KR20150123741A - Vectors for measuring multiple protein-protein interactions simultaneously - Google Patents

Abstract

The present invention relates to a vector for analyzing multiple protein-protein interactions simultaneously. More specifically, the present invention relates to a donor vector and an accepting vector having a specific construct for efficiently searching protein coupling pairs at a library level, a kit including the vectors, and a protein interaction detection method using the same. According to the present invention, when the vector set is used to detect the protein interactions, the protein interactions simultaneously occurring between protein libraries (or a bait protein library and a prey protein library) can be detected. The present invention can also provide an advantage in processing a large amount of information in order to identify the interacting proteins in each protein reaction between the libraries by using the bar code sequence contained in each vector.

Description

[0002] Vectors for measuring multiple protein-protein interactions simultaneously for multiple protein-

The present invention relates to a vector for simultaneous analysis of a plurality of protein-protein interactions, and more particularly, to a vector for a simultaneous analysis of protein-protein interactions using a donor vector having a specific construct for simultaneously and efficiently searching binding pairs of library- Vectors, kits comprising the vectors, and methods for detecting protein interactions using the kits.

One or more proteins in a cell exhibit biological functions through interaction (non-covalent, physical). Understanding the interactions between proteins is therefore of great importance in understanding biological functions. Efforts to identify protein interactions in diverse disciplines such as biochemistry, proteomics, molecular dynamics, and signal transduction have continued to date. Co-immunoprecipitation (Co-IP), fluorescence resonance energy transfer (FRET), yeast two-hybrid and recently designed Bimolecular Fluorescence Complementation (BiFC) are well known.

Among them, Yeast two-hybrid (Fields S, Song O, 1989) was designed by Dr. Song Ok-kyu and Stanley Fields in 1989 and uses a modular characteristic of a common transcription factor. Here, the modular structure consists of the DNA binding domain (DNA binding domain) (DBD) and the activation domain (AD), and the two domains are close to each other It is a method using the principle that normal function as a transcription factor is possible.

Generally, in yeast two-hybrid mothod, GAL4 transcription factor of Saccharomyces cerevisiae (S. cerevisiae) is mainly used and is widely used for screening interactions among specific proteins or interaction partners for one protein. Therefore, it is a method of recombination of gene of protein to be studied in each angular domain of GAL4 transcription factor and induction of expression in the same yeast to determine whether or not there is an interaction. In general, Bait binds to the DNA binding domain and Prey (prey) to the active domain. In Bait, a gene for one kind of protein to be studied is prey, and a cDNA library is mainly recombined for Bait to interact with Bait protein It is conducted in a way that selects partners. The DNA binding domain (DBD), Bait, the active site (AD) and Prey are transformed into yeast in the form of independent vectors, and the ADH1 promoter (ADH1 promoter (Constitutive expression). The expressed DBD-Bait and AD-Prey binding proteins are transferred to the yeast nucleus by NLS (Nuclear Localization Signal) located at the N-terminus of the DNA binding domain and the active domain. If Bait and Prey do not interact with each other in the nucleus, DBD-Bait and AD-Prey do not form a complex, so they can not function as normal GAL4 transcription factors. However, when Bait and Prey interact with each other, DBD-Bait-Prey-AD complex (DBD-Bait-Prey-AD complex) is formed to perform the normal function of GAL4 transcription factor. Which leads to the expression of the reporter.

This principle is a method to confirm the interaction of Bait and Prey through the expression of the reporter gene. Reporters in the yeast genome are composed of GAL4 UAS (Upstream Activation Sequence) and reporter genes to which the DNA binding domain of the GAL4 transcription factor can bind. Typically, LacZ, MEL1 (Colormetric reporter), HIS3, ADE2, URA3 (Authotrophic reporter) Are used. As a result, when Bait and Prey interact with each other, the DBD-Bait-Prey-AD complex binds to the reporter GAL4 UAS and induces the expression of the reporter gene.

One of the advantages of this yeast two-hybrid is that it can be performed in vivo, it is more advantageous to use bacteria than yeast because it is a high eukaryote, And the ability to simultaneously screen thousands of protein interactions. On the other hand, the existing yeast two-hybrid system (Y2H) has some limitations.

The first limitation is that mass screening is difficult. A protein library with high diversity is used when performing screening to find an interacting protein for a specific protein through Y2H. For example, if a protein library with a diversity of 1.0 x 10 ⁷ is used for screening for interacting proteins for a specific protein A, one (1 x 10 ³ ) yeast colony can be selected from one agar medium The experimenter should use full agar medium for screening. This consumes a considerably high labor force for the experimenter, as well as considerable inefficiency in terms of time and cost. Therefore, it is difficult to select the mass because of these problems.

The second limitation is the analysis of data obtained through screening. In the conventional method, a positive candidate (a yeast with interactions between proteins) was selected using an agar medium, and a plasmid was obtained and analyzed by precher gene sequencing. Using this method, analyzing all the positive candidates obtained through mass screening requires a lot of labor and time and cost are also quite inefficient.

The third limitation is the sensitivity of existing reporter systems. The use of reporter systems (eg, β-galactosidase, HIS3, ADE2, etc.) used in conventional Y2H has the disadvantage that it can not discriminate weak protein interactions. And other difficulties in automation, the fact that the protein itself can not be activated when it is activated by transcription, and it is difficult to select when a co-factor is required for protein interactions.

The present inventors have made up a disadvantage of the existing two-hybrid system to produce a vector set having a special construct for simultaneously and efficiently searching the binding pairs of library-level proteins Thus completing the present invention.

Accordingly, an object of the present invention is to provide a recombinant vector comprising a first promoter; A DBD coding sequence that binds to the promoter of a host cell reporter gene; A first cloning site for insertion of a bait protein coding sequence; A first site-specific recombination site; A second cloning site for insertion of a barcode sequence representing the bait protein; And a second site-specific recombinase recognition sequence.

Another object of the present invention is a recombinant DNA comprising: a first promoter; An AD coding sequence to aid transcription of the host cell reporter gene; A first cloning site for insertion of a pre-protein coding sequence; A second cloning site for insertion of a barcode sequence representing said pre-protein; A first site-specific recombination site; And a second site-specific recombinase recognition sequence.

It is still another object of the present invention to provide a kit for protein interaction detection including the donor vector and acceptor vector.

It is still another object of the present invention to provide a method for preparing a bait library, comprising: (a) preparing a bait library by introducing a bait protein and a barcode sequence representing the bait protein into the donor vector; (b) introducing a prey protein and a barcode sequence representing the pre-protein into the acceptor vector to prepare a prey library; (c) introducing the bait library and the prey library into a host cell expressing the recombinant enzyme as a reporter; And (c) detecting the expression of the reporter from the host cell to detect the bait-prey protein binding pairs.

In order to accomplish the above object, the present invention provides a recombinant vector comprising: a first promoter; A DBD coding sequence that binds to the promoter of a host cell reporter gene; A first cloning site for insertion of a bait protein coding sequence; A first site-specific recombination site; A second cloning site for insertion of a barcode sequence representing the bait protein; And a second site-specific recombinase recognition sequence.

According to another aspect of the present invention, An AD coding sequence to aid transcription of the host cell reporter gene; A first cloning site for insertion of a pre-protein coding sequence; A second cloning site for insertion of a barcode sequence representing said pre-protein; A first site-specific recombination site; And a second site-specific recombinase recognition sequence.

In order to accomplish another object of the present invention, the present invention provides a kit for detecting protein interactions including the donor vector and the acceptor vector.

According to another aspect of the present invention, there is provided a method for preparing a bait library, comprising the steps of: (a) preparing a bait library by introducing a bait protein and a barcode sequence representing the bait protein into the donor vector; (b) introducing a prey protein and a barcode sequence representing the pre-protein into the acceptor vector to prepare a prey library; (c) introducing the bait library and the prey library into a host cell expressing the recombinant enzyme as a reporter; And (c) detecting the expression of a reporter from the host cell and detecting bait-prey protein binding pairs.

Hereinafter, the present invention will be described in detail.

The term " vector " as used herein refers to an expression vector capable of expressing a desired protein in a suitable host cell, and a gene construct containing an essential regulatory element operably linked to the expression of the gene insert. Such vectors include plasmid vectors, cosmid vectors, bacteriophage vectors, yeast vectors, viral vectors, and the like. Once transformed into the appropriate host, the vector may replicate and function independently of the host genome, or, in some cases, integrate into the genome itself. Because the plasmid is the most commonly used form of the current vector, the terms "plasmid" and "vector" are sometimes used interchangeably in the context of the present invention. For the purpose of the present invention, it is preferable to use a plasmid vector.

In the present specification, the constitution of each vector is described in 5 'to 3' direction based on one strand of the double strands constituting the plasmid, unless otherwise specified. Therefore, the description order of the genetic constituent units constituting the vector may not substantially match the direction in which the genome is transcribed, and the direction of transcription of the genome contained in the vector may be a direction from the promoter to a structural gene operably linked to the promoter to be. Thus, in the present invention, the terms "upstream" and "downstream" refer to the relative positions of each nucleic acid unit on the reference strand, unless otherwise specified. Those skilled in the art will readily understand whether the gene is expressed in the sense strand described in the present invention or in its antisense strand by transcriptional orientation.

The term "operably linked" in the present invention means that certain sequences interact directly or indirectly to perform an intended function, such as mediation or regulation of gene expression. The interaction of operably linked sequences may be mediated, for example, by proteins interacting with operably linked sequences. When the transcriptional regulatory region and the sequence of interest are operatively linked, the transcription of the sequence of interest can be mediated or regulated by the transcriptional regulatory region by functionally linking these sequences.

As used herein, the term " promoter " means a transcription initiation region from a structural gene as a broad concept, and more specifically, a DNA capable of regulating the transcription of the specific nucleotide sequence into mRNA when linked to a specific nucleotide sequence. ≪ / RTI > Typically, the promoter is located in the 5 'of the desired nucleotide sequence to be transcribed into mRNA, although not in all cases, and provides a site for RNA polymerase and other transcription factors specifically for transcription initiation. Depending on the type of host cell, it is sometimes understood that the promoter comprises a regulatory sequence such as a UAS (upstream activating sequence).

The promoter of the present invention may be a constitutive or regulatable promoter, preferably a constitutive promoter. The term "constitutive" as used in connection with a promoter means that the promoter can direct transcription of operably linked nucleic acid sequences without stimulation (e.g., heat shock, chemicals, etc.). By contrast, an "adjustable" promoter refers to a promoter capable of directing the transcription level of an operably linked nucleic acid sequence to be distinct from that without stimulation when stimulation (eg, heat shock, chemicals, etc.) is present.

Those skilled in the art can use a suitable promoter depending on the host cell into which the vector is introduced. For example, when the host cell is yeast, the GAL10 promoter, ADH1 promoter, GAL1 promoter, CYC1 promoter and PGK promoter can be used. It does not. In addition, suitable promoters for mammalian cells include, but are not limited to, CMV promoter, HSV-TK promoter, RSV promoter, SV40 promoter and LTR promoter.

The term "two hybrid system " in the present invention means a method for analyzing protein interactions by confirming protein binding using the activation of a reporter gene, and a series of constructs used for this purpose. Generally, a double-hybrid system uses a transcription factor capable of activating a reporter gene divided into two physically discrete module domains, a DNA-binding domain and a transcriptionally active domain. In order to analyze protein interactions using these proteins, recombinant proteins are expressed by fusion to bait and pre-protein, respectively, in which interaction between the DNA-binding domain and the transcriptional activation domain is to be detected, and the expressed recombinant protein is expressed as bait and pre- Binding domain binds to the transcriptional activation domain by the interaction between the DNA-binding domain and the transcriptional activation domain, thereby expressing the reporter gene, thereby confirming the interaction of the two proteins. The basic principle of the dual-hybrid system has been applied to various cells including eukaryotic cells and prokaryotic cells. For example, a plant cell-dual hybrid system (Korean Patent No. 10-1460231), a small-double hybrid system Patent No. 10-0471605), mammalian cell-dual hybrid system (US 6251676 B1), bacterial double-hybrid system (EP 1224324 B1), and the like.

The term "transcription factor" in the present invention refers to a module that binds to the promoter region of DNA to regulate transcription. In the present invention, the term " transcription factor " module type, the type thereof is not particularly limited. But are not limited to, GAL4, GCN4, ARD1, the human estrogen receptor, E. coli LexA and B42 proteins, herpes simplex virus VP16, NF-kB p65, and the like.

Also in the module of the DNA-binding domain (DBD) and the transcriptional activation domain (AD) combination, the two domains may be derived from one transcription factor or from different transcription factors. In the latter, specific types of modules derived from different transcription factors in the art, but having an activity of interacting with each other (triggering transcription of a target gene) are known, and examples thereof include, but are not limited to, GAL4 In the case of DBD, the transcriptional activation domain with which it interacts may be selected from the group consisting of GAL4 AD, VP16 AD, and CR2 AD from MSG1.

In the present invention, the term "bait " refers to a target protein or a nucleotide sequence encoding the target protein to be examined for interaction when confirming protein binding in the study of protein interaction. The bait protein may be fused with a DNA-binding domain or transcriptional activation domain of a transcription factor that activates a reporter gene to confirm protein interactions. In a preferred embodiment of the invention, the bait protein is fused with the DNA-binding domain of the transcription factor.

The term "prey " in the present invention refers to a protein or a nucleotide sequence encoding the protein, which is expected to bind with a target protein when confirming protein binding in a study on protein interaction. The pre-protein may be fused with the DNA-binding domain or transcriptional activation domain of the transcription factor that activates the reporter gene to confirm protein interaction. In a preferred embodiment of the invention, the freeprotein is fused with the transcriptional activation domain of the transcription factor.

The term "linker " in the present invention means any nucleic acid sequence linking two nucleic acids. For example, in the present invention, insertions between a Bait protein and a DBD of a transcription factor or a pre- The two units are connected.

In the present invention, the term "cloning site (or foreign DNA insertion site)" means a site having a set of restriction enzyme sites (meaning sites where restriction enzymes can recognize and / or cleave). That is, a base sequence region configured to include a set of restriction enzyme sites so that a desired gene can be inserted into a vector to facilitate gene manipulation during cloning, wherein at least two restriction enzyme sites constitute one set . The cloning site may comprise more than one restriction enzyme site as a set, but preferably the cloning site of the invention is one in which two restriction enzyme sites for one type of restriction enzyme constitute one set, or two restriction sites The two restriction enzyme sites for the enzyme may be one set. Any of various known restriction enzyme sites may be used in the present invention, but it is preferable to use the restriction enzyme region of type II. Such Type II restriction enzymes include, but are not limited to, Sfi I, BsiW I, Sac II, Xba I, Sac II, Afl II or Age I.

The term " barcode sequences " in the present invention refers to any short nucleic acid sequence which is added in different vectors and which enables to display or distinguish each foreign gene (or gene of interest) added to the vector. In the present invention, the foreign gene (or gene of interest) corresponds to a bait or a prey protein, and a person skilled in the art can arbitrarily select a barcode sequence And establishes the relationship between them. The bar code sequence can be arbitrarily set so that a person skilled in the art can express it according to the bait or the pre-protein inserted into the vector. In the bar code sequence, the number of nucleotides constituting the bar code sequence is not particularly limited, but it may be composed of 1 to 20 nucleotides, preferably 5 to 15 nucleotides.

The term " adjacent " in the context of the present invention may mean that it is within about 1 to 100 bp with respect to the positional relationship of the genetic elements in the construct, preferably between 1 and 50 bp It can mean being away from inside.

The term " site-specific recombination site " or " site-specific recombination site " in the present invention is a short nucleic acid sequence recognized by a recombinase, And constitutes a crossover region. Such site-specific recombinase recognition sequences are known in the art and include, but are not limited to, for example, lox, rox, att, dif, and frt sites.

The term " library " in the present invention means a mixture, collection or set of heterologous polypeptides or nucleic acids. The library consists of members each having a single polypeptide or nucleic acid sequence. Sequence differences between library members are responsible for the diversity that exists in the library. The library may take the form of a simple mixture of polypeptides or nucleic acids, or may be in the form of an organism or cell, such as a bacterium, virus, yeast, animal or plant cell, transformed with a library of nucleic acids.

In the present invention, the term 'Next Generation Sequencing' (NGS) is used interchangeably with the term 'parallel sequencing' as is known in the art.

The present invention

A first promoter;

A DBD coding sequence that binds to the promoter of a host cell reporter gene;

A first cloning site for insertion of a bait protein coding sequence;

A first site-specific recombination site;

A second cloning site for insertion of a barcode sequence representing the bait protein; And

And a second site-specific recombinase recognition sequence.

The first promoter refers to a nucleic acid sequence operatively linked to a DBD located downstream thereof and a bait protein coding sequence linked to the DBD to control transcription of the sequence. The kind of the first promoter can be easily changed by a person skilled in the art according to the type of the host cell or the transcription factor and is well known in the art.

The DBD expressed from the DBD coding sequence binds to the promoter of the host cell reporter gene and affects the transcription activity of the reporter gene. In this case, the reporter gene of the host cell is not particularly limited as long as it is used as a reporter in the conventional dual-hybrid system, but the host cell reporter gene is preferably a recombinant enzyme expression gene. The recombinant enzyme may have a site-specific recombination function, and examples thereof include bacteriophage P1 Cre recombinase, yeast FLP recombinase,? C31 recombinase, Inti integrase, bacteriophage λ recombinase, phi 80 recombinase, P22 recombinase, P2 recombinase, 186 recombinase, P4 recombinase, Tn3 resolvase, Hin recombinase, Cin recombinase, E. coli xerC recombinases, Bacillus thuringiensis recombinase, TpnI and β-lactamase transposons, immunoglobulin recombinases, KD recombinase, R recombinase, B2 recombinase, B3 recombinase, and Dre recombinase.

The first and second site-specific recombinant enzyme recognition sequences to be described later in the donor vector of the present invention can be used by a person skilled in the art to change the sequence types according to the recombinase expressed by the host cell as a reporter, There is known a recombination system of 'recombinase / site-specific recognition sequence' such as Cre / lox system, Flp / FRT system, Dre / rox system, Xer / dif system and phiC31 / att system. It will be apparent to those skilled in the art that these systems can be used to construct first and second site-specific recombinant enzyme recognition sequences in the vector of the present invention.

