KR20160047870A - Improved production of isoprenoids by metabolosome construction - Google Patents

Abstract

The present invention relates to an expression vector for constructing a sequential metabolic pathway enzyme complex using a retrotransposon gene derived from Saccharomyces cerevisiae, in particular, an expression vector for constructing a sequential metabolic pathway enzyme complex producing isoprenoid including an equential metabolic pathway enzyme complex for producing isoprenoid; and a recombinant strain transformed with the expression vector for constructing a sequential metabolic pathway enzyme complex for producing isoprenoid or a recombinant strain for producing isoprenoid which expresses an enzyme for synthesizing farnesyl pyrophosphate and a synthesizing enzyme for synthesizing isoprenoid. Further, the present invention relates to a method for producing isoprenoid including the step of culturing the recombinant strain. In the present invention, a metabolome is constructed by using Ty1, which is a retrotransposon derived from a yeast and forms virus-like particles which have the limelight for a vaccine for overproduction of isoprenoid. By using the strategy, an expression vector and a recombinant strain having excellent ability to produce various isoprenoids can be prepared, and also isoprenoid can be produced at a high efficiency by using the expression vector and the recombinant strain. Thus, the present invention is expected to be widely used in corresponding fields.

Description

Improved production of isoprenoids by metabolosome construction by constructing a continuous metabolic pathway assembly [

The present invention relates to the use of Saccharomyces cerevisiae an expression vector for constructing a continuous metabolic pathway enzyme assembly using the retroviscosity-derived retroviral vector, an expression vector for constructing a continuous metabolic pathway enzyme assembly using the cerevisiae- derived retrotransposon gene, in particular an expression vector for constructing an isoprenoid-producing continuous metabolic pathway enzyme assembly comprising a continuous metabolic pathway enzyme assembly for producing isoprenoid, An enzyme for synthesizing a recombinant strain transformed with an expression vector for constructing a continuous metabolic pathway enzyme assembly or a pyrethroid pyrophosphate; And a synthetic enzyme for synthesizing an isoprenoid. The present invention also relates to a recombinant strain for producing isoprenoid. The present invention also relates to a method for producing isoprenoid comprising culturing the recombinant strain.

In a continuous enzyme reaction that constitutes a series of metabolic pathways, the so-called "substrate channeling" through which a product of a reaction spreads to the surrounding environment and is immediately used as a substrate for the next reaction without being diluted It is known that the productivity efficiency is greatly improved. In the case of two consecutive reactions, it is known that such effects can be obtained through fusion of two enzymes. However, in the case of a metabolic pathway composed of a plurality of successive reactions, there is a limit to simply using a method of fusing two enzymes.

Recently, the use of protein domains (scaffolds) that can achieve structural aggregation of these proteins has been increasing with the development of synthetic biology (Lee H. et al., Metabolic Engineering 14: 242-251 (2012) Nature Chem Biol 8: 527-535, (2012)).

Virus-like particles have been actively studied in the field of vaccines. Virus-like particles are similar to viruses, but do not carry infection because they do not have viral genetic material. It is known that virus-like particles can self-assemble with viral structural proteins such as Envolope or Capsid.

Recently, virus-like particles have been expanded from various virus species such as Parvoviridae, Retroviridae, and Flaviviridae. It is also produced by various cell culture systems ranging from animal cells, plant cells, insect cells and yeast. Typically, virus-like particles derived from Hepatitis B and human papillomavirus are approved by the US Food and Drug Administration (FDA) for use as a vaccine. In addition, there have been cases in which vaccines against chitinoguania virus distributed in Africa and Southeast Asia have been developed using virus-like particles (Akahata W. et al., Nat. Med. 16 (3): 334-338 (2010)).

However, in the field of microbial metabolism engineering, there has not been much research on the application of virus-like particles. Therefore, the present inventors selected Tya protein of Ty1 gene, which is known to form virus-like particles in yeast, and used it in the present invention.

On the other hand, isoprenoids are generically referred to as compounds produced by chain condensation of isopentenyl pyrophosphate (IPP) and dimethylated pyrophosphate (DMAPP), which are C5 starting materials. Isoprenoid compounds are usually present in a minor amount in the natural world, and microbial metabolism engineering techniques for producing them in large quantities have been actively conducted recently (Tokuhiro K. et al., Appl. Environ. Microbiol. 75 (17): 5536-43 (2009) , Ohto C. et al., Appl. Microbiol. Biotechnol. 82 (5): 837-845 (2009)).

In particular, C10, C15, and C20 isoprenoid compounds as biofuel to replace gasoline and diesel oil are beginning to be developed as hydrocarbon fuels. Ethanol, which is a representative example of biofuels for replacing fossil fuels, is mainly produced mainly from the United States, and corn starch and Brazil from sugar cane are being produced as raw materials. This causes a side effect of reducing food consumption and causes a global problem of a surge in agricultural product prices And it is known that the effect of CO2 reduction is minimal, unlike originally expected. In addition, ethanol has a lower energy content than gasoline, is corrosive and has a high hygroscopicity, which damages engines and pipelines, makes storage and transportation difficult, and requires a lot of energy for purification.

In recent years, there is a growing need to develop a technology that can produce hydrocarbons with sustainable biological methods that are closer to fuels such as gasoline (C4-C12) and diesel (C9-C23) as next-generation fuels.

Hydrogen compounds such as isoprenol (parnesol, parmesin, squalene, etc.), which can be produced by a biological method, are biosynthesized from acetyl CoA as an isoprenoid compound in the metabolic pathway in Saccharomyces cerevisiae strain This is possible. In order to produce isoprenoids with high efficiency, isopentenyl pyrophosphate (IPP), which is a basic starting material, is the essential intermediate of all isoprenoid compound biosynthesis. About 7 genes including HMG-CoA reductase, which is most important for biosynthesis of DMAPP (dimethylallyl pyrophosphate) And the genes involved in the biosynthesis of isoprenoid biocompounds such as farnesol and farnesene from intermediates, and the construction of metabolic circuits composed of various genes such as FPP (farnesyl pyrophosphate) synthase (ispA, Erg20) The development of techniques for the construction of the metabolosome for the sophisticated and combinatorial expression of these proteins is needed.

Under the circumstances described above, the present inventor has made efforts to construct a metabolosome for efficient production of isoprenoids in Saccharomyces cerevisiae strain. As a result, Saccharomyces cerevisiae The present inventors have confirmed that a continuous metabolic pathway assembly using a retrovirus gene derived from S. cerevisiae can be produced and that the synthesis of IPP and DMAPP, which are precursors of all isoprenoid biosynthesis, and FPP, a biosynthetic precursor of many sesquiterpenoid compounds, The present invention has been completed by constructing a continuous metabolic pathway enzyme assembly which can be universally used for the production of other isoprenoids.

One object of the present invention is to provide an expression vector for constructing a continuous metabolic pathway enzyme assembly using a retrotransposon gene derived from Saccharomyces cerevisiae . In particular, the present invention provides an expression vector for constructing an isoprenoid-producing continuous metabolic pathway enzyme aggregate.

It is another object of the present invention to provide a recombinant Saccharomyces cerevisiae strain for producing isoprenoid transformed with an expression vector for constructing the isoprenoid-producing continuous metabolic pathway enzyme aggregate.

Another object of the present invention is to provide an enzyme for synthesizing panesyl pyrophosphate; And a synthetic enzyme for synthesizing an isoprenoid. The present invention also provides a recombinant Saccharomyces cerevisiae strain for producing isoprenoid.

It is still another object of the present invention to provide a method for producing isoprenoid, comprising culturing the recombinant strain.

In one aspect, the present invention provides a method for producing Saccharomyces cerevisiae cerevisiae) provides a continuous pathway enzyme aggregates constructed expression vector using a retrotransposon-derived genes. More specifically, the present invention relates to a method for producing Saccharomyces cerevisiae cerevisiae- derived retrotransposon gene; And a gene of a continuous metabolic pathway that produces a desired metabolite. The present invention also provides an expression vector for constructing a continuous metabolic pathway assembly.

The present inventors constructed a continuous metabolic pathway enzyme aggregate comprising two or more genes involved in the continuous metabolic pathway using the retro-transposon gene derived from Saccharomyces cerevisiae, thereby improving the efficiency of the metabolic pathway, The results of this study are as follows. In particular, the target metabolite in the present invention may be isoprenoid, and the continuous metabolic pathway may also be an isoprenoid production metabolic pathway. However, the continuous metabolic pathway constructed using the retrotransposon gene derived from Saccharomyces cerevisiae of the present invention Is not limited as long as it is a continuous metabolic pathway capable of constituting pathway enzyme aggregates.

In one specific embodiment of the present invention, in order to construct an enzyme aggregate for an isoprenoid production metabolic pathway, in particular, a metabolic pathway for producing parnesyl and parnesol, a gene encoding farnesyl pyrophosphate synthase (ispA) gene , Hydroxymethylglutaryl CoA reductase 1 (HMG1) gene, diacylglycerol pyrophosphate phosphatase 1 (DPP1) or farnesene synthase (FS) and saccharomyces cerevisiae An expression vector for construction of an isoprenoid-producing continuous metabolic pathway assembly constructing isoprenoid-producing enzyme aggregates was prepared using Tya and Ty1 genes derived from Shia-derived retrotransposons.

