KR20160118173A - A microorganism having enhanced L-lysine productivity and a method of producing L-lysine using the same - Google Patents

Abstract

The present invention relates to novel mutant RNA polymerase sigma factor A (SigA) polypeptides, to polynucleotides encoding the same, to a microorganism comprising the polypeptides, and to a method for producing L-lysine using the microorganism. The microorganism comprising the polypeptides can be expected to provide the convenience of production and the reduction of producing costs.

Description

A microorganism having enhanced L-lysine productivity and a method of producing L-lysine using the same}

The present invention relates to a novel variant RNA polymerase sigma factor A (SigA) polypeptide, a polynucleotide encoding the same, a microorganism comprising the polypeptide, and a method for producing L-lysine using the microorganism.

For the development of strains for mass production of useful products such as amino acids, strains with higher production yields can be developed if genetic factors directly or indirectly involved in the upper stage of the glycolysis are found and used appropriately. As a representative technology, there is a global transcription machinery engineering (gTME) technology that controls the expression of all genes in cells by generating random mutations in the recruiting protein of RNA polymerase. For example, a research group at the Massachusetts Institute of Technology has also successfully increased the production of tyrosine in E. coli using gTME technology (US Patent No. 8735132).

RNA polymerase used in the transcription stage of microorganisms is a macromolecule composed of five subunits, two alpha factors (α), beta (β), beta prime (β') and omega factors. It is composed of (ω), and the holoenzyme is expressed as _{α 2 ββ'ω.} Along with these complete enzymes, sigma factor (σ) is an essential element in the initiation of transcription that confers promoter-binding specificity of RNA polymerase. The strain of the genus Corynebacterium has seven types of sigma factors (SigA, SigB, SigC, SigD, SigE, SigH, SigM) and regulates the transcription of specific gene groups according to changes in the external environment (Journal of Biotechnology 154. 2011 101-113). In particular, SigA is a major regulator of most house keeping genes and core genes among seven sigma factors, and studies have been reported to increase the productivity of target substances by randomly mutating SigA (Metabolic Engineering 9. 2007). 258-267), a study of increasing L-lysine productivity using a strain of the genus Corynebacterium has also been reported (International Publication No. WO2003-054179).

Under this background, the present inventors have made diligent efforts to develop a microorganism that produces a higher concentration of L-lysine without inhibiting the growth of host cells, and as a result, developed a novel variant RNA polymerase sigma factor A (SigA) polypeptide. -By introducing into Corynebacterium having lysine-producing ability, it was confirmed that a strain having improved L-lysine-producing ability can be developed, thereby completing the present invention.

An object of the present invention is to provide a variant polypeptide in which some amino acids of a polypeptide having RNA polymerase sigma factor A activity consisting of the amino acid sequence of SEQ ID NO: 2 are substituted.

Another object of the present invention is to provide a polynucleotide encoding the variant polypeptide.

Another object of the present invention is to provide a microorganism transformed to contain the polypeptide.

Another object of the present invention is to obtain a culture by culturing the microorganism; And recovering L-lysine from the culture or microorganism.

As one aspect for achieving the above object, the present invention provides a novel variant polypeptide having RNA polymerase sigma factor A activity.

In the present invention, the term "RNA polymerase sigma factor A (SigA)" is a protein (SigA) corresponding to one of the sigma factors as a transcription initiation factor that works with RNA polymerase. Sigma factor is involved in transcriptional regulation by interacting with upstream DNA (UP element) present upstream of a specific promoter and various transcriptional regulators. In particular, sigma factor A (SigA) is known as a major regulator that controls most of the key genes. Information on the SigA protein can be obtained from a known database such as NCBI GenBank, for example, a protein having an accession number of NP_601117. Specifically, the SigA protein may include the amino acid sequence of SEQ ID NO: 2, and is not limited thereto as long as it has the same activity as the SigA of the present invention.

In the present invention, the term "variant polypeptide" means that a part or all of the amino acid sequence of a wild-type polypeptide is substituted, and in the present invention, a part of the amino acid sequence of a polypeptide having RNA polymerase sigma factor A (SigA) activity is substituted. It is a polypeptide having RNA polymerase sigma factor A (SigA) activity having a sequence different from that of the amino acid sequence of -type). That is, it is not a wild-type SigA polypeptide, but a SigA variant polypeptide that contributes to improving the L-lysine production ability.

Specifically, the variant polypeptide is a variant polypeptide having RNA polymerase sigma factor A activity in which at least one of the amino acids at the following positions in the polypeptide consisting of the amino acid sequence of SEQ ID NO: 2 is substituted with another amino acid, and the mutant position Is the starting methionine as the first amino acid, from which the 136th amino acid; 254th amino acid; 268th amino acid; 281th amino acid; 381th amino acid; 429th amino acid; And 445th to 495th amino acids. That is, the variant polypeptide may be a polypeptide in which at least one of the 57 mutation positions (136, 254, 268, 281, 381, 429, 445-495) is substituted with another amino acid.

More specifically, from the 445th to 495th amino acids, the 447th amino acid; 451th amino acid; 455th amino acid; 479th amino acid; 483th amino acid; 488th amino acid; And one or more of the amino acids consisting of the 491th amino acid may be substituted with another amino acid, but is not limited thereto.

A specific amino acid substitution may be a combination of one or more of the following 13 amino acid substitutions, and the 136th amino acid from the starting methionine is substituted with glycine (D136G); 254th amino acid is substituted with asparagine (I254N); 268th amino acid is substituted with serine (A268S); 281th amino acid is substituted with serine (T281S); Substituted by arginine at the 381th amino acid (L381R); 429th amino acid is substituted with arginine (Q429R); 447th amino acid is substituted with histidine (L447H); 451th amino acid is substituted with isoleucine (L451I); 455th amino acid is substituted with valine (M455V); 479th amino acid is substituted with arginine (K479R); 483th amino acid is substituted with arginine (K483R); 488th amino acid is substituted with threonine (S488T); And the 491 th amino acid may be substituted with arginine (Q491R).

More specifically, in the polypeptide, the 136th and 281th amino acids from the starting methionine of the polypeptide consisting of the amino acid sequence of SEQ ID NO: 2 are substituted with glycine and serine, respectively (D136G, T281S); 254th amino acid is substituted with asparagine (I254N); 268th amino acid is substituted with serine (A268S); Substituted by arginine at the 381th amino acid (L381R); 429th amino acid is substituted with arginine (Q429R); 447th amino acid is substituted with histidine (L447H); 451st and 491th amino acids are substituted with isoleucine and arginine, respectively (L451I, Q491R); 455th amino acid is substituted with valine (M455V); 479th amino acid is substituted with arginine (K479R); 483th amino acid is substituted with arginine (K483R); 488th amino acid is substituted with threonine (S488T); Or it may be a variant polypeptide in which one or more of the 11 kinds of amino acid substitutions are combined.

According to an embodiment of the present invention, the variant polypeptide may be a polypeptide having any one of the amino acid sequences of SEQ ID NOs: 12 to 22.

The variant polypeptide of the present invention is not only the amino acid sequence set forth in SEQ ID NOs: 12 to 22, but also 70% or more, specifically 80% or more, more specifically 90% or more, and more specifically 99% or more of the sequence. As an amino acid sequence showing homology, any protein that contributes to the improvement of the production ability of L-lysine compared to the wild-type SigA protein is included without limitation, and as a sequence having such a homology, it is substantially the same as or corresponding to the mutant SigA protein. In the case of having an amino acid sequence, it is obvious that some sequences are included in the scope of the present invention, even if they have an amino acid sequence that is deleted, modified, substituted or added.

In the present invention, the term "homology" refers to the degree of identicality of bases or amino acid residues between sequences after alignment of both sequences so as to match as much as possible in a specific comparison region in the amino acid or base sequence of a gene encoding a protein do. If the homology is sufficiently high, the expression product of the gene may have the same or similar activity. The percent of sequence identity may be determined using a known sequence comparison program, and examples include BLAST (NCBI), CLC Main Workbench (CLC bio), MegAlign ^TM (DNASTAR Inc), and the like.

Another aspect of the present invention includes a polynucleotide encoding the variant polypeptide, or a vector comprising the polynucleotide.

In the present invention, the term "polynucleotide" is a polymer of nucleotides in which nucleotide units are connected in a long chain by covalent bonds, and is a DNA or RNA strand having a certain length or more, and more specifically, the variant polypeptide It means an encoding polynucleotide fragment.

In the present invention, the gene encoding the amino acid sequence of the RNA polymerase sigma factor A (SigA) is the rpoD gene, and specifically may be derived from Corynebacterium glutamicum. Base sequences encoding the same amino acid sequence and variants thereof due to genetic code degeneracy are also included in the present invention, and may be specifically represented by SEQ ID NO: 1, but are not limited thereto.

In addition, variant polynucleotides also include a base sequence encoding the same amino acid sequence and variants thereof due to genetic code degeneracy. Specifically, a base sequence encoding any one of the amino acid sequences of the amino acid sequences 12 to 22 and a variant thereof may be included, but are not limited thereto.

As another aspect of the present invention, the present invention provides a host cell comprising a polynucleotide encoding the variant polypeptide and a microorganism transformed with a vector comprising a polynucleotide encoding the variant polypeptide. Specifically, the introduction may be performed by transformation, but is not limited thereto.

Specifically, the microorganism containing the SigA variant polypeptide improves the production capacity of L-lysine without inhibiting the growth of host cells compared to the microorganism containing the wild-type SigA polypeptide, so that L-lysine can be obtained in high yield from these microorganisms. I can.

In the present invention, the term "vector" refers to any medium for cloning and/or transfer of a base into a host cell. The vector may be a replicon capable of binding other DNA fragments to bring about replication of the bound fragment. "Replication unit" refers to any genetic unit (eg, plasmid, phage, cosmid, chromosome, virus) that functions as an autonomous unit of DNA replication in vivo, that is, replicable by its own regulation. . The "vector" includes viral and non-viral mediators for introducing a base into a host cell in vitro, ex vivo or in vivo, and may also include minispherical DNA. For example, the vector may be a plasmid that does not have a bacterial DNA sequence. In addition, the vector may include a transposon (Annu Rev Genet. 2003; 37:3-29.) or an artificial chromosome. Specifically, pACYC177, pACYC184, pCL1920, pECCG117, pUC19, pBR322, pDZ and pMW118 vectors may be used, but are not limited thereto.

In the present invention, the term "transformation" refers to introducing a gene into a host cell so that it can be expressed in a host cell, and if the transformed gene can be expressed in a host cell, it is inserted into the chromosome of the host cell or other than the chromosome. Includes, without limitation, whatever is located.

The gene may be introduced into a host cell in the form of an expression cassette, which is a polynucleotide construct containing all elements necessary for self-expression. The expression cassette usually includes a promoter operably linked to the gene, a transcription termination signal, a ribosome binding site, and a translation termination signal. The expression cassette may be in the form of an expression vector capable of self-replicating. In addition, the gene itself or in the form of a polynucleotide structure may be introduced into a host cell and operably linked to a sequence required for expression in the host cell, but is not limited thereto.

The host cell or microorganism is a cell or microorganism capable of expressing a mutant polypeptide by transforming with a vector containing a polynucleotide encoding a mutant polypeptide or a polynucleotide encoding a mutant polypeptide. For the purpose of, the host cell or microorganism may be any microorganism capable of producing L-lysine including a SigA variant polypeptide. Specifically, for example, Escherichia (Escherichia) genus, Serratia marcescens (Serratia), An air Winiah (Erwinia) genus, Enterobacter bacteria (Enterobacteria) genus, Salmonella (Salmonella) genus Streptomyces (Streptomyces) genus Pseudomonas (Pseudomonas) Microbial strains such as genus, Brevibacterium genus, or Corynebacterium genus may be included, and specifically, may be microorganisms of the genus Corynebacterium, and a more specific example is Corynebacterium glutami Corynebacterium glutamicum ), but is not limited thereto.

In one embodiment of the present invention, the amino acid sequence of any one of the amino acid sequences of SEQ ID NOs: 12 to 22 in several strains of Corynebacterium glutamicum having the ability to produce L-lysine (KCCM11016P, KFCC10750, KCCM10770P and CJ3P) As a result of comparing the L-lysine production ability of the strain by introducing the variant polypeptide having the variant polypeptide, it was confirmed that all strains into which the variant polypeptide was introduced produced more L-lysine than the strain containing the wild-type SigA polypeptide ( Examples 7 to 10 and Tables 8 to 11). These results suggest that the microorganism containing the mutant polypeptide of the present invention is a strain having improved L-lysine production ability, and the economic advantage of obtaining high yield L-lysine by culturing the microorganism.

Accordingly, the present inventors named the strain KCCM11016P::SigA(L447H), the strain with improved L-lysine production ability, as Corynebacterium glutamicum "CA01-2277", and as of November 22, 2013, an international deposit under the Budapest Treaty. It was deposited with the Korean Microorganism Conservation Center (KCCM), an institution, and was given the accession number KCCM11479P.