The 'first cloning site' may be referred to as 'gene insertion site' or the like in the specification of the present invention and consists of a set of restriction enzyme sites as a site for insertion of a bait protein coding sequence. Restriction sites for the cloning of the desired nucleic acid are well known in the art and can be found in the foregoing description.

The DBD coding sequence and the bait protein coding sequence inserted in the first cloning site may be directly linked or linked by a linker sequence. Thus, a linker sequence may be additionally included between the DBD coding sequence and the first cloning site.

The 'first site-specific recombinase recognition sequence' and the 'second site-specific recombinase recognition sequence' in the donor vector are located within the vector at regular intervals, preferably between 500 and 4000 bp (base pair) And may be located at intervals of a range. More preferably, the 'first site-specific recombinase recognition sequence' and the 'second site-specific recombinase recognition sequence' are located at an interval in the range of 750 to 3500 bp, and most preferably in the range of 1500 to 2500 bp, .

In the present invention, the first and second site-specific recombinase recognition sequences are located in the same orientation.

 The first or second site-specific recombinase recognition sequence is not particularly limited as long as it is known in the art. For example, a lox site, a rox site, an att site, a diff site and a frt site, . More specifically, the first or second site-specific recombinase recognition sequence is selected from the group consisting of lox P and its variant, rox and its variant, att P and its variant, dif and its variant, and frt and its variants It can be one. The variant is meant to include a mutant for a sequence known as a wild-type sequence.

Preferably, the first or second site-specific recombinase recognition sequence of the present invention may be a lox site, for example, loxB, loxL, loxR, loxP, loxP3, loxP23 (also referred to in the art as lox23 loxP71 (also referred to in the art as lox5171), loxP71 (also referred to in the art as lox71), loxP66 (also referred to in the art as lox511), loxP86 Also referred to in the art as lox66), M2, M3, M7, M11, and the like. The first or second site-specific recombinase may be the same or different. Most preferably, the first or second site-specific recombinase recognition sequence of the present invention is preferably in the relationship of loxP and loxP mutant (mutant loxP), and the loxP variant (mutant loxP) Which are known and can be referred to in the description of the present invention.

In the donor vector of the present invention, the region consisting of the 'first site-specific recombination site' to the 'second site-specific recombinase recognition sequence' is swiching by the recombinase, And may be referred to herein as the term " donor region ". The portion of the vector other than the donor region is referred to as the non-donor region.

The donor region includes a barcode sequence. That is, the donor region includes a second cloning site for insertion of a barcode sequence representing a bait protein. The second cloning site may be referred to as being compatible with the term " barcode insertion site " in the description of the present invention.

The 'second cloning site' consists of a set of restriction enzyme sites. Restriction sites for the cloning of the desired nucleic acid are well known in the art and can be found in the foregoing description. It is preferable that the second cloning site is directly connected to the downstream of the first site-specific recombinase recognition sequence or is within 1 to 30 bp, preferably within 1 to 20 bp.

Also, the donor region may include a terminator sequence. The term " terminator " refers to an untranslated sequence located downstream in the translation stop codon of a structural gene, operatively linked to a structural gene and regulating transcription termination. The terminator sequence may preferably be located downstream of the bar code sequence in the donor region.

In addition, the donor region may further include one or more marker genes. Preferably, the donor vector of the present invention may further comprise one or more marker genes between the second cloning site and the second site-specific recombinase recognition sequence in the donor region. The marker included in the donor region can be firstly identified as a donor vector of the present invention to confirm whether the host cell has been transformed properly; And secondly the function of confirming whether the bait protein expressed from the donor vector interacts with the expressed protein from the acceptance vector described below.

The marker gene is not particularly limited as long as it is known as a conventional cloning vector marker gene in the art. For example, (i) a drug resistance gene; (Ii) a fluorescent protein coding gene; (Iii) an auxotrophic marker gene; (Iv) a transcription factor gene; And (v) cell surface marker genes.

The drug resistance gene means a gene that imparts a selectable phenotype of a transformant properly transformed by a specific drug treatment, and the drug may be an antibiotic, a cytotoxic agent, or the like. Preferably, the drug resistance gene refers to an antibiotic resistance gene, for example, an ampicillin resistance gene, a kanamycin resistance gene, a chloramphenicol resistance gene, a streptomycin resistance gene, a tetracycline resistance gene, a gentamycin resistance gene, Genes, and the like.

In the above-mentioned fluorescent protein coding gene, the fluorescent protein may be any one known in the art as a fluorescent substance. Examples of the fluorescent protein coding gene include green fluorescent protein (GFP), modified green fluorescent protein, (EFP), red fluorescent protein (RFP), enhanced red fluorescent protein (ERFP), blue fluorescent protein (BFP), enhanced blue fluorescent protein (EBFP), yellow fluorescent protein YFP), enhanced yellow fluorescent protein (EYFP), indigo blue fluorescent protein (CFP), and enhanced blue fluorescent protein (ECFP), preferably using green fluorescent protein (GFP).

The nutritional requirement marker gene is used interchangeably with the term " nutritional marker " in the present description, and is capable of compensating the nutritional requirement of the cell and thus encoding a gene product that imparts nutritional value to the nutritional requirement cell It is a marker sequence. According to the present invention, " nutritional requirement " means that the cell must be grown in a medium having essential nutrients that can not necessarily be produced by the auxotrophic cells themselves. The gene product of the nutritional marker gene promotes the synthesis of the essential imaging element lost in the auxotrophic cells. It will not be necessary to attach essential nutrients to the culture medium in which the cells are grown by the successfully expressed nutritional marker gene. Preferred markers include URA3, LEU2, CAN1, CYH2, TRP1, ADE1, ADE2 and MET5, and the like.

The transcription factor gene is a transcriptional regulatory region of a specific gene, generally a protein involved in induction or inhibition of transcription of the gene by binding to the promoter region, and is not particularly limited as long as it is a protein known in the art. , Cat8, Gal4, Glc7, Hap2, Hxt, Hxk, Lac4, Lac9, Mal63, Mig1, Mig2, Mig3, Mxr1, Oaf1, Sip4, Snf1, Snf3, Rgt2 and URS.

The 'cell surface marker gene' refers to a gene that expresses a specific protein or antigen on a cell surface (that is, cell membrane or cell wall) to give a selectable phenotype of the transformant, But are not limited to, for example,? -Galactosidase, Aga1p / Aga2p, Flo1p, Cwp1p, Cwp2p, Tip1p, Pir1, Pir2, Pir3 and Pir4.

The marker gene contained in the donor region is preferably located in a different translation frame from the DBD and the bait protein coding sequence linked to the DBD. Therefore, it is preferable that the marker gene contained in the donor region is operatively linked to the second promoter located downstream of the marker gene and opposite to the first promoter.

The 'second promoter' is for expressing the marker gene contained in the donor region as described above, and is operatively linked to the marker gene and operates completely independently of the first promoter. The structure linked to the first promoter-DBD and bait protein coding sequences of the present invention and the structure linked to the second promoter-marker gene may be constructed so that the first promoter and the second promoter are separately activated Is preferably inserted into the vector in the direction of the opposite transfer direction.

In one embodiment of the present invention with respect to a marker gene located within the donor region, the donor vector of the invention comprises a marker gene sequentially between a second cloning site and a second site-specific recombinase recognition sequence; And a second promoter having an opposite transcriptional orientation to the first promoter and operatively linked to the marker gene. That is, the donor region of the donor vector of the present invention is sequentially referred to as 'first site-specific recombinase recognition sequence-second cloning site-marker gene-second promoter-second site-specific recombinase recognition sequence for barcode sequence' It can be done.

The kind of the marker gene that can be applied in the above embodiment is not particularly limited, but may preferably be an antibiotic resistance gene, which is described above.

In another preferred embodiment, the donor vector of the present invention comprises a first marker gene sequentially between a second cloning site and a second site-specific recombinase recognition sequence; A second promoter that is opposite in transcriptional orientation to the first promoter and is operably linked to the first marker gene; And a form comprising a first marker gene and a second marker gene different from the first marker gene. That is, the donor site of the donor vector of the present invention is sequentially referred to as a first site-specific recombinase recognition sequence, a second cloning site for a barcode sequence, a first marker gene, a second promoter, a second marker gene, Recombinase recognition sequence ".

In this embodiment, the first marker gene present in the donor region is suitably a selectable marker for screening transformants that have been suitably transformed into the donor vector of the invention. The first marker is operatively linked to a second promoter and is constantly expressed in the transformant into which the donor vector of the present invention is introduced.

In addition, in the above embodiment, the second marker gene present in the donor region is used as a marker for detecting and selecting whether or not the bait and the freeprotein interact with each other. The transformant into which the donor vector of the present invention is introduced, The second marker is not always expressed. That is, within the donor vector, the translation frame (promoter) for transcription or expression of the second marker gene is not contained and the second marker is linked to the 'second promoter-first marker gene' It is in the out of frame. Therefore, the expression of the second marker is not ensured merely by the fact that the donor vector of the present invention is introduced into the transformant, and the recombinant enzyme reporter is expressed in the host cell by the interaction of the second marker with the bait and pre-protein But only when the donor region is recombined in the acceptance vector described later. Therefore, the donor vector is characterized in that it does not contain a regulatory sequence (promoter) for transcription or expression of the second marker gene, which is distinguished from the first marker for screening a transformant. Preferably, the regulatory sequence for transcription or expression of the second marker is contained within the acceptance vector described below, particularly preferably immediately adjacent to the second site-specific recombinase recognition sequence of the acceptor vector.

If the first marker gene and the second marker gene that can be applied in the above embodiment are of different kinds, the combination and the kind of the marker are not particularly limited, and those skilled in the art can change and use the marker by referring to the above description. Preferably, the first marker gene may be an antibiotic resistance gene, and the second marker gene may be a fluorescent protein coding gene.

Further, the donor vector of the present invention may further include a marker gene for a non-donor region which is a portion other than the donor region. The marker gene in the non-donor region may be inserted for the purpose of screening cells transformed with the donor vector of the present invention, and preferably a marker gene inserted in the donor region. Conventional marker genes that can be inserted into vectors are as described above.

The donor vector of the present invention may further include at least one selected from the group consisting of a promoter, a copy origin, an operator, a polyadenylation signal, an enhancer and a secretion signal, and an affinity tag.

As an embodiment of the donor vector according to the present invention, the present invention is a method of removing a multicloning site (MCS) from plasmid pGBKT7, replacing multiple cloning sites (MCS) with two Sfi I restriction sites, followed by a lox2272 sequence and a barcode A pDBD-donor vector characterized in that an insertion site, a kanamycin antibiotic resistance gene and a promoter, a GFP gene, and a loxP sequence are sequentially introduced.

The pDBD-donor vector of the present invention was prepared through gene modification based on the pGBKT7 vector. The multiple cloning site (MCS) was removed, the multiple cloning site (MCS) was replaced with two Sfi I restriction sites, A lox2272 sequence and a barcode insertion site, a kanamycin antibiotic resistance gene and a promoter, a GFP gene and a loxP sequence are sequentially introduced.

The pGBKT7 vector is a yeast two hybrid vector designed to bind to (fusion with) the GAL4 DNA binding domain (DBD) of a target protein, and has a structure similar to that of FIG.

The loxP sequence and the lox2272 sequence are sequences recognized and switched to Cre recombinase. The pDBD-donor vector of the present invention comprises a loxP sequence and a lox2272 sequence recognized and recombined by Cre recombinase, wherein the loxP sequence and the lox2272 sequence are preferably located at intervals of 500 to 4000 bp (base pair) . More preferably, the loxP sequence and the lox2272 sequence may be located at an interval in the range of 750 to 3500 bp, and most preferably in the range of 1500 to 2500 bp, relative to each other. The loxP sequence and the lox2272 sequence of the pDBD-donor vector are located in the same orientation. The GFP gene and the barcode sequence insertion site are introduced between the loxP sequence and the lox2272 sequence.

When a portion between the loxP sequence and the lox2272 sequence is introduced into a pAD-acc vector described later by Cre recombinase, the GFP (green fluorescent protein) gene is expressed by the LEU2 promoter to exhibit fluorescence, and the barcode of the pDBD- The sequence is constructed so that it can be identified (connected to or adjacent to) the bar code sequence of the pAD-acc vector described later (see FIG. 18).

Replacing the 'multiple cloning site (MCS) with two Sfi I restriction enzyme sites' means making the MCS of the existing vector a gene insertion site for the target protein. It is preferable that the gene insertion site allows a desired gene to be introduced by including an arbitrary restriction enzyme recognition site as a site into which a gene of a target protein constituting the library can be inserted, and the restriction enzyme is a known restriction enzyme The kind thereof is not particularly limited, but preferably it can be two Sfi I. The gene to be inserted into the gene insertion site is a target gene to be mutually interacted with a gene to be introduced into a pAD-acc vector to be described later, and its type is not particularly limited.

The barcode sequence insertion site is a sequence representing a bait protein gene introduced into a gene insertion site (between two SfiI restriction enzyme sites) of the pDBD-donor vector. The number of nucleotides is not particularly limited, but 1 to 20 Nucleotides, preferably 5 to 15 nucleotides. It is preferable that the barcode sequence insertion site includes an arbitrary restriction enzyme recognition site so that a desired barcode can be introduced. The restriction enzyme is a known restriction enzyme and its kind is not particularly limited. Preferably, the restriction enzyme is Afl II And Age I.

The pDBD-donor vector of the present invention can be preferably represented by a cleavage map of [Fig. 2]. The pDBD-donor vector represented by the cleaved map in FIG. 2 includes a set of Sfi I restriction sites as a first cloning site for bait protein insertion, Afl II and Age I sets as a second cloning site for a barcode insertion site Of the restriction enzyme recognition sequence. The pDBD-donor vector represented by the cleaved map in Fig. 2 may preferably consist of the nucleotide sequence of SEQ ID NO: 15 and was deposited by the present inventor with the accession number KCTC12790BP.

On the other hand,

A first promoter;

An AD coding sequence to aid transcription of the host cell reporter gene;

A first cloning site for insertion of a pre-protein coding sequence;

A second cloning site for insertion of a barcode sequence representing said pre-protein;

A first site-specific recombinase recognition sequence; And

And a second site-specific recombinase recognition sequence.

The first promoter means a nucleic acid sequence operatively linked to AD and a downstream protein coding sequence linked to the AD located downstream thereof to regulate transcription of the sequence. The kind of the first promoter can be easily changed by a person skilled in the art according to the type of the host cell or the transcription factor and is well known in the art.

The type of AD is not particularly limited as long as it interacts with or binds to the DBD of the donor vector described above, and DBD and AD combinations of transcription factors are as described above.

The 'first cloning site' may be referred to as 'gene insertion site' or the like in the context of the present invention and consists of a set of restriction enzyme sites as a site for insertion of the pre-protein coding sequence. Restriction sites for the cloning of the desired nucleic acid are well known in the art and can be found in the foregoing description.

The AD coding sequence and the pre-protein coding sequence inserted in the first cloning site may be directly linked or linked by a linker sequence. Thus, a linker sequence may be additionally included between the AD coding sequence and the first cloning site.

The second cloning site for insertion of the bar code sequence representing the pre-protein in the acceptance vector is located upstream of the first site-specific recombinase recognition sequence. It is preferable that the second cloning site is directly upstream of the first site-specific recombinase recognition sequence, or is within 1 to 30 bp, preferably within 1 to 20 bp.

The 'first site-specific recombinase recognition sequence' and the 'second site-specific recombinase recognition sequence' in the acceptance vector are located within the vector at regular intervals mutually, preferably between 500 and 4000 bp (base pair) And may be located at intervals of a range. More preferably, the 'first site-specific recombinase recognition sequence' and the 'second site-specific recombinase recognition sequence' are located at an interval of between 500 and 3000 bp, most preferably between 700 and 1200 bp, Lt; / RTI >

The first and second site-specific recombinase recognition sequences of the acceptance vector are the same as the first and second site-specific recombinase recognition sequences of the donor vector, respectively. Thus, according to the combination of 1 and the second site-specific recombinase recognition sequence in the donor vector, one skilled in the art can easily set the first and second site-specific recombinase recognition sequences of the acceptor vector. The first and second site-specific recombinase recognition sequences of the donor vector are as described above.

In the present invention, the first and second site-specific recombinase recognition sequences of the acceptor vector are located in the same orientation. In addition, it is preferable that the first and second site-specific recombinase recognition sequences of the acceptance vector are arranged (or positioned) in the same relative orientation as the first and second site-specific recombinase recognition sequences of the donor vector described above .

In the acceptance vector of the present invention, the region consisting of the 'first site-specific recombination site' to the 'second site-specific recombinase recognition sequence' is swiching by the recombinase, And may be referred to in the present invention as the term " acceptor region ". The portion of the vector other than the receiving region is referred to as the non-receiving region.

The accepting region may include a terminator sequence. The term " terminator " refers to an untranslated sequence located downstream in the translation stop codon of a structural gene, operatively linked to a structural gene and regulating transcription termination. The terminator sequence may preferably be located downstream of the first site-specific recombinase recognition sequence in the accepting region.

In the acceptance vector, the acceptor region is replaced (or substituted, switched, recombined) with the donor region of the donor vector described above by a recombinase expressed as a reporter from the host cell if there is an interaction between bait and pre-protein. As a result, the bait display barcode sequence and the prey display barcode sequence become adjacent to each other with the first site-specific recombinase recognition sequence therebetween.

The acceptor vector may further comprise one or more marker genes in the non-accepting region. Preferably, the acceptor vector further comprises one or more marker genes downstream of the second site-specific recombinase recognition sequence.

The type of the marker gene contained in the acceptance vector is not particularly limited as long as it is known as a conventional cloning vector marker gene in the art, (I) a drug resistance gene; (Ii) a fluorescent protein coding gene; (Iii) an auxotrophic marker gene; (Iv) a transcription factor gene; And (v) cell surface marker genes. It is preferable that the marker gene contained in the acceptance vector is not the same as the marker gene used in the donor vector, and the specific kind of the marker gene is as described above in the description of the donor vector.