Particularly, the present invention provides an expression vector for constructing an isoprenoid-producing continuous metabolic pathway enzyme aggregate. An enzyme gene which specifically synthesizes fenesyl pyrophosphate; A synthetic enzyme gene that synthesizes an isoprenoid; And an expression vector for constructing an isoprenoid production continuous metabolic pathway enzyme assembly comprising a retrotransposon gene, and in particular, to provide an expression vector for i) an enzyme for synthesizing fenesyl pyrophosphate (FPP), fenesyl pyrophosphate synthase a farnesyl pyrophosphate synthase (ispA) gene and a hydroxymethylglutaryl CoA reductase 1 (HMG1) gene; ii) a synthetic enzyme gene which synthesizes isoprenoid using fenesyl pyrophosphate as a precursor; And iii) a retrotransposon gene. The present invention also provides an expression vector for constructing an isoprenoid-producing continuous metabolic pathway assembly.

The term "isoprenoid " of the present invention refers to an organic compound consisting of two or more monomers in which five carbon atoms are arranged in a peculiar form. Particularly, C5 starting material IPP (isopentenyl pyrophosphate) and DMAPP (dimethylallyl pyrophosphate) Refers to compounds produced by sequential condensation of about 50,000 or more compounds. In the present invention, isoprenoids may be sesquiterpenoid compounds that are biosynthesized from farnesyl pyrophosphate (FPP), fannesol, parnesin and squalene, which are triterpenoid compounds. However, the present invention is not limited thereto and effective for biosynthesis of many isoprenoids Lt; / RTI >

In the present invention, the synthetic enzyme for synthesizing isoprenoid includes all the enzymes for synthesizing the various isoprenoids described above. In particular, it may be a synthetic enzyme for synthesizing isoprenoid by using panesyl pyrophosphate as a precursor. Synthetic enzymes for synthesizing the isoprenoids of the present invention include, for example, squalene synthase (Erg9), diacylglycerol pyrophosphate phosphatase 1 (DPP1), farnesene synthase (FS) But is not limited thereto.

The expression vector for isoprenoid production of the present invention may contain a gene of a synthetic enzyme for synthesizing the isoprenoid, which may be a gene encoding a squalene synthetase (Erg9) gene, a parnesol synthase (DPP1) gene, a parnesin synthase FS) gene, but are not limited thereto.

The term " farnesyl pyrophosphate (FPP) "of the present invention, also called farnesyl diphosphate (FDP), refers to biosynthesis of terpenes, terpenoids, sterols, Is an intermediate of the HMG-CoA reductase pathway. In the present invention, fenesyl pyrophosphate can be used as a precursor for synthesizing isoprenoids, and thus can be used as a substrate for a synthetic enzyme for synthesizing isoprenoids. The panesyl pyrophosphate of the present invention can be synthesized from farnesyl pyrophosphate synthase (ispA or Erg20).

The fenesyl pyrophosphate synthase of the present invention is an enzyme that mediates Geranyl-PP from Isopentenyl-5-PP and Farnesyl-PP from Geranyl-PP. In the present invention, the fenesyl pyrophosphate synthase produces isoprenoid The action mediated in FIG. 2 is illustrated in FIG. The expression vector for producing isoprenoid of the present invention may include the gene of the above-mentioned panesyl pyrophosphate synthase, which may be ispA / Erg20 but is not limited thereto.

The term "hydroxymethylglutaryl CoA (HMG-CoA)" of the present invention is a precursor of various steroids or terpene biosynthesis including cholesterol. It is involved in ketone metabolism and steroid or terpene biosynthetic metabolism. That is, HMG-CoA is a compound of a steroid biosynthetic system and a ketone metabolism branching point. The HMG-CoA reductase of the present invention is an important rate-controlling enzyme in the cholesterol biosynthesis system.

The expression vector for isoprenoid production of the present invention may contain the gene of HMG-CoA reductase, which may be hydroxymethyl glutaryl CoA reductase 1 (HMG1) It is not limited.

The term "retrotransposon" of the present invention is a dislocation factor having a property of moving in the genome using RNA as a transcriptional transposon DNA transcript. Generally, there are long terminal repeats (LTRs) on both sides, and they can be propagated through reverse transcription. Typically, after trans-transposon DNA is transcribed into mRNA, a new dsDNA is made through a reverse transcriptase and then moved through a mechanism inserted at another position in the genome. The retrotransposon of the present invention may be Tya (Transposons of yeast element a, Tya) or Ty1 (Transposons of yeast element, Ty1) derived from Saccharomyces cerevisiae, and the nucleic acid sequence of SEQ ID NO: 24 . ≪ / RTI > In the present invention, retrotransposons can be expressed and linked to enzymes and function to constitute a structural aggregate of enzymes.

In a specific embodiment of the present invention, the expression vector for producing isoprenoid includes farnesyl pyrophosphate synthase (ispA) gene and hydroxymethylglutaryl CoA reductase 1 (HMG1) gene (DPP1) gene or a parnesin synthase (FS) gene of a synthetic enzyme that synthesizes isoprenoids. In addition, a retro-transposon gene (Ty1 or Tya) was introduced.

The present invention relates to a method for constructing a strain capable of overproducing an isoprenoid compound, which is an enormous group of physiologically active substances, using Ty1 or Tya, which is a retrotransposon derived from yeast. In a specific embodiment of the present invention, Cloning a yeast-derived retrotransposon Ty1 or Tya and a key gene for isoprenoid synthesis into a yeast expression vector; 2) introducing the fusion expression vector constructed in step 1 into Saccharomyces cerevisiae strain, which is a yeast strain, and culturing; 3) analyzing the isoprenoid compound produced through Step 2 by using gas chromatography; 4) Based on the above step 2, a metabolosome for production of isoprenoid and its production was produced in a strain of Saccharomyces cerevisiae including a culture stage using a 5L laboratory scale fermenter to examine the accurate productivity of isoprenoid and production strain Respectively.

As used herein, the term "vector" refers to an expression vector capable of expressing a desired protein in a suitable host cell, including a necessary regulatory element operably linked to the expression of the gene insert.

The operative linkage with the recombinant vector can be produced using genetic recombination techniques well known in the art, and site-specific DNA cleavage and linkage are made using enzymes generally known in the art.

The vector of the present invention may include a signal sequence or a leader sequence for membrane targeting or secretion in addition to an expression regulatory element such as a promoter, an operator, an initiation codon, a stop codon, a polyadenylation signal, an enhancer, and the like. The promoter of the vector may be constitutive or inducible. In addition, the expression vector includes a selectable marker for selecting a host cell containing the vector, and includes a replication origin in the case of a replicable expression vector. The vector may be self-replicating or integrated into the host DNA. The vector may include a plasmid vector, a cosmid vector, a viral vector, and the like, and any vector known in the art capable of expressing the gene of interest in the yeast host cell may be used without limitation.

The term "operably linked" in the present invention means that when one nucleic acid fragment is combined with another nucleic acid fragment, its function or expression is affected by other nucleic acid fragments, Means a combination of states in which a fragment has no detectable effect in performing its function. That is, the nucleic acid expression control sequence and the nucleic acid sequence encoding the desired protein are functionally linked to perform a general function. In addition, the expression cassette of the present invention may further comprise any transcription initiation regulatory sequence and transcription termination regulatory sequence for regulating transcription. Operable linkages can be produced using genetic recombination techniques well known in the art, and site-specific DNA cleavage and linkage can be performed using enzymes generally known in the art.

As used herein, the term "introduction" means introducing foreign DNA into a cell by transformation or transduction. The transformation was carried out by the CaCl ₂ precipitation method, the Hanahan method which increased the efficiency by using a reducing material called DMSO (dimethyl sulfoxide) in the CaCl ₂ method, the electroporation method, the calcium phosphate precipitation method, the protoplast fusion method, Agrobacterium-mediated transformation, transforming with PEG, dextran sulfate, lipofectamine, and drying / inhibition-mediated transformation methods, which are well known in the art. Transfection refers to the transfer of genes into cells using virus or viral vector particles as a means of infection.

The expression vector for constructing an isoflonate-producing continuous metabolic pathway enzyme assembly of the present invention is prepared from the group consisting of the above-described panesyl pyrophosphate synthase gene, hydroxymethylglutaryl CoA reductase gene and synthetic enzyme gene for synthesizing isoprenoid And one or more genes selected from the group consisting of the phenesyl pyrophosphate synthase gene, the hydroxymethylglutaryl CoA reductase gene and the synthetic enzyme gene which synthesizes isoprenoid may be one in which the selected one or more genes are linked to the retrotransposon gene The linkage between the above genes and the retrotransposon gene may be linked through a linker gene. In the present invention, the linker gene may be composed of the nucleic acid sequence of SEQ ID NO: 26.

