KR20160072736A - Cookie with an improved quality and method of preparing the same - Google Patents

Abstract

The present invention relates to a composition for manufacturing baking confectioneries having smooth mouthfeel and the improved quality, to a manufacturing method of the composition, to paste for manufacturing the baking confectioneries manufactured by mixing the composition, and to baking confectioneries manufactured by using the composition. The composition for manufacturing cookies comprises flour, edible oil and fat, and sugar.

Description

Cookies with improved quality and methods of making same

The present invention relates to a composition for preparing a cookie having a soft texture with improved quality, a method for producing the composition, a kneaded product for preparing a cookie produced by mixing the composition, and a cookie made using the composition.

Many bakery products have a soft texture, and baking products such as cookies are usually hardened after baking and changed to an undesirable texture, which deteriorates or deteriorates the quality. Cookies with a soft texture (aka soft cookies) are generally made to enhance the fat content of butter and margarine to achieve a soft texture.

Cookies are usually prepared by blending and baking wheat flour or various starches, fats, sugars and the like, as well as various nutritional ingredients, as well as additional additives to obtain desired physical properties or quality, such as a moist texture or a desired color.

For example, in order to obtain a moist texture of the cookie, a wetting agent such as corn syrup, maltose, sorbose, galactose, corn syrup, glucose syrup, telephone syrup, honey, molasses, fructose, lactose, dextrose , And mixtures thereof. Also glycerol, sugar alcohols such as mannitol, maltitol, xylitol and sorbitol, and other polyols can be used as wetting agents. In addition, a protein source suitable for inclusion in the baking product may be added to facilitate browning by Maillard browning.

Sugar, fructose and the like can be used as a sweet component in order to produce cookies, but sugar has a high sweetness, and when used in an excessive amount, there is a problem that a smooth texture is deteriorated and a crunchy texture is increased. In addition, liquid fructose has been used for softening the texture of cookies because of its good moisture retaining ability. However, the sticking to the mouth may occur, the shape may be damaged, and the taste may change during the distribution. In addition, fructose fructose together with the above-mentioned saccharides may be further used for the purpose of further improving the moisture holding power of the cookies. However, these saccharides are high in calories and have a problem that the sweetness is not clean.

The present invention relates to a composition for preparing a cookie which has a soft and moisturized texture and can be used in the past without using a wetting agent such as a wetting sugar or a wetting sugar alcohol and can be used in a reduced amount and a low calorie content, And a cookie produced using the composition for preparing a cookie.

It is still another object of the present invention to provide a process for producing a moldable cookie that provides a kneading product for kneading with excellent kneading ability, A preparation method of the composition, a kneaded product for a cookie prepared by mixing the composition, and a cookie produced using the composition for preparing a cookie.

It is a further object of the present invention to provide a cookie-making composition which does not use an additive for promoting browning by the Maillard reaction or can reduce the amount of use by implementing the color of the cookie in a short period of time, A cookie for preparing cookies prepared by mixing the above composition, and a cookie prepared using the composition for making a cookie.

As used herein, the term "cookie " means a baked confectionery produced by kneading and molding a pre-classified material as a raw material and firing the same, and is used in combination with biscuits, cookies, crackers or the like. Cookies may be classified into various types according to the manufacturing method and include, for example, a drop cookie, a molded cookie, a filled cookie, a refrigerator cookie, a sandwich cookie, Is a molded cookie produced by molding a dough using a molding machine.

The cookie may be classified according to the moisture content and the fat content, and the soft cookie may be a cookie having a soft texture, meaning a cookie having a water content of 5% or more and a water activity of 0.4 or more, or a total weight And the total weight of the edible oil and saccharide contained in the cookie is at least 40% by weight based on 100%. A preferred example of the present invention is a soft cookie. When the soft cookies are used with the moisturizing raw materials, the softness of the mouth and the softness of the mouthfeel are continuously sensed in the soft cookies, thereby making it possible to manufacture products satisfying the consumers. In this regard, when using Saikos in the composition or cookie according to the present invention, it is possible to produce a soft cookie which is sensibly better than conventional sugar, syrup and fructose.

The cookie according to the present invention preferably has a water content of 8.3% to 20%, preferably 8.5% to 15%, and a water activity of 0.45 to 0.9, preferably 0.48 to 0.8. The cookies according to the present invention exhibit moisture and water activity in the above-mentioned numerical range, so that it is possible to provide moist feeling with excellent moisture retention.

Moisture refers to the water content contained in the food, and the moisture in the food is always fluctuating according to the surrounding environmental conditions, and indicates the water activity considering the relative humidity in the atmosphere. Water activity is a very important feature in food because it is related to the chemical, biophysical, and physical reactions in foods that change microbial growth and flavor, color, and flavor of food. Therefore, water activity has more significance in food stability than total moisture content. The pure water vapor pressure to the water pressure that the food represents is the definition of water activity.

Water activity and food shelf life are related to microbial growth and chemical reaction rate. Microorganisms can no longer grow at the minimum water activity, and even if the number of microorganisms increases, the number of microorganisms is very small, so water activity is the most easily controllable microorganism. Depending on the type of microorganism, there is a considerable difference in sensitivity to water activity, and fungi and yeast are microorganisms that should pay attention to low water activity. Depending on the moisture or water activity in the food, it affects the degradation (fermentation & decay), enzymatic activity and browning (especially non-enzymatic browning) of microorganisms in the food and these reactions are proportional to the water activity .

One embodiment of the present invention is a composition for making cookies comprising wheat flour, edible fats and saccharides, wherein the saccharide is a composition for making cookies, including a psicose.

The composition for preparing cookies of the present invention may contain 2 to 50 parts by weight of a saccharide as a saccharide based on 100 parts by weight of the total weight of the cook composition. The composition for preparing a cookie may contain, as a saccharide, sucrose alone, or may further include at least one saccharide selected from the group consisting of sugar, fructose, and starch syrup in addition to psicose.

 In the cookie composition of the present invention, the sugar may be at least one selected from the group consisting of white sugar, yellow sugar, brown sugar, and sugar substitute, and preferably white sugar can be used. The sugar may be contained in an amount of 3 to 25 parts by weight, preferably 5 to 20 parts by weight based on 100 parts by weight of the cookie composition of the present invention. The sugar content can be appropriately adjusted to take into account the texture and soft texture of the cookie sticking to the mouth.