The marker gene contained in the non-accepting region is preferably located in a different translation frame from the pre-protein coding sequence linked to AD and AD described above. Therefore, it is preferable that the marker gene contained in the non-accepting region is operatively connected to a second promoter located downstream of the marker gene and opposite to the first promoter.

The 'second promoter' is for expressing the marker gene contained in the non-accepting region as described above, and is operatively linked to the marker gene and operates completely independently of the first promoter. The structure connected to the first promoter-AD and the pre-protein coding sequence of the present invention and the structure linked to the second promoter-marker gene is such that the first promoter and the second promoter are operably linked to each other Is preferably inserted into the vector in the direction of the opposite transfer direction.

In one embodiment of the present invention with respect to a marker gene located in the non-accepting region, the acceptor vector of the present invention comprises a second site-specific recombinase recognition sequence sequentially downstream thereof, a first Marker genes; And a second promoter having an opposite transcriptional orientation to the first promoter and operatively linked to the first marker gene. That is, in the acceptor vector of the present invention, the non-accepting region located downstream of the second site-specific recombinase recognition sequence is referred to as a 'second site-specific recombinase recognition sequence-translation termination codon First marker gene-second promoter ".

In this embodiment, when the donor region is recombined in the acceptor vector due to the expression of the recombinase reporter in the host cell by interaction of bait and prey protein, the second marker (derived from the donor vector) of the donor region (In frame) expressed in a translation frame by the second promoter of the accepting vector.

In addition, the acceptor vector of the present invention may further comprise a second marker gene downstream of the second promoter; And a third promoter having an opposite transcriptional orientation to the first promoter and operatively linked to the second marker gene. That is, in the acceptor vector of the present invention, the non-accepting region located downstream of the second site-specific recombinase recognition sequence is referred to as a 'second site-specific recombinase recognition sequence-translation termination codon A second marker gene having an opposite transcriptional orientation to the first promoter and operatively linked to the first marker gene, a second marker gene having an opposite transcriptional orientation to the first marker gene and operably linked to the second marker gene Third promoter ".

The second marker gene of the acceptor vector may be inserted for the purpose of screening cells transformed with the acceptor vector of the present invention, and it is preferable to use a marker gene other than the marker gene inserted into the donor vector. Conventional marker genes that can be inserted into the vector are as described above, and preferably the second marker gene of the acceptor vector may be an antibiotic resistance gene.

The acceptor vector of the present invention may further comprise at least one selected from the group consisting of a promoter, an origin of replication, an operator, a polyadenylation signal, an enhancer and an secretion signal, and an affinity tag.

As an embodiment of the acceptance vector of the present invention, the present invention is characterized in that a loxP sequence is inserted at the LEU2 gene end of the plasmid pGADT7, the multiple cloning site (MCS) is replaced with two Sfi I restriction sites, , and lox2272 sequences are sequentially introduced.

The pAD-acc vector of the present invention was prepared through gene modification based on the pGADT7 vector. The pAD-acc vector was constructed by inserting the loxP sequence at the end of the LEU2 gene (based on the transcription direction) and introducing multiple cloning sites (MCS) into two Sfi I restriction sites , Followed by a barcode insertion site and a lox2272 sequence, which are sequentially introduced.

The pGADT7 vector is a yeast two hybrid vector designed to be expressed by binding (fusion) of a target protein to the GAL4 activation domain (AD), and has the same structure as that of the cleavage map of [Fig. 3].

The LEU2 gene is an upstream regulator of leucine and is generally used for yeast screening and is basically contained in the pGADT7 vector. The LEU2 gene is regulated in its expression by an operably linked LEU2 promoter.

The loxP sequence and the lox2272 sequence are sequences recognized and switched to Cre recombinase. The loxP sequence and the lox2272 sequence in the pAD-acc vector are spaced apart from each other by a predetermined distance and are preferably located within the vector, preferably at intervals of 500 to 4000 bp (base pair) . More preferably, the loxP sequence and the lox2272 sequence may be located at an interval in the range of 500 to 3000 bp, and most preferably in the range of 700 to 1200 bp, relative to each other. The loxP sequence and the lox2272 sequence of the pAD-acc vector are located in the same orientation. The loxP sequence and the lox2272 sequence of the pAD-acc vector are preferably arranged (or positioned) in the same relative orientation as the loxP sequence and the lox2272 sequence of the pDBD-donor vector. The vector of the present invention is constructed so that the loxP sequence is located at the lower end of the LEU2 gene (based on the transcription direction), and expressed by Cre recombinase when another sequence (gene) binds to the lower end of LEU2. For this purpose, the end of the LEU2 gene in which the loxP sequence is introduced is constructed so as not to stop the expression at the end of LEU2 upon elimination of the stop codon. In addition, a barcode sequence insertion site is introduced in front of the lox2272 sequence so that the barcode sequence inserted at the barcode sequence insertion site is bonded or adjacent to another barcode sequence (i.e., a barcode sequence from the pDBD-donor vector) moved by Cre recombinase Consists of. FIG. 5 shows a cleavage map of a vector after a partial sequence (both sequences flanked by loxP and lox2272) from the pDBD-donor vector was switched to pAD-acc vector by Cre recombinase. The process and the result are shown in Fig.

Replacing the 'multiple cloning site (MCS) with two Sfi I restriction enzyme sites' means making the MCS of the existing vector a gene insertion site for the target protein. It is preferable that the gene insertion site allows a desired gene to be introduced by including an arbitrary restriction enzyme recognition site as a site into which a gene of a target protein constituting the library can be inserted, and the restriction enzyme is a known restriction enzyme The kind thereof is not particularly limited, but preferably it can be two Sfi I. The gene to be inserted into the gene insertion site is a target gene to be mutually interacted with a gene introduced into the pDBD-donor vector, and its kind is not particularly limited.

The barcode sequence insertion site is a sequence representing a freeprotein gene introduced into a gene insertion site (between two SfiI restriction enzyme sites) of the pAD-acc vector. The number of nucleotides is not particularly limited, but 1 to 20 Nucleotides, preferably 5 to 15 nucleotides. It is preferable that the barcode sequence insertion site includes an arbitrary restriction enzyme recognition site so that a desired barcode can be introduced. The restriction enzyme is a known restriction enzyme and its kind is not particularly limited. Preferably, the restriction enzyme is a BsiW I , XbaI and SacII, for example a set of BsiW I and Sac II or a set of XbaI and Sac II.

The pAD-acc vector of the present invention can be preferably represented by a cleavage map of [Figure 1] or [Figure 10]. The cleavage maps of FIGS. 1 and 10 are identical except for the restriction enzyme recognition sequence included in the barcode insertion site. The barcode insertion site of the pAD-acc vector represented by the cleaved map in Fig. 1 contains the restriction enzyme recognition sequence of BsiW I and Sac II, and the bar code insertion site of the pAD-acc vector represented by the cleaved map of Fig. Contains the restriction enzyme recognition sequence of Sac II.

The pAD-acc vector represented by the cleaved map in Fig. 1 may preferably consist of the nucleotide sequence of SEQ ID NO: 16.

The pAD-acc vector represented by the cleaved map in FIG. 10 may preferably consist of the nucleotide sequence shown in SEQ ID NO: 17, and deposited by the present inventor with the accession number KCTC12791BP.

The present invention provides a kit for protein interaction detection comprising the donor vector and the acceptor vector.

In addition to the donor and acceptor vectors, the kit for protein interaction detection according to the present invention may further comprise a material such as a restriction enzyme, a primer, or a buffer for inserting a target nucleic acid into the vectors, And all biological or chemical reagents necessary for screening of transformed cell lines, including, for example, transfection agents, < RTI ID = 0.0 > In addition, the kit of the present invention may further include experimental tools such as a tube and a well plate to be used for mixing the components as needed, and instructional materials (instruction manuals) describing the methods of use. In addition, the construction of the kit of the present invention can be suitably selected by those skilled in the art.

The present invention also provides a method for detecting protein interactions using the donor and acceptor vectors. Specifically,

(a) preparing a bait library by introducing a bait protein coding sequence and a barcode sequence representing the bait protein into the donor vector;

(b) introducing a prey protein coding sequence and a barcode sequence representing the pre-protein into the acceptor vector to prepare a pre-library;

(c) introducing the bait library and the prey library into a host cell expressing the recombinant enzyme as a reporter; And

(c) detecting the expression of the reporter from the host cell and detecting bait-prey protein binding pairs.

 The protein interaction detection method provided in the present invention is based on the existing dual-hybrid system. However, by using the above-described donor vector and acceptor vector of the present invention, it is possible to detect the protein interactions between the protein libraries (Bait protein library and pre- This allows for the detection of protein interactions that occur as a result. In addition, using the bar code sequences contained in each vector, it provides an advantage in the processing of large amounts of information to identify proteins that interact with each other in library protein reactions.

The 'bait library' refers to a total collection of nucleic acids encoding mutated bait proteins. In the present invention, the bait library is prepared by inserting different bait protein coding sequences and a barcode sequence representing the bait protein for each of the donor vectors of the present invention.

The term 'prey library' refers to a total collection of nucleic acids encoding different prey proteins. In the present invention, the prey library is prepared by inserting a different pre-protein coding sequence and a bar code sequence representing the pre-protein for each of the acceptance vectors of the present invention.

In the meantime, standard recombinant DNA and molecular cloning techniques used in the present invention are well known in the art and can be found in the following references (Sambrook, J., Fritsch, EF and Maniatis, T., Molecular Cloning: A Laboratory Manual, 2nd ed., Cold Spring Harbor Laboratory, Cold Spring Harbor, NY (1989); by Silhavy, TJ, Bennan, ML and Enquist, LW, Experiments with Gene Fusions, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY (1984); and by Ausubel, FM et al., Current Protocols in Molecular Biology, published by Greene Publishing Assoc. And Wiley-lnterscience (1987)).

The host cell may be a prokaryotic or eukaryotic cell. For example, eukaryotic cells may be of the species including fungi (yeast), insects and mammalian cells, and prokaryotic cells may include bacteria (e.g., Escherichia coli ) It does not.

In the present invention, the host cell expresses a recombinant enzyme as a reporter, and the recombinant enzyme is inserted into the donor vector used in the step (a) and the site-specific It is preferably a recombinant enzyme capable of recognizing the recombinase recognition sequence. The specific relationship between the site-specific recombinase recognition sequence contained in the donor vector and the acceptor vector and the recombinase expressed by the host cell as a reporter and the recombination system using the same are known in the art as described above, And the constitution of the protein interaction detection method of the present invention can be combined using this.

On the other hand, as the host cells, the present invention provides dual reporter yeast strains simultaneously containing the expression cassettes of (i) and (ii) below;

(i) a c-myc reporter expression cassette comprising a GAL4 upstream activation sequence, GAL1 promoter, MFα1 gene, c-myc epitope-encoding polynucleotide and AgαI gene operably linked in sequence; And

(ii) a Cre reporter expression cassette comprising a GAL4 upstream activation sequence, GAL1 promoter and Cre recombinase expression gene operably linked in sequence.

In the present invention, the term 'expression cassette' refers to a nucleic acid construct which is used interchangeably with an 'expression construct' and is capable of expressing a desired structural gene. The expression cassette may include a suitable promoter and a structural gene operably linked thereto, .

The double-reporter yeast strain contains the Cre reporter system (shown in Fig. 11B) by the c-myc reporter system (shown in Fig. 11A) by the expression cassette of (i) and the expression cassette of (ii) It is characterized by having a dual reporter system.

The yeast strain may be any yeast two hybrid strain. Examples of such strains include Saccharomyces spp., Kluyveromyces spp. Such as Schizosaccharomyces spp., Pichia spp., Paffia spp., Candida spp., Talaromyces spp., Bretanomis spp. and the like in (Brettanomyces spp.), Parkinson solren in (Pachysolen spp.) or Deva Rio in MRS (Debaryomyces spp.), is not limited to this.

The strain may be preferably a strain of the genus Saccharomyces, more preferably a strain of the genus Saccharomyces cerevisiae .

The c-myc reporter expression cassette of (i) may be referred to herein as a '1st reporter' or a '1st reporter system', and may include a GAL4 upstream activation sequence, a GAL1 promoter, , MF alpha 1 gene, c-myc epitope-encoding polynucleotide and Ag alpha I gene.

The GAL4 UAS refers to a sequence to which the DNA binding domain (DBD) of the GAL4 transcription factor can bind. In a dual-hybrid system using a GAL4 transcription factor, the DNA binding domain (DBD) and the transcriptional activation domain (AD) of the GAL4 transcription factor are respectively fused with bait and pre-protein (these are usually referred to as DBD-Bait and AD-Prey, ) And expressed in yeast strains. When DBD-Bait and AD-Prey interact, the GAL4 transcription factor is activated and a report sequence that is operatively linked to the lower level is transcribed.

The GAL1 promoter is operably linked downstream of the GAL4 UAS. In the present invention, the nucleic acid sequence of the GAL1 promoter is not limited thereto, but may be, for example, the nucleotide sequence of SEQ ID NO: 24.

The MF? 1 gene is a secretory signaling factor for the secretion of a protein (c-myc epitope in the present invention) by a foreign gene in yeast. In the present invention, the nucleic acid sequence of the MFα1 gene is not limited thereto, but may be, for example, a nucleotide sequence of SEQ ID NO: 25.

The c-myc epitope (antigenic determinant) coding polynucleotide was constructed to express only a specific epitope of the Myc protein. The sequence structure of the c-myc epitope-encoding polynucleotide of the present invention is not limited thereto, but may be, for example, the nucleotide sequence of SEQ ID NO: 26. The c-myc epitope may be a repetitive form of the c-myc epitope (i.e., a c-myc epitope linked to the first c-myc epitope and repeatedly expressed). The number of repeating times is not particularly limited, but may be 1 to 20 times, preferably 1 to 10 times.

Agα1 gene is a gene that expresses alpha-agglutinin, a cell surface glycoprotein of yeast strain. The Ag [alpha] l gene is linked to a c-myc epitope-encoding polynucleotide. Therefore, when bait and prey interact with each other in yeast two hybrid experiments, alpha-agglutinin is expressed on the cell surface together with the c-myc epitope, so that the c-myc epitope is exposed on the cell surface. In the present invention, the nucleic acid sequence of the Agα1 gene is not limited thereto, but may be, for example, a nucleotide sequence of SEQ ID NO: 28.

In the above (i) c-myc reporter expression cassette, the c-myc epitope-encoding polynucleotide and the Ag? I gene may be those in which the nucleic acid is directly linked or linked by a linker.

The term " linker " in the present invention means any nucleic acid sequence linking two nucleic acids. In the present invention, the linker connecting the c-myc epitope-encoding polynucleotide and the Ag? I gene is not particularly limited in its sequence structure but preferably has a nucleic acid sequence encoding a peptide fragment comprising glycine or / and serine Lt; / RTI > The number and combination of glycine and serine constituting the peptide fragment are not particularly limited, and it is obvious to those skilled in the art that the structure of the linker can be easily set according to the purpose. For example, in the present invention, the linker connecting the c-myc epitope-encoding polynucleotide and the Ag? I gene may comprise the nucleotide sequence of SEQ ID NO: 27.

Most preferably, the c-myc reporter expression cassette of (i) may be operably linked to the DNA sequence represented by SEQ ID NO: 13 downstream of the GAL4 UAS. The DNA sequence of SEQ ID NO: 13 is characterized in that 10 repeats of the c-myc epitope are inserted.

When the bait and prey introduced into the double-reporter yeast strain interact with each other to activate the GAL4 transcription factor, the sub Myc protein (particularly the c-myc epitope) is expressed on the cell surface and detected by bait You can see if prey is interacting.

 The method for detecting the cell surface expression of the Myc protein can be performed by a known protein detection method, and preferably includes an antibody specifically binding to the Myc protein (particularly the c-myc epitope) and an identifiable label And may be a detection method by an antibody that specifically binds to the antibody.

When the antibody is used, known cell detection or cell sorting methods using the binding specificity of the antibody may be used, but may be by a magnetic-activated cell sorting (MACS) method.

The identifiable label may preferably be a fluorescent substance, and more preferably a fluorescent substance of the cyanine series. The method for detecting the expression of the fluorescent substance is not particularly limited as long as it is a known fluorescence analysis method. Preferably, the method can be applied to a fluorescence-activated cell sorting (FACS) method, a fluorescence microscope have.

The Cre reporter expression cassette of (ii) above may be referred to herein as a " 2nd Reporter " or a " 2nd Reporter System ", and is operably linked in sequence and comprises GAL4 upstream activation sequence, GAL1 promoter and Cre recombination Enzyme (Cre recombinase) expression gene.

The GAL4 upstream activation sequence (UAS) and the GAL1 promoter are as described above. The 'Cre recombinase expression gene' is used interchangeably with the term 'CRE gene' in the present specification. The Cre recombinase is a tyrosine recombinase derived from P1 bacterial phage, and is known as an enzyme used for inducing Cre-Lox site recombination. As long as a protein having a known Cre recombinase activity is encoded, the specific nucleotide sequence of the Cre recombinase expression gene in the present invention is not particularly limited, but may be, for example, a nucleotide sequence of SEQ ID NO: 29.

Most preferably, the Cre reporter expression cassette of (ii) may be operably linked to the DNA sequence represented by SEQ ID NO: 14 downstream of the GAL4 UAS.

When the bait and prey introduced into the double reporter yeast strain interact with each other to activate the GAL4 transcription factor, the Cre recombinase is expressed. Therefore, it is possible to directly detect the Cre recombinase or to detect the genetic change generated in the cell due to the expression of the Cre recombinase, thereby confirming whether or not the bait and prey interact with each other.

The method for directly detecting the Cre recombinase may be a known protein detection method, preferably an antibody that specifically binds to the Cre recombinase and an antibody that specifically binds to the antibody, As shown in FIG. The kind of the label is not particularly limited as long as it is used in the art as a protein or an antibody labeling substance, but it may preferably be a fluorescent substance. The method of detecting the expression of the fluorescent substance is not particularly limited as long as it is a known fluorescence analysis method. Preferably, the method can be applied to a fluorescence-activated cell sorting (FACS) method capable of fluorescence analysis and classification of a fluorescently expressed cell, have.