In one specific embodiment of the present invention, an expression vector was constructed in which Ty1 was linked to HMG1, DPP1, or 3 'or 5' of any one or more of FS and ispA. Specifically, pGal-HMG1 / Ty1LDPP1 / Ty1LispA, pGal-HMG1 / DPP1LTy1 / ispALTy1, pGal-Ty1LHMG1 / Ty1LDPP1 / ispALTy1, pGal-HMG1LTy1 / Ty1LDPP1 / ispALTy1, pGal-HMG1 / Ty1LFS / Ty1LispA, pGal-HMG1 / FSLTy1 / , pGal-Ty1LHMG1 / FSLTy1 / ispALTy1 and pGal-HMG1LTy1 / FSLTy1 / ispALTy1 (FIGS. 3 and 4).

In another aspect, the present invention provides a recombinant strain for producing isoprenoid, which is transformed with an expression vector for constructing the isoprenoid-producing continuous metabolic pathway enzyme aggregate.

Specifically, the recombinant strains for producing isoprenoids of the present invention include i) farnesyl pyrophosphate synthase (ispA), an enzyme for synthesizing farnesyl pyrophosphate (FPP), and hydroxymethylglutaryl CoA reductase (Hydroxymethyl glutaryl CoA reductase 1, HMG1); And ii) a synthetic enzyme which synthesizes isoprenoid using fenesyl pyrophosphate as a precursor.

Particularly, i) farnesyl pyrophosphate synthase (ispA) and hydroxymethyl glutaryl CoA reductase 1 (HMG1), an enzyme which synthesizes farnesyl pyrophosphate (FPP) ); And ii) a synthesizing enzyme which synthesizes isoprenoid by using panesyl pyrophosphate as a precursor, and iii) synthesizing said phenesyl pyrophosphate synthase, hydroxymethylglutaryl CoA reductase and isoprenoid And a recombinant strain of Saccharomyces cerevisiae for production of isoprenoid, which is characterized in that retrotransposon is linked to at least one enzyme selected from the group consisting of synthetic enzymes. Particularly, the present invention relates to a method for producing isoprenoid, which comprises expressing a recombinant protein comprising the fenesyl pyrophosphate synthase, the hydroxymethylglutaryl CoA reductase and the synthetic enzyme synthesizing isoprenoid, Lt; / RTI > recombinant strain.

In the present invention, the isoprenoid, isoprenoid synthase, fenesyl pyrophosphate, its synthetic enzyme, hydroxymethylglutaryl CoA and its reducing enzyme are as described above.

In the present invention, the strain may be a strain capable of producing isoprenoids, particularly Saccharomyces cerevisiae cerevisiae ).

Saccharomyces cerevisiae is a representative species of yeast and is the most common among eukaryotes. Its genomic sequence has also been identified, making it very easy to manipulate genes. In addition, it is widely used for various fermentation, and it is known that fermentation of alcohol is particularly excellent. It is already known that Saccharomyces cerevisiae produces isoprenoid compounds such as ergosterol and squalene, which are suitable as host cells of synthetic biology for the production of isoprenoids.

In one embodiment of the present invention, a host cell for efficient isoprenoid production is Saccharomyces cerevisiae S. cerevisiae strain was used. Specifically, recombinant yeast strains Y2805 pGal-Ty1LDPP1 / HMG1 / Ty1LispA, Y2805 pGal-DPP1LTy1 / HMG1 / ispALTy1, Y2805 Ty1LDPP1 / Ty1LHMG1 / ispALTy1, Y2805 Ty1LDPP1 / HMG1LTy1 / ispALTy1 and Y200589 pGal- Ty1LDPP1 / In this study, Y2805 DPP1 / HMG1 / ispA, which expresses the genes DPP1 and ispA and HMG1, respectively, as a control, was constructed as a control. Y200589 DPP1 / HMG1 / ispA was used, and Y2805 ispALDPP1 / HMG1 and Y200589 ispALDPP1 / HMG1 in which DPP1 and ispA were linked by linker (Linker, SEQ ID NO: 25) In addition, recombinant yeast strains producing parnesin, Y2805 pGal-Ty1LFS / HMG1 / Ty1LispA, Y2805 pGal-FSLTy1 / HMG1 / ispALTy1, Y2805 FSLTy1 / Ty1LHMG1 / ispALTy1, Y2805 FSLTy1 / HMG1LTy1 / ispALTy1 and Y200589 pGal- Ty1LFS / HMG1 / , Y200589 pGal-FSLTy1 / HMG1 / ispALTy1, Y200589 FSLTy1 / Ty1LHMG1 / ispALTy1 and Y200589 FSLTy1 / HMG1LTy1 / ispALTy1 were constructed, and as a control, Y2805 FS / HMG1 / ispA and Y200589 Y2805 ispALFS / HMG1 and Y200589 ispALFS / HMG1 were used, in which FS / HMG1 / ispA was used and FS and ispA were linked by a linker (Linker, SEQ ID NO: 25).

In another aspect, the present invention provides a method for producing isoprenoid, comprising culturing a recombinant strain for producing isoprenoid.

The recombinant strains for producing isoprenoids of the present invention can be cultured by culturing a variety of strains known in the art. As an example of the culture, the cells are firstly cultured using UD medium, and then YPDG (1% glucose , 1% galactose) medium, but the culture method is not limited by the above method. Accumulated isoprenoids can also be obtained using conventional separation and extraction methods.

In one specific embodiment of the present invention, the culture is divided into an initial culture and a main culture, and UD medium is used for the initial culture. UD medium contained 0.67% Yeast Nitrogen Base W / O Amino Acids, 0.077% Ura Drop Out Supplement Base, and 2% Glucose. A single colony was inoculated in 3 mL of UD medium and incubated at 30 ° C. and 180 rpm for 24 hours. In the present culture, 25 mL of YPDG medium was dispensed into a 250 mL baffled flask, and the initial cultured strain was inoculated to an OD of 0.1. The YPDG medium used was a medium supplemented with 2% peptone, 1% yeast extract, 1% glucose and 1% galactose. 5 mL of dodecane (Sigma Aldrich Co., USA) was added to efficiently harvest parnesol and parnesin produced during culturing, followed by culturing at 30 DEG C and 180 rpm for 72 hours with stirring. To analyze the parnesol and parnesin collected in the dodecane layer, the productivity was measured by centrifugation.

In one specific embodiment of the present invention, among all the various recombinant strains transformed with the expression vector containing the DPP1 gene so as to produce the parnesol of the present invention, when all the genes introduced into the expression vector are individually expressed by Ty1 fusion expression, It was confirmed that the productivity was about 4.5 times as high as that of the control pGal-DPP1 / HMG1 / ispA (FIG. 5). In addition, among various recombinant strains transformed with the expression vector containing the FS gene so as to produce the parnesic of the present invention, all the genes introduced into the expression vector were separately expressed in the case of Tyl fusion, and the control pGal-FS / HMG1 / and was about 12 times more productive than ispA (Fig. 6).

Furthermore, it was confirmed that even when the strain was cultured using a 5 L fermenter, the production of parnesol and / or parmesin was excellent (FIGS. 7 and 8).

The present invention has constructed a metabolosome using Ty1, a yeast-derived retrotransposon that forms virus-like particles that are attracted to isoprenoids and vaccines for production, It is possible to produce an expression vector and a recombinant strain having excellent productivity against the phenoid, and it is expected that the isoprenoid can be produced with high efficiency by using it and widely used in the technical field.

BRIEF DESCRIPTION OF THE DRAWINGS FIG. 1 is a diagram showing a module mechanism for a substrate channel using retrotransposons (Tya or Ty1) derived from Saccharomyces cerevisiae for constructing a continuous metabolite. 1 is an image for PGOG1 (phosphoglycerate kinase 1) fused with a pOGS40 vector and Tya formed therefrom, and B in Fig. 1 is an image for PGK1 and X fused with pOGS40-X vector and Tya formed therefrom to be.
FIG. 2 is a diagram showing a metabolic pathway for production of isoprenoid in Saccharomyces cerevisiae.
Figure 3 is a schematic diagram of a fusion expression vector constructed for parnesol production. Specifically, parnesol of pGal-DPP1 / HMG1 / ispA, pGal-ispLDPP1 / HMG1, pGal-Ty1LDPP1 / HMG1 / Ty1LispA, pGal- DPP1LTy1 / HMG1 / ispALTy1, pGal- Ty1LDPP1 / Ty1LHMG1 / ispALTy1 and pGal- Ty1LDPP1 / HMG1LTy1 / ispALTy1 A fusion expression vector for production.
Figure 4 is a schematic diagram of a fusion expression vector constructed for parnesin production. Specifically, parnethin of pGal-FS / HMGl / ispA, pGal-ispLFS / HMGl, pGal-Tyl LFS / HMGl / TylLispA, pGal-FSLTyl / HMGl / ispALTyl, pGal- FSLTyl / TylLHMGl / ispALTyl and pGal- FSLTyl / HMGlLTyl / ispALTyl A fusion expression vector for production.
5 is a view of measuring the production and cell growth (OD ₆₀₀₎ of the recombinant yeast strain for Parr nesol production.
6 is a graph showing the productivity and cell growth rate (OD ₆₀₀ ) of recombinant yeast strains for parnesin production.
FIG. 7 is a time chart of fermentation using a 5 L fermenter of a recombinant yeast strain (200589 pGal-Ty1LDPP / HMG1LTy1 / ispALTy1) for production of parnesol. Specifically, the cell growth rate (OD ₆₀₀ ), the amount of glucose, the feeding rate, and the production of parnesol (g / L) were measured.
FIG. 8 is a time chart of fermentation using a 5 L fermenter of recombinant yeast strain (200589 pGal-FSLTy1 / HMG1LTy1 / ispALTy1) for parnesh production. Specifically, the cell growth rate (OD ₆₀₀ ), the amount of glucose, the feeding rate, and the production of parnesin (g / L) were measured.