In the cookie composition of the present invention, the liquid fructose is used for softening the texture of the cookies because of its good moisture retaining ability. The liquid fructose may be contained in an amount of 3 to 25 parts by weight, for example, 5 to 15 parts by weight, and preferably 8 to 12 parts by weight based on 100 parts by weight of the cookie composition of the present invention. The content of the liquid fructose can be appropriately adjusted in consideration of the realization of a soft texture of the cookies, the phenomenon of sticking to the mouth, the damage of the shape of the cookies, and the deterioration of the taste of the cookies during distribution.

Saikosu may be added in the form of a mixture with powders, psicose syrups, or other saccharides. However, unlike powders, since syrup contains a large amount of water, since the dough is excessively cured, some of the sugar may be included in consideration of the physical properties of the dough.

The composition for preparing cookies, the paste or the cookies contained in the cookies may be a solution prepared by dissolving or dissolving the mixture in a powder form, have. In addition, the above-mentioned cyclosaccharide may be a mixed saccharide containing cyclosaccharide alone or an additional saccharide. Examples of the saccharide saccharide may further include at least one selected from the group consisting of fructose, glucose, and oligosaccharide. The mixed sugar may contain 1 to 99.9 parts by weight of a viscose based on 100 parts by weight of the total solid content, and may further include one or more selected from the group consisting of fructose, glucose, and oligosaccharides.

Specific examples of the saccharide-containing mixed sugar include 2 to 55 parts by weight of psicose, 30 to 80 parts by weight of fructose, 2 to 60 parts by weight of glucose and 0 to 15 parts by weight of oligosaccharide based on 100 parts by weight of the total solid content of the mixed sugar And may not include oligosaccharides. Saikos, fructose and glucose are preferably both D-isomer.

Saikosu can be carried out by chemical synthesis, or by biological methods using a cyclic epimerase, preferably by a biological method. Thus, the above-mentioned psicose includes at least one selected from the group consisting of psicose epimerase, cells of the strain producing the enzyme, culture of the strain, lysate of the strain, and extracts of the lysate or the culture The composition for producing psicose may be one prepared by reacting with a fructose-containing raw material.

In one embodiment of the present invention, a method for producing a scikos according to a biological method includes a method of culturing a strain producing a < RTI ID = 0.0 > cytokine < / RTI > epimerizing enzyme or a recombinant strain into which a gene encoding a scikos epimerase has been introduced, The course epimerase can be produced by reacting with a fructose-containing raw material. The above-mentioned cyclic epimerase can be carried out as a solid phase reaction using a liquid phase reaction or an immobilized enzyme.

Alternatively, a strain producing a cytomegalovirus or a recombinant strain into which a gene encoding a cytomegalovirus is introduced is obtained, and the culture of the strain, the culture of the strain, the lysate of the strain, and the lysate of the lysate or the culture Extract of the present invention can be produced by reacting a composition for producing a scorch, which comprises at least one member selected from the group consisting of a fructose-containing raw material, and a fructose-containing raw material. In the case of producing the cytosine using bacterial strains producing the Escherichia epimerase, the reaction can be carried out in the solid phase reaction using a liquid reaction or immobilized cells.

In a specific example of the present invention, as a strain producing a psicose epimerase, it may be a strain capable of producing a psicose epimerase at a high yield while having high stability. The recombinant strain may be a variety of host cells such as Escherichia coli, Bacillus sp., Salmonella sp., And Corynebacterium sp., Preferably, a strain of the genus Corynebacterium, which is a GRAS strain, Lt; / RTI > glutaricum.

In the case of using a recombinant strain, the gene encoding an enzyme derived from various strains can be used as a cytomegalic epimerase. For example, an enzyme derived from trifoneme primitia described in Korean Patent Publication No. 2014-0021974, Korean Patent Publication No. 2014-0080282 Or an enzyme derived from Clostridials dans according to Korean Patent No. 10-1318422, and may also be an enzyme derived from enciphered Halsen. In a specific example, the cytosine epimerase according to the present invention may be an enzyme derived from a clostridial synthase, for example, having the amino acid sequence of SEQ ID NO: 7, and the nucleic acid sequence of SEQ ID NO: 8 or SEQ ID NO: 9 . The nucleic acid sequence of SEQ ID NO: 8 is an E. coli optimized nucleic acid sequence and the SEQ ID NO: 9 is a nucleic acid sequence modified appropriately to Corynebacterium.

In the production of the recombinant strain according to an embodiment of the present invention, the expression of the enzyme may be regulated using a regulatory sequence located on the upper side of the nucleic acid sequence encoding the above-mentioned cyclic epimerase, and the regulatory sequence is essentially a transcription promoter And may further include ribosome binding regions and / or spacer sequences, and the like. The elements constituting the regulatory sequence may be directly linked or linked by including one or more linkers of the nucleic acid sequence having 1 to 100 bases, for example, 5 to 80 bases.

In one embodiment, the transcriptional promoter may be a nucleic acid molecule that expresses a nucleic acid sequence encoding a cyclic epimerase in a Corynebacterium sp. Strain, but may be a tac1, tac2, trc, or sod promoter. The sod promoter is derived from Corynebacterium glutaricum, and preferably comprises the nucleotide sequence of SEQ ID NO: 1 as a core region. The trc promoter is an Escherichia coli -derived promoter produced by a combination of the trp promoter and the lac UV5 promoter. The Tac1 promoter is an Escherichia coli-derived promoter, which is produced by a combination of the trp promoter and the lac UV5 promoter. The Tac2 promoter is an E. coli -based promoter, which is prepared by a combination of the trp promoter and the lac UV5 promoter, and is optimized by modifying the sequence of the Tac1 promoter.

