KR20160104278A - ASL9 gene controlling radial growth of plant and uses thereof - Google Patents

Abstract

The present invention relates to an ASL9 gene for adjusting a thickening growth of a plant, and to a use of the same. More specifically, the present invention relates to a method for adjusting a thickening growth of a plant, wherein he method comprises a step of adjusting the expression of an ASL9 gene by transforming a recombinant vector including the gene by a plant cell; a method for producing a transformed plant in which a thickening growth of the plant is adjusted by means of the method; a transformed plant in which a thickening growth of the plant produced by the previous method is adjusted, and a seed thereof; and a plant thickening growth adjusting composition containing the recombinant vector as an active ingredient. Accordingly, the gene, as a gene in charge in the improvement of productivity, can be utilized in improving productivity by promoting thickening growths of various plants and in improving productivity of a root plant such as radish, sweet potato, and carrot and a woody plant used as a wood material and an energy source. Thus, the gene can also remarkably contribute to the development of the agricultural and plant seed industries.

Description

ASL9 gene and its use for regulating plant hypertrophy {ASL9 gene controlling radial growth of plant and uses thereof}

The present invention relates to an ASL9 gene that regulates plant growth, and more particularly to a method for regulating the expression of an ASL9 gene by transforming a recombinant vector containing the gene into a plant cell. A method for controlling hyperplasia, a method for producing a transgenic plant in which the hypertrophic growth of the plant is controlled by the above method, a transgenic plant in which the hypertrophic growth of the plant produced by the above method is controlled and a seed thereof, The present invention relates to a composition for controlling growth of plants containing an active ingredient.

The vascular tissue of a plant is a material movement pathway necessary for the growth and development of plants including water and nutrients, and each cell having a specific function forms a distinctive structure. In the case of lengthy growth of the primary growth, the stem of the stem is formed by the top apical meristem at the top and consists of the progeny (procambium), the primary phloem, and the xylem . As time passes, cambium cells expanded into the tubular tissue between the bundles for secondary growth are formed, and the secondary tubules and the tubules are developed in different directions Thereby forming a closed circular structure.

The development of the vascular tissues of the stem and root are involved in various plant growth hormones. Auxin and cytokinin, which are closely related to the activity of the entire mitotic tissue, affect cambium cell division and gibberellin and ethylene also participate in cambium activation. Brassinosteroids also control the number or pattern of vascular bundles, which is determined by the maxima produced by controlling the transfer of auxin. In addition, specific genes are known to be involved in the formation of specific tissues. For example, ATHB8, CNA (ATHB15), PHB, PHV, and REV belonging to the HD-ZIP Ⅲ gene group are mainly expressed in the cambium layer of the vascular tissue, and the developmental direction of the tube and the vesicular division Is known to be regulated. In addition, another regulator, KANADI, regulates the expression of HD-ZIP III through miRNA165 / 166, which has been reported to regulate the formation of vascular tissue by interaction with auxin.

Despite relatively well-studied interactions with these complex interactions, there have been no reports of changes in the amount of biomass that can actually be produced through the modification of related genes. This means that there is a limit to increasing biomass production as a factor involved in specific tissue development.

ASL9 (ASYMMETRIC LEAVES 2-like 9), on the other hand, is one of the transcription factors belonging to LBD (LATERAL ORGAN BOUNDARIES DOMAIN), Arabidopsis thaliana roots, and the expression of ASL9 is known to be strongly increased by cytokinin.

Korean Patent Laid-Open No. 10-2011-0108809 discloses ' SRD1 gene derived from sweet potato and a multiple transgenic plant using them', Korean Patent Laid-Open No. 10-2009-0004459 discloses a method for controlling biomass production in plants However, as in the present invention, the ASL9 gene, which regulates plant growth, has not been disclosed.