As another aspect of the present invention, the present invention provides a method for producing L-lysine, comprising culturing the described microorganism and recovering L-lysine from the cultured microorganism or culture medium.

In the present invention, the term "culture" means growing the microorganism in an appropriately artificially controlled environmental condition. The cultivation process of the present invention may be performed according to a suitable medium and culture conditions known in the art. Conditions such as specific culture temperature, culture time, and pH of the medium may be performed according to general knowledge of a person skilled in the art or a conventionally known method, and may be appropriately adjusted accordingly. Specifically, these known culture methods are described in Chmiel; Bioprozesstechnik 1. Einfuhrung indie Bioverfahrenstechnik (Gustav Fischer Verlag, Stuttgart, 1991), and Storhas; Bioreaktoren und periphere Einrichtungen (Vieweg Verlag, Braunschweig / Wiesbaden, 1994). In addition, the cultivation method includes batch culture, cintinuous culture, and fed-batch culture, and specifically, a batch process or an injection batch or a fed-batch or repeated injection batch process (fed batch or Repeated fed batch process) can be cultured continuously, but is not limited thereto.

The medium used for cultivation must meet the requirements of a specific strain in an appropriate manner, and the carbon sources that can be used in the medium include sugars and carbohydrates such as glucose, saccharose, lactose, fructose, maltose, starch, cellulose, Oils and fats such as soybean oil, sunflower oil, castor oil, and coconut oil, fatty acids such as palmitic acid, stearic acid, linoleic acid, alcohols such as glycerol, ethanol, organic acids such as acetic acid, and the like may be included. These materials may be used individually or as a mixture, but are not limited thereto. Nitrogen sources that can be used include peptone, yeast extract, broth, malt extract, corn steep liquor, soybean meal and urea or inorganic compounds such as ammonium sulfate, ammonium chloride, ammonium phosphate, ammonium carbonate and ammonium nitrate, and the like. , The nitrogen source may also be used individually or as a mixture, but is not limited thereto. Personnel that may be used may include potassium dihydrogen phosphate or dipotassium hydrogen phosphate or a corresponding sodium-containing salt. In addition, the culture medium may contain a metal salt such as magnesium sulfate or iron sulfate required for growth. Finally, in addition to the above substances, essential growth substances such as amino acids and vitamins can be used. In addition, precursors suitable for the culture medium may be used. The above-described raw materials may be added to the culture in a batch or continuous manner by an appropriate method in the culture process, but are not limited thereto.

In addition, the pH of the culture can be adjusted by adding compounds such as ammonium hydroxide, potassium hydroxide, ammonia, phosphoric acid and sulfuric acid to the culture in an appropriate manner during the culture. During cultivation, foaming can be suppressed by using an antifoaming agent such as fatty acid polyglycol ester. In addition, in order to maintain the aerobic state of the culture, oxygen or oxygen-containing gas may be injected into the culture, or nitrogen, hydrogen, or carbon dioxide gas may be injected without the injection of gas to maintain the anaerobic and microaerobic state. The temperature of the culture is usually 27°C to 37°C, specifically 30°C to 35°C. The cultivation period may be continued until the production amount of the desired useful substance is obtained, and specifically, may be 10 to 100 hours. L-lysine may be discharged into the culture medium or contained in microorganisms.

In addition, in the method of producing L-lysine of the present invention, a method of recovering L-lysine from cultured microorganisms or culture medium is widely known in the art. The L-lysine recovery method may include filtration, anion exchange chromatography, crystallization and HPLC, but is not limited to these examples.

In the present invention, a variant polypeptide of a variant RNA polymerase sigma factor A capable of up-regulating L-lysine production capacity can be identified. In addition, based on this, the microorganism expressing the mutant polypeptide has a remarkably excellent production yield of L-lysine, so it is possible to expect effects such as reduction in manufacturing cost as well as convenience of production from an industrial point of view.

Hereinafter, the present invention will be described in more detail in the following examples. However, these examples are only intended to aid understanding of the present invention, and the present invention is not limited thereto.

Example 1: Secure SigA variant polypeptide using artificial mutagenesis

In this example, in order to obtain a mutant SigA, a vector library for primary cross-insertion in a chromosome was prepared by the following method. Corynebacterium SigA (SEQ ID NO: 2) encoded by the targeting rpoD gene (SEQ ID NO: 1) performing a Error-prone PCR method base substitution mutation is randomly introduced into a rpoD Genetic variant fragments (1497 bp) were obtained. The Error-prone PCR was performed using GenemorphII Random Mutagenesis Kit (Stratagene), and primer 1 (SEQ ID NO: 3) and primer 2 (SEQ ID NO: 4) were used using Corynebacterium glutamicum ATCC13032 genomic DNA as a template. . 0 to 4.5 mutations per 1 kb were introduced into the amplified gene fragment, and PCR conditions were denaturation 96° C., 30 seconds; Annealing 53° C., 30 seconds; And polymerization reaction at 72° C. for 2 minutes was repeated 30 times.

Primer number Base sequence Sequence number One GTGGAGAGCAGCATGGTAG 3 2 CGCAGAGGAAAACAGTGGC 4

The amplified gene fragment was ligated to a pCR2.1-TOPO vector (hereinafter'pCR2.1') using pCR2.1-TOPO TA Cloning Kit (Invitrogen), transformed into E. coli DH5α, and kanamycin (25 mg/l). ) Was spread on LB solid medium containing. After selecting 20 transformed colonies, plasmids were obtained and sequenced. As a result, it was confirmed that mutations were introduced at different locations with a frequency of 1.5 mutations/kb. About 20,000 transformed E. coli colonies were taken to extract a plasmid, which was named pCR2.1-rpoD(mt) library.

After that, a plasmid having a wild-type rpoD gene was prepared for use as a control. Using Primer 1 (SEQ ID NO: 3) and Primer 2 (SEQ ID NO: 4), Corynebacterium glutamicum ATCC13032 genomic DNA was subjected to PCR under the same conditions as described above as a template. As the polymerase, PfuUltra ^™ high-reliability DNA polymerase (Stratagene) was used, and the plasmid thus produced was named pCR2.1-rpoD (WT).

Example 2: Construction of SigA mutant library with increased L-lysine production capacity

The pCR2.1-rpoD(mt) library prepared above using the KCCM11016P (Korea Patent Registration No. 10-0159812) strain as the parent strain was transformed by homologous chromosome recombination, and kanamycin (25 mg/l) and the following components About 25,000 colonies were secured by spreading on the composite plate medium containing this, which was named as KCCM11016P/pCR2.1-rpoD(mt)-1 to KCCM11016P/pCR2.1-rpoD(mt)-25000. In addition, the prepared pCR2.1-rpoD(WT) vector was transformed into the KCCM11016P strain to prepare a control strain, and was named KCCM11016P/pCR2.1-rpoD(WT).

The obtained transformants are 2 copies of rpoD on the chromosome. The gene is retained, but the pCR2.1-rpoD (mt) library and the pCR2.1-rpoD (WT) vector have 2 copies when inserted into the chromosome of the strain by homologous recombination because the rpoD gene fragment without a promoter is inserted. of Only one copy of the rpoD genes can be expressed to express a mutant or wild-type SigA protein.

<Composite flat plate (pH 7.0)>

Glucose 10 g, Peptone 10 g, Beef extract 5 g, Yeast extract 5 g, Brain Heart Infusion 18.5 g, NaCl 2.5 g, Urea 2 g, Sorbitiol 91 g, Agar 20 g (based on 1 liter of distilled water)

Example 3: SigA mutant library screening with increased L-lysine production capacity

About 25,000 colonies obtained in Example 2 were inoculated into 300 μl of selection medium each containing the following components, and cultured for about 24 hours at 32° C. and 1000 rpm in a 96-deep well plate. In order to analyze the production amount of L-lysine produced during culture, the ninhydrin method was used (J. Biol. Chem. 1948. 176:367?388). After the incubation was completed, 10 µl of the culture supernatant and 190 µl of the ninhardrin reaction solution (63% glycerol, 27% ninhydrin solution (7.1 g/L in 0.5M citrate buffer pH 5.5)) were reacted at 65°C for 30 minutes. Then, the absorbance was measured with a spectrophotometer at a wavelength of 570 nm, and about 935 mutant strain colonies showing an absorbance increased by more than 10% compared to the absorbance of the control strain KCCM11016P/pCR2.1-rpoD (WT) were selected. Other colonies showed similar or decreased absorbance compared to the control.

<Selection medium (pH 8.0)>

Glucose 10 g, 5.5 g ammonium sulfate, MgSO ₄ 7H ₂ O 1.2 g, KH ₂ PO ₄ 0.8 g, K ₂ HPO ₄ 16.4 g, Biotin 100 μg, Thiamine HCl 1000 μg, calcium-pantothenic acid 2000 μg, Nicotinamide 2000 ㎍ (based on 1 liter of distilled water)

The above method was repeated for the 935 strains selected above to select the top 231 strains among the mutant strains having improved L-lysine production capacity by 15% or more compared to the KCCM11016P/PCR2.1-rpoD (WT) strain.

Example 4: KCCM11016P/pCR2.1-rpoD(mt) L-lysine production ability analysis

The L-lysine-producing ability of the 231 strains selected in Example 3 was cultured and analyzed in the following manner.

Each strain was inoculated into a 250 ml corner-baffle flask containing 25 ml of the seed medium containing the following components, and cultured with shaking at 30° C. for 20 hours and 200 rpm. Thereafter, 1 ml of the seed culture solution was inoculated into a 250 ml corner-baffle flask containing 24 ml of the production medium containing the following components, followed by shaking culture at 30° C. for 72 hours and 200 rpm. The concentration of L-lysine was analyzed using HPLC (high performance liquid chromatography).

<Seed medium (pH 7.0)>

Glucose 20 g, peptone 10 g, yeast extract 5 g, urea 1.5 g, KH2PO4 4 g, K2HPO4 8 g, MgSO4 7H2O 0.5 g, biotin 100 μg, thiamine HCl 1000 μg, calcium-pantothenic acid 2000 μg, nicotinamide 2000 μg ( 1 liter of distilled water)

<Production medium (pH 7.0)>

Glucose _{100 g, (NH 4) 2} SO 4 40 g, soy protein 2.5 g, corn steep solids (Corn Steep Solids) 5 g, urea _{3 g, KH 2 PO 4 1} g, MgSO 4 · 7H 2 O 0.5 g, Biotin 100 μg, thiamine hydrochloride 1000 μg, calcium-pantothenic acid 2000 μg, nicotinamide 3000 μg, CaCO ₃ 30 g (based on 1 liter of distilled water).

Among the 231 mutant strains selected above, 17 strains in which the concentration of L-lysine was reproducibly increased compared to the control were selected, and the culture and analysis were repeated, and the analyzed concentration of L-lysine is shown in Table 2 below.

Strain L-lysine (g/) Batch 1 Batch 2 Batch 3 Average Control KCCM11016P/pCR2.1-rpoD(WT) 41.5 42.1 41.8 41.8 One KCCM11016P/pCR2.1-rpoD(mt)-158 45.7 45.2 48.1 46.3 2 KCCM11016P/pCR2.1-rpoD(mt)-1494 44.8 46.2 45.7 45.6 3 KCCM11016P/pCR2.1-rpoD(mt)-1846 46.8 45.9 47.1 46.6 4 KCCM11016P/pCR2.1-rpoD(mt)-2198 49.8 47.8 47.9 48.5 5 KCCM11016P/pCR2.1-rpoD(mt)-2513 45.2 47.3 45.6 46.0 6 KCCM11016P/pCR2.1-rpoD(mt)-3777 45.8 47.6 45.9 46.4 7 KCCM11016P/pCR2.1-rpoD(mt)-4065 50.7 49.8 49.5 50.0 8 KCCM11016P/pCR2.1-rpoD(mt)-5329 44.5 42.5 42.8 43.3 9 KCCM11016P/pCR2.1-rpoD(mt)-6589 41.8 42.3 41.8 42.0 10 KCCM11016P/pCR2.1-rpoD(mt)-9823 47.3 46.8 47.0 47.0 11 KCCM11016P/pCR2.1-rpoD(mt)-11267 45.5 45.3 45.1 45.3 12 KCCM11016P/pCR2.1-rpoD(mt)-13306 48.5 46.5 46.6 47.2 13 KCCM11016P/pCR2.1-rpoD(mt)-14535 48.2 49.3 47.5 48.3 14 KCCM11016P/pCR2.1-rpoD(mt)-16323 44.2 44.6 45.8 44.9 15 KCCM11016P/pCR2.1-rpoD(mt)-17935 46.5 47.2 44.5 46.1 16 KCCM11016P/pCR2.1-rpoD(mt)-18904 42.3 41.5 42.6 42.1 17 KCCM11016P/pCR2.1-rpoD(mt)-19803 47.2 45.3 46.3 46.3

As a result of analyzing the L-lysine concentration of the selected 17 strains, two of the 17 strains (KCCM11016P/pCR2.1-rpoD(mt)-6589, KCCM11016P/pCR2.1-rpoD(mt)-18904) were It was confirmed that the L-lysine production capacity of the 15 strains except for the control strain increased by up to 20% compared to the control strain KCCM11016P/pCR2.1-rpoD (WT).