The ribosome binding region and the spacer may be chemically linked directly or indirectly via a linker nucleic acid sequence in between. In an embodiment of the present invention, the ribosome binding region and the spacer sequence may include one oligonucleotide sequentially connected in 5 'to 3' order. The nucleotide sequences of the promoter sequence, the ribosome binding region and the spacer sequence according to an embodiment of the present invention are shown in Table 1 below. In Table 1, the underlined portions indicate the ribosome binding region, the spacer sequence, the linker sequence, and the like in the regulatory sequence.

order
number Sequences (5 '-> 3') denomination One aagcgcctcatcagcggtaaccatcacgggttcgggtgcgaaaaaccatgccataacaggaatgttcctttcgaaaattgaggaagccttatgcccttcaaccctacttagctgccaattattccgggcttgtgacccgctacccgataaataggtcggctgaaaaatttcgttgcaatatcaacaaaaaggcctatcattgggaggtgtcgcaccaagtacttttgcgaagcgccatctgacggattttcaaaagatgtatatgctcggtgcggaaacctac
gaaaggattttttacccatggctgtatacgaactcccagaactcgactacgcatacgac
gaaaggattacaaa Sod promoter
2 tgacaattaatcatcggctcgtatattgt
gtggaattgtgagcggataacaatttcacacaggaaacagaattcccggggaaaggattacaaa tac1 promoter
3 Tgacaattaatcatccggctcgtataatgt
taacaatttgtggaattgtgagcggacacacaggaaacagaccatggaattcgagctcggtacccggg gaaaggattacaaa Tac2 promoter
4 Tgacaattaatcatcggcctcgtataatgt trc promoter
5 Gaaagga Ribosome binding region 6 Ttacaaa Spacer sequence

It is preferable that the cyclic epimerase according to the present invention is excellent in enzyme activity and thermal stability. Accordingly, in the embodiment of the present invention, the combination of the transcriptional promoter or the regulatory sequence with the gene encoding the cyclic epimerase is important , The tac1, tac2, trc, and sod promoters used in the present invention can provide more than adequate titers of protein expression, and when the sod promoter is used, folding of the protein is robust, It is more preferable to obtain a result which is high.

The method of producing a psicos using a recombinant strain can be carried out according to the method described in Korean Patent Publication Nos. 2014-0021974, 2014-0080282 and Korean Patent No. 10-1318422, but is not particularly limited. In the above-mentioned method of producing a scicos, the concentration of fructose used as a substrate may be 40 to 75% (w / v), for example, 50 to 75% (w / v) have. When the concentration of fructose is lower than the above range, economical efficiency is lowered. When the concentration of fructose is higher than the above range, fructose is not dissolved well, so that the concentration of fructose is preferably within the above range. The fructose may be used in the form of a solution dissolved in a buffer solution or water (e.g., distilled water).

The composition for preparing a cookie according to the present invention may be at least one wheat flour selected from the group consisting of gravitational powder, strong flour and flour powder, and preferably flour can be used. 100 parts by weight of the cookie composition of the present invention contains 30 to 60 parts by weight of wheat flour, preferably 40 to 60 parts by weight. If the wheat flour content is less than 30 parts by weight per 100 parts by weight of the cookie composition, there is a problem in that the bonding strength of the cookie dough is insufficient and the molding is difficult to achieve and a preferable texture is difficult to implement. When the flour content exceeds 60 parts by weight, there is a problem.

The cookie composition of the present invention may further comprise whole wheat flour. The whole wheat flour may be used in a particle size of 18 mesh to 250 mesh, more specifically 90 mesh to 180 mesh. When the whole wheat flour is contained in the cookie composition of the present invention, the amount is 1 to 5 parts by weight, more preferably 1 to 3 parts by weight, based on 100 parts by weight of the cookie composition. The use of a moderate amount of whole wheat flour provides a soft cookie texture and reduces the sticking to the mouth. Excessive amounts of flour can inhibit molding and prevent a clean taste.

The edible oil included in the present invention may be selected from vegetable oil, animal oil, margarine, butter, shortening, and mixtures thereof, preferably selected from margarine, butter, shortening, and mixtures thereof. The vegetable oil may be at least one selected from the group consisting of palm oil, vegetable oil, soybean oil, palm oil, sunflower oil, sunflower oil, ester-exchanged oil and fractionated liquid oil of the oil, and the animal fat is composed of lard, , But the present invention is not limited thereto.

100 parts by weight of the cookie composition of the present invention may contain 10 to 30 parts by weight, preferably 15 to 25 parts by weight of an edible oil. If the content of the edible oil is less than 10 parts by weight, it is difficult to produce a cookie with a soft texture due to poor emulsification. In addition, there is a problem that cookie flavor is lowered. When the content is more than 30 parts by weight, There is a problem that the dough is spread and the formability is poor.

The composition for preparing cookies of the present invention may further comprise whole egg, egg white, egg yolk and the like, and may be included in an amount of 3 to 20 parts by weight based on 100 parts by weight of the total solid content of the composition.

The composition for preparing cookies according to the present invention may further comprise an emulsifier. The emulsifier may be any one ordinarily used in the cookie composition, and may be one or more selected from the group consisting of lecithin, glycerin fatty acid esters and sucrose fatty acid esters, but is not limited thereto. 100 parts by weight of the cookie composition of the present invention may contain 0.1 to 5 parts by weight, preferably 0.3 to 3 parts by weight, of an emulsifier. If the content of the emulsifier is less than 0.1 parts by weight, sufficient emulsification may not be obtained, resulting in a deterioration of product quality with time. If the amount of the emulsifier is more than 5 parts by weight, there is a problem that a taste peculiar to the emulsifier appears.

The composition for preparing cookies according to the present invention may further comprise various additional additives in addition to flour, edible fats and saccharides. Examples of the additive component include at least one selected from the group consisting of emulsifiers, indigestible dextrin, skim milk powder, protein powder, vitamins, minerals, swelling agents (sodium bicarbonate, sodium pyrophosphate, etc.) can do.

The starch can be used without limitation as long as it is commonly used in a cookie composition. Preferably, the starch may be at least one selected from the group consisting of wheat starch, potato starch, corn starch and sweet potato starch, modified starch and indigestible dextrin . The starch may be contained in an amount of 1 to 10 parts by weight, preferably 3 to 8 parts by weight based on 100 parts by weight of the cookie composition of the present invention. If the starch content is less than 1 part by weight, there is a problem that a soft texture is difficult to be exhibited and a cookie sticks to the mouth. When the starch content is more than 10 parts by weight, the dough becomes sticky and hinders molding.

The indigestible dextrin, for example, indigestible maltodextrin, is a type of dietary fiber, which can also help improve a smooth texture. An indigestible maltodextrin may be used. When the cookie composition of the present invention contains the indigestible maltodextrin, the indigestible maltodextrin content is preferably 1 to 5 parts by weight, and more preferably 1 to 3 parts by weight per 100 parts by weight of the cookie composition.

The cookie composition of the present invention may further comprise a vitamin. When the cookie composition of the present invention contains vitamin, the content is preferably 0.1 to 5 parts by weight, more preferably 0.1 to 3 parts by weight per 100 parts by weight of the cookie composition. It is preferable to adjust the amount of vitamin A, vitamin B1, vitamin B6, vitamin C, niacin, folic acid and vitamin E to 25% or more of the nutrient reference value and iron and zinc to 10% or more of the nutrient reference value, Used in consideration of lost amount.