The present invention has been made in view of the above-mentioned needs. In the present invention, it has been confirmed that the ASL9 gene is involved in the hyperplasia of plants by using a plant in which the expression of the ASL9 gene is regulated. In particular, it was confirmed that overexpression of the ASL9 gene induces the development of cambium present in the roots and stem of the plant, resulting in increased plant growth. Thus, the inventors have completed the present invention by confirming that the ASL9 gene can be used to produce plants and their seeds in which the growth of roots and stems of plants is controlled.

In order to accomplish the above object, the present invention provides a method for controlling the hyperplasia of a plant, comprising the step of transforming a recombinant vector comprising ASL9 gene into a plant cell to regulate the expression of the ASL9 gene.

Further, the present invention provides a method for producing a transgenic plant in which the plant growth is regulated by the above method.

In addition, the present invention provides transgenic plants and seeds thereof that have been regulated in the growth of plants produced by the above method.

In addition, the present invention provides a composition for controlling growth of plants containing the recombinant vector as an active ingredient.

The present invention relates to an ASL9 Gene, and its use, and it has been confirmed that the expression of ASL9 gene of the present invention can be regulated to significantly increase the growth of root and stem of the plant. Therefore, the gene is a gene involved in an increase in productivity, and can be utilized for improving the productivity by promoting the growth of various crops in the future. In particular, the productivity of woody plants used as root crops such as radish, sweet potato, It can contribute to development of agriculture and plant seed industry.

Figure 1 shows the U2 :: ASL9: VP16 vector map of the present invention.
FIG. 2 shows the results of comparing the ASL9 expression levels of the U2 :: ASL9: VP16 transformant and the wild type (WT) of the present invention.
FIG. 3 shows the results of analysis of the traits of U2 :: ASL9: VP16 Arabidopsis transformants and wild type (Col-0) of the present invention. A shows the diameters of stems for 10 U2 :: ASL9: VP16 Arabidopsis transformants and wild type, B for U2 :: ASL9: VP16 Arabidopsis transformants and 10 wild type, respectively. C means U2 :: ASL9: VP16 Arabidopsis thaliana transformants and 10 wild-type roots, D indicates the diameter of U2 :: ASL9: VP16 Arabidopsis transformants and wild type Truncated cross-sectional microcut image, arrows representing cambial layer, E: U2 :: ASL9: VP16 Arabidopsis transformants and wild-type roots cross-section microcutting image
FIG. 4 shows the results of analysis of roots and stem thickness changes of U2 :: ASL9: VP16 Arabidopsis transformants and wild-type (Col-0) plants of the present invention according to cytokinin treatment. A is the root thickness change, BAP (6-benzylaminopurine) is the synthetic compound showing the cytokinin activity, B is the stem thickness change

In order to accomplish the object of the present invention, the present invention provides a method for regulating plant enlargement, comprising the step of transforming a recombinant vector comprising a gene encoding ASL9 protein into plant cells to regulate the expression of ASL9 gene to provide.

The range of the ASL9 protein according to the present invention includes a protein having the amino acid sequence represented by SEQ ID NO: 2 and a functional equivalent of the protein. Is at least 70%, preferably at least 80%, more preferably at least 90%, even more preferably at least 70%, more preferably at least 90%, more preferably at least 90% Quot; refers to a protein having a homology of at least 95% with a physiological activity substantially equivalent to that of the protein represented by SEQ ID NO: 2.

In addition, the present invention provides a gene encoding the ASL9 protein. The gene of the present invention is characterized by controlling the hypertrophic growth of a plant, and includes both genomic DNA and cDNA encoding the ASL9 protein. Preferably, the gene of the present invention may include the nucleotide sequence shown in SEQ ID NO: 1. In addition, homologues of the nucleotide sequences are included within the scope of the present invention. Specifically, the gene has a nucleotide sequence having a sequence homology of 70% or more, more preferably 80% or more, still more preferably 90% or more, and most preferably 95% or more, with the nucleotide sequence of SEQ ID NO: 1 . "% Of sequence homology to polynucleotides" is ascertained by comparing the comparison region with two optimally aligned sequences, and a portion of the polynucleotide sequence in the comparison region is the reference sequence for the optimal alignment of the two sequences (I. E., A gap) relative to the < / RTI >

The above-mentioned "gene expression control" of the present invention refers to increasing or decreasing the expression of the ASL9 gene in plants.