As a method for detecting a genetic change generated in a cell due to expression of the Cre recombinase, specifically, a Cre-lox recombination system is introduced into the yeast of the present invention, It can be a way to detect. This may require prior work to introduce one or more lox sites into the genome of the yeast strain and / or into the foreign nucleic acid (e. G., Vector, etc.) to be introduced into the yeast strain before the bait and prey proteins are expressed in yeast cells have. The lox site is as described above.

When the Cre recombinase is expressed, recombination occurs in the nucleic acid region containing the lox site, resulting in a change in the nucleic acid sequence, and the altered nucleic acid sequence can exhibit a substantial phenotype.

The altered nucleic acid sequence may be detected by a known sequencing method. The sequencing method is not limited thereto, but may be performed by a method such as Sanger sequencing or NGS (Next Generation Sequencing).

In addition, if the altered phenotype appears in the cell due to the changed nucleic acid sequence, the interaction phenotype may be detected to determine the interaction between the bait and prey proteins.

The change expression type is meant to include both a new expression of a phenotype not previously shown or a combination of a phenotype.

For example, when one or more lox sites are positioned near a marker gene that does not belong to any translation frame (frame), the expression When lox site recombination occurs by recombinase, the positions of the nucleic acid sequences in the frame can be switched so that the marker gene enters the translation frame, and thus a marker gene that has not been expressed before is expressed Resulting in a change in phenotype.

The combination of phenotypes resulted in lox site recombination by Cre recombinase expressed by bait and prey protein interactions, for example, when one or more lox sites were placed near one translation frame for a marker gene The entire translation frame of the marker gene may be switched to another location on the dielectric to represent a plurality of phenotypes.

The type of the marker gene is not particularly limited, and includes, for example, a drug resistance gene, a fluorescent protein coding gene, a nutritional requirement marker gene, and the like. In the present invention, it may be preferable to use a fluorescent protein coding gene as the marker gene. In this case, the cells can be easily detected by fluorescence-activated cell sorting (FACS) Can be selected.

 In the double reporter yeast strain, the 1st reporter system and the 2nd reporter system may be located in different regions in the yeast dielectric. That is, the 1st reporter system and the 2nd reporter system may be located on different chromosomes.

The double reporter yeast strain was deposited with the present inventor as KCTC12792BP. As the first reporter system, the c-myc reporter expression cassette in which the DNA sequence represented by SEQ ID NO: 13 is operatively linked is contained in the chromosome 15 of the yeast genome, downstream of GAL4 UAS, and GAL4 UAS The Cre reporter expression cassette in which the DNA sequence represented by SEQ ID NO: 14 is operatively linked is contained in the chromosome 5.

As used herein, the term 'introduction' refers to transformation to express a nucleic acid in a host cell, and transformation with a vector of a host cell can be carried out by a transformation method known in the art, for example, calcium phosphate method, calcium chloride method, Microprojectile bombardment, electroporation, particle gun bombardment, silicon carbide whiskers, sonication, PEG-mediated (PEG-mediated) fusion, microinjection, liposome-mediated method, magnetic nanoparticle-mediated method, and the like, but the present invention is not limited thereto.

When the expression of the reporter from the host cell is examined, it is possible to detect bait-prey protein binding pairs. In particular, when the recombinase is expressed as a reporter, the combination of the donor vector and each barcode sequence contained in the acceptance vector are combined (See Fig. 14). By using the bar code sequence thus adjacently combined, not only the presence or absence of the interaction of the protein can be detected by PCR, but also the simultaneous analysis of a large amount of proteins between the library and the library through the bar code reading through NGS The intensity difference of protein interactions can also be detected.

In the method for detecting protein interactions of the present invention, the most preferred method may be as follows;

(a) constructing first and second libraries by introducing different barcode sequences into the pAD-acc vector and the pDBD-donor vector, respectively, and recombining the genes expressing different target proteins;

(b) introducing said first and second libraries into said double reporter yeast strain;

(c) a protein expressed from the gene introduced into the pAD-acc vector and a protein expressed from the gene introduced into the pDB-donor vector interact with each other from the yeast strain into which the first library and the second library are introduced Selecting yeast strains; And

(d) identifying the barcode sequence of the selected yeast strain to select the interacting protein.

Hereinafter, the method will be described step by step.

In step (a), the first and second libraries are constructed by introducing different bar code sequences into the pAD-acc vector and the pDBD-donor vector, respectively, and recombining the genes expressing different target proteins.

The above pAD-acc vector, pDBD-donor vector and barcode sequence are as described above. A schematic diagram of the vectors is provided in Figures 14A and 14B.

The barcode is a sequence introduced to identify a gene to be recombined, and it is preferable that a different barcode sequence is introduced depending on a target protein gene (that is, a bait protein gene or a freeprotein gene) recombined in each vector. The bar code sequence is inserted into the pAD-acc vector and the bar code sequence insertion site of the pDBD-donor vector.

The target protein gene refers to a DNA (gene) encoding a protein to be examined for interaction, and is inserted into a gene insertion site (between two Sfi I sites) of a pAD-acc vector and a pDBD-donor vector.

The method of recombining the bar code sequence and the gene into the vector of the present invention can be carried out by a known gene manipulation method.

The first library of the present invention refers to a group of pAD-acc vectors into which a target protein gene (in particular, a freeprotein gene) and a barcode sequence are introduced, and a second library contains a target protein gene (in particular, a bait protein gene) PDBD-donor vector group.

In the step (b), the first and second libraries are introduced into the double reporter yeast strain of the present invention. The method of introducing the library of the present invention into yeast strains can be performed by a known yeast transformation method.

In step (c), a yeast strain in which a protein (AD-Prey) expressed from a gene introduced into a pAD-acc vector interacts with a protein expressed from a gene introduced into a pDBD-donor vector (DBD-Bait) is selected .

Since the yeast strain of the present invention has a dual reporter system of (i) and (ii) described above, when the AD-Prey interacts with the DBD-Bait, the reporter system of (i) myc epitope is expressed on the surface of the yeast cell wall, and various phenotypes are expressed by the reporter system of (ii), such as expression of GFP, barcode sequence combination, resistance to two or more antibiotics.

More specifically, the Cre recombinase produced by the expression of the CRE gene of the reporter system (ii) in the yeast two hybrid process of yeast strain of the present invention in the yeast two hybird process is described in relation to the phenotype of the reporter system of (ii) Recognize the loxP and lox2272 sequences of the introduced pAD-acc vector and pDBD-donor vector and recombine them. Expression of GFP protein by recombination with Cre recombinase of the above two vectors (GFP is linked in such a manner that GFP is expressed at the bottom of LEU2 by recombination, that is, GFP is in frame in LEU2 translation frame) and combination of barcode sequence (the bar code sequence of the pDBD-donor vector is transferred to the pAD-acc vector), and the expression of the GFP protein is detected to select a strain in which the interaction between bait and prey occurs, The pAD-acc vector and the pDBD-donor vector can be used to identify the interacting protein by identifying the barcode sequence. The identification refers to identifying the polynucleotide sequence of the barcode and can be identified by a known sequencing method. The method of detecting the expression of the GFP protein is not particularly limited as long as it is a known fluorescence analysis method. Preferably, the fluorescence-activated cell sorting (FACS) method capable of fluorescence analysis and classification of fluorescently expressed cells can be used. In addition, the combination of the above-mentioned barcode sequences can detect the presence or absence of the interaction of the protein through PCR, and can also be used for the simultaneous analysis of proteins in a large amount of library-library through bar code reading (bacord reading) The intensity difference of action is also detectable.

 Using these phenotypes, yeast strains that interact with AD-Prey and DBD-Bait can be selected. FIG. 14C shows a schematic diagram of a vector reconstructed by the reporter system of (ii) when the AD-Prey interacts with DBD-Bait, and specifically shows a cleavage map thereof in FIG.

For example, the primary antibody that specifically binds to the Myc protein (particularly, the c-myc epitope) is bound to the Myc protein and the 1 < st > A secondary antibody that specifically binds to a secondary antibody and binds to a secondary antibody labeled with a fluorescent substance (in particular, a cyanine family) and is screened using a fluorescence microscope or FACS; a method in which a primary antibody that specifically binds to Myc protein is added to a protein A method of screening by performing MACS using magnetic beads coated with an antibody that specifically binds to the primary antibody, a method of selecting and treating two or more kinds of antibiotics, a fluorescence microscope observation of GFP or a FACS And then performing a screening process. In particular, the method using MACS or FACS in the present invention can treat a large amount of strains with much less time and labor even without using agar medium, compared with yeast two hybrid screening using conventional agar medium, Do.

In step (d), the bar code sequence of the selected yeast strain is identified, and the proteins of the genes are identified and selected.

The bar code sequence in step (d) is a combination of the respective bar code sequences introduced together with a gene encoding Prey and Bait in the pAD-acc vector and the pDBD-donor vector in step (a). The yeast strain of the present invention produces Cre recombinase when Prey and Bait interact, and binds (or adjoins) the bar code sequence contained in the pAD-acc vector and the pDBD-donor vector. That is, since the bar code sequence contained in the pDBD-donor vector is transferred into the pAD-acc vector, each bar code sequence is adjacent to a specific nucleic acid combination. As described above, it can be understood that the protein interaction detection method of the present invention is based on a barcode transfer assay.

In the library construction, it is examined how the genes introduced into each vector match with the bar code sequence. Therefore, it is possible to identify which proteins interact with each other through identification of the bar code sequence of the selected yeast strains, You can easily check. The method of identifying the bar code sequence may be performed by sequencing (for example, Sanger sequencing, NSG), which is a known polynucleotide sequence discrimination method.

Detection of protein interactions using the donor and acceptor vectors of the invention with specific constructs results in simultaneous protein interactions in the protein libraries (the bait protein library and the pre-protein library) Not only does this allow for detection, but it also provides an advantage in the processing of large amounts of information to identify proteins that interact with each other in library protein reactions using the bar code sequences contained in each vector.

Figure 1 is a cleavage map of the pAD-acc vector of the present invention.
Figure 2 is a cleavage map of the pDBD-donor vector of the present invention (Accession No. KCTC12790BP).
Fig. 3 is a cleavage map of the pGAADT7 AD vector, which is a basic vector for producing the pAD-acc vector of the present invention.
FIG. 4 is a cleavage map of the pGBKT7 vector, which is a basic vector for producing the pDBD-donor vector of the present invention.
FIG. 5 shows a cleavage map of a vector after some sequences are switched from a pDBD-donor vector to a pAD-acc vector by the Cre recombinase of the present invention. Specifically, it shows the vector cleavage map after recombination by lox site between the pAD-acc vector having the cleaved map of FIG. 1 and the pDBD-donor vector having the cleavage map of FIG. 2.
FIGS. 6 and 7 are fluorescence micrographs showing that the reporter gene of the yeast is functioning after transfection of the vector of the present invention in which p53 and SV40 large T antigen are introduced into the yeast strain of the present invention (p53 (WT): wild type Murine p53; p53 (D278G, 34%): a mutation that changed the 278th amino acid D (aspartic acid) of p53 protein to G (Glycine), decreased binding capacity to SV40 LT by 34%; p53 (V144G, 4.9% (E255K, 1.5%): The 255th amino acid E (Glutamic acid) of the p53 protein is converted to K (Lysine) by the mutation of the amino acid V (Valine) A mutated mutation, reduced binding to SV40 LT by 1.5%; Lamin A: a protein that does not interact with the p53 protein at all (Negative control).
FIG. 8 is a graph showing a result of detecting and isolating yeast cells having protein interaction by FACS after transforming the vector of the present invention into which p53 (wild type and its muatant) and SV40 large T antigen were introduced into the yeast strain of the present invention, (WT) and Sv40 T, Fig. 8b: D278G (34%) and Sv40 T, and Fig. 8c (a) shows the result of analysis of GFP (Cre recombinase expression confirmation) : V144G (4.9%) and Sv40T, Figure 8d: E255K (1.5%) and Sv40T, Figure 8e: Lamin A and Sv40 T).
FIG. 9 is a graph showing the result of detection and isolation of yeast cells in which protein interactions have occurred after transfection according to the present invention vector in which p53 and SV40 large T antigen are introduced into yeast strain of the present invention (X axis: GFP expression intensity, Y axis : Cy5 expression intensity, Figure 9a: p53 (WT) and Sv40 T, Figure 9b: D278G (34%) and Sv40 T, Figure 9c: V144G (4.9%) and Sv40 T, Figure 9d: E255K T, Figure 9e: Lamin A and Sv40 T).
10 is a cleavage map of another form of pAD-acc vector (Accession No. KCTC12791BP) in the present invention.
Figure 11 shows two reporter systems included in the yeast cells of the present invention (A: c-myc reporter system, B: Cre reporter system)
12 is a schematic diagram showing that a c-myc epitope is expressed on the yeast cell wall when two desired proteins interact with each other by a c-myc reporter system.
Figure 13 shows several implementations of a c-myc reporter expression system for a c-myc reporter system (A: 10 repeats of c-myc, 5 repeats of c-myc, )
14 is a schematic diagram showing that the pDBD-donor vector (A) and the pAD-acc vector (B) are recombined (C) by the cre reporter system.
Figure 15 shows the signal intensity according to the number of c-myc epitope repeats in the c-myc reporter system.
FIG. 16 shows the results of screening of MACS according to protein interaction and the result of GFP using yeast using the dual reporter Y2H system of the present invention.
FIG. 17 is a graph showing the result of MACS screening by fluorescence signal according to protein interaction by performing MACS once and twice in yeast using the dual reporter Y2H system of the present invention.
FIG. 18 shows binding positions of the primers A, B and C used in the present invention, which are generated as a result of barcode transfer by expression of Cre recombinase in the present invention, to detect the barcode combination.
FIG. 19 is a result of detecting whether or not bar codes are combined according to the protein interaction in yeast to which the dual reporter Y2H system of the present invention is applied by the PCR method.
FIG. 20 is a graph showing the results of detection of the combination of bar codes according to protein interaction by the PCR method on the colonies produced after the treatment with the two antibiotics in the yeast to which the dual reporter Y2H system of the present invention was applied.
FIG. 21 shows the bar code read value according to the protein interaction intensity, using the NGS analysis method.

22 shows the bar code read value according to the protein-protein interaction strength between the library and the library, using the NGS analysis method.
FIG. 23 shows the result of aligning the top 36 in order of NGS result bacord read count with respect to FIG. 22. FIG.
FIG. 24 shows data showing that the cell sorting ability is changed by MACS according to the protein interaction intensity. As the protein interaction intensity is strong, cell sorting by MACS is performed well and the result is confirmed by fluorescence intensity (FIG. 24a: Figure 24b: D278G (34%) and Sv40T, Figure 24c: V144G (4.9%) and Sv40 T, Figure 24d: E255K (1.5%) and Sv40 T, Figure 24e: Lamin A and p53 (WT) Sv40 T).

Hereinafter, the present invention will be described in detail by way of examples.

However, the following examples are illustrative of the present invention, and the present invention is not limited to the following examples.

< Example  1>

Mega-throughput with dual reporter system Y2H  Yeast strain development

<1-1> c- myc Epitope  1st to express reporter  Expression cassette

(Expression cassette) of the 'Gal1 promoter MFα1-myc10 repeats-Glycine / Serine linker-AgαI (C-term)' of SEQ ID NO: 13 downstream of GAL4 UAS (upstream activation sequence) c-myc reporter system.

At this time, an expression construct (see FIG. 13) in which the number of myc repeats in the expression construct was 0, 1, 5, 10 (myc10 repeats) was produced and introduced into yeast, The mouse α-myc antibody (c-Myc Antibody (9E10) (Santa Cruz sc-40)) and goat α-mouse IgG-Cy5 antibody (A10524 of Molecular probe) were treated with a fluorescent microscope Respectively.

As a result, as shown in Fig. 15, it was confirmed that the fluorescence expression was strong in c-myc 10 repeat, which was confirmed in the subsequent experiments.

<1-2> Cre recombinase 2nd reporter  Expression cassette

A Cre reporter system with the 'GAL1 promoter-CRE recombinase' of SEQ ID NO: 14 linked downstream of the GAL4 UAS (upstream activation sequence) was constructed.

<1-3> c- myc  The reporter expression cassette and Cre  Production of yeast strains simultaneously containing reporter expression cassettes

Yeast strains in which the expression constructs 1-1 and 1-2 were permanently expressed were prepared. The expression construct of the 'Gal1 promoter MFα1- myc10 repeats-Glycine / Serine linker-AgαI (C-term)' of SEQ ID NO: 13 is located downstream of the GAL4 UAS (upstream activation sequence) in chromosome 15, The 'GAL1 promoter-CRE recombinase' expression construct of SEQ ID NO: 14 is located downstream of the GAL4 UAS (upstream activation sequence) in chromosome 5.

Specifically, c-myc reporter and Cre reporter was produced co-expression of yeast strain 'SK10-CRE (Accession No. KCTC12792BP)', wherein the yeast strain has a genotype in Table 1 below.

Strain name Genotype SK10-CRE MATa, GAL4A, Gal80A, TRP1-901, URa3-52, Leu2-3, Leu2-112,
[HIS3 :: GAL1-Agα1-myc10, URA3 :: GAL1-CRE]

The production method of the yeast is as follows. First, pRS_pGAL1-MFαI-myc10-GS-Agα1 (350a.a) was introduced into a JC-993 (ATCC 204097) yeast strain having the genotype shown in Table 2 below to prepare SK10 as a yeast having a GAL1-Agα1-myc10 reporter system . The above pRS_pGAL1-MFαI-myc10-GS-Agα1 (350a.a) had a portion homologous to the his3 gene on the yeast genome, and the reporter was introduced by inducing recombination thereof. Specifically, 5 ug pRS_pGAL1-MFαI-myc10-GS-Agα1 (350a.a) was treated with restriction enzyme Msc I (truncated His3 gene in the middle), completely reacted, ethanol precipitation was used to completely quench the DNA, Was used for conversion. Transformants were screened in SD / -Ura, -His + 25mM 3 -AT media selective medium, and yeast transformed with the reporter gene in the genome of the selected candidate group was transformed with PCR and a vector expressing GAL4 continuously I confirmed the normal operation of the reporter.