Example 5: SigA artificial mutant library selection attention rpoD Genetic Variation Identification

Compared to the control of the 17 kinds selected from the above Example 4 to determine the mutagenic SigA of the 15 strains with increased capability producing L- lysine, rpoD The base sequence of the variant was analyzed. PCR was performed using primer 1 (SEQ ID NO: 3) and primer 3 (SEQ ID NO: 5) to determine the nucleotide sequence.

Primer number Base sequence Sequence number One GTGGAGAGCAGCATGGTAG 3 3 AACAGCTATGACCATG 5

Through the nucleotide sequence analysis of the mutant rpoD gene fragments of each of the 15 strains obtained, the nucleotide sequence of the mutant rpoD gene was confirmed based on the National Institutes of Health Gene Bank (NIH GenBank), and the amino acid sequence of the mutant SigA was confirmed. . The results of analyzing the variant SigA amino acid sequence of the selected 15 strains are shown in Table 4 below.

Strain SigA amino acid mutation KCCM11016P/pCR2.1-rpoD(mt)-158 D136G, T281S KCCM11016P/pCR2.1-rpoD(mt)-1494 L381R KCCM11016P/pCR2.1-rpoD(mt)-1846 M230T KCCM11016P/pCR2.1-rpoD(mt)-2198 M455V KCCM11016P/pCR2.1-rpoD(mt)-2513 S488T KCCM11016P/pCR2.1-rpoD(mt)-3777 R279L KCCM11016P/pCR2.1-rpoD(mt)-4065 L447H KCCM11016P/pCR2.1-rpoD(mt)-5329 A268S KCCM11016P/pCR2.1-rpoD(mt)-9823 L451I, Q491R KCCM11016P/pCR2.1-rpoD(mt)-11267 Q429R KCCM11016P/pCR2.1-rpoD(mt)-13306 K90E, K105Y, D250G, I254L KCCM11016P/pCR2.1-rpoD(mt)-14535 I254N KCCM11016P/pCR2.1-rpoD(mt)-16323 K483R KCCM11016P/pCR2.1-rpoD(mt)-17935 K479R KCCM11016P/pCR2.1-rpoD(mt)-19803 D238V, N263S, E358D

As a result, it was confirmed that as few as 1 amino acid and as many as 4 amino acids were substituted. In the notation of Table 4, the number refers to the amino acid number of SigA, the alphabet before the number refers to the amino acid before substitution, and the alphabet after the number refers to the substituted amino acid.

Example 6: high concentration L- Lysine Producer for rpoD Vector production for introducing mutant chromosomes

In order to confirm the effect of applying the SigA mutation identified in Example 4, a vector capable of introducing it onto the chromosome was constructed.

Based on the reported nucleotide sequence, primer 4 (SEQ ID NO: 6) with an EcoRI restriction enzyme site inserted at the 5'end and Primer 5 (SEQ ID NO: 7) with a SalI restriction enzyme site inserted at the 3'end were synthesized. Using this primer pair, PCR was performed on each of the selected 15 chromosomes as a template to amplify 15 mutant rpoD(mt) gene fragments. PCR conditions were denatured at 94° C. for 5 minutes, then denatured at 94° C. for 30 seconds, annealing at 56° C. for 30 seconds, and polymerization at 72° C. for 2 minutes were repeated 30 times, followed by polymerization at 72° C. for 7 minutes.

Primer number Base sequence Sequence number 4 AAGAATTCGTGGAGAGCAGCATGGTAG 6 5 AAGTCGACCGCAGAGGAAAACAGTGGC 7

15 kinds of gene fragments amplified by PCR were treated with restriction enzymes EcoRI and SalI to obtain respective DNA fragments, and then the pDZ vector for chromosome introduction having restriction enzymes EcoRI and SalI ends (Korea Patent Registration No. 10-0924065 ), and then transformed into E. coli DH5α and plated on LB solid medium containing kanamycin (25mg/ℓ). After selecting a colony transformed with a vector into which the target gene was inserted through PCR, a plasmid was obtained using a commonly known plasmid extraction method, and pDZ-SigA (D136G, T281S) respectively according to the mutations inserted into the SigA of this plasmid. , pDZ-SigA(L381R), pDZ-SigA(M230T), pDZ-SigA(M455V), pDZ-SigA(S488T), pDZ-SigA(R279L), pDZ-SigA(I254N), pDZ-SigA(A268S), pDZ-SigA(L451I, Q491R), pDZ-SigA(Q429R), pDZ-SigA(K90E, K105Y, D250G, I254L), pDZ-SigA(L447H), pDZ-SigA(K483R), pDZ-SigA(K479R)) It was named pDZ-SigA (D238V, N263S, E358D). In addition, as another control for the mutants, primer 6 for constructing a vector for inserting the SigA mutant A414V onto the chromosome, previously reported to be effective in increasing L-lysine productivity (International Patent Publication No. WO2003-054179). To 9 (SEQ ID NOs: 8 to 11) were prepared. Using Corynebacterium glutamicum ATCC13032 genomic DNA as a template, PCR was performed with primers 6 and 9 pairs, and primers 7 and 8 pairs, respectively. PCR conditions were denatured at 94° C. for 5 minutes, then denatured at 94° C. for 30 seconds, annealing at 56° C. for 30 seconds, and polymerization at 72° C. for 1 minute were repeated 30 times, followed by polymerization at 72° C. for 7 minutes.

Primer number Base sequence Sequence number 6 GCAGGTCGACTCTAGACTCACCCCAGCCGTCAAGCGT 8 7 CCGGGGATCCTCTAGATCAAGGCGATGTCGGAAAATG 9 8 AAGACTCCGAAGTCGTCGTCGCAGT 10 9 ACTGCGACGACGACTTCGGAGTCTT 11

As a result, two approximately 500bp gene fragments were obtained, and the amplified product was conjugated to a pDZ vector using an Infusion cloning kit (Invitrogen), and the prepared vector was named pDZ-SigA (A414V).

Example 7: high concentration L- Lysine Producer for SigA Into which the variant polypeptide has been introduced KCCM11016P Strain production and L- Lysine Productivity compare

The 15 new mutant introduction vectors and 1 type of the previously reported mutant introduction vector prepared in Example 6 were transformed into the L-lysine producing strain, Corynebacterium glutamicum KCCM11016P, by a two-step homologous chromosome recombination. Then, the strain into which the SigA mutation was introduced on the chromosome was selected by sequencing analysis, and the strain into which the SigA mutation was introduced was KCCM11016P::SigA(D136G, T281S), KCCM11016P::SigA(L381R), KCCM11016P::SigA( M230T), KCCM11016P::SigA(M455V), KCCM11016P::SigA(S488T), KCCM11016P::SigA(R279L), KCCM11016P::SigA(I254N), KCCM11016P::SigA(AL110268S), KCCM11016P::SigA(AL11016P::SigA(AL11016P), KCCM11016P: Q491R), KCCM11016P::SigA(Q429R), KCCM11016P::SigA(K90E, K105Y, D250G, I254L), KCCM11016P::SigA(L447H), KCCM11016P::SigA(K483R), KCCM11016P::SigA(K483R), KCCM11016P:: Named as ::SigA(D238V, N263S, E358D), KCCM11016P::SigA(A414V).

Cultured in the same manner as in Example 4, the concentration of L-lysine was analyzed therefrom, and the results are shown in Table 7 below.

Strain L-lysine (g/) Batch 1 Batch 2 Batch 3 Average Control KCCM11016P 42.8 41.6 43.1 42.5 One KCCM11016P::SigA(D136G, T281S) 46.2 45.8 45.2 45.7 2 KCCM11016P::SigA(L381R) 45.2 45.8 46.7 45.9 3 KCCM11016P::SigA(M230T) 41.8 42.1 41.9 41.9 4 KCCM11016P::SigA(M455V) 50.1 48.1 49.2 49.1 5 KCCM11016P::SigA(S488T), 45.1 44.9 45.8 45.3 6 KCCM11016P::SigA(R279L) 42.5 43.2 40.9 42.2 7 KCCM11016P::SigA(L447H) 51.2 49.9 50.8 50.6 8 KCCM11016P::SigA(A268S) 43.2 44.1 45.5 44.3 9 KCCM11016P::SigA(L451I, Q491R) 47.5 47.1 49.8 48.1 10 KCCM11016P::SigA(Q429R) 44.9 45.2 45.1 45.1 11 KCCM11016P::SigA(K90E, K105Y, D250G, I254L) 31.5 28.6 40.5 33.5 12 KCCM11016P::SigA (I254N) 49.1 48.5 47.8 48.5 13 KCCM11016P::SigA(K483R) 45.1 44.1 45.6 44.9 14 KCCM11016P::SigA(K479R) 44.7 45.6 45.8 45.4 15 KCCM11016P::SigA(D238V,N263S,E358D) 21.5 22.9 19.2 21.2 Control KCCM11016P::SigA(A414V) 43.2 44 43.5 43.6

As a result, two new mutant strains (KCCM11016P::SigA(M230T), KCCM11016P::SigA(R279L)) showed equivalent L-lysine production ability compared to the parent strain, and the other two new mutant strains ( KCCM11016P::SigA (K90E, K105Y, D250G, I254L), KCCM11016P::SigA (D238V, N263S, E358D)) significantly slowed the growth rate and significantly reduced the L-lysine production. However, the remaining 11 new mutant strains showed a maximum 19% increase in L-lysine production capacity compared to the parent strain, and the L-lysine production capacity increased 16% compared to the previously reported variant (SigA(A414V)) KCCM11016P::SigA(A414V). Confirmed. Accordingly, the present inventors named the strain KCCM11016P::SigA(L447H), the strain with improved L-lysine production ability, as Corynebacterium glutamicum "CA01-2277", and as of November 22, 2013, an international deposit under the Budapest Treaty. It was deposited with the Korean Microorganism Conservation Center (KCCM), an institution, and was given the accession number KCCM11479P.

These results suggest that 11 novel SigA variant polypeptides have excellent L-lysine production ability.

Example 8: high concentration L- Lysine Producer for SigA Into which the variant polypeptide has been introduced KFCC10750 Strain production and L- Lysine Productivity compare

In order to confirm the effect of introducing 11 strains of SigA selected in Example 7 in other strains belonging to Corynebacterium glutamicum, Corynebacterium, a strain producing L-lysine, was carried out in the same manner as in Example 7 above. Glutamicum KFCC10750 (KCCM11347P. Republic of Korea Patent No. 10-0073610) 11 strains of SigA mutations were respectively introduced, and KFCC10750::SigA(D136G, T281S), KFCC10750::SigA(L381R), KFCC10750:: SigA(M455V), KFCC10750::SigA(S488T), KFCC10750::SigA(I254N), KFCC10750::SigA(A268S), KFCC10750::SigA(L451I, Q491R), KFCC10750::SigA(Q429R), KFCC10750::SigA(Q429R), KFCC10750:: It was named SigA(L447H), KFCC10750::SigA(K483R), KFCC10750::SigA(K479R). In addition, a strain into which the previously reported mutant SigA (A414V) was introduced was also produced, and it was named as KFCC10750::SigA (A414V).

Cultured in the same manner as in Example 4, the concentration of L-lysine was analyzed therefrom, and the results are shown in Table 8 below.

Strain L-lysine (g/) Batch 1 Batch 2 Batch 3 Average Control KFCC10750 38.8 38.1 37.9 38.3 One KFCC10750::SigA(D136G, T281S) 41.1 41.2 40.9 41.1 2 KFCC10750::SigA(L381R) 42.1 41.8 41.1 41.7 3 KFCC10750::SigA(M455V) 43.2 43.8 44.2 43.7 4 KFCC10750::SigA(S488T) 42.1 40.8 41.9 41.6 5 KFCC10750::SigA (L447H) 44.5 45.1 44.9 44.8 6 KFCC10750::SigA(A268S) 39.9 41.1 39.7 40.2 7 KFCC10750::SigA(L451I, Q491R) 42.9 44.1 43.8 43.6 8 KFCC10750::SigA(Q429R) 40.2 41.2 42.1 41.2 9 KFCC10750::SigA(I254N) 44.9 44.5 43.8 44.4 10 KFCC10750::SigA(K483R) 40.5 41 40.9 40.8 11 KFCC10750::SigA(K479R) 39.9 41.5 41.1 40.8 Control KFCC10750::SigA(A414V) 39.6 39.1 39.5 39.4

As a result, 11 new mutant introduced strains increased L-lysine production capacity by up to 17% compared to the parent strain, and L-lysine production capacity increased about 14% compared to the previously reported mutant (SigAA414V) KFCC10750::SigA(A414V). It was confirmed.