Hereinafter, the present invention will be described in more detail with reference to examples. However, these examples are for illustrative purposes only, and the scope of the present invention is not limited to these examples.

The present inventors constructed a continuous metabolic pathway enzyme assembly comprising two or more genes involved in a continuous metabolic pathway using the retro-transposon gene derived from Saccharomyces cerevisiae, thereby enhancing the efficiency of the metabolic pathway, And to increase the productivity of the product. As a representative example, two consecutive metabolic pathways producing isoprenoids, namely, two consecutive metabolic pathways producing parnesesol and parnesin, which are isoprenoids, were selected and applied. This is illustrated by the following examples.

Example  One : Parnesol  Production of fusion expression vectors and transformants

1-1. Parnesol  The resulting fusion expression vector

The present inventors have attempted to produce a fusion expression vector that produces parnesol, a kind of isoprenoid, with high efficiency. The yeast - derived retrotransposon gene and the core gene for parnesol synthesis were fused and cloned into an expression vector for the construction of a metabolic domain.

Specifically, the enzymes ispA and FPP, which are the precursors of parnesol biosynthesis, which is a key step in the parnesol biosynthesis, the enzyme DPP1, which makes parnesol, hydroxymethyl glutaryl CoA reductase (HMG1), an enzyme biosynthesizing mevalonate from hydroxymethyl glutaryl CoA A gene that is a nucleic acid sequence encoding Ty1 (SEQ ID NO: 23), which is a yeast-derived retrotransposon for construction of the metabolosome, was obtained through Polymerase Chain Reaction (PCR).

The ispA gene is expressed by Escherichia coli ) chromosome as a template, and DPP1, HMG1 and Ty1 were obtained as a template of Saccharomyces cerevisiae dielectrics.

The polymerase chain reaction for gene synthesis was carried out at 98 ° C for 30 seconds using Phusion Hot Start II High-Fidelity DNA Polymerase (Thermofixi Scientific Inc., USA), and incubated at 98 ° C for 10 seconds, at 50 ° C The reaction was performed for 30 seconds at 72 ° C for 30 seconds and at a gene size of 1 kb to perform the cycle 25 times at the cycle (98 ° C for 10 seconds, 50 ° C for 30 seconds, 72 ° C for 30 seconds per 1 kb gene size) At 72 < [deg.] ≫ C for 5 minutes.

The genes amplified by the polymerase chain reaction were identified by sequencing. Ty1 gene was fused with the linker gene (SEQ ID NO: 26) at the N-terminal and C-terminal of each of DPP1 and ispA and HMG1 gene for the construction of the metabolosome using the Ty1 gene.

The primers used are summarized in Table 1 below.

Primers for Fusion Vector Production for Parnesol Production gene primer Base sequence Restriction enzyme Ty1L
DPP1 Ty1L-F
(SEQ ID NO: 1) 5'-GCGC GAATTC AAAAATGGAATCCCAACAATTATCTCAACATTC-3 ' EcoR I Ty1L (DPP1) -R
(SEQ ID NO: 2) 5'- GGATCCGCCGCCACCCGAGCCACCGCCACC TTTGGTTGTATTCGTATAGCTGCGAG-3 ' DPP1 (Ty1L) -F
(SEQ ID NO: 3) 5'- GGTGGCGGTGGCTCGGGTGGCGGCGGATCC ATGAACAGAGTTTCGTTTATTAAAACGCC-3 ' DPP1-R
(SEQ ID NO: 4) 5'-GCGC GTCGAC TTACATACCTTCATCGGACAAAGGATG-3 ' SalI DPP1
LTy1 DPP1-F
(SEQ ID NO: 5) 5'-GCGC GAATTC AAAAATGAACAGAGTTTCGTTTATTAAAACGCC-3 ' EcoR I DPP1 (LTy1) -R
(SEQ ID NO: 6) 5'- GGATCCGCCGCCACCCGAGCCACCGCCACC CATACCTTCATCGGACAAAGGATGT-3 ' LTy1 (DPP1) -F
(SEQ ID NO: 7) 5'- GGTGGCGGTGGCTCGGGTGGCGGCGGATCC ATGGAATCCCAACAATTATCTCAACATTC-3 ' LTy1-R
(SEQ ID NO: 8) 5'-GCGC GTCGAC TTATTTGGTTGTATTCGTATAGCTGCGA-3 ' SalI Ty1L
ispa Ty1L-F
(SEQ ID NO: 1) 5'-GCGC GAATTC AAAAATGGAATCCCAACAATTATCTCAACATTC-3 ' EcoR I Ty1L (ispA) -R
(SEQ ID NO: 2) 5'- GGATCCGCCGCCACCCGAGCCACCGCCACC TTTGGTTGTATTCGTATAGCTGCGAG-3 ' ispA (Ty1L) -F
(SEQ ID NO: 9) 5'- GGTGGCGGTGGCTCGGGTGGCGGCGGATCC ATGGAATCCCAACAATTATCTCAACATT-3 ' LispA-R
(SEQ ID NO: 10) 5'-GCGC GTCGAC TTATTTATTACGCTGGATGATGTAGTCC-3 ' SalI ispal
Ty1 ispA-F
(SEQ ID NO: 11) 5'-GCGC GAATTC AAAAATGGACTTTCCGCAGCAACTCGA-3 ' EcoR I ispA (LTy1) -R
(SEQ ID NO: 12) 5'- GGATCCGCCGCCACCCGAGCCACCGCCACC TTTATTACGCTGGATGATGTAGTCCG-3 ' LTy1 (ispA) -F
(SEQ ID NO: 7) 5'- GGTGGCGGTGGCTCGGGTGGCGGCGGATCC ATGGAATCCCAACAATTATCTCAACATTC-3 ' LTy1-R
(SEQ ID NO: 8) 5'-GCGC GTCGAC TTATTTGGTTGTATTCGTATAGCTGCGA-3 ' Ty1L
HMG1 Ty1L-F
(SEQ ID NO: 1) 5'-GCGC GAATTC AAAAATGGAATCCCAACAATTATCTCAACATTC-3 ' EcoR I Ty1L (HMGl) -R
(SEQ ID NO: 2) 5'- GGATCCGCCGCCACCCGAGCCACCGCCACC TTTGGTTGTATTCGTATAGCTGCGAG-3 ' HMG1 (Ty1L) -F
(SEQ ID NO: 13) 5'- GGTGGCGGTGGCTCGGGTGGCGGCGGATCC ATGGACCAATTGGTGAAAACTGAAGTC-3 ' HMG1-R
(SEQ ID NO: 14) 5'-GCGCGTCGACTTAGGATTTAATGCAGGTGACGGAC-3 ' SalI HMG1
Ty1 HMG1-F
(SEQ ID NO: 15) 5'-GCGC GAATTC AAAAATGGACCAATTGGTGAAAACTGAAGTC-3 ' EcoR I HMGl (LTy1) -R
(SEQ ID NO: 16) 5'- GGATCCGCCGCCACCCGAGCCACCGCCACC GGATTTAATGCAGGTGACGGACC-3 ' LTy1 (HMGl) -F
(SEQ ID NO: 7) 5'- GGTGGCGGTGGCTCGGGTGGCGGCGGATCC ATGGAATCCCAACAATTATCTCAACATTC-3 ' LTy1-R
(SEQ ID NO: 8) 5'-GCGC GTCGAC TTATTTGGTTGTATTCGTATAGCTGCGA-3 ' SalI

* Bold: Restriction enzyme / * Underline: Linker gene

Ty1LDPP1 gene (Ty1-linker (L) -DPP1) was obtained by using the primers described in SEQ ID NOS: 1, 2, 3 and 4 and the primers described in SEQ ID NOS: 5, 6, To obtain the DPP1LTy1 gene. In addition, Ty1LispA gene was obtained using the primers shown in SEQ ID NOS: 1, 2, 9 and 10, and the ispALTy1 gene was obtained using the primers shown in SEQ ID NOS: 11, 12, 7 and 8. In addition, the Ty1LHMG1 gene was obtained using the primers shown in SEQ ID NOS: 1, 2, 13 and 14, and the HMG1LTy1 gene was obtained using the primers shown in SEQ ID NOS: 15, 16, 7 and 8.