The genotype of SK10 yeast thus constructed is shown in Table 2 below. In the SK10 yeast, LacZ of the URA3 :: GAL1-LacZ moiety on the yeast genome was replaced with CRE gene, and SK10-Cre yeast strain having the double reporter of the present invention Respectively. Using Cas9-gRNA, a dsDNA cleavage site was created in the LacZ site on the genome. Donor DNA, which had 300 bp of the end of the Gal1 promoter and 500 bp of the end of the LacZ gene at the 3 'end at the 5' PCR, and inserted into the transformant to induce homologous recombination. Specifically, 200 ng of p414-TEF1p-Cas9-CYC1t (Cas9 expression vector) was transformed into SK10 yeast strain and selected in SD / -Ura, -His, -Trp agar medium to obtain SK10 + Cas9 transformant . The Cre donor DNA was amplified and prepared by PCR, and 6 ug of DNA was precipitated through ethanol precipitation and dried sufficiently before use. Then, 200 ng of Donor DNA and a guide RNA expression vector were transformed into the yeast strain SK10 + Cas9 transformant (on the SD / -Ura, -His, -Trp). Transformants were screened through SD / -Ura, -His, -Trp, -Leu agar medium and the introduction of reporter gene was confirmed by PCR using the CRE gene present in the genome of the transformant.

Strain name Genotype JC-993
(ATCC 204097) MATa gal4 gal80 trp1-901 ura3-52 leu2-3 leu2-112 his3
[URA3 :: pGAL1-LacZ] SK10 MATa, GAL4A, Gal80A, TRP1-901, URa3-52, Leu2-3, Leu2-112,
[HIS3 :: GAL1-Agα1-myc10, URA3 :: GAL1-LacZ]

< Example  2>

Mega-throughput Y2H  building a vector

A vector used in the Mega-through put Y2H system of the present invention was prepared. The vector of the present invention consists of two pairs of pAD-acc and pDBD-donor, both of which contain sequences that are switched by the barcode sequence and CRE recombinase. The pDBD-donor vector contains a fluorescent protein gene (GFP). When it is switched by Cre recombinase, the identification barcode and GFP gene contained in the pDBD-donor vector are shifted to the pAD-acc vector So that they can be detected and expressed, respectively.

<2-1> pAD - acc  Construction of vector

Based on the existing Y2H vector pGADT7 vector (Clontech, see FIG. 3), it was modified for the purpose of the present invention. First, the MCS portion was removed and a gene insertion site containing two Sfi I restriction enzyme recognition sites was introduced. Then, NGS analysis was carried out to identify the inserted gene. The barcode insertion site (restriction enzymes BsiW I and Sac II [refer to the cleavage map in FIG. 1], or restriction enzymes XbaI and Sac II [see the open map in FIG. 10] ) And the lox2272 nucleotide sequence (SEQ ID NO: 20), which can induce recombination by CRE recombinase, was inserted just after the second Sfi I recognition site. The loxP nucleotide sequence (SEQ ID NO: 21) removed and inserted the stop codon of the Leu2 gene. As a result, loxP and lox2272 were arranged to be about 1000 bp apart, and loxP and lox2272 were positioned in the same orientation. A pAD-acc vector having a cleaved map of the full sequence (SEQ ID NO: 16) or the full sequence (SEQ ID NO: 17) was prepared through the above-described procedure.

<2-2> pDBD - Construction of donor vector

Based on the existing Y2H vector pGBKT7 vector (Clontech, see FIG. 4), it was modified for the purpose of the present invention. First, the MCS portion was removed and a gene insertion site containing two Sfi I restriction enzyme recognition sites was introduced. Then, a barcode insertion site (restriction enzyme Afl II / Age I) for identifying the inserted gene by NGS analysis together with the lox2272 base sequence capable of inducing recombination by CRE recombinase was inserted into the second Sfi I recognition site Respectively. Followed by the insertion of the antibiotic kanamycin resistance gene and promoter, and the GFP gene and loxP nucleotide sequence. As a result, loxP and lox2272 were arranged to be about 2000 bp apart, and loxP and lox2272 were positioned in the same orientation. Through the above-described procedure, a pDBD-donor vector having a cleavage map of the full sequence (SEQ ID NO: 15) was prepared.

<2-3> Barcode and vector preparation

A barcode for inserting into the constructed vector was prepared. barcode template oligo and a primer to amplify it by PCR. Barcode was synthesized by PCR using High-fidelity Phusion DNA polymerase (NEB, Cat. No. M0530). A PCR machine Bio-rad T100 ^TM thermal cycler was used (Cat.No 186-1096), were made to the PCR reaction solution in the proportion shown in Table 3, the relief of PCR Condition is as follows; 95 ° C / 30 sec - [95 ° C / 20 sec -65 ° C / 30 sec] _{x15 cycles} -72 ° C / 60 sec -4 ° C / ∞.

Composition of PCR reaction solution matter Volume density 5X Phusion DNA Pol. buffer 10 μl 1X dNTP (10 mM) 4 μl 0.8 mM Primer F, R (50 pmoles / ul) 2/2 ul 100 pmole each Barcode template (0.01 pmole / ul) 2 μl 0.02 pmoles Phusion DNA polymerase 2 μl D.W 28 μl Total volume 50 μl

The template oligo and primer sequences used in the barcode construction SEQ ID NO: name order One Barcode Template oligo AD 5'-CGT ACG CTT GGG NNN NNN NNN NTT TCC ACC GCG G-3 ' 2 AD-5 (BsiW I) 5'-TGC ACA GCG TAC GCT TGG G-3 ' 3 AD-3 (Sac II) 5'-GGC CAT GCC GCG GTG GAAA-3 ' 4 Barcode Template oligo DBD 5'-ACC GGT CTT GGG NNN NNN NNN NTT TCC ACT TAA G-3 ' 5 DBD-5 (Afl II) 5'-TGC ACA GAC CGG TCT TGG G-3 ' 6 DBD-3 (Age I) 5'-GGC CAT GCT TAA GTG GAAA-3 '

The products obtained by PCR were treated with restriction enzymes. The bar codes for AD are treated with restriction enzymes BsiW I (NEB) and Sac II (NEB) to match pAD-acc, and the bar codes for DBD are treated with restriction enzymes Afl II (NEB) and Age I (NEB Corp.).

After the restriction enzyme treatment, Shrimp alkaline phosphatase (78390, manufactured by USB Corporation) was treated to remove all phosphate groups at both ends. A fully defined section (approximately 30 bp) was purified pure through 10% polyacrylamide gel (1X TBE).

The vectors constructed in Examples 2-1 and 2-2 were treated with restriction enzymes, respectively. pAD-acc vector was treated with restriction enzymes BsiW I (NEB) and Sac II (NEB), and pDBD-donor vector was treated with restriction enzymes Afl II (NEB) and Age I (NEB).

After the enzyme treatment, a completely restricted section was purified using Expin Gel SV (Geneall's 102-150).

<2-4> Building Barcode Insertion Library

The vector and barcode obtained by the above procedure are mixed so that the ratio of the number of molecules is 1:10, and then T4 DNA ligase (NE20 M0202) is treated to induce recombination. (12 hours at 4 ° C) and then transformed into bacteria (Top10F ') to prepare an amount to obtain a total of 1.0 × 10 ⁷ bacterial clones.

The prepared clone was inoculated on a 0.3% seaPrep agarose (Lonza 50302) LB medium and incubated at 37 ° C for 36 hours. A plasmid maxi kit (Qiagen 12165) was used to obtain a library having a barcode inserted therein.

<2-5> PCR Preparation of recombinant gene

A total of 27 genes were used for recombination, including genes involved in the synthesis of Amino-acyl tRNA. Specifically, AIMP1 (genebank NM_004757.3), AIMP2 (NM_006303.3), AIMP3 (NM_004280), DRS (NM_001349.2), FRSα (NM_004461.2), FRSβ (NM_005687.3), HRS NRS (NM_004539.3), SRS (NM_006513.3), WRS (NM_004184.3), YRS (NM_003680.3), CRS (NM_139273.3), GRS (NM_002047.2) (NM_004990.3), QRS (NM_005051.1), and LRS-B (521-1176 aa), which are difficult to clone due to the large size of LRS-A (1-520 aa) , RRS (NM_002887.3), TRS (NM_152295.4), PRS (NM_004446.2 to 753-1512 aa), IRS (NM_013417.2), ARS (NM_001605.2), ERS (NM_004446.2 to 1-953 (1-938 aa) and VRS-B (939-1265 aa) due to the difficulty of cloning due to the size of the gene being too large for KRS (NM_001130089.1) and VRS (NM_006295.2) And the gene of DX2 (AIMP2-DX2, SEQ ID NO: 22) was used, and the list of genes was shown in [Table 6].

Using the cDNA of each of the above genes as a template, PCR was performed in the same manner as in the above Example 2-3 except for the primers used to amplify the nucleic acid. The primers used in this experiment are shown in Table 5 below. The gene to be inserted into the pAD-acc vector was amplified using the primers of SEQ ID NOS: 7 and 9, and the gene to be inserted into the pDBD-donor vector was amplified using the primers of SEQ ID NOS: 7 and 8.

The primer sequences used in library construction SEQ ID NO: name order 7 aaRS (F) sfi I 5'-GCG ATC AGG CCC AGC AGG CCG GCG CCG AGA CCG CGG TC-3 ' 8 DBD-aaRS (R) sfi I 5'-ACA GCT TGG CCA GCA GGG CCC TGC AGG TCG ACC TCG AG-3 ' 9 AD-aaRS (R) sfi I 5'-ACA GCT TGG CCC AGC AGG CCC TGC AGG TCG ACC TCG AG-3 '

<2-6> Genetic recombination

A total of 54 PCR products (27 kinds of AD-aaRS, 27 kinds of DBD-aaRS), pAD-acc and pDBD-donor were digested with restriction enzyme Sfi I (R0123 of NEB). After cleavage, only the desired product was purified using Expin Gel SV (Geneall's 102-150). Then, the ratio of the number of molecules of the aaRS gene treated with the restriction enzyme to that of the vector was adjusted to 3: 1, and the recombination was induced by treatment with T4 DNA ligase (NEB M0202). The recombinant reaction was carried out at 4 ° C for 1 hour and after transformation, transformed into bacteria (Top10F '). Recombinant clones were screened for resistance to ampicillin and kanamycin antibiotics in LB agar medium, respectively. (Refer to [Table 6]). The sequence of the barcodes was determined by Sanger sequencing method. Briefly, the BigDye®Terminator v3.1 Cycle Sequencing Kit (Cat. No. 4337455, life technologies) and ABI 3730XL Sequencing machine (capillary 96ea x 50 cm) were used for the above sequencing.

< Example  3>

dual reporter  Mega-throughput Y2H  Establish system and check system operation

In order to perform a screening system operation test, p53 protein (SEQ ID NO: 19) and SV40 large T antigen (SEQ ID NO: 18) which are already known to interact with each other are introduced into the vector of the present invention, Fluorescence development was observed by introducing the inventive double-reporter yeast strain (yeast strain of Example 1, that is, a yeast strain having reporter genes CRE and c-myc as reporter genes).

<3-1> Library Configuration

First, as shown in Table 7, a p53 mutation with limited binding capacity to Sv40 was prepared and introduced into a vector to construct a test library. The method for introducing the gene into the vector for constructing the library was carried out in the same manner as in Example 2. [

Configuring the test library Experimental group Control group One pDBD-donor-p53 (WT) + pAD-acc-Sv40 T 6 pDBD-donor-p53 (WT) 2 pDBD-donor-p53 (D278G, 34%) + pAD-acc-Sv40 T 7 pDBD-donor-p53 (D278G, 34%) 3 pDBD-donor-p53 (V144G, 4.9%) + pAD-acc-Sv40 T 8 pDBD-donor-p53 (V144G, 4.9%) 4 pDBD-donor-p53 (E255K, 1.5%) + pAD-acc-Sv40 T 9 pDBD-donor-p53 (E255K, 1.5%) 5 pDBD-donor-Lamin A + pAD-acc-Sv40 T 10 pDBD-donor-Lamin A 11 pAD-acc-Sv 40 T

The description of the above table is as follows.

p53 (W.T): wild type Murine p53 (SEQ ID NO: 19)

p53 (D278G, 34%): a mutation that changed the 278th amino acid D (aspartic acid) of p53 protein to G (Glycin)

p53 (V144G, 4.9%): a mutation that changed the 144th amino acid V (Valine) of p53 protein to G (Glycine), decreased binding strength to SV40 L.T by 4.9%

p53 (E255K, 1.5%): a mutation that changed the 255th amino acid E (Glutamic acid) of p53 protein to K (Lysine) and decreased the binding force to 1.5% with SV40 L.T

Lamin A: a protein that does not interact with the SV40 LT protein at all (Negative control, SEQ ID NO: 23)

SV40 LT: a protein known to interact with wild type Murine p53 (SEQ ID NO: 18)

&Lt; 3-2 > Transformation of yeast strains and GFP Through CRE  Check if the reporter is working

Yeast transformants prepared in Example 1 were transformed using Yeastmaker Yeast Transformation System 2 (Cat no. 630439, Clontech). The recombinant DNA used in the transformation was used after mixing 100 ng per plasmid according to Table 7. (Total 11 kinds of experimental groups) After transforming the yeast prepared in Example 1, SD / -U, H, L, T agar medium. After culturing for 3 days, the cultured agar medium was observed under a fluorescence microscope.

As a result of the experiment, as shown in FIG. 6, it was confirmed that fluorescence appeared successfully in the cells in which the interaction occurred. In addition, the stronger the binding force between the proteins, the higher the expression level of the reporter gene, and consequently, the stronger the fluorescence intensity was confirmed.

<3-3> Antibiotic treatment CRE  Check if the reporter is working

In the transfected cells as described above, when protein interactions occur, plasmids resistant to both Ampicillin and kanamycin are recombined by CRE recombinase. In order to confirm this, the plasmid was purified using the Easy Yeast Plasmid Isolation Kit (Clontech, Cat. No: 630467) in the transformant yeast obtained in the same manner as in Example 3-2, '), And the resulting colonies were measured after inoculation with LB-ampicillin medium or LB-ampicillin and kanamycin medium. The medium was prepared by adding 50 μg / ml of ampicillin to each of Luria-Bertani (LB) Broth and Miller (Company: Difco, Cat. No. 244620), each consisting of 10 g Tryptone, 5 g Yeast extract and 10 g NaCl Or / and kanamycin at a concentration of 15 ug / ml.

Antibiotic treatment results p53
WT P53
D278G P53
V144G P53
E255K Laminin A Amp ^r 389 401 296 266 312 Amp ^r Kan ^r  138  80 19 4 0 Amp ^r Kan ^r
/ Amp ^r 35.7 ± 3.3% 19.8 ± 3.4% 6.2 ± 3.4% 1.8 ± 0.5% 0% Relative frequency 100.0% 55.5% 17.4% 5.0% 0%

* 3 Average result for repeated experiments

As a result, as shown in Table 9, stronger interactions between proteins resulted in an increase in recombination rate by CRE, so that plasmids resistant to both antibiotics were increased and more colonies were formed.

&Lt; 3-4 > Myc  Check if the reporter is working

In order to confirm whether the c-myc reporter gene functions normally in the cultured transformant yeast, mouse α-c-myc antibody that binds to Myc firstly expressed in the transformant yeast cultured and the c-myc Antibody-conjugated secondary antibody was treated with Alexa Fluor 568 Goat anti-Mouse IgG antibody (Molecular probe) and observed with fluorescence microscope.

As a result of the experiment, as shown in Fig. 7, it was confirmed that Myc of the yeast strain works normally by protein interactions and red fluorescence appears. GFP fluorescence was also observed by normal expression of Cre recombinase.

<3-5> Confirmation of selection process of fluorescently labeled yeast cells

To confirm that the yeast strain expressing fluorescence by the interaction of the SV40 large T antigen with the known p53 protein introduced into the pAD-acc vector and the pDBD-donor vector introduced into the yeast strain can be detected and isolated without agar medium operation The yeast strains transformed in Example 3-2 were cultured in a liquid medium, the cells were separated, suspended in a buffer, and subjected to FACS analysis.

Specifically, in the main experimental groups transformed in Example 3-2, the cultured medium was centrifuged to completely remove the culture medium and only yeast cells were obtained. The yeast cells were washed with 5 ml of WB buffer (1X PBS, 5% BSA, 5 mM EDTA), and 1 ml of mouse α-myc antibody (c-Myc Antibody (9E10) (Santa sc-40, manufactured by cruz) was diluted 1: 500 and added to the washed yeast. The tubes containing the samples were kept in ice and allowed to react for 30 minutes while the cold was maintained. After 30 minutes, the yeast was washed with 5 ml of WB buffer. Then, 1 ml of goat α-mouse IgG-Cy5 (Molecular probe A10524) antibody, a fluorescent dye-labeled secondary antibody, was diluted 1: 500 It was added to the yeast with the secondary antibody and mixed well. This was also stored in ice and allowed to react for 30 minutes while keeping it in a cold state. After completion of the staining, the cells were washed twice with 5 ml of 1X PBS in 5 ml of WB buffer, and the yeast cells were completely disrupted with 3 ml of 1X PBS, and then transferred to a 14 ml FACS tube (352017 from BD falcon).

The prepared samples were analyzed by FACS Moflo XDP (Backman Coulter) and the yeast group having fluorescence (GFP, Cy5) appeared through the expression of the reporter gene induced by protein interactions was separately isolated. Selected cells were at least 1.0 x 10 ⁷ cells.

As a result, as shown in FIG. 8 and FIG. 9, in the case of the first and second test groups in which the interaction occurs, cells are separated by normal expression of the report gene (FIGS. 8A and 8B, (See Fig. 9B). In the case of the experiment group 3 to 5 (see Figs. 8C, 8D and 8E and 9C, 9D and 9E, respectively) in which the transfected proteins do not interact, To 11, data not shown).