In a method according to one embodiment of the present invention, a recombinant vector comprising the gene of SEQ ID NO: 1 is transformed into a plant cell by overexpressing the ASL9 gene to regulate the plant growth of the plant, But it is not limited to this, as it may induce development and increase the growth of roots and stems of the plant.

The term "recombinant" refers to a cell in which a cell replicates a heterologous nucleic acid, expresses the nucleic acid, or expresses a protein encoded by a peptide, heterologous peptide or heterologous nucleic acid. The recombinant cell can express a gene or a gene fragment that is not found in the natural form of the cell in one of the sense or antisense form. In addition, the recombinant cell can express a gene found in a cell in its natural state, but the gene has been modified and reintroduced intracellularly by an artificial means.

The term "vector" is used to refer to a DNA fragment (s), nucleic acid molecule, which is transferred into a cell. The vector replicates the DNA and can be independently regenerated in the host cell. The term "carrier" is often used interchangeably with "vector ". The term "expression vector" means a recombinant DNA molecule comprising a desired coding sequence and a suitable nucleic acid sequence necessary for expressing a coding sequence operably linked in a particular host organism. Promoters, enhancers, termination signals and polyadenylation signals available in eukaryotic cells are known.

A preferred example of a plant expression vector is a Ti-plasmid vector which is capable of transferring a so-called T-region to a plant cell when it is present in a suitable host such as Agrobacterium tumefaciens. Other types of Ti-plasmid vectors (see EP 0 116 718 B1) are currently used to transfer hybrid DNA sequences to plant cells or protoplasts in which new plants capable of properly inserting hybrid DNA into the plant's genome can be produced have. A particularly preferred form of the Ti-plasmid vector is a so-called binary vector as claimed in EP 0 120 516 B1 and U.S. Patent No. 4,940,838. Other suitable vectors that can be used to introduce the DNA according to the invention into the plant host include viral vectors such as those that can be derived from double-stranded plant viruses (e. G., CaMV) and single- For example, from non -complete plant virus vectors. The use of such vectors may be particularly advantageous when it is difficult to transform the plant host properly.

The expression vector will preferably comprise one or more selectable markers. The marker is typically a nucleic acid sequence having a property that can be selected by a chemical method, and includes all genes capable of distinguishing a transformed cell from a non-transformed cell. Examples include herbicide resistance genes such as glyphosate, phosphinothricin and glufosinate, kanamycin, G418, Bleomycin, hygromycin, But are not limited to, antibiotic resistance genes such as chloramphenicol.

In the plant expression vector of the present invention, the promoter may be CaMV 35S, actin, ubiquitin, pEMU, MAS or histone promoter, but is not limited thereto.

The term "promoter " refers to the region of DNA upstream from the structural gene and refers to a DNA molecule to which an RNA polymerase binds to initiate transcription. A "plant promoter" is a promoter capable of initiating transcription in plant cells. A "constitutive promoter" is a promoter that is active under most environmental conditions and developmental conditions or cell differentiation. Constructive promoters may be preferred in the present invention because the choice of transformants can be made by various tissues at various stages. Thus, constitutive promoters do not limit selectivity.

In the plant expression vectors of the present invention, conventional terminators can be used. Examples thereof include nopaline synthase (NOS), rice α-amylase RAmy1 A terminator, phaseoline terminator, Agrobacterium and the terminator of the Octopine gene of Tumefaciens, but the present invention is not limited thereto. Regarding the need for terminators, it is generally known that such regions increase the certainty and efficiency of transcription in plant cells. Therefore, the use of a terminator is highly desirable in the context of the present invention.