The cookie composition of the present invention may further contain minerals such as iron, zinc, and calcium. The calcium may be at least one selected from the group consisting of egg shell calcium, milk calcium, shell calcium and calcium carbonate. When calcium is contained in the cookie composition of the present invention, the calcium content is 0.5 to 5 parts by weight, preferably 0.5 to 3 parts by weight. It is desirable to adjust the calcium content so that the calcium content per serving of the cookie is 70 mg or more so as to meet the standards of the food preparation for weight control.

The composition for making a cookie of the present invention may be a powdery composition comprising essential ingredients and optionally further ingredient (s), or may be a kneaded product prepared by mixing these compositions directly or by adding water. When the cookie composition of the present invention further comprises water, the content thereof may preferably be 5 to 15 parts by weight, more preferably 8 to 12 parts by weight, per 100 parts by weight of the total components excluding water. When the components are mixed by dividing into at least two stages (e.g., two to three stages, preferably three stages), it is preferred that the water is introduced at the second stage or thereafter.

The composition for preparing cookies according to the present invention may be homogeneously blended to provide a kneaded product. Preferably, the kneaded product for preparing a cookie is prepared by mixing the residual dough (%) of the molding machine with the total weight of the dough used for molding For example, 5% or less, for example, 1% to 5%.

Cookies prepared according to the present invention preferably have a water content of 8.3% -20%, preferably 8.5% to 15%, and a water activity (Aw) of 0.45 to 0.9, preferably 0.48 to 0.8 It is possible to provide a texture that is soft and does not stick to the mouth.

The present invention relates to a composition for preparing a cookie having a soft texture with improved quality by replacing all or part of saccharides such as sugar and fructose used in cookies with a sauces, a method for producing the composition, a cookie And a cookie prepared using the composition. Also, the composition for making a cookie having a soft texture of the present invention, or a dough or a cookie produced therefrom, can provide a moist texture, a low calorie, a dough aptitude and a fast color And the like achieve excellent effects.

1 is a view showing an example of an expression recombinant vector (pCES_sodCDPE) for producing a psicose syrup used in the present invention.

The present invention will be described in more detail with reference to the following examples, but the scope of the present invention is not limited to the following examples.

Manufacturing example  One: Saikos  Produce

1-1: Saikos  Production of production strains

The DPE gene (Gene bank: EDS06411.1) derived from Clostridium scindens ATCC 35704 was synthesized as modified polynucleotides by optimizing E. coli for the Escherichia coli To name it CDPE. The polynucleotide optimized for Escherichia coli (SEQ ID NO: 2) and the sod promoter and T7 terminator obtained from the pET21a vector were obtained through PCR using each template, which was then ligated into a template by overlap PCR (PCR) And cloned into pGEM T-easy vector through T-vector cloning to confirm the sequence of the polynucleotide including the sod promoter (SEQ ID NO: 1), the optimized CDPE sequence of SEQ ID NO: 8 and the T7-terminator.

The entire confirmed polynucleotide was inserted into the same restriction enzyme site of the expression vector pCES208 (J. Microbiol. Biotechnol., 18: 639-647, 2008) using restriction enzymes NotI and XbaI (NEB) to obtain a recombinant vector pCES208 / (PCES_sodCDPE) was prepared. A cleavage map of the prepared recombinant vector (pCES_sodCDPE) is shown in Fig.

The prepared recombinant vector (pCES_sodCDPE) plasmid was transformed into Corynebacterium glutaricum using electroporation. Colonies were picked and inoculated into 4 ml of LB medium (10 g / L of tryptone, 10 g / L of NaCl, 5 g / L of yeast extract) supplemented with kanamycin at a final concentration of 15 ug / And cultured for about 16 hours. Then, 1 ml of the culture was obtained and inoculated into 100 ml of LB medium containing 15 ug / ml kanamycin, and the cultivation was continued for 16 hours or more. After lysis of cells cultured with Beadbeater, only supernatant is obtained, mixed with sample buffer 1: 1, and heated at 100 ° C for 5 minutes. The prepared sample was subjected to electrophoresis on a 12% SDS-PAGE gel (composition: running gel - 3.3 ml H2O, 4.0 ml 30% acrylamide, 2.5 ml 1.5 M Tris buffer (pH 8.8) 20 μl 10% SDS, 20 μl 10% APS, 2 μl TEMED) at 180 V for about 50 minutes at room temperature The protein expression was confirmed by electrophoresis. After the expression of CDPE was confirmed on SDS-PAGE gel, the His-tag purification was performed using Ni-NTA resin to determine the precise expression level. The expression (%) = (Purified protein (mg) / Total soluble protein )) * 100). The transformed Corynebacterium glutaricum prepared above produced 16.62 mg of total soluble protein and 1.74 mg of purified enzyme protein.

1-2: Saikos  Manufacture of syrups

Cells were recovered by centrifugation in a strain culture in order to produce a scissors from fructose using the recombinant strain producing the scuche epimerase obtained in Production Example 1-1.

The cell suspension was then treated with 0.05% (w / v) of an emulsifier (M-1695) in a final volume at 35 ° C (± 5 ° C) for 60 minutes. After the completion of the reaction, the supernatant containing the emulsifier was removed using a centrifuge, and the cells were recovered.

For the preparation of the immobilized beads, the recovered cells were mixed with DW to a final cell concentration of 5% (w / v), mixed with 4% (w / v) alginic acid dissolved in water and 5% ) Were mixed at a ratio of 1: 1, and the mixture was stored at 4 ° C in order to remove the bubbles generated during mixing. The refrigerated mixture was injected through a Neddle (inner diameter: 0.20 to 0.30 mm) to form droplets. The mixture was dropped by weight. The dropped mixture was dropped into a 100 mM calcium chloride (CaCl ₂ ) To form spherical or elliptical beads (diameter 2.0 to 2.2 mm). The formed beads were soaked in a 100 mM calcium chloride solution and mixed evenly by a stirrer so as to be further cured.