The genes prepared by the above method were digested with restriction enzymes (Takara Shuzo, Japan) EcoR I and Sal I into a pCal-vector (a vector containing Gal10, a galactose-inducible promoter), a Saccharomyces cerevisiae expression vector And then recombinant vectors were prepared. 35 (6): e45 (6). In this way, the fusion protein of the present invention can be used for the production of isoprenoids efficiently using the In-Fusion method (Nick S. et al., Nucleic Acids Res. 2007). In-Fusion cloning kit was used with In-Fusion HD cloning kit (Clontech, USA).

Specifically, each of the genes including the Gal10 promoter was obtained through polymerase chain reaction using the primers described in SEQ ID NOs: 17 and 18, using the respective fusion expression vectors constructed as the template DNA as the template DNA. (PGal-HMG1), which is one of the fusion expression vectors previously constructed, was digested with restriction enzyme (Takara Shuzo, Japan) Sma I and further introduced into various combinations using the In-Fusion method (Fig. The vector prepared by the above-described In-Fusion method was named pGal-Ty1LDPP1 / HMG1 / Ty1LispA, pGal-DPP1LTy1 / HMG1 / ispALTy1, pGal-Ty1LDPP / HMG1LTy1 / ispALTy1, pGal- Ty1LDPP1 / Ty1LHMG1 / ispALTy1 3).

The primers used for the In-Fusion cloning are summarized in Table 2 below.

Primers used for In-Fusion cloning primer Base sequence Restriction enzyme Fusion-SmaI-F
(SEQ ID NO: 17) 5'-TCGAGCTCGGTA CCCGGG GATCCATCGCTTCGCTGATTAA-3 ' Sma I Fusion-SmaI-R
(SEQ ID NO: 18) 5'-AAGCGATGGATCCCCACAATGAGCCTTGCTGCAACATCC-3 '

* Bold: Restriction enzyme

1-2. Preparation and screening of transformants

The fusion expression vectors prepared by the method of Example 1-1 were transformed into Saccharomyces cerevisiae Y2805 and Y200589 and transformed into UD medium (0.67% Yeast Nitrogen Base W / O Amino Acids, 0.077% Ura Drop Out suppolement base, 2% glucose) at 30 DEG C for 72 hours to select transgenic strains.

Example  2 : Farnesine  Production of fusion expression vectors and transformants

2-1. Farnesine  The resulting fusion expression vector

The present inventors have attempted to produce a fusion expression vector that produces parnesic, a kind of isoprenoid, with high efficiency. The yeast - derived retrotransposon gene and the key gene for parnesin synthesis were fused to the expression vector for the construction of the metabolic domain.

Specifically, among the enzymes in the parnesin biosynthesis process, farnesene synthase (FS), which catalyzes the conversion of alkenes to pyrene, has been eliminated from the precursor FPP, which is the same as parnesol biosynthesis, and the precursor FPP DPP1, an enzyme that makes parnesol from FPP and FPP, hydroxymethyl glutaryl CoA reductase (HMG1), which is an enzyme biosynthesizing mevalonate from hydroxymethyl glutaryl CoA, and Ty1 (SEQ ID NO: 23), a retrotransposon derived from yeast for metabolosome construction Were obtained by polymerase chain reaction (PCR).

The polymerase chain reaction for gene synthesis was carried out at 98 ° C for 30 seconds using Phusion Hot Start II High-Fidelity DNA Polymerase (Thermofixi Scientific Inc., USA), and incubated at 98 ° C for 10 seconds, at 50 ° C The reaction was performed for 30 seconds at 72 ° C for 30 seconds and at a gene size of 1 kb to perform the cycle 25 times at the cycle (98 ° C for 10 seconds, 50 ° C for 30 seconds, 72 ° C for 30 seconds per 1 kb gene size) At 72 < [deg.] ≫ C for 5 minutes.

The genes amplified by the polymerase chain reaction were identified by sequencing. Ty1 gene was fused to Linker gene (SEQ ID NO: 25) at the N-terminus and C-terminus of FS and ispA and HMG1 gene, respectively, for the construction of metabolosome using Ty1 gene.

The primers used are summarized in Table 3 below.

Primers for the preparation of fusion vectors for parnesin production gene primer Base sequence Restriction enzyme Ty1L
FS Ty1L-F
(SEQ ID NO: 1) 5'-GCGC GAATTC AAAAATGGAATCCCAACAATTATCTCAACATTC-3 ' EcoR I Ty1L (FS) -R
(SEQ ID NO: 2) 5'- GGATCCGCCGCCACCCGAGCCACCGCCACC TTTGGTTGTATTCGTATAGCTGCGAG-3 ' FS (Ty1L) -F
(SEQ ID NO: 19) 5'- GGTGGCGGTGGCTCGGGTGGCGGCGGATCC ATGGAATTTCGTGTCCACCTGCAA-3 ' FS-R
(SEQ ID NO: 20) 5'-GCGC GTCGAC TTAGTTGACCAGCGGCTGAAACAG-3 ' Sal I FSL
Ty1 FS-F
(SEQ ID NO: 21) 5'-GCGC GAATTC AAAAATGGAATTTCGTGTCCACCTGCAA-3 ' EcoR I FS (LTy1) -R
(SEQ ID NO: 22) Gt ; LTy1 (FS) -F
(SEQ ID NO: 7) 5'- GGTGGCGGTGGCTCGGGTGGCGGCGGATCC ATGGAATCCCAACAATTATCTCAACATTC-3 ' LTy1-R
(SEQ ID NO: 8) 5'-GCGC GTCGAC TTATTTGGTTGTATTCGTATAGCTGCGA-3 ' Sal I

* Bold: Restriction enzyme / underline: Linker gene

(Ty1-linker (L) -FS) was obtained by using the primers described in SEQ ID NOS: 1, 2, 19 and 20 and the primers described in SEQ ID NOs: 21, 22, To obtain the FSLTy1 gene. In addition, Ty1LispA gene was obtained using the primers shown in SEQ ID NOS: 1, 2, 9 and 10, and the ispALTy1 gene was obtained using the primers shown in SEQ ID NOS: 11, 12, 7 and 8. In addition, the Ty1LHMG1 gene was obtained using the primers shown in SEQ ID NOS: 1, 2, 13 and 14, and the HMG1LTy1 gene was obtained using the primers shown in SEQ ID NOS: 15, 16, 7 and 8.

The genes prepared by the above method were digested with restriction enzymes (Takara Shuzo, Japan) EcoR I and Sal I into a pCal-vector (a vector containing Gal10, a galactose-inducible promoter), a Saccharomyces cerevisiae expression vector And then recombinant vectors were prepared. 35 (6): e45 (6). In this way, the fusion protein of the present invention can be used for the production of isoprenoids efficiently using the In-Fusion method (Nick S. et al., Nucleic Acids Res. 2007). In-Fusion cloning kit was used with In-Fusion HD cloning kit (Clontech, USA).

Specifically, each of the genes including the Gal10 promoter was obtained through polymerase chain reaction using the primers described in SEQ ID NOs: 17 and 18, using the respective fusion expression vectors constructed as the template DNA as the template DNA. PGal-HMG1, which is one of the fusion expression vectors previously constructed, was digested with restriction enzymes (Takara Shuzo, Japan) Sma I and further introduced into various combinations using the In-Fusion method (Fig. 3). PGal-FSLTy1 / HMG1LTy1 / ispALTy1, pGal-FSLTy1 / Ty1LHMG1 / ispALTy1 (also referred to as pGal-HMG1 / Ty1FS / Ty1LispA, pGal-HMG1 / FSLTy1 / ispALTy1, pGal- 4).

2-2. Preparation and screening of transformants

The fusion expression vectors prepared in Example 2-1 were transformed into Saccharomyces cerevisiae Y2805 and Y200589 and transformed into UD medium (0.67% Yeast Nitrogen Base W / O Amino Acids, 0.077% Ura Drop Out suppolement base, 2% glucose) at 30 DEG C for 72 hours to select transgenic strains.