By "gene overexpression" is meant that the gene is expressed at a level that is expressed in a wild-type plant. As a method of introducing the gene into a plant, there is a method of transforming a plant using an expression vector containing the gene under the control of a promoter. The above promoter is not particularly limited as long as it can overexpress an insertion gene in a plant. Examples of such promoters include, but are not limited to, 35S RNA and 19S RNA promoters of CaMV; A full-length transcriptional promoter derived from Peak Work Mosaic Virus (FMV) and a coat protein promoter of TMV.

Transformation of a plant means any method of transferring DNA to a plant. Such transformation methods do not necessarily have a regeneration and / or tissue culture period. Transformation of plant species is now common for plant species, including both terminal plants as well as dicotyledonous plants. In principle, any transformation method can be used to introduce the hybrid DNA according to the present invention into suitable progenitor cells. The method is based on the calcium / polyethylene glycol method for protoplasts (Krens et al., 1982, Nature 296: 72-74; Negrutiu et al., 1987, Plant Mol. Biol. 8: 363-373) 1986, Mol. Gen. Genet. 202: 179-185), the use of various plant elements (such as, for example, Shillito et al., 1985, Bio / Technol.3: 1099-1102) (DNA or RNA-coated) particle impact method (Klein et al., 1987, Nature 327: 70), infiltration of plants or Agrobacterium tumefaciens mediated gene transfer by transformation of mature pollen or micro- Virus infection (EP 0 301 316), and the like. A preferred method according to the present invention comprises Agrobacterium mediated DNA delivery. Particularly preferred is the use of so-called binary vector techniques as described in EPA 120 516 and U.S. Pat. No. 4,940,838.

"Plant cell" used for transformation of a plant may be any plant cell. Plant cells are cultured cells, cultured tissues, cultivated or whole plants. "Plant tissue" refers to a tissue of differentiated or undifferentiated plant, including but not limited to roots, stems, leaves, pollen, seeds, cancer tissues, and various types of cells used for culture, protoplasts, shoots and callus tissue. The plant tissue may be in planta or may be in an organ culture, tissue culture or cell culture.

In addition, the present invention provides a method for producing a transgenic plant in which plant growth is regulated, comprising transforming a plant cell with a recombinant vector comprising a gene encoding an ASL9 protein.

In the method according to an embodiment of the present invention, the ASL9 protein may be composed of the amino acid sequence of SEQ ID NO: 2, but is not limited thereto.

In the production method according to one embodiment of the present invention, the gene encoding the ASL9 protein may be the nucleotide sequence of SEQ ID NO: 1, but is not limited thereto.

In a method according to an embodiment of the present invention, a recombinant vector comprising a gene coding for the ASL9 protein is transformed into a plant cell by overexpressing the ASL9 gene so as to regulate the plant growth of the plant, It is possible to induce the development of the cambium to increase the plant growth, but the present invention is not limited thereto.

In addition, the present invention provides transgenic plants and seeds thereof that have been regulated in the growth of plants produced by the above method.

Also, the plants according to the present invention can be applied to plants such as Arabidopsis, eggplant, tobacco, red pepper, tomato, burdock, ciliaceae, lettuce, bellflower, spinach, modern sweet potato, celery, carrot, buttercup, parsley, cabbage, Rice, barley, wheat, rye, corn, sorghum, oats, onion, etc., such as rice bran, watermelon, melon, cucumber, pak, strawberry, soybean, mung bean, kidney bean, pea, It is preferably a dicotyledon. The plants are preferably Arabidopsis thaliana , but are not limited thereto.

The present invention also provides a composition for regulating the growth of plants containing a recombinant vector comprising a gene encoding ASL9 protein as an active ingredient.

The composition for controlling growth of plants of the present invention includes a recombinant vector containing the gene encoding the ASL9 protein of the present invention as an active ingredient and is capable of regulating the growth of the plant by transforming the gene into a plant. Preferably, the overexpression of the ASL9 gene may increase plant enlargement, but the present invention is not limited thereto.

Hereinafter, the present invention will be described in more detail with reference to Examples. It is to be understood by those skilled in the art that these embodiments are merely illustrative of the present invention and that the scope of the present invention is not limited thereto.