Example 9: high concentration L- Lysine Producer for SigA Into which the variant polypeptide has been introduced KCCM10770P Strain production and L- Lysine Productivity compare

In order to confirm the effect of the 11 SigA mutations selected in Example 7 in other strains belonging to Corynebacterium glutamicum, the L-lysine producing strain, Corynebacterium glutami, was carried out in the same manner as in Example 7 above. KCCM10770P (Korean Registered Patent No. 10-0924065) to prepare a strain in which the SigA mutation was introduced, and KCCM10770P::SigA(D136G, T281S), KCCM10770P::SigA(L381R), KCCM10770P::SigA(M455V), KCCM10770P: :SigA(S488T), KCCM10770P::SigA(I254N), KCCM10770P::SigA(A268S), KCCM10770P::SigA(L451I, Q491R), KCCM10770P::SigA(Q429R), KCCM1047770P::SigA(L47770P::SigA(L451I)) It was named :SigA(K483R), KCCM10770P::SigA(K479R). In addition, a strain into which the previously reported mutant SigA (A414V) was introduced was also produced, and was named as KCCM10770P::SigA (A414V).

Cultured in the same manner as in Example 4, the concentration of L-lysine was analyzed therefrom, and the results are shown in Table 9 below.

Strain L-lysine (g/) Batch 1 Batch 2 Batch 3 Average Control KCCM10770P 47.5 48.1 47.9 47.8 One KCCM10770P::SigA(D136G, T281S) 51.1 51.6 52.1 51.6 2 KCCM10770P::SigA(L381R) 52.6 50.9 52.1 51.9 3 KCCM10770P::SigA(M455V) 55.1 54.3 54.8 54.7 4 KCCM10770P::SigA(S488T) 52.1 52.4 51.9 52.1 5 KCCM10770P::SigA(L447H) 56.9 57.6 57.1 57.2 6 KCCM10770P::SigA(A268S) 50.5 50.1 49.9 50.2 7 KCCM10770P::SigA(L451I, Q491R) 55.3 54.9 54.1 54.8 8 KCCM10770P::SigA(Q429R) 52.4 52.3 50.9 51.9 9 KCCM10770P::SigA (I254N) 55.9 55.4 54.1 55.1 10 KCCM10770P::SigA(K483R) 51.9 51.3 51.5 51.6 11 KCCM10770P::SigA(K479R) 51 51.7 52.1 51.6 Control KCCM10770P::SigA(A414V) 48.9 49.5 50.1 49.5

As a result, 11 new mutant introduced strains showed a maximum 20% increase in L-lysine production capacity compared to the parent strain, and about 16% increased L-lysine production capacity compared to the previously reported mutant (SigAA414V) KCCM10770P::SigA(A414V) It was confirmed.

Example 10: high concentration L- Lysine Producer for SigA Production of CJ3P strains with variant polypeptides and comparison of L-lysine production capacity

Corynebacterium glutamicum CJ3P (Binder et al. Genome Biology 2012; 13:R40) was prepared and a strain in which the SigA mutation was introduced was prepared and CJ3P::SigA(D136G, T281S), CJ3P::SigA(L381R), CJ3P::SigA(M455V), CJ3P::SigA(S488T), CJ3P: :SigA(I254N), CJ3P::SigA(A268S), CJ3P::SigA(L451I, Q491R), CJ3P::SigA(Q429R), CJ3P::SigA(L447H), CJ3P::SigA(K483R), CJ3P: : Named as SigA (K479R). In addition, a strain into which the previously reported mutant SigA (A414V) was introduced was also produced, and was named CJ3P::SigA (A414V). CJ3P strain is a Corynebacterium glutamicum strain that has the ability to produce L-lysine by introducing three kinds of mutations into wild strains based on known techniques.

Cultured in the same manner as in Example 4, the concentration of L-lysine was analyzed therefrom, and the results are shown in Table 10 below.

Strain L-lysine (g/) Batch 1 Batch 2 Batch 3 Average Control CJ3P 8.2 8.3 8.0 8.2 One CJ3P::SigA(D136G, T281S) 9.0 8.8 8.9 8.9 2 CJ3P::SigA(L381R) 8.7 8.9 8.5 8.7 3 CJ3P::SigA(M455V) 9.3 9.5 9.1 9.3 4 CJ3P::SigA(S488T) 9.0 9.1 8.8 9.0 5 CJ3P::SigA(L447H) 9.8 10.1 9.5 9.8 6 CJ3P::SigA(A268S) 8.5 8.7 8.9 8.7 7 CJ3P::SigA(L451I, Q491R) 9.1 9.0 8.8 9.0 8 CJ3P::SigA(Q429R) 8.9 8.8 9.0 8.9 9 CJ3P::SigA (I254N) 9.1 9.7 9.5 9.4 10 CJ3P::SigA(K483R) 8.8 9.1 8.5 8.8 11 CJ3P::SigA(K479R) 8.6 8.9 8.8 8.8 Control CJ3P::SigA(A414V) 8.5 8.4 8.6 8.5

As a result, 11 new mutant introduced strains increased L-lysine production capacity by up to 20% compared to the parent strain, and L-lysine production capacity increased about 15% compared to CJ3P::SigA(A414V), the previously reported mutant (SigAA414V). Confirmed.

According to the above results, 11 kinds of variant polypeptides having SigA activity newly secured in the present invention (SigA(D136G, T281S), SigA(L381R), SigA(M455V), SigA(S488T), SigA(I254N) , SigA(A268S), SigA(L451I, Q491R), SigA(Q429R), SigA(L447H), SigA(K483R), SigA(K479R)) in various Corynebacterium microorganisms, respectively, to increase L-lysine production capacity. There is an excellent effect, which suggests that the L-lysine production capacity enhancement effect is superior to the previously reported mutant SigA (A414V).

From the above description, those skilled in the art to which the present invention pertains will understand that the present invention can be implemented in other specific forms without changing the technical spirit or essential features thereof. In this regard, the examples described above are illustrative in all respects, and should be understood as non-limiting. The scope of the present invention should be construed as including the meaning and scope of the claims to be described later rather than the detailed description, and all changes or modified forms derived from the equivalent concept within the scope of the present invention.