Example  3: Parnesol , Farnesine  Culture of recombinant yeast strains produced

The recombinant yeast strains Y2805 pGal-Ty1LDPP1 / HMG1 / Ty1LispA, Y2805 pGal-DPP1LTy1 / HMG1 / ispALTy1, Y2805 Ty1LDPP1 / Ty1LHMG1 / ispALTy1, Y2805 Ty1LDPP1 / HMG1LTy1 / ispALTy1 and Y200589 pGal- Ty1LDPP1 / HMG1 / islLTp1 / Ypg1LTy1 / ispALTy1 was constructed as a control, and Y2805 DPP1 / HMG1 / isoHP1 / HMGl / ispA and Y200589 DPP1 / HMG1 / ispA were used. In addition, Y2805 ispALDPP1 / HMG1 and Y200589 ispALDPP1 / HMG1, in which DPP1 and ispA were linked by linker (SEQ ID NO: 25)

The recombinant yeast strain producing parnesine Y2805 pGal-Ty1LFS / HMG1 / Ty1LispA, Y2805 pGal-FSLTy1 / HMG1 / ispALTy1, Y2805 FSLTy1 / Ty1LHMG1 / ispALTy1, Y2805 FSLTy1 / HMG1LTy1 / ispALTy1 and Y200589 pGal- Ty1LFS / HMG1 / Ty1LispA, Y200589 HMG1 / ispALTy1, Y200589 FSLTy1 / Ty1LHMG1 / ispALTy1, and Y200589 FSLTy1 / HMG1LTy1 / ispALTy1 were constructed, and Y2805 FS / HMG1 / ispA and Y200589 FS / HMG1 / ispA was used, and Y2805 ispALFS / HMG1 and Y200589 ispALFS / HMG1, in which fusion and ispA were linked by linker (SEQ ID NO: 25), were used.

In order to compare parnesol and parnesin productivity of cultured recombinant yeast strains, the cells were cultured in YPDG (1% glucose, 1% galactose) medium.

The culture was divided into initial culture and main culture. UD medium was used for the initial culture and YPDG medium was used for the main culture.

The UD medium was a medium supplemented with 0.67% yeast Nitrogen Base W / O Amino Acids, 0.077% Ura Drop Out supplement base and 2% glucose. The YPDG medium contained 2% peptone, 1% yeast extract, 1% glucose, and 1% galactose.

In the initial culture, 3 mL of UD medium was inoculated with a single colony and cultured at 30 ° C. and 180 rpm for 24 hours. The culturing was carried out by inoculating YPDG medium into 250 mL baffled flasks each in an amount of 25 mL, and then inoculating the initially cultured strain to an OD of 0.1. 5 mL of dodecane (Sigma Aldrich, USA) was added to efficiently harvest parnesol and parnesin generated during culturing, followed by culturing at 30 DEG C and 180 rpm for 72 hours with stirring.

Example  4: gas chromatography ( Gas Chromatography ) Parnesol , Parnesin productivity measurement

The present cultivation in Example 3 was performed to analyze parnesol and parnesin collected in the dodecane layer. For this, 200 μl of the dodecane layer was taken from the culture solution, and 2 μl of the solution was used for gas chromatography (GC) analysis.

Specifically, parnesol and parnesin were analyzed in the following manner. The culture medium in the 250 ml baffle flask was transferred to a 50 ml falcon tube and allowed to stand for a while to separate the dodecane layer and the culture medium layer. One mL of the separated dodecane layer was taken and centrifuged at 12,000 rpm for 10 minutes. After centrifugation, 200 μl of the supernatant was taken and 2 μl of the supernatant was subjected to gas chromatography quantitative analysis.

Gas chromatography 7890A from Agilent was used for gas chromatography. The GC column was 19091J-413HP-5 (5% -Phenyl Methyl Siloxane, 30mX0.32mmX0.25μm film thickness), and the detector was a flame ionization detector (FID) using hydrogen and oxygen. And high purity helium was used as a carrier gas. The sample was washed three times with chloroform (Junsei, Japan), split ratio 10: 1, split flow 10 mL / min, pressure 5.1068 psi, and heater temp 300 ° C oven The temp was held at 40 ° C for 3 min hold, 240 ° C for 5 min hold at 10 ° C / min, 300 ° C for 1 min hold at 10 ° C / min, FID temp was 320 ° C H2 flow 40 ml / min, Air flow 400 ml / min , makeup flow 30 mL / min temp 250 캜, 10 캜 / min 300 캜 1 min. The total analysis time was 35 minutes. The concentrations of parnesol and parnesin in the analyzed dodecane layer were compared with each other in terms of the concentration of parnesol and parmesin produced per liter of culture.

As a result of the above experiment, the parnesol collected in the Dodecane layer showed a peak at 20.1 minutes. Comparing the productivity of parnesol, pGal-DPP1 / HMG1 / ispA, which expresses genes individually, showed a parnesol productivity of 0.04 g / L in Y200589 strain. On the other hand, in the case of pGal-ispALDPP1 / HMG1 in which ispA and DPP1 genes were fused with Liker in order to obtain a substrate channeling effect in the continuous reaction, the Y200589 strain showed an increase in productivity by 4 times and was 0.17 g / L . In the case of pGal-Ty1LDPP1 / HMG1 / Ty1LispA fused to the N-terminal of yeast-derived retrotransposon for metabolosome construction, Y200589 strain showed about 3 times more productivity than the control pGal-DPP1 / HMG1 / ispA there was. However, in the case of pGal-DPP1LTy1 / HMG1 / ispALTy1 in which Ty1 was fused and expressed at the C-terminus, it was confirmed that Y200589 strain did not produce parnesol at all. Therefore, in the DPP1 gene, it is presumed that Tyl is lost when it is linked to the C-terminus. In the case of Ty1 fusion of HMG1 gene, productivity of pGal-Ty1LDPP1 / Ty1LHMG1 / ispALTy1 fusion-expressing Ty1 at the N-terminal was increased more than pGal-Ty1LDPP1 / HMG1 / Ty1LispA when Ty1 was not further fused And an additional productivity of about 1.5 times (0.18 g / L). Further, in the case of pGal-Ty1LDPP1 / HMG1LTy1 / ispALTy1 in which Ty1 was fused and expressed at the C-terminus of HMG1 gene, a further increase in parnesol production of 0.182 g / L was confirmed. Finally, each gene was individually expressed in the case of TyI fusion The productivity of Y200589 strain was about 4.5 times higher than that of the control pGal-DPP1 / HMG1 / ispA (FIG. 5).

In addition, as a result of the above experiment, the parneses collected in the Dodecane layer showed a peak at 17.8 minutes. Comparing the productivity of parnesin, pGal-FS / HMG1 / ispA, which expresses the genes individually, showed parnesin productivity of 0.021 g / L in strain Y200589. On the other hand, in the case of pGal-ispALFS / HMG1 in which ispA and FS genes were fused with Linker to obtain substrate channeling effect in continuous reaction, productivity was increased to 4 times and 0.08 g / L was obtained. In the case of pGal-Ty1LFS / HMG1 / Ty1LispA in which Ty1, a yeast-derived retrotransposon for the construction of the metabolosome, was fused at its N-terminus, it was confirmed that Y2805 and Y200589 did not produce parnesin at all. However, in the case of pGal-FSLTy1 / HMG1 / ispALTy1 in which Ty1 was fused at the C-terminus, productivity of Y200589 strain was about 9 times higher than that of pGal-FS / HMG1 / ispA, indicating 0.18 g / L productivity there was. Therefore, in the FS gene, it is presumed that Tyl lost its activity when it was linked to the N-terminal. In the case of Ty1 fusion of HMG1 gene, productivity of pGal-FSLTy1 / Ty1LHMG1 / ispALTy1 fusion with Ty1 at N-terminal was slightly increased compared with pGal-FSLTy1 / HMG1 / ispALTy1 without Ty1 fusion, In the case of pGal-FSLTy1 / HMG1LTy1 / ispALTy1 in which Ty1 was fused and expressed at the C-terminus of the tyrosine phosphorylase gene, a further increase in parnesin production of 0.24 g / L was confirmed. Finally, / HMG1 / ispA in the strain Y200589 (Fig. 6).

Example  5: Fermentation through cultivation of fermentation tank of production strain

In order to investigate the accurate productivity of parnesol and production strains Y200589 pGal-Ty1LDPP1 / HMG1LTy1 / ispALTy1 and parnesin and production strain Y200589 pGal-FSLTy1 / HMG1Ty1 / ispALTy1 which were the most productive in Example 4, a 5L-scale fermenter was operated Productivity.

Specifically, first, 25 mL of UD medium was inoculated with a single colony and cultured for 20 hours, and then added to 175 mL of YPD medium (2% peptone, 1% yeast extract, 1% glucose) Lt; 0 > C, 180 rpm. After the initial culture, the cells were inoculated into 1.8 L of YPD medium, and the volume of the medium was adjusted to 2 L to start fermentation. 400 mL of dodecane was added to the culture to efficiently harvest the produced parnesol and parnesin. When the glucose is completely consumed, feeding begins. The feeding medium contains 600 g / L of glucose, 40 g / L of yeast extract, 0.7919 g / L of leucine, 0.726 g / L, 0.594 g / L of tyrosine and 0.276 g / L of tryptophane were used. The pH was adjusted to 6.0, which was adjusted with 10N NaOH. 30 캜, 3 vvm, and 800 rpm while stirring. To induce galactose induction, 5 g / L of galactose was added 4 times up to 72 hours, and then 10 g / L of each was added at 96, 120 and 144 hours, respectively, in order to avoid a sudden induction load.