U2 :: ASL9 : VP16  Producing vectors and transgenic plants

Arabidopsis The structure for the overexpression of ASL9 (At1g16530) gene in thaliana was constructed using a multisite gateway system (Invitrogen). The U2 promoter (At2g27510) was amplified by polymerase chain reaction (PCR) using the primers shown in Table 1 and inserted into pDONR P4-P1R through BP reaction. ASL9 The coding region of the gene was inserted into pDONR 221 through the BP reaction after the PCR with the primer shown in Table 1. VP16 gene was used as a transcriptional activator and the BP reaction was performed using the primer shown in Table 1 And inserted into pDONR P2R-P3 (Table 1). The U2 promoter, ASL9 Gene and VP16 The gene was inserted into the target vector dpGreen-BarT vector (Lee et al. 2006. PNAS 103: 6055-6060) through LR reaction. The thus-transformed vector was introduced into Agrobacterium tumefaciens GV3101 having pSOUP, and then introduced into the genome of Arabidopsis thaliana plants by inoculation into a stigma immediately before flowering using a floral dip method 1).

The primers used in the present invention Name of the primer The forward direction (5'-3 ') The reverse direction (5'-3 ') SEQ ID NO: Primer sequence SEQ ID NO: Primer sequence U2 promoter 3 GGGGACAACTTTGTATAGAAAAGTTGCCTATAAAAGCTTTCACGTTTT 4 GGGGACTGCTTTTTTGTACAAACTTGCTCTTGTTTATCACCTGCGTT ASL9 gene 5 GGGGACAAGTTTGTACAAAAAAAGCAGGCTGGATGAGACAAAAGGGTCACAG 6 GGGGACCACTTTGTACAAGAAAGCTGGGTGGCAAGACCAAAGGAAGTCTC VP16 gene 7 GGGGACAGCTTTCTTGTACAAAGTGGATGAAGCCTGGGGGACGAGCTC 8 GGGGACAACTTTGTATAATAAAGTTGACTATCCCGGCCCCGGGGAAT GAPDH 9 GCATTGAGCGACAAGTTTGTG 10 AGTACGAACTCAACCACACAC ASL9 11 CACGGCAAGTACCGTTACTTT 12 AGACCAAAGGAAGTCTCCGG

Example  One. U2 :: ASL9 : VP16 Lt; RTI ID = 0.0 > ASL9 Expression analysis

Wild type and U2 :: ASL9 : VP16 transgenic plants were grown for 5 weeks, and then 10 individuals were collected, and total RNA was extracted from roots and stems. In the root, the main stem was removed and the RNA was extracted. Total RNA was extracted from the stem by cutting 1 cm of the upper part 0.5 cm from the rosette leaf. ₄ μl of oligo (dT) ₁₆ μl and dNTPs 2.5 mM each were added to 1 μg of total RNA, and the volume was filled with the third distilled water so that a total of 14 μl was obtained. The mixture was allowed to react at 65 DEG C for 5 minutes and then quenched for 1 minute on ice and then denaturated. 1 μl of 0.1 M DTT from Invitrogen, 4 μl of first-strand 5 × buffer, and 1 μl of Superscript reverse transcriptase were added to the mixture to make a total of 20 μl, followed by a reverse transcription reaction at 50 ° C for 60 minutes And reacted at 70 ° C for 15 minutes to inactivate the reverse transcriptase. To 20 μl of the obtained complementary DNA, 80 μl of the third distilled water was added to make a final volume of 100 μl, and real-time PCR was performed using 1 μl. As the marker, GAPDH was used, and the primer shown in Table 1 was used. The primers (SEQ ID NOS: 11 and 12) listed in Table 1 were used to confirm the expression level of ASL9 (Table 1). GAPDH And ASL9 About Each experiment was repeated three times.

As a result, as shown in Fig. 2, the relative amount of ASL9 expression in wild-type roots and transgenic plants was shown based on the expression level of wild-type stems, and the expression level of ASL9 in transgenic plant roots and stems was significantly .