&Lt; 3-6 > barcord  Check reading availability

From the yeast cells expressing GFP in the above Example 3-5, the yeast cells of Easy Yeast Plasmid Isolation Kit (Clontech, Cat. &Lt; RTI ID = 0.0 &gt; No: 630467), and PCR was performed using the primers shown in Table 10 below. By PCR machine was used for ^{Bio-rad T100 TM thermal cycler (} Cat.No 186-1096), a DNA polymerase was used as the High-fidelity DNA polymerase (NEB, Cat.No M0530), the composition, such as Table 3 To prepare a PCR reaction solution. The specific PCR conditions are as follows; 95 ° C / 30 seconds - [95 ° C / 20 seconds -65 ° C / 30 seconds] _{x25 cycles} -72 ° C / 60 seconds -4 ° C / ∞.

Colony yeasts that did not express GFP were used as controls. As shown in FIG. 18, the pair of primers A and C in Table 10 detects whether or not the bar code sequence introduced from the DBD-donor vector (that is, the sequence representing the bait protein) and the bar code sequence of the AD-acc vector are combined And pairs of primers A and B in Table 10 below were used in a control experiment to confirm the presence of the plasmid. Specific experimental groups and control groups are shown in Table 11 below.

Primer sequence SEQ ID NO: designation sequence 10 primer GGCCgTCGAcTaaTtGAGTGACGTACGCTTGGG 11 primer B ggccATGCCGCGGTGGAAA 12 primer C GCCCCAAGGGGTTATGCTAGTTATCTTAAG

Lane Template Primers One GFP positive colony A / C 2 GFP negative colony A / C 3 GFP positive colony A / B 4 GFP negative colony A / B

19 shows the result of amplifying the recombined barcode near loxP by PCR. In the lane 1 gene expressing GFP, recombination was induced by Cre recombinase and a 115-bp Barcode PCR product was formed. In the lane 2 of the colonies that did not express GFP, Barcode PCR product Was not detected. lane 3 and lane 4 were used as controls to confirm that plasmids were present (48 bp).

To further elucidate this, nucleic acids were extracted from selected cells by the method of Example 3-3, and PCR was performed in the same manner as described above. As a result, as shown in Fig. 20, it was confirmed that Barcode PCR products were detected normally in yeast resistant to both ampicillin and kanamycin due to protein interaction.

Thus, it was confirmed that the system for detecting the interactions between proteins using the yeast strains and the vectors of the present invention works normally.

< Example  4>

dual reporter  Mega-throughput Y2H  System Interaction Study

<4-1> Screening of protein-interacting yeast by MACS (Magnetic-activated cell sorting)

As shown in Table 6, a total of 27 kinds of ARS genes and barcode sequences representing the respective proteins were recombined into a pAD-acc vector and a pDBD-donor vector. Lamin A and SV40 T were used as negative controls. Each vector was prepared as described above and transformed into the yeast of the present invention, and the experiment was conducted with the experimental group as shown in Table 12 below. 1.0x10 ⁸ Yeast cells were treated with 80ng c-Myc antibody (9e10, SantaCruz, sc-40) to bind AgαI-myc10 expressed on the surface of yeast cells, followed by BioMag Goat Anti-Mouse IgG , And 1 ml of a magnetic bead (qiagen, Cat. No. 310007) were mixed together to finally bind the yeast and the magnetic beads through antigen-antibody binding. After immersing all the magnetic beads on the bottom using a magnet, yeast not attached to the beads was removed, and SD / -U, H, L, and T agar medium were added and the yeast bound to the beads was incubated at 30 ° C for 24 hours Respectively. Selected cells were analyzed by fluorescence microscopy.

O.D 600 Total cell number ARS library vs ARS library 2.015 2.0 X 10 ⁸ Lamin vs Sv40 Large T 0.046 4.6 X 10 ⁶

As shown in FIG. 16, cells expressing c-myc reporter through MACS were selected, and fluorescence microscopy observation of GFP fluorescence expression in these cells was confirmed. Therefore, it was possible to select yeasts that are undergoing protein interaction through MACS and other processes without agar medium.

In order to determine how efficiently the MACS method can select yeast cells in relation to the protein interaction intensity, a vector was prepared as shown in Table 13 below, and the yeast of the present invention (double reporter yeast of Example 1) And MACS was carried out in the same manner as described above.

pHAB210: pDBD-donor-p53 VS pHAB215: pAD-acc-SV40 T pHAB211: pDBD-donor-p53-E255K (1.5%) pHAB212: pDBD-donor-p53-V144G (4.9%) pHAB213: pDBD-donor-p53-D278G (34%) pHAB214: pDBD-donor-Lamin A

p53  (WT)
vs
Sv40  T D278G
(34%)
vs
Sv40  T V144G  (4.9%)
vs
Sv40  T E255K
(1.5%)
vs
Sv40  T Lamin  A
vs
Sv40  T c- Myc  + 28.76% 27.84% 11.54% 1.47% 0.47% 1.0x 10 ⁵ -> 28760 1.0x 10 ⁵ -> 27840 1.0x 10 ⁵ -> 11540 1.0x 10 ⁵ -> 1470 1.0x 10 ⁵ -> 4700 5.0 x 10 ⁶ 1.7 x 10 ⁷ cells 1.8 x 10 ⁷ cells 4.3 x 10 ⁷ cells 3.6 x 10 ⁸ cells - Cell concentration 1.17 x 10 ⁹ cells / ml 1.0 x 10 ⁹ cells / ml 8.8 x 10 ⁸ cells / ml 1.0 x 10 ⁹ cells / ml 1.15 x 10 ⁹ cells / ml Volume to
5.0 x 10 ⁶ cell 15 μl 18 μl 49 μl 340 μl 300 μl Cells to
3.6 x 10 ⁸ 3.2 x 10 ⁸ cells 3.2 x 10 ⁸ cells 2.9 x 10 ⁸ cells - -

As a result, as shown in Table 14 and FIG. 24, it can be seen that as the intensity of interaction between proteins is stronger, the amount of cells selected by MACS is different. Therefore, by performing MACS, those with strong protein interactions are better selected, which is thought to contribute to the improvement of the Y2H system accuracy of the present invention.

<4-2> Comparison of efficiency of fluorescence use and MACS utilization in screening protein-interacting yeast

As a method for screening yeast cells (i.e., positive cells) in which protein interaction actually took place, it was examined whether the method using fluorescence or the method using MACS enabled more accurate selection. First, the yeast of the present invention was transformed as in Example 4-1, and after 36 hours, the fluorescence of Cy5 and GFP was examined through FACS (Moflow ^TM XDP, Beckman coulter). As in Example 4-1, Yeast of the present invention was transformed and MACS was performed once and twice. After 24 hours, the fluorescence of Cy5 and GFP was measured by FACS (Moflow ^TM XDP, Beckman coulter) Respectively.

 As shown in FIG. 17, in the transformant yeast that did not perform MACS, it was difficult to know the protein interaction through fluorescence expression at 36 hours after each vector was introduced into the yeast (FIG. 17A) Positive cells with interactions were able to be separated. Especially, as the number of times of MACS administration increased, positive cell sorting power was increased (FIG. 17B). Using MACS, we confirmed that positive cells can be selected with high accuracy.

<4-3> Barcode for identification of interacting proteins Reading (reading)

To identify which proteins interact with the dual reporter Mega-throughput Y2H system of the present invention, their bar code sequences were analyzed. Specifically, first, the library of Table 7 was constructed by the above-mentioned method, and these were introduced into the yeast of the present invention. The recombinant barcode DNA samples were obtained in the same manner as in Example 3-6, and then NGS analysis was commissioned on the Celamics Co., Ltd. For the NGS analysis, MiSeq Reagent Kit v2 (300 cycles) (Illumina, Cat. No. MS-102-2001) was used for sample preparation and each barcode read number was analyzed using Illumine MiSeq Desktop Sequencer.

As a result, as shown in FIG. 21, it was confirmed that the number of barcode reads was significantly different according to the affinity of LaminA and SV40 T for p53. That is, as the affinity (interaction intensity) of the protein decreases, the number of barcode leads decreases.

<4-4> Analysis of library-library protein interaction

In order to confirm whether the dual reporter Mega-throughput Y2H system of the present invention can provide information about each protein interaction between the library-library, the Y2H system of the present invention was operated on the ARS library (see Table 6) The result of reading the bar code with NGS was confirmed by Ceremix Co., Ltd. In the experiment, the AD-acc vector was fixed to express AIMP2 and the ARS library was applied to DBD-donor vector (FIG. 22A). DBD-doner vector was fixed to express AIMP2 and ARS library was added to D-acc vector (FIG. 22B).

As a result, as shown in FIG. 22 and FIG. 23, it was possible to analyze the intensities of protein interactions by comparing the readings of bar codes in a large amount of protein simultaneous analysis using a library.

As described above, the present invention relates to a vector for simultaneous analysis of a plurality of protein-protein interactions, and more particularly, to a specific construct for simultaneously and efficiently detecting binding pairs of proteins at a library level A donor vector and acceptor vector, a kit containing the vectors, and a method for detecting protein interactions using the kit.

Detecting interactions between proteins using the vector set of the present invention not only enables the detection of protein interactions that occur simultaneously in protein libraries (bait protein library and pre-protein library) Barcode sequences are used to provide an advantage in the processing of large amounts of information to identify proteins that interact with each other in library protein reactions.

Korea Biotechnology Research Institute KCTC12790BP 20150408 Korea Biotechnology Research Institute KCTC12791BP 20150408 Korea Biotechnology Research Institute KCTC12792BP 20150408