After all of the mixed solution was injected, the beads were further cured while refrigerated for 4 to 6 hours, and then replaced with a fresh 100 mM calcium chloride solution, and cured in a refrigerated state for about 6 hours. The hardened beads were completely removed from the beads, and then water having a volume three times the bead volume was added thereto. The beads were then stirred for 10 minutes. This process was repeated three times to remove the calcium chloride solution. The washed beads were completely removed for manganese soaking, and then a 40-brix (%) reaction substrate containing 10 mM of manganese was added thereto in a volume three times as large as the bead volume, followed by stirring for 10 minutes. And replaced with a reaction substrate containing 10 mM manganese. The reaction substrate is adjusted to pH 6.8 ~ 7.2 with 3N NaOH. Depending on the type of product, liquid fructose or crystalline fructose can be the reaction substrate. After the beads were replaced with the reaction substrate containing 10 mM manganese, the beads were transferred to the reaction tank and reacted at a reaction temperature of 50 ° C. for about 30 to 60 minutes to complete the sorbing of beads with manganese and fructose. The diameter of the finished bead decreases to 1.6 ~ 1.8mm and the strength also increases. The substrate of the beads which had been soaked was removed and the immobilized reaction column was filled and used for the production of the viscose syrup.

≪ Immobilization column reaction conditions >

Reaction temperature: Internal temperature of column jacket 50 ℃

Substrate flow rate: 0.5 SV (space velocity L. h-1)

Reaction Substrate: Crystalline fructose 40brix, pH 6.8 ~ 7.2, Mn ^{2 +} free

Bead preparation: 2.5% (w / w) cells, 2% (w / w) alginic acid mixture and 10 mM Mn ^{2 +} soaking

The immobilization reaction column was provided with a raw material containing 92% by weight of fructose when the raw material solution contained 75% of solid content and 100% by weight of total solid content, Respectively. That is, 25 (w / w)% of psicose syrup of glucose: fructose: sucrose: oligosaccharide = 6: 67: 25: 2 was obtained from the reaction solution in the weight ratio of glucose: fructose: Lt; / RTI >

1-3: Saikos  Preparation of powder

To remove impurities such as color and ion components, the psicose syrup obtained in Preparation Example 1-2 was added to a column at room temperature filled with a cation exchange resin, an anion exchange resin and a resin mixed with a cation and an anion exchange resin, Exchanged resin at a flow rate of 2 times the volume of the exchange resin, and separated into a high-purity scorch solution by chromatography packed with a calcium (Ca ^{2 +} ) type ion exchange resin. The high-purity cicos syrup was concentrated to a concentration of 82 Bx, and the solution was cooled to a supersaturated temperature of 35 캜 and then gradually cooled to a temperature of 10 캜 to form crystals. The mother liquor obtained in the crystallization step was centrifugally dehydrated to remove the mother liquor, and the crystal was washed with cooling water, followed by drying and recovering.

Example  1 to 4: Saikos  Cookies using powder

The ingredients and compositions shown in Table 2 below were mixed to prepare a dough for soft cookie manufacture. In Example 1, 15% by weight of sugar and 5% by weight of psicose powder (purity of 99%) were used. In Example 2, 10% by weight of sugar and 10% % And 10% by weight of cyosomy powder, and Example 4 used 20% by weight of sucrose powder without sugar.

The dough is prepared by mixing raw materials such as natural butter, sugar skimmed milk and purified salt into a mixer, mixing the mixture at a high speed (rpm 120) for about 2 minutes, mixing the liquid raw material and the blend water for 3 minutes at high speed, And coconut were added and kneaded at low speed (rpm 50) for about 2 minutes to prepare dough.

The cooked dough was molded by a molding machine called Rotary Depositioner to a thickness of about 20 g, placed on a steel band (baking frame), set at 200 ° C. under 180 ° C. in an electric oven for about 10 minutes Baked.

Raw material (unit:% by weight) Example 1 Example 2 Example 3 Example 4 Natural butter 23.0 23.0 23.0 23.0 Skim milk powder 2.0 2.0 2.0 2.0 Purified salt 0.3 0.3 0.3 0.3 baking soda 0.9 0.9 0.9 0.9 Acid pyrophosphate
(SAPP) 0.4 0.4 0.4 0.4 lecithin 0.3 0.3 0.3 0.3 Sugar 15.0 10.0 5.0 0.0 Saikos 5.0 10.0 15.0 20.0 Total volume 7.2 7.2 7.2 7.2 coconut 4.4 4.4 4.4 4.4 weak flour 41.5 41.5 41.5 41.5 Sum 100 100 100 100

Comparative Example  1: Making sugar cookies

Dough and cookies were prepared in substantially the same manner as in Example 1. However, instead of 15 wt% of sugar and 5 wt% of sucrose used in Example 1, 20 wt% of sugar was used as Comparative Example 1. The specific ingredients and compositions used for making the dough are shown in Table 3 below.

Comparative Example  2-4: Cookie production using sugar and fructose

Dough and cookies were prepared in substantially the same manner as in Example 1. In Comparative Example 2, 15 wt% of sugar and 5 wt% of fructose were used instead of 15 wt% of sucrose and 5 wt% of sucrose used in Example 1. In Comparative Example 3, 10 wt% of sugar and 10 wt% In Comparative Example 4, 7.5% by weight of sugar and 12.5% by weight of sucrose were used. The specific ingredients and compositions used for making the dough are shown in Table 3 below.

Raw material (unit:% by weight) Comparative Example 1 Comparative Example 2 Comparative Example 3 Comparative Example 4 Natural butter 23.0 23.0 23.0 23.0 Skim milk powder 2.0 2.0 2.0 2.0 Purified salt 0.3 0.3 0.3 0.3 baking soda 0.9 0.9 0.9 0.9 Acid pyrophosphate
(SAPP) 0.4 0.4 0.4 0.4 lecithin 0.3 0.3 0.3 0.3 Sugar 20.0 15.0 10.0 7.5 fruit sugar 0.0 5.0 10.0 12.5 Total volume 7.2 7.2 7.2 7.2 coconut 4.4 4.4 4.4 4.4 weak flour 41.5 41.5 41.5 41.5 TOTAL 100.0 100.0 100.0 100.0

Test Example  1: Evaluation of moisture and water activity of cookies

Moisture refers to the water content contained in the food, and the moisture in the food is always fluctuating according to the surrounding environmental conditions, and indicates the water activity considering the relative humidity in the atmosphere. Water activity is a very important feature in food because it is related to the chemical, biophysical, and physical reactions in foods that change microbial growth and flavor, color, and flavor of food.