Korea Microorganism Conservation Center (overseas) KCCM11479P 20131122

<110> CJ CheilJedang Corporation <120> A microorganism having enhanced L-lysine productivity and a method of producing L-lysine using the same <130> PA131284-KR-D3 <160> 22 <170> KopatentIn 2.0 <210> 1 <211> 1497 <212> DNA <213> Corynebacterium glutamicum <400> 1 gtggagagca gcatggtaga aaacaacgta gcaaaaaaga cggtcgctaa aaagaccgca 60 cgcaagaccg cacgcaaagc agccccgcgc gtggcaaccc cattgggagt cgcatctgag 120 tctcccattt cggccacccc tgcgcgcagc atcgatggaa cctcaacccc tgttgaagct 180 gctgacacca tagagaccac cgcccctgca gcgaaggctc ctgcggccaa ggctcccgct 240 aaaaaggttg ccaagaagac agctcgcaag gcacctgcga aaaagactgt cgccaagaaa 300 gccacaaccg ccaaggctgc acctgcaact gccaaggacg aaaacgcacc tgttgatgac 360 gacgaggaga acctcgctca ggatgaacag gacttcgacg gcgatgactt cgtagacggc 420 atcgaagacg aagaagatga agacggcgtc gaagccctcg gtgaagaaag cgaagacgac 480 gaagaggacg gctcatccgt ttgggatgaa gacgaatccg caaccctgcg tcaggcacgt 540 aaagatgccg agctcaccgc ttccgccgac tctgttcgcg cttacctgaa gcaaatcggt 600 aaagttgccc tgctgaacgc tgaacaggaa gtctccctgg caaagcgcat cgaagcaggc 660 ctttacgcca cccaccgcat ggaggaaatg gaagaagctt tcgcagccgg tgacaaggac 720 gcgaaactca ccccagccgt caagcgtgac ctccgcgcca tcgctcgtga cggccgcaag 780 gcgaaaaacc acctcctgga agccaacctt cgtctggttg tctccctggc aaagcgctac 840 accggccgtg gcatggcatt cctggacctc atccaggaag gcaacctcgg tctgattcgt 900 gccgtagaga agttcgacta ctccaagggc tacaagttct ccacctacgc aacctggtgg 960 atccgtcagg caatcacccg cgccatggcc gaccaagcac gaaccatccg tatcccagtc 1020 cacatggttg aagtgatcaa caaacttggt cgcatccaac gtgaactcct tcaggaactc 1080 ggccgcgaac caaccccaca ggaactgtcc aaagaaatgg acatctccga ggaaaaggta 1140 ctggaaatcc agcagtacgc ccgcgaacca atctccctgg accaaaccat cggcgacgaa 1200 ggcgacagcc agctcggcga cttcatcgaa gactccgaag ccgtcgtcgc agtcgacgcc 1260 gtctcattca ccctgctgca agaccagcta caggacgtcc tagagaccct ctccgaacgt 1320 gaagccggcg tggttaaact ccgcttcgga ctcaccgacg gaatgccacg cactttagac 1380 gaaatcggcc aagtttacgg tgtcacccgt gagcgcatcc gccagattga gtccaagacc 1440 atgtctaagc tgcgccaccc atcacgctcc caggtccttc gcgactacct ggactaa 1497 <210> 2 <211> 498 <212> PRT <213> Corynebacterium glutamicum <400> 2 Met Glu Ser Ser Met Val Glu Asn Asn Val Ala Lys Lys Thr Val Ala 1 5 10 15 Lys Lys Thr Ala Arg Lys Thr Ala Arg Lys Ala Ala Pro Arg Val Ala 20 25 30 Thr Pro Leu Gly Val Ala Ser Glu Ser Pro Ile Ser Ala Thr Pro Ala 35 40 45 Arg Ser Ile Asp Gly Thr Ser Thr Pro Val Glu Ala Ala Asp Thr Ile 50 55 60 Glu Thr Thr Ala Pro Ala Ala Lys Ala Pro Ala Ala Lys Ala Pro Ala 65 70 75 80 Lys Lys Val Ala Lys Lys Thr Ala Arg Lys Ala Pro Ala Lys Lys Thr 85 90 95 Val Ala Lys Lys Ala Thr Thr Ala Lys Ala Ala Pro Ala Thr Ala Lys 100 105 110 Asp Glu Asn Ala Pro Val Asp Asp Asp Glu Glu Asn Leu Ala Gln Asp 115 120 125 Glu Gln Asp Phe Asp Gly Asp Asp Phe Val Asp Gly Ile Glu Asp Glu 130 135 140 Glu Asp Glu Asp Gly Val Glu Ala Leu Gly Glu Glu Ser Glu Asp Asp 145 150 155 160 Glu Glu Asp Gly Ser Ser Val Trp Asp Glu Asp Glu Ser Ala Thr Leu 165 170 175 Arg Gln Ala Arg Lys Asp Ala Glu Leu Thr Ala Ser Ala Asp Ser Val 180 185 190 Arg Ala Tyr Leu Lys Gln Ile Gly Lys Val Ala Leu Leu Asn Ala Glu 195 200 205 Gln Glu Val Ser Leu Ala Lys Arg Ile Glu Ala Gly Leu Tyr Ala Thr 210 215 220 His Arg Met Glu Glu Met Glu Glu Ala Phe Ala Ala Gly Asp Lys Asp 225 230 235 240 Ala Lys Leu Thr Pro Ala Val Lys Arg Asp Leu Arg Ala Ile Ala Arg 245 250 255 Asp Gly Arg Lys Ala Lys Asn His Leu Leu Glu Ala Asn Leu Arg Leu 260 265 270 Val Val Ser Leu Ala Lys Arg Tyr Thr Gly Arg Gly Met Ala Phe Leu 275 280 285 Asp Leu Ile Gln Glu Gly Asn Leu Gly Leu Ile Arg Ala Val Glu Lys 290 295 300 Phe Asp Tyr Ser Lys Gly Tyr Lys Phe Ser Thr Tyr Ala Thr Trp Trp 305 310 315 320 Ile Arg Gln Ala Ile Thr Arg Ala Met Ala Asp Gln Ala Arg Thr Ile 325 330 335 Arg Ile Pro Val His Met Val Glu Val Ile Asn Lys Leu Gly Arg Ile 340 345 350 Gln Arg Glu Leu Leu Gln Glu Leu Gly Arg Glu Pro Thr Pro Gln Glu 355 360 365 Leu Ser Lys Glu Met Asp Ile Ser Glu Glu Lys Val Leu Glu Ile Gln 370 375 380 Gln Tyr Ala Arg Glu Pro Ile Ser Leu Asp Gln Thr Ile Gly Asp Glu 385 390 395 400 Gly Asp Ser Gln Leu Gly Asp Phe Ile Glu Asp Ser Glu Ala Val Val 405 410 415 Ala Val Asp Ala Val Ser Phe Thr Leu Leu Gln Asp Gln Leu Gln Asp 420 425 430 Val Leu Glu Thr Leu Ser Glu Arg Glu Ala Gly Val Val Lys Leu Arg 435 440 445 Phe Gly Leu Thr Asp Gly Met Pro Arg Thr Leu Asp Glu Ile Gly Gln 450 455 460 Val Tyr Gly Val Thr Arg Glu Arg Ile Arg Gln Ile Glu Ser Lys Thr 465 470 475 480 Met Ser Lys Leu Arg His Pro Ser Arg Ser Gln Val Leu Arg Asp Tyr 485 490 495 Leu Asp <210> 3 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Primer 1 <400> 3 gtggagagca gcatggtag 19 <210> 4 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Primer 2 <400> 4 cgcagaggaa aacagtggc 19 <210> 5 <211> 16 <212> DNA <213> Artificial Sequence <220> <223> Primer 3 <400> 5 aacagctatg accatg 16 <210> 6 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> Primer 4 <400> 6 aagaattcgt ggagagcagc atggtag 27 <210> 7 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> Primer 5 <400> 7 aagtcgaccg cagaggaaaa cagtggc 27 <210> 8 <211> 37 <212> DNA <213> Artificial Sequence <220> <223> Primer 6 <400> 8 gcaggtcgac tctagactca ccccagccgt caagcgt 37 <210> 9 <211> 37 <212> DNA <213> Artificial Sequence <220> <223> Primer 7 <400> 9 ccggggatcc tctagatcaa ggcgatgtcg gaaaatg 37 <210> 10 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> Primer 8 <400> 10 aagactccga agtcgtcgtc gcagt 25 <210> 11 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> Primer 9 <400> 11 actgcgacga cgacttcgga gtctt 25 <210> 12 <211> 498 <212> PRT <213> Artificial Sequence <220> <223> SigA variant <400> 12 Met Glu Ser Ser Met Val Glu Asn Asn Val Ala Lys Lys Thr Val Ala 1 5 10 15 Lys Lys Thr Ala Arg Lys Thr Ala Arg Lys Ala Ala Pro Arg Val Ala 20 25 30 Thr Pro Leu Gly Val Ala Ser Glu Ser Pro Ile Ser Ala Thr Pro Ala 35 40 45 Arg Ser Ile Asp Gly Thr Ser Thr Pro Val Glu Ala Ala Asp Thr Ile 50 55 60 Glu Thr Thr Ala Pro Ala Ala Lys Ala Pro Ala Ala Lys Ala Pro Ala 65 70 75 80 Lys Lys Val Ala Lys Lys Thr Ala Arg Lys Ala Pro Ala Lys Lys Thr 85 90 95 Val Ala Lys Lys Ala Thr Thr Ala Lys Ala Ala Pro Ala Thr Ala Lys 100 105 110 Asp Glu Asn Ala Pro Val Asp Asp Asp Glu Glu Asn Leu Ala Gln Asp 115 120 125 Glu Gln Asp Phe Asp Gly Asp Gly Phe Val Asp Gly Ile Glu Asp Glu 130 135 140 Glu Asp Glu Asp Gly Val Glu Ala Leu Gly Glu Glu Ser Glu Asp Asp 145 150 155 160 Glu Glu Asp Gly Ser Ser Val Trp Asp Glu Asp Glu Ser Ala Thr Leu 165 170 175 Arg Gln Ala Arg Lys Asp Ala Glu Leu Thr Ala Ser Ala Asp Ser Val 180 185 190 Arg Ala Tyr Leu Lys Gln Ile Gly Lys Val Ala Leu Leu Asn Ala Glu 195 200 205 Gln Glu Val Ser Leu Ala Lys Arg Ile Glu Ala Gly Leu Tyr Ala Thr 210 215 220 His Arg Met Glu Glu Met Glu Glu Ala Phe Ala Ala Gly Asp Lys Asp 225 230 235 240 Ala Lys Leu Thr Pro Ala Val Lys Arg Asp Leu Arg Ala Ile Ala Arg 245 250 255 Asp Gly Arg Lys Ala Lys Asn His Leu Leu Glu Ala Asn Leu Arg Leu 260 265 270 Val Val Ser Leu Ala Lys Arg Tyr Ser Gly Arg Gly Met Ala Phe Leu 275 280 285 Asp Leu Ile Gln Glu Gly Asn Leu Gly Leu Ile Arg Ala Val Glu Lys 290 295 300 Phe Asp Tyr Ser Lys Gly Tyr Lys Phe Ser Thr Tyr Ala Thr Trp Trp 305 310 315 320 Ile Arg Gln Ala Ile Thr Arg Ala Met Ala Asp Gln Ala Arg Thr Ile 325 330 335 Arg Ile Pro Val His Met Val Glu Val Ile Asn Lys Leu Gly Arg Ile 340 345 350 Gln Arg Glu Leu Leu Gln Glu Leu Gly Arg Glu Pro Thr Pro Gln Glu 355 360 365 Leu Ser Lys Glu Met Asp Ile Ser Glu Glu Lys Val Leu Glu Ile Gln 370 375 380 Gln Tyr Ala Arg Glu Pro Ile Ser Leu Asp Gln Thr Ile Gly Asp Glu 385 390 395 400 Gly Asp Ser Gln Leu Gly Asp Phe Ile Glu Asp Ser Glu Ala Val Val 405 410 415 Ala Val Asp Ala Val Ser Phe Thr Leu Leu Gln Asp Gln Leu Gln Asp 420 425 430 Val Leu Glu Thr Leu Ser Glu Arg Glu Ala Gly Val Val Lys Leu Arg 435 440 445 Phe Gly Leu Thr Asp Gly Met Pro Arg Thr Leu Asp Glu Ile Gly Gln 450 455 460 Val Tyr Gly Val Thr Arg Glu Arg Ile Arg Gln Ile Glu Ser Lys Thr 465 470 475 480 Met Ser Lys Leu Arg His Pro Ser Arg Ser Gln Val Leu Arg Asp Tyr 485 490 495 Leu Asp <210> 13 <211> 498 <212> PRT <213> Artificial Sequence <220> <223> SigA variant <400> 13 Met Glu Ser Ser Met Val Glu Asn Asn Val Ala Lys Lys Thr Val Ala 1 5 10 15 Lys Lys Thr Ala Arg Lys Thr Ala Arg Lys Ala Ala Pro Arg Val Ala 20 25 30 Thr Pro Leu Gly Val Ala Ser Glu Ser Pro Ile Ser Ala Thr Pro Ala 35 40 45 Arg Ser Ile Asp Gly Thr Ser Thr Pro Val Glu Ala Ala Asp Thr Ile 50 55 60 Glu Thr Thr Ala Pro Ala Ala Lys Ala Pro Ala Ala Lys Ala Pro Ala 65 70 75 80 Lys Lys Val Ala Lys Lys Thr Ala Arg Lys Ala Pro Ala Lys Lys Thr 85 90 95 Val Ala Lys Lys Ala Thr Thr Ala Lys Ala Ala Pro Ala Thr Ala Lys 100 105 110 Asp Glu Asn Ala Pro Val Asp Asp Asp Glu Glu Asn Leu Ala Gln Asp 115 120 125 Glu Gln Asp Phe Asp Gly Asp Asp Phe Val Asp Gly Ile Glu Asp Glu 130 135 140 Glu Asp Glu Asp Gly Val Glu Ala Leu Gly Glu Glu Ser Glu Asp Asp 145 150 155 160 Glu Glu Asp Gly Ser Ser Val Trp Asp Glu Asp Glu Ser Ala Thr Leu 165 170 175 Arg Gln Ala Arg Lys Asp Ala Glu Leu Thr Ala Ser Ala Asp Ser Val 180 185 190 Arg Ala Tyr Leu Lys Gln Ile Gly Lys Val Ala Leu Leu Asn Ala Glu 195 200 205 Gln Glu Val Ser Leu Ala Lys Arg Ile Glu Ala Gly Leu Tyr Ala Thr 210 215 220 His Arg Met Glu Glu Met Glu Glu Ala Phe Ala Ala Gly Asp Lys Asp 225 230 235 240 Ala Lys Leu Thr Pro Ala Val Lys Arg Asp Leu Arg Ala Ile Ala Arg 245 250 255 Asp Gly Arg Lys Ala Lys Asn His Leu Leu Glu Ala Asn Leu Arg Leu 260 265 270 Val Val Ser Leu Ala Lys Arg Tyr Thr Gly Arg Gly Met Ala Phe Leu 275 280 285 Asp Leu Ile Gln Glu Gly Asn Leu Gly Leu Ile Arg Ala Val Glu Lys 290 295 300 Phe Asp Tyr Ser Lys Gly Tyr Lys Phe Ser Thr Tyr Ala Thr Trp Trp 305 310 315 320 Ile Arg Gln Ala Ile Thr Arg Ala Met Ala Asp Gln Ala Arg Thr Ile 325 330 335 Arg Ile Pro Val His Met Val Glu Val Ile Asn Lys Leu Gly Arg Ile 340 345 350 Gln Arg Glu Leu Leu Gln Glu Leu Gly Arg Glu Pro Thr Pro Gln Glu 355 360 365 Leu Ser Lys Glu Met Asp Ile Ser Glu Glu Lys Val Arg Glu Ile Gln 370 375 380 Gln Tyr Ala Arg Glu Pro Ile Ser Leu Asp Gln Thr Ile Gly Asp Glu 385 390 395 400 Gly Asp Ser Gln Leu Gly Asp Phe Ile Glu Asp Ser Glu Ala Val Val 405 410 415 Ala Val Asp Ala Val Ser Phe Thr Leu Leu Gln Asp Gln Leu Gln Asp 420 425 430 Val Leu Glu Thr Leu Ser Glu Arg Glu Ala Gly Val Val Lys Leu Arg 435 440 445 Phe Gly Leu Thr Asp Gly Met Pro Arg Thr Leu Asp Glu Ile Gly Gln 450 455 460 Val Tyr Gly Val Thr Arg Glu Arg Ile Arg Gln Ile Glu Ser Lys Thr 465 470 475 480 Met Ser Lys Leu Arg His Pro Ser Arg Ser Gln Val Leu Arg Asp Tyr 485 490 495 Leu Asp <210> 14 <211> 498 <212> PRT <213> Artificial Sequence <220> <223> SigA variant <400> 14 Met Glu Ser Ser Met Val Glu Asn Asn Val Ala Lys Lys Thr Val Ala 1 5 10 15 Lys Lys Thr Ala Arg Lys Thr Ala Arg Lys Ala Ala Pro Arg Val Ala 20 25 30 Thr Pro Leu Gly Val Ala Ser Glu Ser Pro Ile Ser Ala Thr Pro Ala 35 40 45 Arg Ser Ile Asp Gly Thr Ser Thr Pro Val Glu Ala Ala Asp Thr Ile 50 55 60 Glu Thr Thr Ala Pro Ala