Example  2. U2 :: ASL9 : VP16 Of root and stem of transgenic plants introduced Hypertrophic growth  Measurement and internal structure analysis

U2 :: ASL9: VP16 Arabidopsis transformants and wild type (Col-0) were grown for 5 weeks and the growth difference was analyzed. As a result of measuring the weight of the upper part, there was no significant difference between the transformant and the wild type, as shown in Fig. 3A. In order to investigate the change in the thickness of the stem, the thickness of the stalk 0.5 cm from the rosette leaf was compared with the wild type, showing a 52% increase (FIG. 3B). In addition, in order to investigate the change in root thickness, root thickness under hypocotyl was compared with that of wild type, showing an increase of 30.2% (FIG. 3C). The growth of the shoots was not affected, but it seemed to affect the thickness of the stem and root. As a result of cross sectional microcracking for better understanding, it was confirmed that the cambium developed more greatly (FIGS. 3D and 3E).

Example  3. Cytokinin ( Cytokinin Analysis of Growth Changes in Transgenic Plants

U2 :: ASL9: VP16 Arabidopsis thaliana transformants and the wild-type plant hormone, cytokinin. U2 :: ASL9: VP16 transgenic plants and wild type were grown in pots for 4 weeks and treated with cytokinins at 0, 10 and 100 μM concentrations. After one week, the roots and stem diameters of the plants were measured. As a result, as shown in Fig. 4, although the transgenic plants and the wild-type plants increased in diameter during the treatment with cytokinins, the ratio of transgenic plant diameters proportional to the diameter of the wild type was found to be further increased upon treatment with cytokinins (Table 2 and Table 3). Therefore, it was judged that ASL9 reacted with cytokinin to further increase the activity of the cambium.

Wild-type and U2 :: ASL9: VP16 transgenic plant roots by cytokinin treatment WT (no BAP) WT (100 [mu] M BAP) U2 :: ASL9: VP16 (no BAP) U2 :: ASL9: VP16
(100 [mu] M BAP) WT (no BAP) One 1.14 1.29 1.6 WT (100 [mu] M BAP) - One 1.13 1.4 U2 :: ASL9: VP16 (no BAP) - - One 1.36 U2 :: ASL9: VP16 (100 [mu] M BAP) - - - One

Wild type and U2 :: ASL9: VP16 transgenic plant stem treated with cytokinin treatment WT (no BAP) WT (100 [mu] M BAP) U2 :: ASL9: VP16 (no BAP) U2 :: ASL9: VP16
(100 [mu] M BAP) WT (no BAP) One 1.2 1.28 1.48 WT (100 [mu] M BAP) - One 1.07 1.24 U2 :: ASL9: VP16 (no BAP) - - One 1.15 U2 :: ASL9: VP16 (100 [mu] M BAP) - - - One