The moisture and water activity of the cookies prepared in Examples 1 to 4 and Comparative Examples 1 to 4 were evaluated in the following manner. Water activity is an intrinsic property of food, and equilibrium relative humidity is a property in an environment that equilibrates with food. The moisture content (%) in the cookies was calculated by measuring the loss of moisture in the cookware at 125 ° C for 10 minutes using a moisture meter and using the following equation.

[Equation 1]

Water content (%) = Weight of water (g) / Weight of sample (g) x 100

Weight of water (g) = Weight of sample before drying (g) - Weight of sample after drying (g)

The water activity in the cookie is calculated according to the following formula, and the value can be easily obtained by using a moisture activity meter.

Aw = P / P1

Where Aw = water activity,

P = water vapor pressure of the food at an arbitrary temperature

P1 = vapor pressure of pure water at any temperature

The water activity meter used was manufactured by Decagon Device. Inc (USA) model Aqualab Series 3TE.

Raw material moisture(%) Water activity Comparative Example 1 5.82 0.41 Comparative Example 2 7.11 0.462 Comparative Example 3 8.13 0.471 Comparative Example 4 8.27 0.485 Example 1 8.30 0.487 Example 2 8.42 0.497 Example 3 10.95 0.503 Example 4 12.02 0.519

As shown in the results of Table 4, in the case of Examples 1 to 4, as compared with Comparative Example 1 using only sugar and Comparative Examples 2 to 4, which are mixtures of sugar and fructose, moisture content and water activity Of the total population. The results of this experiment show that the sauces-containing dough and cookies according to the present invention show superior moisturizing effect compared with sugar, and that the sauces have better results in promoting the softness of cookies than sugar. Therefore, in Example 4, which contains no sugar but only psicose, it showed superior results in moisturizing property and texture compared with the comparative example including sugar and fructose.

Test Example  2: Color evaluation of cookies

The color values of the cookies prepared in Examples 1 to 4 and the cookies prepared in Comparative Example 1 (using only sugar) and Comparative Example 3 (using sugar and fructose mixed) were measured with a colorimeter (CM-3500d, Konica Minolta, Osaka, Japan ). L value indicating lightness, a value indicating redness and b value indicating yellowness were measured. At this time, the L value of the color standard plate was 98.07, the a value was 0.63, and the b value was 0.47. The measured chromaticities are shown in Table 5 below.

division L a b Comparative Example 1 70.34 4.03 35.91 Comparative Example 3 64.35 9.64 37.45 Example 1 65.32 7.54 36.63 Example 2 62.22 10.84 37.56 Example 3 61.24 12.21 38.61 Example 4 59.36 13.33 40.49

From the results of Examples 1 to 4 in Table 5, the higher the content of the cytochrome, the lower the L value, which means that the browning reaction by heat becomes faster, and the a value is higher and the b value is also proportionally increased , Which means that the same color is achieved quickly. In the colors of baked cookies, the products containing the psicose of Examples 1 to 4, as compared with the sugar of Comparative Example 1, can obtain the target color more quickly. The composition for preparing cookies according to the present invention has a desired color quickly, which means that the baking time can be shortened and the moisture can be easily retained. Therefore, in the case of the cookies of the present invention, since the desired color of the cookie is rapidly realized, the baking time of the cookies is shortened, and the effect of increasing the moisture retention of the cookies is obtained.

Example  5: Saikos  Cookie production using syrup

Except that 25% of the psicose syrup produced in Production Example 1-2 was used instead of the psicose powder and ingredients were mixed in the ingredients and composition shown in Table 6 below to prepare soft cookies Was prepared.

In Example 5, 10% by weight of sugar and 10% by weight of biscuit syrup 25% (Brix 75) were used, but it was 2.5% in terms of the solid content of psicose syrup

The dough is prepared by mixing raw materials such as natural butter, sugar skimmed milk and purified salt into a mixer and mixing them for 2 minutes at high speed (rpm 120). After mixing the liquid raw material such as psicose syrup, The mixture was mixed with wheat flour and coconut, and kneaded at a low speed (rpm 50) for 2 minutes to prepare a dough.

The cooked dough was molded by a molding machine called Rotary Depositioner to a thickness of about 20 g, placed on a steel band (baking frame), set at 200 ° C. under 180 ° C. in an electric oven for about 10 minutes Baked.

Raw material (unit:% by weight) Example 5 Natural butter 23.0 Skim milk powder 2.0 Purified salt 0.3 baking soda 0.9 Acid pyrophosphate
(SAPP) 0.4 lecithin 0.3 Sugar 10.0 Saikos 10.0 Total volume 7.2 coconut 4.4 weak flour 41.5 Sum 100

Test Example  3: Evaluation of color of baked cookies

The cookies prepared in Example 5 were evaluated in terms of chromaticity of the cookies in substantially the same manner as in Test Example 2 and shown in Table 7 below.

division Chromaticity (L) Chromaticity (a) Chromaticity (b) Comparative Example 1 70.34 4.03 35.91 Example 5 66.23 9.24 39.92

Test Example  4: Dough Aptitude

When the dough produced in Example 5 and the dough produced in Comparative Example 1 were molded in the rotary degausser, the dough becomes sticky to the molding machine, which means that the kneading property is poor. When the amount of dough sticking to the molding machine during the dough molding is measured, the moldability of the dough can be quantified and measured. The weight of the whole dough is measured before molding, the molding is completed using a molding machine, Thereafter, the amount of dough remaining in the molding machine was collected and the weight was measured and substituted for the following formula.

(%) = Weight of residual dough in molding machine (g) / weight of whole dough (g)

As a result, in Comparative Example 1, the residual dough amount (g) of the molding machine was 0.2 g, the residual dough amount (%) of the molding machine was 1%, the dough amount (g) ) Was 0.75%. Therefore, in Example 6 using sugar and psicose syrup, the dough loss in the molding machine was relatively low as compared with Comparative Example 1 in which sugar was used, and since the dough was not adhered to the molding machine, And it was found that the aptitude was excellent.

Test Example  5: Assessment of water and water activity

Water and moisture activity of the dough and cookies prepared in Example 5 were evaluated in substantially the same manner as in Test Example 1.

The product of Example 5 was found to have a water content of 8.3 wt% and a water activity of 0.492. It was confirmed that the product of Example 5 had a water content and water activity higher than that of Comparative Example 1 using only sugar in an amount of 5.82 wt%. Therefore, it was confirmed that the product of Example 6 had better moisture retention and texture than sugar.