Ala Lys Ala Pro Ala Ala Lys Ala Pro Ala 65 70 75 80 Lys Lys Val Ala Lys Lys Thr Ala Arg Lys Ala Pro Ala Lys Lys Thr 85 90 95 Val Ala Lys Lys Ala Thr Thr Ala Lys Ala Ala Pro Ala Thr Ala Lys 100 105 110 Asp Glu Asn Ala Pro Val Asp Asp Asp Glu Glu Asn Leu Ala Gln Asp 115 120 125 Glu Gln Asp Phe Asp Gly Asp Asp Phe Val Asp Gly Ile Glu Asp Glu 130 135 140 Glu Asp Glu Asp Gly Val Glu Ala Leu Gly Glu Glu Ser Glu Asp Asp 145 150 155 160 Glu Glu Asp Gly Ser Ser Val Trp Asp Glu Asp Glu Ser Ala Thr Leu 165 170 175 Arg Gln Ala Arg Lys Asp Ala Glu Leu Thr Ala Ser Ala Asp Ser Val 180 185 190 Arg Ala Tyr Leu Lys Gln Ile Gly Lys Val Ala Leu Leu Asn Ala Glu 195 200 205 Gln Glu Val Ser Leu Ala Lys Arg Ile Glu Ala Gly Leu Tyr Ala Thr 210 215 220 His Arg Met Glu Glu Met Glu Glu Ala Phe Ala Ala Gly Asp Lys Asp 225 230 235 240 Ala Lys Leu Thr Pro Ala Val Lys Arg Asp Leu Arg Ala Ile Ala Arg 245 250 255 Asp Gly Arg Lys Ala Lys Asn His Leu Leu Glu Ala Asn Leu Arg Leu 260 265 270 Val Val Ser Leu Ala Lys Arg Tyr Thr Gly Arg Gly Met Ala Phe Leu 275 280 285 Asp Leu Ile Gln Glu Gly Asn Leu Gly Leu Ile Arg Ala Val Glu Lys 290 295 300 Phe Asp Tyr Ser Lys Gly Tyr Lys Phe Ser Thr Tyr Ala Thr Trp Trp 305 310 315 320 Ile Arg Gln Ala Ile Thr Arg Ala Met Ala Asp Gln Ala Arg Thr Ile 325 330 335 Arg Ile Pro Val His Met Val Glu Val Ile Asn Lys Leu Gly Arg Ile 340 345 350 Gln Arg Glu Leu Leu Gln Glu Leu Gly Arg Glu Pro Thr Pro Gln Glu 355 360 365 Leu Ser Lys Glu Met Asp Ile Ser Glu Glu Lys Val Leu Glu Ile Gln 370 375 380 Gln Tyr Ala Arg Glu Pro Ile Ser Leu Asp Gln Thr Ile Gly Asp Glu 385 390 395 400 Gly Asp Ser Gln Leu Gly Asp Phe Ile Glu Asp Ser Glu Ala Val Val 405 410 415 Ala Val Asp Ala Val Ser Phe Thr Leu Leu Gln Asp Gln Leu Gln Asp 420 425 430 Val Leu Glu Thr Leu Ser Glu Arg Glu Ala Gly Val Val Lys Leu Arg 435 440 445 Phe Gly Leu Thr Asp Gly Val Pro Arg Thr Leu Asp Glu Ile Gly Gln 450 455 460 Val Tyr Gly Val Thr Arg Glu Arg Ile Arg Gln Ile Glu Ser Lys Thr 465 470 475 480 Met Ser Lys Leu Arg His Pro Ser Arg Ser Gln Val Leu Arg Asp Tyr 485 490 495 Leu Asp <210> 15 <211> 498 <212> PRT <213> Artificial Sequence <220> <223> SigA variant <400> 15 Met Glu Ser Ser Met Val Glu Asn Asn Val Ala Lys Lys Thr Val Ala 1 5 10 15 Lys Lys Thr Ala Arg Lys Thr Ala Arg Lys Ala Ala Pro Arg Val Ala 20 25 30 Thr Pro Leu Gly Val Ala Ser Glu Ser Pro Ile Ser Ala Thr Pro Ala 35 40 45 Arg Ser Ile Asp Gly Thr Ser Thr Pro Val Glu Ala Ala Asp Thr Ile 50 55 60 Glu Thr Thr Ala Pro Ala Ala Lys Ala Pro Ala Ala Lys Ala Pro Ala 65 70 75 80 Lys Lys Val Ala Lys Lys Thr Ala Arg Lys Ala Pro Ala Lys Lys Thr 85 90 95 Val Ala Lys Lys Ala Thr Thr Ala Lys Ala Ala Pro Ala Thr Ala Lys 100 105 110 Asp Glu Asn Ala Pro Val Asp Asp Asp Glu Glu Asn Leu Ala Gln Asp 115 120 125 Glu Gln Asp Phe Asp Gly Asp Asp Phe Val Asp Gly Ile Glu Asp Glu 130 135 140 Glu Asp Glu Asp Gly Val Glu Ala Leu Gly Glu Glu Ser Glu Asp Asp 145 150 155 160 Glu Glu Asp Gly Ser Ser Val Trp Asp Glu Asp Glu Ser Ala Thr Leu 165 170 175 Arg Gln Ala Arg Lys Asp Ala Glu Leu Thr Ala Ser Ala Asp Ser Val 180 185 190 Arg Ala Tyr Leu Lys Gln Ile Gly Lys Val Ala Leu Leu Asn Ala Glu 195 200 205 Gln Glu Val Ser Leu Ala Lys Arg Ile Glu Ala Gly Leu Tyr Ala Thr 210 215 220 His Arg Met Glu Glu Met Glu Glu Ala Phe Ala Ala Gly Asp Lys Asp 225 230 235 240 Ala Lys Leu Thr Pro Ala Val Lys Arg Asp Leu Arg Ala Ile Ala Arg 245 250 255 Asp Gly Arg Lys Ala Lys Asn His Leu Leu Glu Ala Asn Leu Arg Leu 260 265 270 Val Val Ser Leu Ala Lys Arg Tyr Thr Gly Arg Gly Met Ala Phe Leu 275 280 285 Asp Leu Ile Gln Glu Gly Asn Leu Gly Leu Ile Arg Ala Val Glu Lys 290 295 300 Phe Asp Tyr Ser Lys Gly Tyr Lys Phe Ser Thr Tyr Ala Thr Trp Trp 305 310 315 320 Ile Arg Gln Ala Ile Thr Arg Ala Met Ala Asp Gln Ala Arg Thr Ile 325 330 335 Arg Ile Pro Val His Met Val Glu Val Ile Asn Lys Leu Gly Arg Ile 340 345 350 Gln Arg Glu Leu Leu Gln Glu Leu Gly Arg Glu Pro Thr Pro Gln Glu 355 360 365 Leu Ser Lys Glu Met Asp Ile Ser Glu Glu Lys Val Leu Glu Ile Gln 370 375 380 Gln Tyr Ala Arg Glu Pro Ile Ser Leu Asp Gln Thr Ile Gly Asp Glu 385 390 395 400 Gly Asp Ser Gln Leu Gly Asp Phe Ile Glu Asp Ser Glu Ala Val Val 405 410 415 Ala Val Asp Ala Val Ser Phe Thr Leu Leu Gln Asp Gln Leu Gln Asp 420 425 430 Val Leu Glu Thr Leu Ser Glu Arg Glu Ala Gly Val Val Lys Leu Arg 435 440 445 Phe Gly Leu Thr Asp Gly Met Pro Arg Thr Leu Asp Glu Ile Gly Gln 450 455 460 Val Tyr Gly Val Thr Arg Glu Arg Ile Arg Gln Ile Glu Ser Lys Thr 465 470 475 480 Met Ser Lys Leu Arg His Pro Thr Arg Ser Gln Val Leu Arg Asp Tyr 485 490 495 Leu Asp <210> 16 <211> 498 <212> PRT <213> Artificial Sequence <220> <223> SigA variant <400> 16 Met Glu Ser Ser Met Val Glu Asn Asn Val Ala Lys Lys Thr Val Ala 1 5 10 15 Lys Lys Thr Ala Arg Lys Thr Ala Arg Lys Ala Ala Pro Arg Val Ala 20 25 30 Thr Pro Leu Gly Val Ala Ser Glu Ser Pro Ile Ser Ala Thr Pro Ala 35 40 45 Arg Ser Ile Asp Gly Thr Ser Thr Pro Val Glu Ala Ala Asp Thr Ile 50 55 60 Glu Thr Thr Ala Pro Ala Ala Lys Ala Pro Ala Ala Lys Ala Pro Ala 65 70 75 80 Lys Lys Val Ala Lys Lys Thr Ala Arg Lys Ala Pro Ala Lys Lys Thr 85 90 95 Val Ala Lys Lys Ala Thr Thr Ala Lys Ala Ala Pro Ala Thr Ala Lys 100 105 110 Asp Glu Asn Ala Pro Val Asp Asp Asp Glu Glu Asn Leu Ala Gln Asp 115 120 125 Glu Gln Asp Phe Asp Gly Asp Asp Phe Val Asp Gly Ile Glu Asp Glu 130 135 140 Glu Asp Glu Asp Gly Val Glu Ala Leu Gly Glu Glu Ser Glu Asp Asp 145 150 155 160 Glu Glu Asp Gly Ser Ser Val Trp Asp Glu Asp Glu Ser Ala Thr Leu 165 170 175 Arg Gln Ala Arg Lys Asp Ala Glu Leu Thr Ala Ser Ala Asp Ser Val 180 185 190 Arg Ala Tyr Leu Lys Gln Ile Gly Lys Val Ala Leu Leu Asn Ala Glu 195 200 205 Gln Glu Val Ser Leu Ala Lys Arg Ile Glu Ala Gly Leu Tyr Ala Thr 210 215 220 His Arg Met Glu Glu Met Glu Glu Ala Phe Ala Ala Gly Asp Lys Asp 225 230 235 240 Ala Lys Leu Thr Pro Ala Val Lys Arg Asp Leu Arg Ala Ile Ala Arg 245 250 255 Asp Gly Arg Lys Ala Lys Asn His Leu Leu Glu Ala Asn Leu Arg Leu 260 265 270 Val Val Ser Leu Ala Lys Arg Tyr Thr Gly Arg Gly Met Ala Phe Leu 275 280 285 Asp Leu Ile Gln Glu Gly Asn Leu Gly Leu Ile Arg Ala Val Glu Lys 290 295 300 Phe Asp Tyr Ser Lys Gly Tyr Lys Phe Ser Thr Tyr Ala Thr Trp Trp 305 310 315 320 Ile Arg Gln Ala Ile Thr Arg Ala Met Ala Asp Gln Ala Arg Thr Ile 325 330 335 Arg Ile Pro Val His Met Val Glu Val Ile Asn Lys Leu Gly Arg Ile 340 345 350 Gln Arg Glu Leu Leu Gln Glu Leu Gly Arg Glu Pro Thr Pro Gln Glu 355 360 365 Leu Ser Lys Glu Met Asp Ile Ser Glu Glu Lys Val Leu Glu Ile Gln 370 375 380 Gln Tyr Ala Arg Glu Pro Ile Ser Leu Asp Gln Thr Ile Gly Asp Glu 385 390 395 400 Gly Asp Ser Gln Leu Gly Asp Phe Ile Glu Asp Ser Glu Ala Val Val 405 410 415 Ala Val Asp Ala Val Ser Phe Thr Leu Leu Gln Asp Gln Leu Gln Asp 420 425 430 Val Leu Glu Thr Leu Ser Glu Arg Glu Ala Gly Val Val Lys His Arg 435 440 445 Phe Gly Leu Thr Asp Gly Met Pro Arg Thr Leu Asp Glu Ile Gly Gln 450 455 460 Val Tyr Gly Val Thr Arg Glu Arg Ile Arg Gln Ile Glu Ser Lys Thr 465 470 475 480 Met Ser Lys Leu Arg His Pro Ser Arg Ser Gln Val Leu Arg Asp Tyr 485 490 495 Leu Asp <210> 17 <211> 498 <212> PRT <213> Artificial Sequence <220> <223> SigA variant <400> 17 Met Glu Ser Ser Met Val Glu Asn Asn Val Ala Lys Lys Thr Val Ala 1 5 10 15 Lys Lys Thr Ala Arg Lys Thr Ala Arg Lys Ala Ala Pro Arg Val Ala 20 25 30 Thr Pro Leu Gly Val Ala Ser Glu Ser Pro Ile Ser Ala Thr Pro Ala 35 40 45 Arg Ser Ile Asp Gly Thr Ser Thr Pro Val Glu Ala Ala Asp Thr Ile 50 55 60 Glu Thr Thr Ala Pro Ala Ala Lys Ala Pro Ala Ala Lys Ala Pro Ala 65 70 75 80 Lys Lys Val Ala Lys Lys Thr Ala Arg Lys Ala Pro Ala Lys Lys Thr 85 90 95 Val Ala Lys Lys Ala Thr Thr Ala Lys Ala Ala Pro Ala Thr Ala Lys 100 105 110 Asp Glu Asn Ala Pro Val Asp Asp Asp Glu Glu Asn Leu Ala Gln Asp 115 120 125 Glu Gln Asp Phe Asp Gly Asp Asp Phe Val Asp Gly Ile Glu Asp Glu 130 135 140 Glu Asp Glu Asp Gly Val Glu Ala Leu Gly Glu Glu Ser Glu Asp Asp 145 150 155 160 Glu Glu Asp Gly Ser Ser Val Trp Asp Glu Asp Glu Ser Ala Thr Leu 165 170 175 Arg Gln Ala Arg Lys Asp Ala Glu Leu Thr Ala Ser Ala Asp Ser Val 180 185 190 Arg Ala Tyr Leu Lys Gln Ile Gly Lys Val Ala Leu Leu Asn Ala Glu 195 200 205 Gln Glu Val Ser Leu Ala Lys Arg Ile Glu Ala Gly Leu Tyr Ala Thr 210 215 220 His Arg Met Glu Glu Met Glu Glu Ala Phe Ala Ala Gly Asp Lys Asp 225 230 235 240 Ala Lys Leu Thr Pro Ala Val Lys Arg Asp Leu Arg Ala Ile Ala Arg 245 250 255 Asp Gly Arg Lys Ala Lys Asn His Leu Leu Glu Ser Asn Leu Arg Leu 260 265 270 Val Val Ser Leu Ala Lys Arg Tyr Thr Gly Arg Gly Met Ala Phe Leu 275 280 285 Asp Leu Ile Gln Glu Gly Asn Leu Gly Leu Ile Arg Ala Val Glu Lys 290 295 300 Phe Asp Tyr Ser Lys Gly Tyr Lys Phe Ser Thr Tyr Ala Thr Trp Trp 305 310 315 320 Ile Arg Gln Ala Ile Thr Arg Ala Met Ala Asp Gln Ala Arg Thr Ile 325 330 335 Arg Ile Pro Val His Met Val Glu Val Ile Asn Lys Leu Gly Arg Ile 340 345 350 Gln Arg Glu Leu Leu Gln Glu Leu Gly Arg Glu Pro Thr Pro Gln Glu 355 360 365 Leu Ser Lys Glu Met Asp Ile Ser Glu Glu Lys Val Leu Glu Ile Gln 370 375 380 Gln Tyr Ala Arg Glu Pro Ile Ser Leu Asp Gln Thr Ile Gly Asp Glu 385 390 395 400 Gly Asp Ser Gln Leu Gly Asp Phe Ile Glu Asp Ser Glu Ala Val Val 405 410 415 Ala Val Asp Ala Val Ser Phe Thr Leu Leu Gln Asp Gln Leu Gln Asp 420 425 430 Val Leu Glu Thr Leu Ser Glu Arg Glu Ala Gly Val Val Lys Leu Arg 435 440 445 Phe Gly Leu Thr Asp Gly Met Pro Arg Thr Leu Asp Glu Ile Gly Gln 450 455 460 Val Tyr Gly Val Thr Arg Glu Arg Ile Arg Gln Ile Glu Ser Lys Thr 465 470 475 480 Met Ser Lys Leu Arg His Pro Ser Arg Ser Gln Val Leu Arg Asp Tyr 485 490 495 Leu Asp <210> 18 <211> 498 <212> PRT <213> Artificial Sequence <220> <223> SigA variant <400> 18 Met Glu Ser Ser Met Val Glu Asn Asn Val Ala Lys Lys Thr Val Ala 1 5 10 15 Lys Lys Thr Ala Arg Lys Thr Ala Arg Lys Ala Ala Pro Arg Val Ala 20 25 30 Thr Pro Leu Gly Val Ala Ser Glu Ser Pro Ile Ser Ala Thr Pro Ala 35 40 45 Arg Ser Ile Asp Gly Thr Ser Thr Pro Val Glu Ala Ala Asp Thr Ile 50 55 60 Glu Thr Thr Ala Pro Ala Ala Lys Ala Pro Ala Ala Lys Ala Pro Ala 65 70 75 80 Lys Lys Val Ala Lys Lys Thr Ala Arg Lys Ala Pro Ala Lys Lys Thr 85 90 95 Val Ala Lys Lys Ala Thr Thr Ala Lys Ala Ala Pro Ala Thr Ala Lys 100 105 110 Asp Glu Asn Ala Pro Val Asp Asp Asp Glu Glu Asn Leu Ala Gln Asp 115 120 125 Glu Gln Asp Phe Asp Gly Asp Asp Phe Val Asp Gly Ile Glu Asp Glu 130 135 140 Glu Asp Glu Asp Gly Val Glu Ala Leu Gly Glu Glu Ser Glu Asp Asp 145 150 155 160 Glu Glu Asp Gly Ser Ser Val Trp Asp Glu Asp Glu Ser Ala Thr Leu 165 170 175 Arg Gln Ala Arg Lys Asp Ala Glu Leu Thr Ala Ser Ala Asp Ser Val 180 185 190 Arg Ala Tyr Leu Lys Gln Ile Gly Lys Val Ala Leu Leu Asn Ala Glu 195 200 205 Gln Glu Val Ser Leu Ala Lys Arg Ile Glu Ala Gly Leu Tyr Ala Thr 210 215 220 His Arg Met Glu Glu Met Glu Glu Ala Phe Ala Ala Gly Asp Lys Asp 225 230 235 240 Ala Lys Leu Thr Pro Ala Val Lys Arg Asp Leu Arg Ala Ile Ala Arg 245 250 255 Asp Gly Arg Lys Ala Lys Asn His Leu Leu Glu Ala Asn Leu Arg Leu 260 265 270 Val Val Ser Leu Ala Lys Arg Tyr Thr Gly Arg Gly Met Ala