 성분을 바람직한 실시예로 혼합 조성하였지만, 그 배합비를 임의로 변형 실시하여도 무방하며, 통상의 건강식품 제조방법에 따라 상기의 성분을 혼합한 다음, 과립을 제조하고, 통상의 방법에 따라 건강식품 조성물 제조에 사용할 수 있다.
Although the composition ratio of the above-mentioned vitamin and mineral mixture is comparatively mixed with a composition suitable for health food as a preferred embodiment, the compounding ratio may be arbitrarily modified, and the above ingredients are mixed according to a conventional method for producing healthy foods , Granules can be prepared and used in the manufacture of health food compositions according to conventional methods.

2-2. 건강음료의 제조 2-2. Manufacture of health drinks

패오니플로린 100 mgPaoniflorin 100 mg

비타민 C 15 gVitamin C 15 g

비타민 E(분말) 100 gVitamin E (powder) 100 g

젖산철 19.75 g19.75 g of ferrous lactate

산화아연 3.5 g3.5 g of zinc oxide

니코틴산아미드 3.5 gNicotinic acid amide 3.5 g

비타민 A 0.2 gVitamin A 0.2 g

비타민 B1 0.25 gVitamin B1 0.25 g

비타민 B2 0.3 gVitamin B2 0.3 g

물 정량Water quantification

통상의 건강음료 제조방법에 따라 상기의 성분을 혼합한 다음, 약 1시간 동안 85 ℃에서 교반 가열한 후, 만들어진 용액을 여과하여 멸균된 2 L 용기에 취득하여 밀봉 멸균한 뒤 냉장 보관한 다음 본 발명의 건강음료 조성물 제조에 사용한다.The above components were mixed according to a conventional health drink manufacturing method, and the mixture was stirred and heated at 85 DEG C for about 1 hour. The solution thus prepared was filtered and sterilized in a sterilized 2 L container, It is used in the production of the health beverage composition of the invention.

상기 조성비는 비교적 기호음료에 적합한 성분을 바람직한 실시예로 혼합 조성하였지만 수요계층이나, 수요국가, 사용용도 등 지역적, 민족적 기호도에 따라서 그 배합비를 임의로 변형 실시하여도 무방하다.Although the compositional ratio is relatively mixed with a component suitable for a favorite drink, it is also possible to arbitrarily modify the compounding ratio according to the regional or national preference such as the demand class, the demanding country, and the use purpose.

Claims (8)

하기 화학식1로 표시되는 패오니플로린(paeoniflorin)을 유효성분으로 포함하는 불임증 예방 또는 치료용 약학적 조성물.
[화학식1]
Figure pat00002

1. A pharmaceutical composition for preventing or treating infertility comprising paeoniflorin represented by the following formula (1) as an active ingredient.
[Chemical Formula 1]
Figure pat00002

제1항에 있어서, 상기 불임증은 여성 불임증인 것인, 약학적 조성물.
2. The pharmaceutical composition according to claim 1, wherein the infertility is female infertility.
제2항에 있어서, 상기 여성 불임증은 착상 장애에 의한 것인, 약학적 조성물.
3. The pharmaceutical composition according to claim 2, wherein the female infertility is due to an implantation disorder.
하기 화학식1로 표시되는 패오니플로린(paeoniflorin)을 유효성분으로 포함하는 불임증 예방 또는 개선용 식품 조성물.
[화학식1]
Figure pat00003

1. A food composition for preventing or improving infertility comprising paeoniflorin represented by the following formula (1) as an active ingredient.
[Chemical Formula 1]
Figure pat00003

하기 화학식1로 표시되는 패오니플로린(paeoniflorin)을 유효성분으로 포함하는 임신촉진용 약학적 조성물.
[화학식1]
Figure pat00004

A pharmaceutical composition for promoting pregnancy comprising paeoniflorin represented by the following formula (1) as an active ingredient.
[Chemical Formula 1]
Figure pat00004

하기 화학식1로 표시되는 패오니플로린(paeoniflorin)을 유효성분으로 포함하는 임신촉진용 식품 조성물.
[화학식1]
Figure pat00005

1. A food composition for promoting pregnancy comprising paeoniflorin represented by the following formula (1) as an active ingredient.
[Chemical Formula 1]
Figure pat00005

하기 화학식1로 표시되는 패오니플로린(paeoniflorin)을 유효성분으로 포함하는 난자의 자궁 내 착상능 증진용 약학적 조성물.
[화학식1]
Figure pat00006

A pharmaceutical composition for enhancing the intrauterine implantability of an oocyte comprising paeoniflorin represented by the following formula (1) as an active ingredient.
[Chemical Formula 1]
Figure pat00006

하기 화학식1로 표시되는 패오니플로린(paeoniflorin)을 유효성분으로 포함하는 난자의 자궁 내 착상능 증진용 식품 조성물.
[화학식1]
Figure pat00007


1. A food composition for enhancing the in utero implantability of an oocyte comprising paeoniflorin represented by the following formula (1) as an active ingredient.
[Chemical Formula 1]
Figure pat00007