Test Example  6: Sensory evaluation

In order to evaluate the moist feel, usability, flavor, shape, and sweetness of the cookies, the cookies of Examples 2, 4, and 5 and Comparative Examples 1 and 3 were placed in the mouth and the oral skin was evenly stimulated for 20 seconds After each sample was spit out, the mouth was washed with water each time the sample was evaluated. After 10 minutes had elapsed, the next sample was evaluated and the sensory elements were expressed on a 10-point box scale. The sensory evaluation staff consisted of 10 panel members who were trained on taste and flavor evaluation, and were rated on a 10-point scale. The evaluation criteria of the above items are as follows, and the results are shown in the following table.

[Evaluation standard]

Moist feeling: 0 points for no gentle feeling in the mouth, no hardness based on degree of hardness, and 10 points for the maximum value.

Usability: Based on the feeling of melting in the mouth, the lowest value is set to 0 point and the maximum value is set to 10.

Flavor: Based on the degree of high and low odor, it is set to 10 points with low degree of smell, high odor with zero point, high smell with maximum value and minimum odor value.

Geometry: It is set as minimum 0 point and maximum 10 point based on appearance preference.

Sweetness: Based on the level of sweetness, it is set as 0 point minimum and 10 point maximum.

division Moist feeling Usability zest shape sweetness Comparative Example 1 4.0 4.3 5.5 5.0 6.3 Comparative Example 3 7.1 7.2 6.3 6.0 6.9 Example 2 8.5 7.8 6.5 6.3 7.3 Example 4 9.3 8.9 7.2 6.8 7.5 Example 5 8.1 7.5 6.4 6.3 7.1

As shown in Table 8, as compared with the cookies of Comparative Examples 1 and 3, the product using the psicose showed excellent moist feel, usability, flavor, shape and sweetness of cookies.

<110> SAMYANG GENEX CORPORATION <120> Cookie with an improved quality and method of preparing same <130> DPP20146450KR <160> 9 <170> Kopatentin 1.71 <210> 1 <211> 356 <212> DNA <213> Artificial Sequence <220> The sod promoter (6) <400> 1 aagcgcctca tcagcggtaa ccatcacggg ttcgggtgcg aaaaaccatg ccataacagg 60 aatgttcctt tcgaaaattg aggaagcctt atgcccttca accctactta gctgccaatt 120 attccgggct tgtgacccgc tacccgataa ataggtcggc tgaaaaattt cgttgcaata 180 tcaacaaaaa ggcctatcat tgggaggtgt cgcaccaagt acttttgcga agcgccatct 240 gacggatttt caaaagatgt atatgctcgg tgcggaaacc tacgaaagga ttttttaccc 300 atggctgtat acgaactccc agaactcgac tacgcatacg acgaaaggat tacaaa 356 <210> 2 <211> 93 <212> DNA <213> Artificial Sequence <220> <223> The Tac1 promoter (4) <400> 2 tgacaattaa tcatcggctc gtatattgtg tggaattgtg agcggataac aatttcacac 60 aggaaacaga attcccgggg aaaggattac aaa 93 <210> 3 <211> 112 <212> DNA <213> Artificial Sequence <220> <223> The Tac2 promoter (4) <400> 3 tgacaattaa tcatccggct cgtataatgt taacaatttg tggaattgtg agcggacaca 60 caggaaacag accatggaat tcgagctcgg tacccgggga aaggattaca aa 112 <210> 4 <211> 30 <212> DNA <213> Artificial Sequence <220> The Trc promoter (1) <400> 4 tgacaattaa tcatcggcct cgtataatgt 30 <210> 5 <211> 7 <212> DNA <213> Artificial Sequence <220> <223> Ribosome binding region <400> 5 gaaagga 7 <210> 6 <211> 7 <212> DNA <213> Artificial Sequence <220> <223> Spacer sequence <400> 6 ttacaaa 7 <210> 7 <211> 289 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence of an enzyme protein originated from          Clostridium scindens <400> 7 Met Lys His Gly Ile Tyr Tyr Ala Tyr Trp Glu Gln Glu Trp Ala Ala   1 5 10 15 Asp Tyr Lys Arg Tyr Val Glu Lys Ala Ala Lys Leu Gly Phe Asp Ile              20 25 30 Leu Glu Val Gly Ala Ala Pro Leu Pro Asp Tyr Ser Ala Gln Glu Val          35 40 45 Lys Glu Leu Lys Lys Cys Ala Asp Asp Asn Gly Ile Gln Leu Thr Ala      50 55 60 Gly Tyr Gly Pro Ala Phe Asn His Asn Met Gly Ser Ser Asp Pro Lys  65 70 75 80 Ile Arg Glu Glu Ala Leu Gln Trp Tyr Lys Arg Leu Phe Glu Val Met                  85 90 95 Ala Gly Leu Asp Ile His Leu Ile Gly Gly Ala Leu Tyr Ser Tyr Trp             100 105 110 Pro Val Asp Phe Ala Thr Ala Asn Lys Glu Glu Asp Trp Lys His Ser         115 120 125 Val Glu Gly Met Gln Ile Leu Ala Pro Ile Ala Ser Gln Tyr Gly Ile     130 135 140 Asn Leu Gly Met Glu Val Leu Asn Arg Phe Glu Ser His Ile Leu Asn 145 150 155 160 Thr Ser Glu Glu Gly Val Lys Phe Val Thr Glu Val Gly Met Asp Asn                 165 170 175 Val Lys Val Met Leu Asp Thr Phe His Met Asn Ile Glu Glu Ser Ser             180 185 190 Ile Gly Asp Ala Ile Arg His Ala Gly Lys Leu Leu Gly His Phe His         195 200 205 Thr Gly Glu Cys Asn Arg Met Val Pro Gly Lys Gly Arg Thr Pro Trp     210 215 220 Arg Glu Ile Gly Asp Ala Leu Arg Glu Ile Glu Tyr Asp Gly Thr Val 225 230 235 240 Val Met Glu Pro Phe Val Arg Met Gly Gly Gln Val Gly Ser Asp Ile                 245 250 255 Lys Val Trp Arg Asp Ile Ser Lys Gly Ala Gly Glu Asp Arg Leu Asp             260 265 270 Glu Asp Ala Arg Arg Ala Val Glu Phe Gln Arg Tyr Met Leu Glu Trp         275 280 285 Lys     <210> 8 <211> 870 <212> DNA <213> Artificial Sequence <220> Modified nucleic acid sequence (1) of the enzyme protein of SEQ          ID NO: 7 <400> 8 atgaaacacg gtatctacta cgcgtactgg gaacaggaat gggcggcgga ctacaaacgt 60 tacgttgaaa aagcggcgaa actgggtttc gacatcctgg aagttggtgc ggcgccgctg 120 ccggactact ctgcgcagga agttaaagaa ctgaaaaaat gcgcggacga caacggtatc 180 cagctgaccg cgggttacgg tccggcgttc aaccacaaca tgggttcttc tgacccgaaa 240 atccgtgaag aagcgctgca gtggtacaaa cgtctgttcg aagttatggc gggtctggac 300 atccacctga tcggtggtgc gctgtactct tactggccgg ttgacttcgc gaccgcgaac 360 aaagaagaag actggaaaca ctctgttgaa ggtatgcaga tcctggcgcc gatcgcgtct 420 cagtacggta tcaacctggg tatggaagtt ctgaaccgtt tcgaatctca catcctgaac 480 acctctgaag aaggtgttaa attcgttacc gaagttggta tggacaacgt taaagttatg 540 ctggacacct tccacatgaa catcgaagaa tcttctatcg gtgacgcgat ccgtcacgcg 600 ggtaaactgc tgggtcactt ccacaccggt gaatgcaacc gtatggttcc gggtaaaggt 660 cgtaccccgt ggcgtgaaat cggtgacgcg ctgcgtgaaa tcgaatacga cggtaccgtt 720 gttatggaac cgttcgttcg tatgggtggt caggttggtt ctgacatcaa agtttggcgt 780 gacatctcta aaggtgcggg tgaagaccgt ctggacgaag acgcgcgtcg tgcggttgaa 840 ttccagcgtt acatgctgga atggaaataa 870 <210> 9 <211> 870 <212> DNA <213> Artificial Sequence <220> Modified nucleic acid sequence (2) of the enzyme protein of SEQ ID          NO: 7 <400> 9 atgaagcacg gcatctacta cgcatactgg gagcaggagt gggcagcaga ctacaagcgc 60 tacgttgaga aggcagcaaa gctgggcttc gacatcctgg aggttggcgc agcaccactg 120 ccagactact ccgcacagga ggttaaggag ctgaagaagt gcgcagacga caacggcatc 180 cagctgaccg caggctacgg cccagcattc aaccacaaca tgggctcctc cgacccaaag 240 atccgcgagg aggcactgca gtggtacaag cgcctgttcg aggttatggc aggcctggac 300 atccacctga tcggcggcgc actgtactcc tactggccag ttgacttcgc aaccgcaaac 360 aaggaggagg actggaagca ctccgttgag ggcatgcaga tcctggcacc aatcgcatcc 420 cagtacggca tcaacctggg catggaggtt ctgaaccgct tcgagtccca catcctgaac 480 acctccgagg agggcgttaa gttcgttacc gaggttggca tggacaacgt taaggttatg 540 ctggacacct tccacatgaa catcgaggag tcctccatcg gcgacgcaat ccgccacgca 600 ggcaagctgc tgggccactt ccacaccggc gagtgcaacc gcatggttcc aggcaagggc 660 cgcaccccat ggcgcgagat cggcgacgca ctgcgcgaga tcgagtacga cggcaccgtt 720 gttatggagc cattcgttcg catgggcggc caggttggct ccgacatcaa ggtttggcgc 780 gacatctcca agggcgcagg cgaggaccgc ctggacgagg acgcacgccg cgcagttgag 840 ttccagcgct acatgctgga gtggaagtaa 870