Phe Leu 275 280 285 Asp Leu Ile Gln Glu Gly Asn Leu Gly Leu Ile Arg Ala Val Glu Lys 290 295 300 Phe Asp Tyr Ser Lys Gly Tyr Lys Phe Ser Thr Tyr Ala Thr Trp Trp 305 310 315 320 Ile Arg Gln Ala Ile Thr Arg Ala Met Ala Asp Gln Ala Arg Thr Ile 325 330 335 Arg Ile Pro Val His Met Val Glu Val Ile Asn Lys Leu Gly Arg Ile 340 345 350 Gln Arg Glu Leu Leu Gln Glu Leu Gly Arg Glu Pro Thr Pro Gln Glu 355 360 365 Leu Ser Lys Glu Met Asp Ile Ser Glu Glu Lys Val Leu Glu Ile Gln 370 375 380 Gln Tyr Ala Arg Glu Pro Ile Ser Leu Asp Gln Thr Ile Gly Asp Glu 385 390 395 400 Gly Asp Ser Gln Leu Gly Asp Phe Ile Glu Asp Ser Glu Ala Val Val 405 410 415 Ala Val Asp Ala Val Ser Phe Thr Leu Leu Gln Asp Gln Leu Gln Asp 420 425 430 Val Leu Glu Thr Leu Ser Glu Arg Glu Ala Gly Val Val Lys Leu Arg 435 440 445 Phe Gly Ile Thr Asp Gly Met Pro Arg Thr Leu Asp Glu Ile Gly Gln 450 455 460 Val Tyr Gly Val Thr Arg Glu Arg Ile Arg Gln Ile Glu Ser Lys Thr 465 470 475 480 Met Ser Lys Leu Arg His Pro Ser Arg Ser Arg Val Leu Arg Asp Tyr 485 490 495 Leu Asp <210> 19 <211> 498 <212> PRT <213> Artificial Sequence <220> <223> SigA variant <400> 19 Met Glu Ser Ser Met Val Glu Asn Asn Val Ala Lys Lys Thr Val Ala 1 5 10 15 Lys Lys Thr Ala Arg Lys Thr Ala Arg Lys Ala Ala Pro Arg Val Ala 20 25 30 Thr Pro Leu Gly Val Ala Ser Glu Ser Pro Ile Ser Ala Thr Pro Ala 35 40 45 Arg Ser Ile Asp Gly Thr Ser Thr Pro Val Glu Ala Ala Asp Thr Ile 50 55 60 Glu Thr Thr Ala Pro Ala Ala Lys Ala Pro Ala Ala Lys Ala Pro Ala 65 70 75 80 Lys Lys Val Ala Lys Lys Thr Ala Arg Lys Ala Pro Ala Lys Lys Thr 85 90 95 Val Ala Lys Lys Ala Thr Thr Ala Lys Ala Ala Pro Ala Thr Ala Lys 100 105 110 Asp Glu Asn Ala Pro Val Asp Asp Asp Glu Glu Asn Leu Ala Gln Asp 115 120 125 Glu Gln Asp Phe Asp Gly Asp Asp Phe Val Asp Gly Ile Glu Asp Glu 130 135 140 Glu Asp Glu Asp Gly Val Glu Ala Leu Gly Glu Glu Ser Glu Asp Asp 145 150 155 160 Glu Glu Asp Gly Ser Ser Val Trp Asp Glu Asp Glu Ser Ala Thr Leu 165 170 175 Arg Gln Ala Arg Lys Asp Ala Glu Leu Thr Ala Ser Ala Asp Ser Val 180 185 190 Arg Ala Tyr Leu Lys Gln Ile Gly Lys Val Ala Leu Leu Asn Ala Glu 195 200 205 Gln Glu Val Ser Leu Ala Lys Arg Ile Glu Ala Gly Leu Tyr Ala Thr 210 215 220 His Arg Met Glu Glu Met Glu Glu Ala Phe Ala Ala Gly Asp Lys Asp 225 230 235 240 Ala Lys Leu Thr Pro Ala Val Lys Arg Asp Leu Arg Ala Ile Ala Arg 245 250 255 Asp Gly Arg Lys Ala Lys Asn His Leu Leu Glu Ala Asn Leu Arg Leu 260 265 270 Val Val Ser Leu Ala Lys Arg Tyr Thr Gly Arg Gly Met Ala Phe Leu 275 280 285 Asp Leu Ile Gln Glu Gly Asn Leu Gly Leu Ile Arg Ala Val Glu Lys 290 295 300 Phe Asp Tyr Ser Lys Gly Tyr Lys Phe Ser Thr Tyr Ala Thr Trp Trp 305 310 315 320 Ile Arg Gln Ala Ile Thr Arg Ala Met Ala Asp Gln Ala Arg Thr Ile 325 330 335 Arg Ile Pro Val His Met Val Glu Val Ile Asn Lys Leu Gly Arg Ile 340 345 350 Gln Arg Glu Leu Leu Gln Glu Leu Gly Arg Glu Pro Thr Pro Gln Glu 355 360 365 Leu Ser Lys Glu Met Asp Ile Ser Glu Glu Lys Val Leu Glu Ile Gln 370 375 380 Gln Tyr Ala Arg Glu Pro Ile Ser Leu Asp Gln Thr Ile Gly Asp Glu 385 390 395 400 Gly Asp Ser Gln Leu Gly Asp Phe Ile Glu Asp Ser Glu Ala Val Val 405 410 415 Ala Val Asp Ala Val Ser Phe Thr Leu Leu Gln Asp Arg Leu Gln Asp 420 425 430 Val Leu Glu Thr Leu Ser Glu Arg Glu Ala Gly Val Val Lys Leu Arg 435 440 445 Phe Gly Leu Thr Asp Gly Met Pro Arg Thr Leu Asp Glu Ile Gly Gln 450 455 460 Val Tyr Gly Val Thr Arg Glu Arg Ile Arg Gln Ile Glu Ser Lys Thr 465 470 475 480 Met Ser Lys Leu Arg His Pro Ser Arg Ser Gln Val Leu Arg Asp Tyr 485 490 495 Leu Asp <210> 20 <211> 498 <212> PRT <213> Artificial Sequence <220> <223> SigA variant <400> 20 Met Glu Ser Ser Met Val Glu Asn Asn Val Ala Lys Lys Thr Val Ala 1 5 10 15 Lys Lys Thr Ala Arg Lys Thr Ala Arg Lys Ala Ala Pro Arg Val Ala 20 25 30 Thr Pro Leu Gly Val Ala Ser Glu Ser Pro Ile Ser Ala Thr Pro Ala 35 40 45 Arg Ser Ile Asp Gly Thr Ser Thr Pro Val Glu Ala Ala Asp Thr Ile 50 55 60 Glu Thr Thr Ala Pro Ala Ala Lys Ala Pro Ala Ala Lys Ala Pro Ala 65 70 75 80 Lys Lys Val Ala Lys Lys Thr Ala Arg Lys Ala Pro Ala Lys Lys Thr 85 90 95 Val Ala Lys Lys Ala Thr Thr Ala Lys Ala Ala Pro Ala Thr Ala Lys 100 105 110 Asp Glu Asn Ala Pro Val Asp Asp Asp Glu Glu Asn Leu Ala Gln Asp 115 120 125 Glu Gln Asp Phe Asp Gly Asp Asp Phe Val Asp Gly Ile Glu Asp Glu 130 135 140 Glu Asp Glu Asp Gly Val Glu Ala Leu Gly Glu Glu Ser Glu Asp Asp 145 150 155 160 Glu Glu Asp Gly Ser Ser Val Trp Asp Glu Asp Glu Ser Ala Thr Leu 165 170 175 Arg Gln Ala Arg Lys Asp Ala Glu Leu Thr Ala Ser Ala Asp Ser Val 180 185 190 Arg Ala Tyr Leu Lys Gln Ile Gly Lys Val Ala Leu Leu Asn Ala Glu 195 200 205 Gln Glu Val Ser Leu Ala Lys Arg Ile Glu Ala Gly Leu Tyr Ala Thr 210 215 220 His Arg Met Glu Glu Met Glu Glu Ala Phe Ala Ala Gly Asp Lys Asp 225 230 235 240 Ala Lys Leu Thr Pro Ala Val Lys Arg Asp Leu Arg Ala Asn Ala Arg 245 250 255 Asp Gly Arg Lys Ala Lys Asn His Leu Leu Glu Ala Asn Leu Arg Leu 260 265 270 Val Val Ser Leu Ala Lys Arg Tyr Thr Gly Arg Gly Met Ala Phe Leu 275 280 285 Asp Leu Ile Gln Glu Gly Asn Leu Gly Leu Ile Arg Ala Val Glu Lys 290 295 300 Phe Asp Tyr Ser Lys Gly Tyr Lys Phe Ser Thr Tyr Ala Thr Trp Trp 305 310 315 320 Ile Arg Gln Ala Ile Thr Arg Ala Met Ala Asp Gln Ala Arg Thr Ile 325 330 335 Arg Ile Pro Val His Met Val Glu Val Ile Asn Lys Leu Gly Arg Ile 340 345 350 Gln Arg Glu Leu Leu Gln Glu Leu Gly Arg Glu Pro Thr Pro Gln Glu 355 360 365 Leu Ser Lys Glu Met Asp Ile Ser Glu Glu Lys Val Leu Glu Ile Gln 370 375 380 Gln Tyr Ala Arg Glu Pro Ile Ser Leu Asp Gln Thr Ile Gly Asp Glu 385 390 395 400 Gly Asp Ser Gln Leu Gly Asp Phe Ile Glu Asp Ser Glu Ala Val Val 405 410 415 Ala Val Asp Ala Val Ser Phe Thr Leu Leu Gln Asp Gln Leu Gln Asp 420 425 430 Val Leu Glu Thr Leu Ser Glu Arg Glu Ala Gly Val Val Lys Leu Arg 435 440 445 Phe Gly Leu Thr Asp Gly Met Pro Arg Thr Leu Asp Glu Ile Gly Gln 450 455 460 Val Tyr Gly Val Thr Arg Glu Arg Ile Arg Gln Ile Glu Ser Lys Thr 465 470 475 480 Met Ser Lys Leu Arg His Pro Ser Arg Ser Gln Val Leu Arg Asp Tyr 485 490 495 Leu Asp <210> 21 <211> 498 <212> PRT <213> Artificial Sequence <220> <223> SigA variant <400> 21 Met Glu Ser Ser Met Val Glu Asn Asn Val Ala Lys Lys Thr Val Ala 1 5 10 15 Lys Lys Thr Ala Arg Lys Thr Ala Arg Lys Ala Ala Pro Arg Val Ala 20 25 30 Thr Pro Leu Gly Val Ala Ser Glu Ser Pro Ile Ser Ala Thr Pro Ala 35 40 45 Arg Ser Ile Asp Gly Thr Ser Thr Pro Val Glu Ala Ala Asp Thr Ile 50 55 60 Glu Thr Thr Ala Pro Ala Ala Lys Ala Pro Ala Ala Lys Ala Pro Ala 65 70 75 80 Lys Lys Val Ala Lys Lys Thr Ala Arg Lys Ala Pro Ala Lys Lys Thr 85 90 95 Val Ala Lys Lys Ala Thr Thr Ala Lys Ala Ala Pro Ala Thr Ala Lys 100 105 110 Asp Glu Asn Ala Pro Val Asp Asp Asp Glu Glu Asn Leu Ala Gln Asp 115 120 125 Glu Gln Asp Phe Asp Gly Asp Asp Phe Val Asp Gly Ile Glu Asp Glu 130 135 140 Glu Asp Glu Asp Gly Val Glu Ala Leu Gly Glu Glu Ser Glu Asp Asp 145 150 155 160 Glu Glu Asp Gly Ser Ser Val Trp Asp Glu Asp Glu Ser Ala Thr Leu 165 170 175 Arg Gln Ala Arg Lys Asp Ala Glu Leu Thr Ala Ser Ala Asp Ser Val 180 185 190 Arg Ala Tyr Leu Lys Gln Ile Gly Lys Val Ala Leu Leu Asn Ala Glu 195 200 205 Gln Glu Val Ser Leu Ala Lys Arg Ile Glu Ala Gly Leu Tyr Ala Thr 210 215 220 His Arg Met Glu Glu Met Glu Glu Ala Phe Ala Ala Gly Asp Lys Asp 225 230 235 240 Ala Lys Leu Thr Pro Ala Val Lys Arg Asp Leu Arg Ala Ile Ala Arg 245 250 255 Asp Gly Arg Lys Ala Lys Asn His Leu Leu Glu Ala Asn Leu Arg Leu 260 265 270 Val Val Ser Leu Ala Lys Arg Tyr Thr Gly Arg Gly Met Ala Phe Leu 275 280 285 Asp Leu Ile Gln Glu Gly Asn Leu Gly Leu Ile Arg Ala Val Glu Lys 290 295 300 Phe Asp Tyr Ser Lys Gly Tyr Lys Phe Ser Thr Tyr Ala Thr Trp Trp 305 310 315 320 Ile Arg Gln Ala Ile Thr Arg Ala Met Ala Asp Gln Ala Arg Thr Ile 325 330 335 Arg Ile Pro Val His Met Val Glu Val Ile Asn Lys Leu Gly Arg Ile 340 345 350 Gln Arg Glu Leu Leu Gln Glu Leu Gly Arg Glu Pro Thr Pro Gln Glu 355 360 365 Leu Ser Lys Glu Met Asp Ile Ser Glu Glu Lys Val Leu Glu Ile Gln 370 375 380 Gln Tyr Ala Arg Glu Pro Ile Ser Leu Asp Gln Thr Ile Gly Asp Glu 385 390 395 400 Gly Asp Ser Gln Leu Gly Asp Phe Ile Glu Asp Ser Glu Ala Val Val 405 410 415 Ala Val Asp Ala Val Ser Phe Thr Leu Leu Gln Asp Gln Leu Gln Asp 420 425 430 Val Leu Glu Thr Leu Ser Glu Arg Glu Ala Gly Val Val Lys Leu Arg 435 440 445 Phe Gly Leu Thr Asp Gly Met Pro Arg Thr Leu Asp Glu Ile Gly Gln 450 455 460 Val Tyr Gly Val Thr Arg Glu Arg Ile Arg Gln Ile Glu Ser Lys Thr 465 470 475 480 Met Ser Arg Leu Arg His Pro Ser Arg Ser Gln Val Leu Arg Asp Tyr 485 490 495 Leu Asp <210> 22 <211> 498 <212> PRT <213> Artificial Sequence <220> <223> SigA variant <400> 22 Met Glu Ser Ser Met Val Glu Asn Asn Val Ala Lys Lys Thr Val Ala 1 5 10 15 Lys Lys Thr Ala Arg Lys Thr Ala Arg Lys Ala Ala Pro Arg Val Ala 20 25 30 Thr Pro Leu Gly Val Ala Ser Glu Ser Pro Ile Ser Ala Thr Pro Ala 35 40 45 Arg Ser Ile Asp Gly Thr Ser Thr Pro Val Glu Ala Ala Asp Thr Ile 50 55 60 Glu Thr Thr Ala Pro Ala Ala Lys Ala Pro Ala Ala Lys Ala Pro Ala 65 70 75 80 Lys Lys Val Ala Lys Lys Thr Ala Arg Lys Ala Pro Ala Lys Lys Thr 85 90 95 Val Ala Lys Lys Ala Thr Thr Ala Lys Ala Ala Pro Ala Thr Ala Lys 100 105 110 Asp Glu Asn Ala Pro Val Asp Asp Asp Glu Glu Asn Leu Ala Gln Asp 115 120 125 Glu Gln Asp Phe Asp Gly Asp Asp Phe Val Asp Gly Ile Glu Asp Glu 130 135 140 Glu Asp Glu Asp Gly Val Glu Ala Leu Gly Glu Glu Ser Glu Asp Asp 145 150 155 160 Glu Glu Asp Gly Ser Ser Val Trp Asp Glu Asp Glu Ser Ala Thr Leu 165 170 175 Arg Gln Ala Arg Lys Asp Ala Glu Leu Thr Ala Ser Ala Asp Ser Val 180 185 190 Arg Ala Tyr Leu Lys Gln Ile Gly Lys Val Ala Leu Leu Asn Ala Glu 195 200 205 Gln Glu Val Ser Leu Ala Lys Arg Ile Glu Ala Gly Leu Tyr Ala Thr 210 215 220 His Arg Met Glu Glu Met Glu Glu Ala Phe Ala Ala Gly Asp Lys Asp 225 230 235 240 Ala Lys Leu Thr Pro Ala Val Lys Arg Asp Leu Arg Ala Ile Ala Arg 245 250 255 Asp Gly Arg Lys Ala Lys Asn His Leu Leu Glu Ala Asn Leu Arg Leu 260 265 270 Val Val Ser Leu Ala Lys Arg Tyr Thr Gly Arg Gly Met Ala Phe Leu 275 280 285 Asp Leu Ile Gln Glu Gly Asn Leu Gly Leu Ile Arg Ala Val Glu Lys 290 295 300 Phe Asp Tyr Ser Lys Gly Tyr Lys Phe Ser Thr Tyr Ala Thr Trp Trp 305 310 315 320 Ile Arg Gln Ala Ile Thr Arg Ala Met Ala Asp Gln Ala Arg Thr Ile 325 330 335 Arg Ile Pro Val His Met Val Glu Val Ile Asn Lys Leu Gly Arg Ile 340 345 350 Gln Arg Glu Leu Leu Gln Glu Leu Gly Arg Glu Pro Thr Pro Gln Glu 355 360 365 Leu Ser Lys Glu Met Asp Ile Ser Glu Glu Lys Val Leu Glu Ile Gln 370 375 380 Gln Tyr Ala Arg Glu Pro Ile Ser Leu Asp Gln Thr Ile Gly Asp Glu 385 390 395 400 Gly Asp Ser Gln Leu Gly Asp Phe Ile Glu Asp Ser Glu Ala Val Val 405 410 415 Ala Val Asp Ala Val Ser Phe Thr Leu Leu Gln Asp Gln Leu Gln Asp 420 425 430 Val Leu Glu Thr Leu Ser Glu Arg Glu Ala Gly Val Val Lys Leu Arg 435 440 445 Phe Gly Leu Thr Asp Gly Met Pro Arg Thr Leu Asp Glu Ile Gly Gln 450 455 460 Val Tyr Gly Val Thr Arg Glu Arg Ile Arg Gln Ile Glu Ser Arg Thr 465 470 475 480 Met Ser Lys Leu Arg His Pro Ser Arg Ser Gln Val Leu Arg Asp Tyr 485 490 495 Leu Asp