KR1020150050388A 2015-04-09 2015-04-09 Composition containing paeoniflorin for preventing or treating infertility KR101697915B1 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
KR1020150050388A KR101697915B1 (en) 2015-04-09 2015-04-09 Composition containing paeoniflorin for preventing or treating infertility

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
KR1020150050388A KR101697915B1 (en) 2015-04-09 2015-04-09 Composition containing paeoniflorin for preventing or treating infertility

Publications (2)

Publication Number Publication Date
KR20160121023A true KR20160121023A (en) 2016-10-19
KR101697915B1 KR101697915B1 (en) 2017-01-18

Family

ID=57250945

Family Applications (1)

Application Number Title Priority Date Filing Date
KR1020150050388A KR101697915B1 (en) 2015-04-09 2015-04-09 Composition containing paeoniflorin for preventing or treating infertility

Country Status (1)

Country Link
KR (1) KR101697915B1 (en)

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20190042477A (en) * 2017-10-16 2019-04-24 부산대학교 산학협력단 Improvement of embryo implantation by Yeosin-san
CN112294832A (en) * 2020-11-18 2021-02-02 阜阳师范大学 New application of paeoniflorin
KR102392292B1 (en) 2021-07-21 2022-05-03 중앙대학교 산학협력단 Composition for preventing or treating cachexia and muscle loss comprising pheniflorin

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JPS6485990A (en) * 1987-09-28 1989-03-30 Tsumura & Co Antihypertestoeronemia agent

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JPS6485990A (en) * 1987-09-28 1989-03-30 Tsumura & Co Antihypertestoeronemia agent

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
Nippon Naibunpi Gakkai Zasshi, 1988, 64(11), 1124-1139 *

Cited By (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20190042477A (en) * 2017-10-16 2019-04-24 부산대학교 산학협력단 Improvement of embryo implantation by Yeosin-san
CN112294832A (en) * 2020-11-18 2021-02-02 阜阳师范大学 New application of paeoniflorin
KR102392292B1 (en) 2021-07-21 2022-05-03 중앙대학교 산학협력단 Composition for preventing or treating cachexia and muscle loss comprising pheniflorin
WO2023003193A1 (en) 2021-07-21 2023-01-26 중앙대학교 산학협력단 Composition including paeoniflorin for prevention or treatment of cachexia and muscle loss

Also Published As

Publication number Publication date
KR101697915B1 (en) 2017-01-18

Similar Documents

Publication Publication Date Title
KR102376425B1 (en) Composition useful for promoting female fertility
WO2020262325A1 (en) Anti-aging agent for females
KR101697915B1 (en) Composition containing paeoniflorin for preventing or treating infertility
KR101538047B1 (en) Composition containing polysacchride-removed Paeonia lactiflora extract for improving pregnancy
WO2020258585A1 (en) Health food for improvement of female fertility and preparation method thereof
KR102534210B1 (en) Pharmaceutical Composition comprising Nidus vespae extract as an active ingredient for Preventing or Treating obesity
KR101730949B1 (en) Compositions for preventing or treating infertility comprising an extract of Perilla frutescens
KR101742968B1 (en) Composition containing alpha-cyperone for improving pregnancy
KR101667242B1 (en) Composition containing paeonol for preventing or treating infertility
KR102148771B1 (en) Improvement of embryo implantation by Yeosin-san
KR101788299B1 (en) Composition containing protocatechuic acid for improving pregnancy
KR101669887B1 (en) Composition containing benzoic acid for improving pregnancy
JP7352275B2 (en) Composition for improving menopausal symptoms
KR101897896B1 (en) Composition comprising Coumestrol for improving pregnancy
KR102167989B1 (en) Composition for preventing, ameliorating or treating infertility caused by implantation failure comprising ginseng extract as effective component
ES2940465T3 (en) Tungsten (VI) salts to stimulate fertility and reproduction and to improve the effectiveness of assisted reproductive techniques
WO2019124608A1 (en) Pharmaceutical composition for preventing or treating rheumatoid arthritis, containing 4'-(p-toluenesulfonylamido)-4-hydroxychalcone as active ingredient
KR20210058334A (en) Composition for treating asherman syndrome comprising perivascular stem cell medium or cyclophilin a
KR102066565B1 (en) Composition for preventing, ameliorating or treating male infertility comprising extract of Prunus species as effective component
KR102672575B1 (en) Composition comprising herbal mixture extract for inhibiting anti-cancer drug resistance
EP2253228B1 (en) Composition for controlling and improving female and male gametogenesis
KR101482086B1 (en) Composition for preventing or treating Peyronie's disease comprising histone deacetylase 2 inhibitor
KR102144264B1 (en) Composition for preventing and treating a cancer comprising leonurus sibiricus
KR101879975B1 (en) Composition comprising Naringenin for improving pregnancy
KR101810879B1 (en) Method for increasing erythropoietin using GABA

Legal Events

Date Code Title Description
A201 Request for examination
E902 Notification of reason for refusal
E701 Decision to grant or registration of patent right
GRNT Written decision to grant
FPAY Annual fee payment

Payment date: 20191231

Year of fee payment: 4