<110> Medicinal Bioconvergence Research Center <120> Vectors for measuring multiple protein-protein interactions          simultaneously <130> NP15-0046 <150> KR 10-2015-0037979 <151> 2015-03-19 <150> KR 1020140049726 <151> 2014-04-25 <160> 29 <170> Kopatentin 2.0 <210> 1 <211> 34 <212> DNA <213> Artificial Sequence <220> <223> Barcode template oligo AD <400> 1 cgtacgcttg ggnnnnnnnn nntttccacc gcgg 34 <210> 2 <211> 19 <212> DNA <213> Artificial Sequence <220> &Lt; 223 > AD-5 (BsiW I) <400> 2 tgcacagcgt acgcttggg 19 <210> 3 <211> 19 <212> DNA <213> Artificial Sequence <220> &Lt; 223 > AD-3 (Sac II) <400> 3 ggccatgccg cggtggaaa 19 <210> 4 <211> 34 <212> DNA <213> Artificial Sequence <220> <223> Barcode template oligo DBD <400> 4 accggtcttg ggnnnnnnnn nntttccact taag 34 <210> 5 <211> 19 <212> DNA <213> Artificial Sequence <220> &Lt; 223 > DBD-5 (Afl II) <400> 5 tgcacagacc ggtcttggg 19 <210> 6 <211> 19 <212> DNA <213> Artificial Sequence <220> &Lt; 223 > DBD-3 (Age I) <400> 6 ggccatgctt aagtggaaa 19 <210> 7 <211> 38 <212> DNA <213> Artificial Sequence <220> <223> aaRS (F) sfi I <400> 7 gcgatcaggc ccagcaggcc ggcgccgaga ccgcggtc 38 <210> 8 <211> 38 <212> DNA <213> Artificial Sequence <220> &Lt; 223 > DBD-aaRS (R) sfi I <400> 8 acagcttggc cagcagggcc ctgcaggtcg acctcgag 38 <210> 9 <211> 38 <212> DNA <213> Artificial Sequence <220> <223> AD-aaRS (R) sfi I <400> 9 acagcttggc ccagcaggcc ctgcaggtcg acctcgag 38 <210> 10 <211> 33 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 10 ggccgtcgac taattgagtg acgtacgctt ggg 33 <210> 11 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> primer B <400> 11 ggccatgccg cggtggaaa 19 <210> 12 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> primer C <400> 12 gccccaaggg gttatgctag ttatcttaag 30 <210> 13 <211> 2474 <212> DNA <213> Artificial Sequence <220> <223> Gal1 promoter- MFalpha1- myc10 repeats- Glycine / Serine linker-          Agalpha I (C-term) <400> 13 acggattaga agccgccgag cgggtgacag ccctccgaag gaagactctc ctccgtgcgt 60 cctcgtcttc accggtcgcg ttcctgaaac gcagatgtgc ctcgcgccgc actgctccga 120 acaataaaga ttctacaata ctagctttta tggttatgaa gaggaaaaat tggcagtaac 180 ctggccccac aaaccttcaa atgaacgaat caaattaaca accataggat gataatgcga 240 ttagtttttt agccttattt ctggggtaat taatcagcga agcgatgatt tttgatctat 300 taacagatat ataaatgcaa aaactgcata accactttaa ctaatacttt caacattttc 360 ggtttgtatt acttcttatt caaatgtaat aaaagtatca acaaaaaatt gttaatatac 420 ctctatactt taacgtcaag gagaaaaaac cccggatcgg actactagca gctgtaatac 480 gactcactat agggaatatt aagctaattc tacttcatac attttcaatt aagagatcta 540 tgagatttcc ttcaattttt actgctgttt tattcgcagc atcctccgca ttagctgctc 600 cagtcaacac tacaacagaa gatgaaacgg cacaaattcc ggctgaagct gtcatcggtt 660 actcagattt agaaggggat ttcgatgttg ctgttttgcc attttccaac agcacaaata 720 acgggttatt gtttataaat actactattg ccagcattgc tgctaaagaa gaaggggtat 780 ctctcgagaa aagagaggct gaagctacgc gtaacacaca gtatgttttt gatatcaaaa 840 tgtcccatcg atttaaagct atggagcaaa agctcatttc tgaagaggac ttgaatgaaa 900 tggagcaaaa gctcatttct gaagaggact tgaatgaaat ggagcaaaag ctcatttctg 960 aagaggactt gaatgaaatg gagcaaaagc tcatttctga agaggacttg aatgaaatgg 1020 agcaaaagct catttctgaa gaggacttga atgaaatgga gagcttgggc gacctcacct 1080 cgatcaaaat gtcccatcga tttaaagcta tggagcaaaa gctcatttct gaagaggact 1140 tgaatgaaat ggagcaaaag ctcatttctg aagaggactt gaatgaaatg gagcaaaagc 1200 tcatttctga agaggacttg aatgaaatgg agcaaaagct catttctgaa gaggacttga 1260 atgaaatgga gcaaaagctc atttctgaag aggacttgaa tgaaatggag agcttgggcg 1320 acctcaccgc cgctaatggc aagcttctgc aggctagtgg tggtggtggt tctggtggtg 1380 gtggttctgg tggtggtggt tctgctagca tgactctcga gcttgatacc atagcaaata 1440 ctacgtacgc tacgcaattc tcgactacta gggaatttat tgtttatcag ggtcggaacc 1500 tcggtacagc tagcgccaaa agctctttta tctcaaccac tactactgat ttaacaagta 1560 taaacactag tgcgtattcc actggatcca tttccacagt agaaacaggc aatcgaacta 1620 catcagaagt gatcagccat gtggtgacta ccagcacaaa actgtctcca actgctacta 1680 ccagcctgac aattgcacaa accagtatct attctactga ctcaaatatc acagtaggaa 1740 cagatattca caccacatca gaagtgatta gtgatgtgga aaccattagc agagaaacag 1800 cttcgaccgt tgtagccgct ccaacctcaa caactggatg gacaggcgct atgaatactt 1860 acatctcgca atttacatcc tcttctttcg caacaatcaa cagcacacca ataatctctt 1920 catcagcagt atttgaaacc tcagatgctt caattgtcaa tgtgcacact gaaaatatca 1980 cgaatactgc tgctgttcca tctgaagagc ccacttttgt aaatgccacg agaaactcct 2040 taaattcctt ctgcagcagc aaacagccat ccagtccctc atcttatacg tcttccccac 2100 tcgtatcgtc cctctccgta agcaaaacat tactaagcac cagttttacg ccttctgtgc 2160 caacatctaa tacatatatc aaaacgaaaa atacgggtta ctttgagcac acggctttga 2220 caacatcttc agttggcctt aattctttta gtgaaacagc agtctcatct cagggaacga 2280 tcgcataccc aattgtccgg tatccaacag aatttcacat caacttctct catgatttca acctatgaag 2400 gtaaagcgtc tatatttttc tcagctgagc tcggttcgat catttttctg cttttgtcgt 2460 acctgctatt ctaa 2474 <210> 14 <211> 1588 <212> DNA <213> Artificial Sequence <220> <223> GAL1 promoter-CRE recombinase <400> 14 acggattaga agccgccgag cgggtgacag ccctccgaag gaagactctc ctccgtgcgt 60 cctcgtcttc accggtcgcg ttcctgaaac gcagatgtgc ctcgcgccgc actgctccga 120 acaataaaga ttctacaata ctagctttta tggttatgaa gaggaaaaat tggcagtaac 180 ctggccccac aaaccttcaa atgaacgaat caaattaaca accataggat gataatgcga 240 ttagtttttt agccttattt ctggggtaat taatcagcga agcgatgatt tttgatctat 300 taacagatat ataaatgcaa aaactgcata accactttaa ctaatacttt caacattttc 360 ggtttgtatt acttcttatt caaatgtaat aaaagtatca acaaaaaatt gttaatatac 420 ctctatactt taacgtcaag gagaaaaaac tataatgact aaatctcatt cagaagaagt 480 gattgtacct gagttcaatt ctagcgcaaa ggaattacca agaccattgg ccgaaaagtg 540 cggaattcaa atgtctaatt tgttgactgt tcatcaaaat ttgccagctt tgccagttga 600 tgcaacgtct gatgaggtaa gaaagaattt gatggatatg tttagagata gacaagcatt 660 ctctgaacat acttggaaaa tgttgttgtc tgtttgtaga tcttgggctg cttggtgtaa 720 attaaataat agaaaatggt ttccagctga accagaagat gttagagatt atttgttgta 780 tttgcaagct agaggtttgg ctgttaaaac tatacaacaa catttgggtc aattaaatat 840 gttgcatagg agatctggtt tgcctagacc atctgattct aatgctgtat ctttggttat 900 gagaaggatt agaaaagaaa atgttgatgc aggtgaaaga gctaaacaag cattggcgtt 960 tgaaagaact gattttgatc aagttagatc tttgatggaa aattctgata gatgtcaaga 1020 tatagaaac ttggctttct tgggaattgc ttataataca ttgttgagaa ttgctgaaat 1080 tgctagaatt agagttaaag acatttctag aactgatggt ggtagaatgt tgattcatat 1140 tggtagaact aaaacattgg tttcaactgc tggcgttgag aaagcattgt ctttgggtgt 1200 tactaaattg gttgaaagat ggatttctgt atctggtgtg gctgatgacc caaataatta 1260 tttattttgt agagttagaa agaatggtgt tgcggctcca tctgctacat ctcagctctc 1320 tacccgtgcc ttggaaggaa tttttgaagc aactcataga ttgatttatg gtgctaaaga 1380 tgattctggt caaagatatt tagcatggtc tggtcattct gctagagttg gtgccgctag 1440 agatatggct agagctgggg tatctattcc tgaaattatg caagctggtg gttggactaa 1500 tgttaacatc gtcatgaact atattagaaa tttggattct gaaactggtg caatggttag 1560 actcttggaa gatggtgatc ccgggtag 1588 <210> 15 <211> 8410 <212> DNA <213> Artificial Sequence <220> <223> pDBD-donor <400> 15 cggtgcgggc ctcttcgcta ttacgccaga tccttttgtt gtttccgggt gtacaatatg 60 gacttcctct tttctggcaa ccaaacccat acatcgggat tcctataata ccttcgttgg 120 tctccctaac atgtaggtgg cggaggggag atatacaata gaacagatac cagacaagac 180 ataatgggct aaacaagact acaccaatta cactgcctca ttgatggtgg tacataacga 240 actaatactg tagccctaga cttgatagcc atcatcatat cgaagtttca ctaccctttt 300 tccatttgcc atctattgaa gtaataatag gcgcatgcaa cttcttttct ttttttttct 360 tttctctctc ccccgttgtt gtctcaccat atccgcaatg acaaaaaaaa tgatggaaga 420 cactaaagga aaaaattaac gacaaagaca gcaccaacag atgtcgttgt tccagagctg 480 atgaggggta tctcgaagca cacgaaactt tttccttcct tcattcacgc acactactct 540 ctaatgagca acggtatacg gccttccttc cagttacttg aatttgaaat aaaaaaagtt 600 tgctgtcttg ctatcaagta taaatagacc tgcaattatt aatcttttgt ttcctcgtca 660 ttgttctcgt tccctttctt ccttgtttct ttttctgcac aatatttcaa gctataccaa 720 gcatacaatc aactccaagc ttgaagcaag cctcctgaaa gatgaagcta ctgtcttcta 780 tcgaacaagc atgcgatatt tgccgactta aaaagctcaa gtgctccaaa gaaaaaccga 840 agtgcgccaa gtgtctgaag aacaactggg agtgtcgcta ctctcccaaa accaaaaggt 900 ctccgctgac tagggcacat ctgacagaag tggaatcaag gctagaaaga ctggaacagc 960 tatttctact gatttttcct cgagaagacc ttgacatgat tttgaaaatg gattctttac 1020 aggatataaa agcattgtta acaggattat ttgtacaaga taatgtgaat aaagatgccg 1080 tcacagatag attggcttca gtggagactg atatgcctct aacattgaga cagcatagaa 1140 taagtgcgac atcatcatcg gaagagagta gtaacaaagg tcaaagacag ttgactgtat 1200 cgccggaatt tgtaatacga ctcactatag ggcgagccgc catcatggag gagcagaagc 1260 tgatctcaga ggaggacctg catatacgcg tggcctggag ggccgccgaa ttcccgggga 1320 tccgtcgacc tgcagcggcc gcagggcctc cagggccact agttaattga gtgagacgtc 1380 ccccattcga gaataaataa cttcgtataa agtatcctat acgaagttat accggtctaa 1440 agtagcccct tgaattccga ggcagtaggc acgtgaagtt gcttcttggc ctcacctagg 1500 ctgcccgcgc cggacttgta cagctcgtcc atgccgagag tgatcccggc ggcggtcacg 1560 aactccagca ggaccatgtg atcgcgcttc tcgttggggt ctttgctcag ggcggactgg 1620 gtgctcaggt agtggttgtc gggcagcagc acggggccgt cgccgatggg ggtgttctgc 1680 tggtagtggt cggcgagctg cacgctgccg tcctcgatgt tgtggcggat cttgaagttc 1740 accttgatgc cgttcttctg cttgtcggcc atgatataga cgttgtggct gttgtagttg 1800 tactccagct tgtgccccag gatgttgccg tcctccttga agtcgatgcc cttcagctcg 1860 atgcggttca ccagggtgtc gccctcgaac ttcacctcgg cgcgggtctt gtagttgccg 1920 tcgtccttga agaagatggt gcgctcctgg acgtagcctt cgggcatggc ggacttgaag 1980 aagtcgtgct gcttcatgtg gtcggggtag cggctgaagc actgcacgcc gtaggtcagg 2040 gtggtcacga gggtgggcca gggcacgggc agcttgccgg tggtgcagat gaacttcagg 2100 gtcagcttgc cgtaggtggc atcgccctcg ccctcgccgg acacgctgaa cttgtggccg 2160 tttacgtcgc cgtccagctc gaccaggatg ggcaccaccc cggtgaacag ctcctcgccc 2220 ttgctcacca tcttaagata actagcataa ccccttgggg cctctaaacg ggtcttgagg 2280 ggttttttgc gcgcttgcag ccaagctaat tccgggcgaa tttcttatga tttatgattt 2340 ttattattaa ataagttata aaaaaaataa gtgtatacaa attttaaagt gactcttagg 2400 ttttaaaacg aaaattctta ttcttgagta actctttcct gtaggtcagg ttgctttctc 2460 aggtatagca tgaggtcgct cttattgacc acacctctac cggcatgcaa gcttggcgta 2520 atcatggtca tagctgtttc ctgtgtgaaa ttgttatccg ctcacaattc cacacaacat 2580 acgagccgga agcataaagt gtaaagcctg gggtgcctaa tgagtgaggt aactcacatt 2640 aattgcgttg cgctcactgc ccgctttcca gtcgggaaac ctgtcgtgcc agctgcatta 2700 atgaatcggc caacgcgcgg ggagaggcgg ttgacgtccc ccattcgaga ataaatcgat 2760 agtcccgctc agaagaactc gtcaagaagg cgatagaagg cgatgcgctg cgaatcggga 2820 gcggcgatac cgtaaagcac gaggaagcgg tcagcccatt cgccgccaag ctcttcagca 2880 atatcacggg tagccaacgc tatgtcctga tagcggtccg ccacacccag ccggccacag 2940 tcgatgaatc cagaaaagcg gccattttcc accatgatat tcggcaagca ggcatcgtca 3000 tgggtcacga cgagatcctc gccgtcgggc atgctcgcct tgagcctggc gaacagttcg 3060 gctggcgcga gcccctgatg ctcttcgtcc agatcatcct gatcgacaag accggcttcc 3120 atccgagtac gtgctcgctc gatgcgatgt ttcgcttggt ggtcgaatgg gcaggtagcc 3180 ggatcaagcg tatgcagccg ccgcattgca tcagccatga tggatacttt ctcggcagga 3240 gcaaggtgag atgacaggag atcctgcccc ggcacttcgc ccaatagcag ccagtccctt 3300 cccgcttcag tgacaacgtc gagcacagct gcgcaaggaa cgcccgtcgt ggccagccac 3360 gatagccgcg ctgcctcgtc ttgcagttca ttcagggcac cggacaggtc ggtcttgaca 3420 aaaagaaccg ggcgcccctg cgctgacagc cggaacacgg cggcatcaga gcagccgatt 3480 gtctgttgtg cccagtcata gccgaatagc ctctccaccc aagcggccgg agaacctgcg 3540 tgcaatccat cttgttcaat catactcttc ctttttcaat attattgaag catttatcag 3600 ggttattgtc tcatgagcgg atacatattt gaatgtattt agaaaaataa acaaataggg 3660 gttccgcgca catttccccg aaaggcgcgc cttattcttc accggcatct gcatccgggg 3720 tcttgaaggc gtgctggtac tccacgatgc ccagctcggt gttgctgtga tcctcctcca 3780 cgcggcggaa ggcgaacatg gggcccccgt tctgcaggat gctggggtgg atggcgctct 3840 tgaagtgcat gtggctgtcc accacggagc tgtagtagcc gccgtcgcgc aggctgaagg 3900 tgcgggtgaa gctgccatcc agatcgttat cgcccatggg gtgcaggtgc tccacggtgg 3960 cgttgctgcg gatgatcttg tcggtgaaga tcacgctgtc ctcggggaag ccggtgccca 4020 tcaccttgaa gtcgccgatc acgcggccgg cctcgtagcg gtagctgaag ctcacgtgca 4080 gcacgccgcc gtcctcgtac ttctcgatgc gggtgttggt gtagccgccg ttgttgatgg 4140 cgtgcaggaa ggggttctcg tagccgctgg ggtaggtgcc gaagtggtag aagccgtagc 4200 ccatcacgtg gctcagcagg taggggctga aggtcagggc gcctttggtg ctcttcatct 4260 tgttggtcat gcggccctgc tcgggggtgc cctctccgcc gcccaccagc tcgaactcca 4320 cgccgttcag ggtgccggtg atgcggcact cgatctccat ggcgggcagg ccgctctcgt 4380 cgctctccat agatcttgag cgtcgagtta gcatatggat cgatccatat aacttcgtat 4440 aatgtatgct atacgaagtt attacgatac cgtcaacttg tttattgcag cttataatgg 4500 taccgggcgc tcttccgctt cctcgctcac tgactcgctg cgctcggtcg ttcggctgcg 4560 gcgagcggta tcagctcact caaaggcggt aatacggtta tccacagaat caggggataa 4620 cgcaggaaag aacatgtgag caaaaggcca gcaaaaggcc aggaaccgta aaaaggccgc 4680 gttgctggcg tttttccata ggctccgccc ccctgacgag catcacaaaa atcgacgctc 4740 aagtcagagg tggcgaaacc cgacaggact ataaagatac caggcgtttc cccctggaag 4800 ctccctcgtg cgctctcctg ttccgaccct gccgcttacc ggatacctgt ccgcctttct 4860 cccttcggga agcgtggcgc tttctcatag ctcacgctgt aggtatctca gttcggtgta 4920 ggtcgttcgc tccaagctgg gctgtgtgca cgaacccccc gttcagcccg accgctgcgc 4980 cttatccggt aactatcgtc ttgagtccaa cccggtaaga cacgacttat cgccactggc 5040 agcagccact ggtaacagga ttagcagagc gaggtatgta ggcggtgcta cagagttctt 5100 gaagtggtgg cctaactacg gctacactag aaggacagta tttggtatct gcgctctgct 5160 gaagccagtt accttcggaa aaagagttgg tagctcttga tccggcaaac aaaccaccgc 5220 tggtagcggt ggtttttttg tttgcaagca gcagattacg cgcagaaaaa aaggatctca 5280 agaagatcct ttgatctttt ctacggggtc tgacgctcag tggaacgaaa actcacgtta 5340 agggattttg gtcatgagat tatcaaaaag gatcttcacc tagatccttt taaattaaaa 5400 atgaagtttt aaatcaatct aaagtatata tgagtaacct gaggctatgg cagggcctgc 5460 cgccccgacg ttggctgcga gccctgggcc ttcacccgaa cttggggggt ggggtgggga 5520 aaaggaagaa acgcgggcgt attggcccca atggggtctc ggtggggtat cgacagagtg 5580 ccagccctgg gaccgaaccc cgcgtttatg aacaaacgac ccaacaccgt gcgttttatt 5640 ctgtcttttt attgccgtca tagcgcgggt tccttccggt attgtctcct tccgtgtttc 5700 agttagcctc cccctagcta gtacaatttc ctgatgcggt attttctcct tacgcatctg 5760 tgcggtattt cacaccgcat agatcggcaa gtgcacaaac aatacttaaa taaatactac 5820 tcagtaataa cctatttctt agcatttttg acgaaatttg ctattttgtt agagtctttt 5880 acaccatttg tctccacacc tccgcttaca tcaacaccaa taacgccatt taatctaagc 5940 gcatcaccaa cattttctgg cgtcagtcca ccagctaaca taaaatgtaa gctttcgggg 6000 ctctcttgcc ttccaaccca gtcagaaatc gagttccaat ccaaaagttc acctgtccca 6060 cctgcttctg aatcaaacaa gggaataaac gaatgaggtt tctgtgaagc tgcactgagt 6120 agtatgttgc agtcttttgg aaatacgagt cttttaataa ctggcaaacc gaggaactct 6180 tggtattctt gccacgactc atctccatgc agttggacga tatcaatgcc gtaatcattg 6240 accagagcca aaacatcctc cttaggttga ttacgaaaca cgccaaccaa gtatttcgga 6300 gtgcctgaac tatttttata tgcttttaca agacttgaaa ttttccttgc aataaccggg 6360 tcaattgttc tctttctatt gggcacacat ataataccca gcaagtcagc atcggaatct 6420 agagcacatt ctgcggcctc tgtgctctgc aagccgcaaa ctttcaccaa tggaccagaa 6480 ctacctgtga aattaataac agacatactc caagctgcct ttgtgtgctt aatcacgtat 6540 actcacgtgc tcaatagtca ccaatgccct ccctcttggc cctctccttt tcttttttcg 6600 accgaattaa ttcttaatcg gcaaaaaaag aaaagctccg gatcaagatt gtacgtaagg 6660 tgacaagcta tttttcaata aagaatatct tccactactg ccatctggcg tcataactgc 6720 aaagtacaca tatattacga tgctgttcta ttaaatgctt cctatattat atatatagta 6780 atgtcgttga tctatggtgc actctcagta