In the 5L fermenter of the parnesol-producing strain Y200589 pGal-Ty1LDPP1 / HMG1LTy1 / ispALTy1, which showed the highest productivity in Example 4, OD was no longer able to grow to 95 after 96 hours, All of them were consumed after the time, and the feeding was started from 18 hours. The parnesol yield analysis was performed by taking 10 mL of samples every 6 hours from 48 hours.

As a result of the parnesol production analysis, it was confirmed that 0.056 g / L was continuously increased at 48 hours, 0.334 g / L at 72 hours, and 0.512 g / L at 96 hours. It was confirmed that the parnesol was finally produced at the highest level of about 0.9 g / L in 164 hours (FIG. 7).

In addition, the 5-L fermenter of the parnezin-producing strain Y200589 pGal-FSLTy1 / HMG1LTy1 / ispALTy1, which showed the highest productivity in Example 4, showed an increase in OD continuously increased to 164 Glucose was consumed after 24 hours and feeding was started from 18 hours. Parnesin production was analyzed by taking 10 mL of samples every 6 hours from 48 hours.

As a result of parnesin production analysis, it was found that parneses was continuously produced until the second half of fermentation, similarly to the case of fermentation with parnesol (FIG. 8). However, unlike flask cultivation, it was found that not only parnesin but also parnesol were produced at about the same level. L of parnesin, 0.274 g / L of parnesin, 0.24 g / L of parnesin, 72.0 g / L of parnesin and 964 g / L of parnesin at 96 hours. As shown in Fig.

Finally, the isoprenoid productivity of 0.93 g / L of parmesin and 0.89 g / L of parnesol was obtained at 164 hours of fermentation.

Example  6: Analysis of results

As can be seen from the above examples, the present inventors constructed a metabolosome by using Ty1, a yeast-derived retrotransposon that forms virus-like particles that are attracted to isoprenoids and vaccines for production. Ty1 is known to have no problem in viral-like particle formation even when fused to an N-terminal or C-terminal foreign protein. However, as shown in Example 4, Typ1 in the case of the enzyme FPP1, which produces parnesol from FPP, Fernesol productivity was increased when fused, but Fernesol was not produced when fused to C-terminal. In the case of enzyme FS that catalyzes the conversion of pyrophosphate to alkene by elimination of pyrophosphate from the same precursor FPP as parnesol biosynthesis, parnesin productivity was increased when fused to the C-terminus but increased when parnezin was fused to the N- It was confirmed that no god was produced. However, HMG1, an enzyme that biosynthesizes mevalonate from the enzyme ispA, a hydroxymethyl glutaryl CoA, which forms the precursor FPP immediately before parnesol biosynthesis, produces isoprenoid even when Tyl is fused in both N-terminal and C-terminal directions Enzymes were confirmed to be unaffected by orientation.

As mentioned above, there are some enzymes that are not influenced by orientation when constructing metabolosome. However, since enzymes that do not produce isoprenoid at all due to orientation exist, directivity is also important factor for constructing metabolosome It is one.

As a result of culturing the 5L fermenter to confirm the more accurate productivity of the parnezol and parnezin-producing recombinant strains, which are the most highly productive, the fermentation patterns of the 5L fermenter showed that the parnesol and parnesin were continuously produced even after the cell growth was stopped I could. Therefore, it is expected that the productivity of fermentation can be increased through continuous culture process. It is also expected that the productivity will continue to increase when Ty1 is further fused to other enzymes in the isoprenoid metabolic pathway.

From the above description, it will be understood by those skilled in the art that the present invention may be embodied in other specific forms without departing from the spirit or essential characteristics thereof. In this regard, it should be understood that the above-described embodiments are to be considered in all respects as illustrative and not restrictive. The scope of the present invention should be construed as being included in the scope of the present invention without departing from the scope of the present invention as defined by the appended claims.

<110> Korea Research Institute of Bioscience and Biotechnology <120> Improved production of isoprenoids by metabolosome construction <130> KPA140786-KR <160> 26 <170> Kopatentin 2.0 <210> 1 <211> 43 <212> DNA <213> Artificial Sequence <220> <223> Ty1L-F primer <400> 1 gcgcgaattc aaaaatggaa tcccaacaat tatctcaaca ttc 43 <210> 2 <211> 56 <212> DNA <213> Artificial Sequence <220> <223> Ty1L (DPP1) -R primer <400> 2 ggatccgccg ccacccgagc caccgccacc tttggttgta ttcgtatagc tgcgag 56 <210> 3 <211> 59 <212> DNA <213> Artificial Sequence <220> DPP1 (Ty1L) -F primer <400> 3 ggtggcggtg gctcgggtgg cggcggatcc atgaacagag tttcgtttat taaaacgcc 59 <210> 4 <211> 37 <212> DNA <213> Artificial Sequence <220> <223> DPP1-R primer <400> 4 gcgcgtcgac ttacatacct tcatcggaca aaggatg 37 <210> 5 <211> 43 <212> DNA <213> Artificial Sequence <220> <223> DPP1-F primer <400> 5 gcgcgaattc aaaaatgaac agagtttcgt ttattaaaac gcc 43 <210> 6 <211> 55 <212> DNA <213> Artificial Sequence <220> DPP1 (LTy1) -R primer <400> 6 ggatccgccg ccacccgagc caccgccacc cataccttca tcggacaaag gatgt 55 <210> 7 <211> 59 <212> DNA <213> Artificial Sequence <220> <223> LTy1 (DPP1) -F primer <400> 7 ggtggcggtg gctcgggtgg cggcggatcc atggaatccc aacaattatc tcaacattc 59 <210> 8 <211> 38 <212> DNA <213> Artificial Sequence <220> <223> LTy1-R primer <400> 8 gcgcgtcgac ttatttggtt gtattcgtat agctgcga 38 <210> 9 <211> 58 <212> DNA <213> Artificial Sequence <220> <223> ispA (Ty1L) -F primer <400> 9 ggtggcggtg gctcgggtgg cggcggatcc atggaatccc aacaattatc tcaacatt 58 <210> 10 <211> 38 <212> DNA <213> Artificial Sequence <220> <223> LispA-R primer <400> 10 gcgcgtcgac ttatttatta cgctggatga tgtagtcc 38 <210> 11 <211> 37 <212> DNA <213> Artificial Sequence <220> <223> ispA-F primer <400> 11 gcgcgaattc aaaaatggac tttccgcagc aactcga 37 <210> 12 <211> 56 <212> DNA <213> Artificial Sequence <220> <223> ispA (LTy1) -R primer <400> 12 ggatccgccg ccacccgagc caccgccacc tttattacgc tggatgatgt agtccg 56 <210> 13 <211> 57 <212> DNA <213> Artificial Sequence <220> HMG1 (Ty1L) -F primer <400> 13 ggtggcggtg gctcgggtgg cggcggatcc atggaccaat tggtgaaaac tgaagtc 57 <210> 14 <211> 35 <212> DNA <213> Artificial Sequence <220> <223> HMG1-R primer <400> 14 gcgcgtcgac ttaggattta atgcaggtga cggac 35 <210> 15 <211> 41 <212> DNA <213> Artificial Sequence <220> <223> HMG1-F primer <400> 15 gcgcgaattc aaaaatggac caattggtga aaactgaagt c 41 <210> 16 <211> 53 <212> DNA <213> Artificial Sequence <220> HMG1 (LTy1) -R primer <400> 16 ggatccgccg ccacccgagc caccgccacc ggatttaatg caggtgacgg acc 53 <210> 17 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> Fusion-SmaI-F primer <400> 17 tcgagctcgg tacccgggga tccatcgctt cgctgattaa 40 <210> 18 <211> 39 <212> DNA <213> Artificial Sequence <220> <223> Fusion-SmaI-R primer <400> 18 aagcgatgga tccccacaat gagccttgct gcaacatcc 39 <210> 19 <211> 54 <212> DNA <213> Artificial Sequence <220> FS (Ty1L) -F primer <400> 19 ggtggcggtg gctcgggtgg cggcggatcc atggaatttc gtgtccacct gcaa 54 <210> 20 <211> 34 <212> DNA <213> Artificial Sequence <220> <223> FS-R primer <400> 20 gcgcgtcgac ttagttgacc agcggctgaa acag 34 <210> 21 <211> 38 <212> DNA <213> Artificial Sequence <220> <223> FS-F primer <400> 21 gcgcgaattc aaaaatggaa tttcgtgtcc acctgcaa 38 <210> 22 <211> 51 <212> DNA <213> Artificial Sequence <220> &Lt; 223 > FS (LTy1) -R primer <400> 22 ggatccgccg ccacccgagc caccgccacc gttgaccagc ggctgaaaca g 51 <210> 23 <211> 379 <212> PRT <213> Ty1 aa seq <400> 23 Met Glu Ser Gln Gln Leu Ser Gln His Ser Pro Ile Ser His Gly Ser   1 5 10 15 Ala Cys Ala Ser Val Thr Ser Lys Glu Val His Thr Asn Gln Asp Pro              20 25 30 Leu Asp Val Ser Ala Ser Lys Thr Glu Glu Cys Glu Lys Ala Ser Thr          35 40 45 Lys Ala Asn Ser Gln Gln Thr Thr Thr Pro Ala Ser Ser Ala Val Pro      50 55 60 Glu Asn Pro His His Ala Ser Pro Gln Thr Ala Gln Ser His Ser Pro  65 70 75 80 Gln Asn Gly Pro Tyr Pro Gln Gln Cys Met Met Thr Gln Asn Gln Ala                  85 90 95 Asn Pro Ser Gly Trp Ser Phe Tyr Gly His Ser Ser Ile Pro Tyr             100 105 110 Thr Pro Tyr Gln Met Ser Pro Met Tyr Phe Pro Pro Gly Pro Gln Ser         115 120 125 Gln Phe Pro Gln Tyr Pro Ser Ser Val Gly Thr Pro Leu Arg Thr Pro     130 135 140 Ser Pro Glu Ser Gly Asn Thr Phe Thr Asp Ser Ser Ala Asp Ser 145 150 155 160 Asp Met Thr Ser Thr Lys Lys Tyr Val Arg Pro Pro Pro Met Leu Thr                 165 170 175 Ser Pro Asn Asp Phe Pro Asn Trp Val Lys Thr Tyr Ile Lys Phe Leu             180 185 190 Gln Asn Ser Asn Leu Gly Gly Ile Ile Pro Thr Val Asn Gly Lys Pro         195 200 205 Val Arg Gln Ile Thr Asp Asp Glu Leu Thr Phe Leu Tyr Asn Thr Phe     210 215 220 Gln Ile Phe Ala Pro Ser Gln Phe Leu Pro Thr Trp Val Lys Asp Ile 225 230 235 240 Leu Ser Val Asp Tyr Thr Asp Ile Met Lys Ile Leu Ser Lys Ser Ile                 245 250 255 Glu Lys Met Gln Ser Asp Thr Gln Glu Ala Asn Asp Ile Val Thr Leu             260 265 270 Ala Asn Leu Gln Tyr Asn Gly Ser Thr Pro Ala Asp Ala Phe Glu Thr         275 280 285 Lys Val Thr Asn Ile Ile Asp Arg Leu Asn Asn Asn Gly Ile His Ile     290 295 300 Asn Asn Lys Val Ala Cys Gln Leu Ile Met Arg Gly Leu Ser Gly Glu 305 310 315 320 Tyr Lys Phe Leu Arg Tyr Thr Arg His Arg His Leu Asn Met Thr Val                 325 330 335 Ala Glu Leu Phe Leu Asp Ile His Ale Ile Tyr Glu Glu Gln Gln Gly             340 345 350 Ser Arg Asn Ser Lys Pro Asn Tyr Arg Arg Asn Pro Ser Asp Glu Lys         355 360 365 Asn Asp Ser Arg Ser Tyr Thr Asn Thr Thr Lys     370 375 <210> 24 <211> 1140 <212> DNA <213> Ty1 seq <400> 24 atggaatccc aacaattatc tcaacattca cccatttctc atggtagcgc ctgtgcttcg 60 gttacttcta aggaagtcca cacaaatcaa gatccgttag acgtttcagc ttccaaaaca 120 gaagaatgtg agaaggcttc cactaaggct aactctcaac agacaacaac acctgcttca 180 tcagctgttc cagagaaccc ccatcatgcc tctcctcaaa ctgctcagtc acattcacca 240 cagaatgggc cgtacccaca gcagtgcatg atgacccaaa accaagccaa tccatctggt 300 tggtcatttt acggacaccc atctatgatt ccgtatacac cttatcaaat gtcgcctatg 360 tactttccac ctgggccaca atcacagttt ccgcagtatc catcatcagt tggaacgcct 420 ctgaggactc catcacctga gtcaggtaat acatttactg attcatcctc agcggactct 480 gatatgacat ccactaaaaa atatgtcaga ccaccaccaa tgttaacctc acctaatgac 540 tttccaaatt gggttaaaac atacatcaaa tttttacaaa actcgaatct cggtggtatt 600 attccgacag taaacggaaa acccgtacgt cagatcactg atgatgaact caccttcttg 660 tataacactt ttcaaatatt tgctccctct caattcctac ctacctgggt caaagacatc 720 ctatccgttg attatacgga tatcatgaaa attctttcca aaagtattga aaaaatgcaa 780 tctgataccc aagaggcaaa cgacattgtg accctggcaa atttgcaata taatggcagt 840 acacctgcag atgcatttga aacaaaagtc acaaacatta tcgacagact gaacaataat 900 ggcattcata tcaataacaa ggtcgcatgc caattaatta tgagaggtct atctggcgaa 960 tataaatttt tacgctacac acgtcatcga catctaaata tgacagtcgc tgaactgttc 1020 ttagatatcc atgctattta tgaagaacaa cagggatcga gaaacagtaa acctaattac 1080 aggagaaatc cgagtgatga gaagaatgat tctcgcagct atacgaatac aaccaaataa 1140                                                                         1140 <210> 25 <211> 10 <212> PRT <213> Artificial Sequence <220> <223> Linker aa seq <400> 25 Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser   1 5 10 <210> 26 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Linker seq <400> 26 ggtggcggtg gctcgggtgg cggcggatcc 30