<110> SNU R & DB FOUNDATION <120> ASL9 gene controlling radial growth of plant and uses thereof <130> PN15025 <160> 12 <170> Kopatentin 2.0 <210> 1 <211> 498 <212> DNA <213> Arabidopsis thaliana <400> 1 atgagacaaa agggtcacag acacggaaga acagtatcgc cttgtgccgg ctgtaaactt 60 ctccggcgaa aatgtgtgaa agattcatgc gtctttgctc cgtattttcc ggccaaagag 120 ccttacaagt ttgccattgt ccacaagatt tttggtgcta gtaatgtcaa taagatgttg 180 caggagctgt cggagaacca ccggagcgac gccgtggatt cgatggtgta cgaggccaac 240 gcgaggatac aagatcctgt gtatggatgt gtagggacaa tttcgtcgtt acacagacaa 300 ctggaaactc tccaaactca gctcgctttt gctcaagccg agttgattca tataaggacg 360 ctccaccgta ttcataccaa acccccgccg tacacggcaa gtaccgttac tttcccctcg 420 aacaaagact tctacagtga catcgacatg gctgttgcgt atacggatga tgccggagac 480 ttcctttggt cttgctag 498 <210> 2 <211> 165 <212> PRT <213> Arabidopsis thaliana <400> 2 Met Arg Gln Lys Gly His Arg His Gly Arg Thr Val Ser Pro Cys Ala   1 5 10 15 Gly Cys Lys Leu Leu Arg Arg Lys Cys Val Lys Asp Ser Cys Val Phe              20 25 30 Ala Pro Tyr Phe Pro Ala Lys Glu Pro Tyr Lys Phe Ala Ile Val His          35 40 45 Lys Ile Phe Gly Ala Ser Asn Val Asn Lys Met Leu Gln Glu Leu Ser      50 55 60 Glu Asn His Arg Ser Asp Ala Val Asp Ser Met Val Tyr Glu Ala Asn  65 70 75 80 Ala Arg Ile Gln Asp Pro Val Tyr Gly Cys Val Gly Thr Ile Ser Ser                  85 90 95 Leu His Arg Gln Leu Glu Thr Leu Gln Thr Gln Leu Ala Phe Ala Gln             100 105 110 Ala Glu Leu Ile His Ile Arg Thr Leu His Arg Ile His Thr Lys Pro         115 120 125 Pro Pro Tyr Thr Ala Ser Thr Val Thr Phe Pro Ser Asn Lys Asp Phe     130 135 140 Tyr Ser Asp Ile Asp Met Ala Val Ala Tyr Thr Asp Asp Ala Gly Asp 145 150 155 160 Phe Leu Trp Ser Cys                 165 <210> 3 <211> 48 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 3 ggggacaact ttgtatagaa aagttgccta taaaagcttt cacgtttt 48 <210> 4 <211> 47 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 4 ggggactgct tttttgtaca aacttgctct tgtttatcac ctgcgtt 47 <210> 5 <211> 51 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 5 ggggacaagt ttgtacaaaa aagcaggctg gatgagacaa aagggtcaca g 51 <210> 6 <211> 50 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 6 ggggaccact ttgtacaaga aagctgggtg gcaagaccaa aggaagtctc 50 <210> 7 <211> 48 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 7 ggggacagct ttcttgtaca aagtggatga agcctggggg acgagctc 48 <210> 8 <211> 47 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 8 ggggacaact ttgtataata aagttgacta tcccggcccc ggggaat 47 <210> 9 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 9 gcattgagcg acaagtttgt g 21 <210> 10 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 10 agtacgaact caaccacaca c 21 <210> 11 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 11 cacggcaagt accgttactt t 21 <210> 12 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 12 agaccaaagg aagtctccgg 20

Claims (12)

A method for regulating plant enlargement, comprising the step of transforming a plant cell with a recombinant vector comprising a gene encoding an ASL9 protein to regulate the expression of the ASL9 gene. 2. The method of claim 1, wherein the ASL9 protein comprises the amino acid sequence of SEQ ID NO: 2. The method according to claim 1, wherein the ASL gene is over-expressed to increase plant growth. 4. The method of claim 3, wherein the increased growth of the plant is induced by the development of the cambium of the root or stem. A method for producing transgenic plants, the method comprising the step of transforming a recombinant vector comprising a gene encoding ASL9 protein into plant cells to regulate the expression of the ASL9 gene. 6. The method of claim 5, wherein the ASL9 protein comprises the amino acid sequence of SEQ ID NO: 2. 6. The method according to claim 5, wherein the ASL gene is overexpressed to increase plant growth. 8. The method of claim 7, wherein the increased growth of the plant is induced by the development of the cambium of the root or stem. 9. A transgenic plant having regulated hypertrophy of a plant produced by the method of any one of claims 5 to 8. 10. The transgenic plant according to claim 9, wherein the transgenic plant is a dicotyledonous plant. The seed of the transgenic plant of claim 9, wherein the plant growth is regulated. A composition for regulating the growth of plants comprising a recombinant vector comprising a gene encoding ASL9 protein as an active ingredient.

Images