Claims (18)

A composition for preparing a cookie comprising wheat flour, edible fats and saccharides, wherein the saccharide comprises psicose. The composition of claim 1, wherein the composition has a Psicos solid content of 2 to 50 parts by weight based on 100 parts by weight of the total solids content of the composition. The composition according to claim 1, wherein the saccharide comprises psicose and further comprises at least one saccharide selected from the group consisting of sugar, fructose, and syrup. The composition of claim 1, wherein the psicose is added in powder or liquid form. [Claim 2] The method according to claim 1, wherein the cyclosporin is contained in an amount of 1 to 99.9 parts by weight, based on 100 parts by weight of the total solid content of the mixed sugar, and further contains at least one saccharide selected from the group consisting of fructose, glucose and oligosaccharide / RTI &gt; 6. The composition according to claim 5, wherein the Saicos is from about 2 to about 55 parts by weight, about 30 to about 80 parts by weight of fructose, and from about 2 to about 60 parts by weight of glucose, based on 100 parts by weight of the total solids content of the mixed sugar. 2. The composition of claim 1, wherein the composition further comprises a whole egg, egg white or egg yolk. 2. The composition of claim 1, wherein the soft cookie comprises a total sum of edible fats and saccharides of at least 40% by weight, whichever is 100% by weight of the total solids content of the composition. The composition according to claim 1, which is a molded cookie prepared by compounding, molding and firing the composition for cookie-making. The composition according to claim 1, wherein the composition comprises 30 to 60 parts by weight of wheat flour, 10 to 30 parts by weight of edible oil, and 3 to 20 parts by weight of egg, based on 100 parts by weight of the total solid content of the composition. The composition according to claim 1, wherein the composition further comprises at least one starch selected from the group consisting of wheat starch, potato starch, corn starch, sweet potato starch, and modified starch. The composition of claim 1, wherein the composition further comprises at least one component selected from the group consisting of an emulsifier, an indigestible dextrin, a protein powder, a vitamin, a mineral, a salt, a swelling agent, an emulsifier, a flavoring agent, and a coconut. The composition according to claim 1, wherein the wheat flour is at least one selected from the group consisting of force, gravity, strength, millability, and a mixture thereof. The composition according to claim 1, wherein the edible oil is at least one selected from the group consisting of vegetable oil, animal oil, margarine, butter, shortening, and mixtures thereof. A kneaded product for producing cookies, which is prepared by uniformly blending and firing a composition for preparing cookies according to any one of claims 1 to 14. 16. The kneading composition for cookies according to claim 15, wherein the kneaded product for producing cookies is a kneaded product having a residual amount of kneaded batter (%) of 5% by weight or less based on 100% by weight of the kneaded product. A molded cookie obtained by molding and baking a kneaded product produced by uniformly moving a composition for preparing cookies according to any one of claims 1 to 14. The molded cookie according to claim 17, wherein the moisture content of the cookie is 8.3% to 20% and the moisture activity is 0.45 to 0.9.

Images