Claims (16)

A retrotransposon gene derived from Saccharomyces cerevisiae; And a gene of a continuous metabolic pathway that produces a desired metabolite.
2. The expression vector according to claim 1, wherein the target metabolite is isoprenoid.
3. The expression vector according to claim 2, wherein the isoprenoid is selected from the group consisting of squalene, parnesol, parmesin.
3. The method of claim 2,
i) a farnesyl pyrophosphate synthase (ispA) gene and a hydroxymethyl glutaryl CoA reductase 1 (HMG1), an enzyme that synthesizes farnesyl pyrophosphate (FPP) gene;
ii) a synthetic enzyme gene which synthesizes isoprenoid using fenesyl pyrophosphate as a precursor; And
iii) an expression vector for constructing an assembly of a continuous metabolic pathway enzyme, which comprises producing an isoprenoid containing a retro-transposon gene.
5. The method according to claim 4, wherein the synthetic enzyme gene for synthesizing the isoprenoid is selected from the group consisting of a squalene synthetase (Erg9) gene, a parnesol synthase (DPP1) gene, and a parnesine synthase (FS) Expression vector for construction of a continuous metabolic pathway enzyme assembly.
The expression vector according to claim 4, wherein the retro-transposon gene is Ty1 gene derived from Saccharomyces cerevisiae.
7. The expression vector for constructing a continuous metabolic pathway assembly according to claim 6, wherein the Ty1 gene is a nucleic acid sequence of SEQ ID NO: 24.
5. The method according to claim 4, wherein the retrotransposon gene is linked to at least one gene selected from the group consisting of the fenesyl pyrophosphate synthase gene, the hydroxymethylglutaryl CoA reductase gene and the synthetic enzyme gene synthesizing isoprenoid Expression vector for construction of a continuous metabolic pathway enzyme assembly.
9. The method according to claim 8, wherein the retrotransposon gene is linked to at least one gene selected from the group consisting of the fenesyl pyrophosphate synthase gene, the hydroxymethylglutaryl CoA reductase gene and the synthetic enzyme gene synthesizing isoprenoid, Expression vector for construction of a continuous metabolic pathway assembly, which is linked via a linker gene.
10. The expression vector for constructing a continuous metabolic pathway assembly according to claim 9, wherein the linker gene comprises the nucleic acid sequence of SEQ ID NO: 26.
A process for producing an isoprenoid transformed with an expression vector for constructing a continuous metabolic pathway enzyme construct, characterized by producing the isoprenoid according to claim 4, wherein Saccharomyces cerevisiae cerevisiae ) recombinant strains.
i) farnesyl pyrophosphate synthase (ispA) and hydroxymethyl glutaryl CoA reductase 1 (HMG1), an enzyme that synthesizes farnesyl pyrophosphate (FPP); And
ii) a synthetic enzyme which synthesizes an isoprenoid by using panesyl pyrophosphate as a precursor,
iii) an expression vector comprising at least one enzyme selected from the group consisting of fenesyl pyrophosphate synthase, hydroxymethylglutaryl CoA reductase and synthetic enzyme for synthesizing isoprenoid, Saccharomyces cerevisiae recombinant strain for the production of nodule.
13. The recombinant Saccharomyces cerevisiae strain for producing isoprenoids according to claim 12, wherein the isoprenoid is selected from the group consisting of squalene, parnesol, parmesin.
13. The method according to claim 12, wherein the synthetic enzyme for synthesizing the isoprenoid is selected from the group consisting of squalene synthetase (Erg9), parnesol synthase (DPP1), parnesin synthase (FS) A recombinant strain of Saccharomyces cerevisiae.
15. A method for producing isoprenoids comprising culturing a recombinant strain according to any one of claims 11 to 14.
16. The method of claim 15, wherein the isoprenoid is selected from the group consisting of squalene, parnesol, parmesin.

Images