Claims (11)

A mutant polypeptide having an RNA polymerase sigma factor A activity in which a start methionine is substituted as a first amino acid and the 488th amino acid is substituted with another amino acid in a polypeptide consisting of the amino acid sequence of SEQ ID NO: 2.
The mutant polypeptide of claim 1, wherein the mutant polypeptide further comprises at least one mutant polypeptide wherein at least one of the amino acids of the following positions is substituted with another amino acid;
Starting from methionine as the first amino acid,
The 136th amino acid; The 254th amino acid; 268th amino acid; Amino acid 281; The 381st amino acid; The 429th amino acid; The 451st amino acid; The 483rd amino acid; And the 491st amino acid.
3. The method of claim 2, wherein the mutated polypeptide comprises a variant polypeptide having the amino acid substitution:
The 136th amino acid is replaced by glycine; The 254th amino acid is substituted with asparagine; The 268th amino acid is replaced by serine; The 281st amino acid is replaced by serine; 381 &lt; / RTI &gt; amino acid residues; The 429th amino acid is replaced by an arginine; The 451th amino acid is substituted with isoleucine; The 483th amino acid is substituted with an arginine; Replace the 488th amino acid with threonine; Or the 491st amino acid is substituted with an arginine.
The mutant polypeptide of claim 1, wherein the mutant polypeptide is the amino acid sequence of SEQ ID NO: 15.
9. A polynucleotide encoding a variant polypeptide of any of claims 1 or 2.
A host cell comprising the polynucleotide of claim 5.
In the polypeptide consisting of the amino acid sequence of SEQ ID NO: 2, the L-threonine transgene is transformed to include the mutant polypeptide having the RNA polymerase sigma factor A activity, wherein the starting methionine is the first amino acid and the 488th amino acid is replaced with another amino acid. Microorganisms of the genus Corynebacterium with improved lysine production ability.
[Claim 7] The method according to claim 7, wherein the mutant polypeptide further comprises a microorganism belonging to the genus Corynebacterium having an improved L-lysine producing ability, wherein at least one of the amino acids of the following positions is substituted with another amino acid;
Starting from methionine as the first amino acid,
The 136th amino acid; The 254th amino acid; 268th amino acid; Amino acid 281; The 381st amino acid; The 429th amino acid; The 451st amino acid; The 483rd amino acid; And the 491st amino acid.
9. The microorganism of claim 8, wherein the mutant polypeptide has the following amino acid substitutions: Corynebacterium sp.
The 136th amino acid is replaced by glycine; The 254th amino acid is substituted with asparagine; The 268th amino acid is replaced by serine; The 281st amino acid is replaced by serine; 381 &lt; / RTI &gt; amino acid residues; The 429th amino acid is replaced by an arginine; The 451th amino acid is substituted with isoleucine; The 483th amino acid is substituted with an arginine; Replace the 488th amino acid with threonine; Or the 491st amino acid is substituted with an arginine.
8. The microorganism of the genus Corynebacterium according to claim 7, wherein the microorganism is Corynebacterium glutamicum .
Culturing the microorganism according to any one of claims 7 to 10; And recovering L-lysine from the cultured microorganism or culture medium.