caatctgctc tgatgccgca tagttaagcc 6840 agccccgaca cccgccaaca cccgctgacg cgccctgacg ggcttgtctg ctcccggcat 6900 ccgcttacag acaagctgtg accgtctccg ggagctgcat gtgtcagagg ttttcaccgt 6960 catcaccgaa acgcgcgaga cgaaagggcc tcgtgatacg cctattttta taggttaatg 7020 tcatgataat aatggtttct taatatgatc caatatcaaa ggaaatgata gcattgaagg 7080 atgagactaa tccaattgag gagtggcagc atatagaaca gctaaagggt agtgctgaag 7140 gaagcatacg ataccccgca tggaatggga taatatcaca ggaggtacta gactaccttt 7200 catcctacat aaatagacgc atataagtac gcatttaagc ataaacacgc actatgccgt 7260 tcttctcatg tatatatata tacaggcaac acgcagatat aggtgcgacg tgaacagtga 7320 gctgtatgtg cgcagctcgc gttgcatttt cggaagcgct cgttttcgga aacgctttga 7380 agttcctatt ccgaagttcc tattctctag aaagtatagg aacttcagag cgcttttgaa 7440 aaccaaaagc gctctgaaga cgcactttca aaaaaccaaa aacgcaccgg actgtaacga 7500 gctactaaaa tattgcgaat accgcttcca caaacattgc tcaaaagtat ctctttgcta 7560 tatatctctg tgctatatcc ctatataacc tacccatcca cctttcgctc cttgaacttg 7620 catctaaact cgacctctac attttttatg tttatctcta gtattactct ttagacaaaa 7680 aaattgtagt aagaactatt catagagtga atcgaaaaca atacgaaaat gtaaacattt 7740 cctatacgta gtatatagag acaaaataga agaaaccgtt cataattttc tgaccaatga 7800 agaatcatca acgctatcac tttctgttca caaagtatgc gcaatccaca tcggtataga 7860 atataatcgg ggatgccttt atcttgaaaa aatgcacccg cagcttcgct agtaatcagt 7920 aaacgcggga agtggagtca ggcttttttt atggaagaga aaatagacac caaagtagcc 7980 ttcttctaac cttaacggac ctacagtgca aaaagttatc aagagactgc attatagagc 8040 gcacaaagga gaaaaaaagt aatctaagat gctttgttag aaaaatagcg ctctcgggat 8100 gcatttttgt agaacaaaaa agaagtatag attctttgtt ggtaaaatag cgctctcgcg 8160 ttgcatttct gttctgtaaa aatgcagctc agattctttg tttgaaaaat tagcgctctc 8220 gcgttgcatt tttgttttac aaaaatgaag cacagattct tcgttggtaa aatagcgctt 8280 tcgcgttgca tttctgttct gtaaaaatgc agctcagatt ctttgtttga aaaattagcg 8340 ctctcgcgtt gcatttttgt tctacaaaat gaagcacaga tgcttcgttc aggtggcact 8400 tttcggcgat 8410 <210> 16 <211> 8955 <212> DNA <213> Artificial Sequence <220> <223> pAD-acceptor <400> 16 tgcatgcctg caggtcgaga tccgggatcg aagaaatgat ggtaaatgaa ataggaaatc 60 aaggagcatg aaggcaaaag acaaatataa gggtcgaacg aaaaataaag tgaaaagtgt 120 tgatatgatg tatttggctt tgcggcgccg aaaaaacgag tttacgcaat tgcacaatca 180 tgctgactct gtggcggacc cgcgctcttg ccggcccggc gataacgctg ggcgtgaggc 240 tgtgcccggc ggagtttttt gcgcctgcat tttccaaggt ttaccctgcg ctaaggggcg 300 agattggaga agcaataaga atgccggttg gggttgcgat gatgacgacc acgacaactg 360 gtgtcattat ttaagttgcc gaaagaacct gagtgcattt gcaacatgag tatactagaa 420 gaatgagcca agacttgcga gacgcgagtt tgccggtggt gcgaacaata gagcgaccat 480 gaccttgaag gtgagacgcg cataaccgct agagtacttt gaagaggaaa cagcaatagg 540 gttgctacca gtataaatag acaggtacat acaacactgg aaatggttgt ctgtttgagt 600 acgctttcaa ttcatttggg tgtgcacttt attatgttac aatatggaag ggaactttac 660 acttctccta tgcacatata ttaattaaag tccaatgcta gtagagaagg ggggtaacac 720 ccctccgcgc tcttttccga tttttttcta aaccgtggaa tatttcggat atccttttgt 780 tgtttccggg tgtacaatat ggacttcctc ttttctggca accaaaccca tacatcggga 840 ttcctataat accttcgttg gtctccctaa catgtaggtg gcggagggga gatatacaat 900 agaacagata ccagacaaga cataatgggc taaacaagac tacaccaatt acactgcctc 960 attgatggtg gtacataacg aactaatact gtagccctag acttgatagc catcatcata 1020 tcgaagtttc actacccttt ttccatttgc catctattga agtaataata ggcgcatgca 1080 acttcttttc tttttttttc ttttctctct cccccgttgt tgtctcacca tatccgcaat 1140 gacaaaaaaa atgatggaag acactaaagg aaaaaattaa cgacaaagac agcaccaaca 1200 gatgtcgttg ttccagagct gatgaggggt atctcgaagc acacgaaact ttttccttcc 1260 ttcattcacg cacactactc tctaatgagc aacggtatac ggccttcctt ccagttactt 1320 gaatttgaaa taaaaaaaag tttgctgtct tgctatcaag tataaataga cctgcaatta 1380 ttaatctttt gtttcctcgt cattgttctc gttccctttc ttccttgttt ctttttctgc 1440 acaatatttc aagctatacc aagcatacaa tcaactccaa gctttgcaaa gatggataaa 1500 gcggaattaa ttcccgagcc tccaaaaaag aagagaaagg tcgaattggg taccgccgcc 1560 aattttaatc aaagtgggaa tattgctgat agctcattgt ccttcacttt cactaacagt 1620 agcaacggtc cgaacctcat aacaactcaa acaaattctc aagcgctttc acaaccaatt 1680 gcctcctcta acgttcatga taacttcatg aataatgaaa tcacggctag taaaattgat 1740 gatggtaata attcaaaacc actgtcacct ggttggacgg accaaactgc gtataacgcg 1800 tttggaatca ctacagggat gtttaatacc actacaatgg atgatgtata taactatcta 1860 ttcgatgatg aagatacccc accaaaccca aaaaaagaga tctttcaata cgactcacta 1920 aagggcgagc gccgccatgg ggcctggagg gccagtgaat tccacccggg tgggcatcga 1980 tacgggatcc atcgagctcg agctgcaggg cctccagggc cgtcgactaa ttgagtgaac 2040 gtacgctaaa gtagcccctt gaattccgag gcagtaggca cgtgaagttg cttcttggcc 2100 tcacctaggc tgcccgcgcc ggacttgtac agctcgtcca tgccgagagt gatcccggcg 2160 gcggtcacga actccagcag gaccatgtga tcgcgcttct cgttggggtc tttgctcagg 2220 gcggactggg tgctcaggta gtggttgtcg ggcagcagca cggggccgtc gccgatgggg 2280 gtgttctgct ggtagtggtc ggcgagctgc acgctgccgt cctcgatgtt gtggcggatc 2340 ttgaagttca ccttgatgcc gttcttctgc ttgtcggcca tgatatagac gttgtggctg 2400 ttgtagttgt actccagctt gtgccccagg atgttgccgt cctccttgaa gtcgatgccc 2460 ttcagctcga tgcggttcac cagggtgtcg ccctcgaact tcacctcggc gcgggtcttg 2520 tagttgccgt cgtccttgaa gaagatggtg cgctcctgga cgtagccttc gggcatggcg 2580 gacttgaaga agtcgtgctg cttcatgtgg tcggggtagc ggctgaagca ctgcacgccg 2640 taggtcaggg tggtcacgag ggtgggccag ggcacgggca gcttgccggt ggtgcagatg 2700 aacttcaggg tcagcttgcc gtaggtggca tcgccctcgc cctcgccgga cacgctgaac 2760 ttgtggccgt ttacgtcgcc gtccagctcg accaggatgg gcaccacccc ggtgaacagc 2820 tcctcgccct tgctcaccat ccgcggataa cttcgtataa agtatcctat acgaagttat 2880 gcatccgcta gccatgtaac ctctgatcta tagaattttt taaatgacta gaattaatgc 2940 ccatcttttt tttggaccta aattcttcat gaaaatatat tacgagggct tattcagaag 3000 ctttggactt cttcgccaga ggtttggtca agtctccaat caaggttgtc ggcttgtcta 3060 ccttgccaga aatttacgaa aagatggaaa agggtcaaat cgttggtaga tacgttgttg 3120 acacttctaa ataagcgaat ttcttatgat ttatgatttt tattattaaa taagttataa 3180 aaaaaataag tgtatacaaa ttttaaagtg actcttaggt tttaaaacga aaattcttat 3240 tcttgagtaa ctctttcctg taggtcaggt tgctttctca ggtatagcat gaggtcgctc 3300 ttattgacca cacctctacc ggccggtcga aattccccta ccctatgaac atattccatt 3360 ttgtaatttc gtgtcgtttc tattatgaat ttcatttata aagtttatgt acaaatatca 3420 taaaaaaacc tagggcatcc accatgaaaa agcctgaact caccgcgacg tctgtcgaga 3480 agtttctgat cgaaaagttc gacagcgtct ccgacctgat gcagctctcg gagggcgaag 3540 aatctcgtgc tttcagcttc gatgtaggag ggcgtggata tgtcctgcgg gtaaatagct 3600 gcgccgatgg tttctacaaa gatcgttatg tttatcggca ctttgcatcg gccgcgctcc 3660 cgattccgga agtgcttgac attggggagt tcagcgagag cctgacctat tgcatctccc 3720 gccgtgcaca gggtgtcacg ttgcaagacc tgcctgaaac cgaactgccc gctgttctgc 3780 agcttacata tggatcgatc catataactt cgtataatgt atgctatacg aagttatact 3840 agtaaggatt ttcttaactt cttcggcgac agcatcaccg acttcggtgg tactgttgga 3900 accacctaaa tcaccagttc tgatacctgc atccaaaacc tttttaactg catcttcaat 3960 ggccttacct tcttcaggca agttcaatga caatttcaac atcattgcag cagacaagat 4020 agtggcgata gggttgacct tattctttgg caaatctgca gcagaaccgt ggcatggttc 4080 gtacaaacca aatgcggtgt tcttgtctgg caaagaggcc aaggacgcag atggcaacaa 4140 acccaaggaa cctgggataa cggaggcttc atcggagatg atatcaccaa acatgttgct 4200 ggtgattata ataccattta ggtgggttgg gttcttaact aggatcatgg cggcagaatc 4260 aatcaattga tgttgaacct tcaatgtagg aaattcgttc ttgatggttt cctccacagt 4320 ttttctccat aatcttgaag aggccaaaac attagcttta tccaaggacc aaataggcaa 4380 tggtggctca tgttgtaggg ccatgaaagc ggccattctt gtgattcttt gcacttctgg 4440 aacggtgtat tgttcactat cccaagcgac accatcacca tcgtcttcct ttctcttacc 4500 aaagtaaata cctcccacta attctctgac aacaacgaag tcagtacctt tagcaaattg 4560 tggcttgatt ggagataagt ctaaaagaga gtcggatgca aagttacatg gtcttaagtt 4620 ggcgtacaat tgaagttctt tacggatttt tagtaaacct tgttcaggtc taacactacc 4680 tgtaccccat ttaggaccac ccacagcacc taacaaaacg gcatcaacct tcttggaggc 4740 ttccagcgcc tcatctggaa gtgggacacc tgtagcgtcg atagcagcac caccaattaa 4800 atgattttcg aaatcgaact tgacattgga acgaacatca gaaatagctt taagaacctt 4860 aatggcttcg gctgtgattt cttgaccaac gtggtcacct ggcaaaacga cgatcttctt 4920 aggggcagac attagaatgg tatatccttg aaatatatat atatattgct gaaatgtaaa 4980 aggtaagaaa agttagaaag taagacgatt gctaaccacc tattggaaaa aacaataggt 5040 ccttaaataa tattgtcaac ttcaagtatt gtgatgcaag catttagtca tgaacgcttc 5100 tctattctat atgaaaagcc ggttccggcg ctctcacctt tcctttttct cccaattttt 5160 cagttgaaaa aggtatatgc gtcaggcgac ctctgaaatt aacaaaaaat ttccagtcat 5220 cgaatttgat tctgtgcgat agcgcccctg tgtgttctcg ttatgttgag gaaaaaaata 5280 atggttgcta agagattcga actcttgcat cttacgatac ctgagtattc ccacagttgg 5340 ggatctcgac tctagctaga ggatcaattc gtaatcatgg tcatagctgt ttcctgtgtg 5400 aaattgttat ccgctcacaa ttccacacaa catacgagcc ggaagcataa agtgtaaagc 5460 ctggggtgcc taatgagtga gctaactcac attaattgcg ttgcgctcac tgcccgcttt 5520 ccagtcggga aacctgtcgt gccagctgca ttaatgaatc ggccaacgcg cggggagagg 5580 cggtttgcgt attgggcgct cttccgcttc ctcgctcact gactcgctgc gctcggtcgt 5640 tcggctgcgg cgagcggtat cagctcactc aaaggcggta atacggttat ccacagaatc 5700 aggggataac gcaggaaaga acatgtgagc aaaaggccag caaaaggcca ggaaccgtaa 5760 aaaggccgcg ttgctggcgt ttttccatag gctccgcccc cctgacgagc atcacaaaaa 5820 tcgacgctca agtcagaggt ggcgaaaccc gacaggacta taaagatacc aggcgtttcc 5880 ccctggaagc tccctcgtgc gctctcctgt tccgaccctg ccgcttaccg gatacctgtc 5940 cgcctttctc ccttcgggaa gcgtggcgct ttctcatagc tcacgctgta ggtatctcag 6000 ttcggtgtag gtcgttcgct ccaagctggg ctgtgtgcac gaaccccccg ttcagcccga 6060 ccgctgcgcc ttatccggta actatcgtct tgagtccaac ccggtaagac acgacttatc 6120 gccactggca gcagccactg gtaacaggat tagcagagcg aggtatgtag gcggtgctac 6180 agagttcttg aagtggtggc ctaactacgg ctacactaga aggacagtat ttggtatctg 6240 cgctctgctg aagccagtta ccttcggaaa aagagttggt agctcttgat ccggcaaaca 6300 aaccaccgct ggtagcggtg gtttttttgt ttgcaagcag cagattacgc gcagaaaaaa 6360 aggatctcaa gaagatcctt tgatcttttc tacggggtct gacgctcagt ggaacgaaaa 6420 ctcacgttaa gggattttgg tcatgagatt atcaaaaagg atcttcacct agatcctttt 6480 aaattaaaaa tgaagtttta aatcaatcta aagtatatat gagtaaactt ggtctgacag 6540 ttaccaatgc ttaatcagtg aggcacctat ctcagcgatc tgtctatttc gttcatccat 6600 agttgcctga ctccccgtcg tgtagataac tacgatacgg gagggcttac catctggccc 6660 cagtgctgca atgataccgc gagacccacg ctcaccggct gcagatttat cagcaataaa 6720 ccagccagcc ggaagggccg agcgcagaag tggtcctgca actttatccg cctccatcca 6780 gtctattaat tgttgccggg aagctagagt aagtagttcg ccagttaata gtttgcgcaa 6840 cgttgttgcc attgctacag gcatcgtggt gtcacgctcg tcgtttggta tggcttcatt 6900 cagctccggt tcccaacgat caaggcgagt tacatgatcc cccatgttgt gcaaaaaagc 6960 ggttagctcc ttcggtcctc cgatcgttgt cagaagtaag ttggccgcag tgttatcact 7020 catggttatg gcagcactgc ataattctct tactgtcatg ccatccgtaa gatgcttttc 7080 tgtgactggt gagtactcaa ccaagtcatt ctgagaatag tgtatgcggc gaccgagttg 7140 ctcttgcccg gcgtcaatac gggataatac cgcgccacat agcagaactt taaaagtgct 7200 catcattgga aaacgttctt cggggcgaaa actctcaagg atcttaccgc tgttgagatc 7260 cagttcgatg taacccactc gtgcacccaa ctgatcttca gcatctttta ctttcaccag 7320 cgtttctggg tgagcaaaaa caggaaggca aaatgccgca aaaaagggaa taagggcgac 7380 acggaaatgt tgaatactca tactcttcct ttttcaatat tattgaagca tttatcaggg 7440 ttattgtctc atgagcggat acatatttga atgtatttag aaaaataaac aaataggggt 7500 tccgcgcaca tttccccgaa aagtgccacc tgacgtctaa gaaaccatta ttatcatgac 7560 attaacctat aaaaataggc gtatcacgag gccctttcgt ctcgcgcgtt tcggtgatga 7620 cggtgaaaac ctctgacaca tgcagctccc ggagacggtc acagcttgtc tgtaagcgga 7680 tgccgggagc agacaagccc gtcagggcgc gtcagcgggt gttggcgggt gtcggggctg 7740 gcttaactat gcggcatcag agcagattgt actgagagtg caccataacg catttaagca 7800 taaacacgca ctatgccgtt cttctcatgt atatatatat acaggcaaca cgcagatata 7860 ggtgcgacgt gaacagtgag ctgtatgtgc gcagctcgcg ttgcattttc ggaagcgctc 7920 gttttcggaa acgctttgaa gttcctattc cgaagttcct attctctagc tagaaagtat 7980 aggaacttca gagcgctttt gaaaaccaaa agcgctctga agacgcactt tcaaaaaacc 8040 aaaaacgcac cggactgtaa cgagctacta aaatattgcg aataccgctt ccacaaacat 8100 tgctcaaaag tatctctttg ctatatatct ctgtgctata tccctatata acctacccat 8160 ccacctttcg ctccttgaac ttgcatctaa actcgacctc tacatttttt atgtttatct 8220 ctagtattac tctttagaca aaaaaattgt agtaagaact attcatagag tgaatcgaaa 8280 acaatacgaa aatgtaaaca tttcctatac gtagtatata gagacaaaat agaagaaacc 8340 gttcataatt ttctgaccaa tgaagaatca tcaacgctat cactttctgt tcacaaagta 8400 tgcgcaatcc acatcggtat agaatataat cggggatgcc tttatcttga aaaaatgcac 8460 ccgcagcttc gctagtaatc agtaaacgcg ggaagtggag tcaggctttt tttatggaag 8520 agaaaataga caccaaagta gccttcttct aaccttaacg gacctacagt gcaaaaagtt 8580 atcaagagac tgcattatag agcgcacaaa ggagaaaaaa agtaatctaa gatgctttgt 8640 tagaaaaata gcgctctcgg gatgcatttt tgtagaacaa aaaagaagta tagattcttt 8700 gttggtaaaa tagcgctctc gcgttgcatt tctgttctgt aaaaatgcag ctcagattct 8760 ttgtttgaaa aattagcgct ctcgcgttgc atttttgttt tacaaaaatg aagcacagat 8820 tcttcgttgg taaaatagcg ctttcgcgtt gcatttctgt tctgtaaaaa tgcagctcag 8880 attctttgtt tgaaaaatta gcgctctcgc gttgcatttt tgttctacaa aatgaagcac 8940 agatgcttcg ttgct 8955 <210> 17 <211> 8955 <212> DNA <213> Artificial Sequence <220> <223> pAD-acceptor <400> 17 tgcatgcctg caggtcgaga tccgggatcg aagaaatgat ggtaaatgaa ataggaaatc 60 aaggagcatg aaggcaaaag acaaatataa gggtcgaacg aaaaataaag tgaaaagtgt 120 tgatatgatg tatttggctt tgcggcgccg aaaaaacgag tttacgcaat tgcacaatca 180 tgctgactct gtggcggacc cgcgctcttg ccggcccggc gataacgctg ggcgtgaggc 240 tgtgcccggc ggagtttttt gcgcctgcat tttccaaggt ttaccctgcg ctaaggggcg 300 agattggaga agcaataaga atgccggttg gggttgcgat gatgacgacc acgacaactg 360 gtgtcattat ttaagttgcc gaaagaacct gagtgcattt gcaacatgag tatactagaa 420 gaatgagcca agacttgcga gacgcgagtt tgccggtggt gcgaacaata gagcgaccat 480 gaccttgaag gtgagacgcg cataaccgct agagtacttt gaagaggaaa cagcaatagg 540 gttgctacca gtataaatag acaggtacat acaacactgg aaatggttgt ctgtttgagt 600 acgctttcaa ttcatttggg tgtgcacttt attatgttac aatatggaag ggaactttac 660 acttctccta tgcacatata ttaattaaag tccaatgcta gtagagaagg ggggtaacac 720 ccctccgcgc tcttttccga tttttttcta aaccgtggaa tatttcggat atccttttgt 780 tgtttccggg tgtacaatat ggacttcctc ttttctggca accaaaccca tacatcggga 840 ttcctataat accttcgttg gtctccctaa catgtaggtg gcggagggga gatatacaat 900 agaacagata ccagacaaga cataatgggc taaacaagac tacaccaatt acactgcctc 960 attgatggtg gtacataacg aactaatact gtagccctag acttgatagc catcatcata 1020 tcgaagtttc actacccttt ttccatttgc catctattga agtaataata ggcgcatgca 1080 acttcttttc tttttttttc ttttctctct cccccgttgt tgtctcacca tatccgcaat 1140 gacaaaaaaa atgatggaag acactaaagg aaaaaattaa cgacaaagac agcaccaaca 1200 gatgtcgttg ttccagagct gatgaggggt atctcgaagc acacgaaact ttttccttcc 1260 ttcattcacg cacactactc tctaatgagc aacggtatac ggccttcctt ccagttactt 1320 gaatttgaaa taaaaaaaag tttgctgtct tgctatcaag tataaataga cctgcaatta 1380 ttaatctttt gtttcctcgt cattgttctc gttccctttc ttccttgttt ctttttctgc 1440 acaatatttc aagctatacc aagcatacaa tcaactccaa gctttgcaaa gatggataaa 1500 gcggaattaa ttcccgagcc tccaaaaaag aagagaaagg tcgaattggg taccgccgcc 1560 aattttaatc aaagtgggaa tattgctgat agctcattgt ccttcacttt cactaacagt 1620 agcaacggtc cgaacctcat aacaactcaa acaaattctc aagcgctttc acaaccaatt 1680 gcctcctcta acgttcatga taacttcatg aataatgaaa tcacggctag taaaattgat 1740 gatggtaata attcaaaacc actgtcacct ggttggacgg accaaactgc gtataacgcg 1800 tttggaatca ctacagggat gtttaatacc actacaatgg atgatgtata taactatcta 1860 ttcgatgatg aagatacccc accaaaccca aaaaaagaga tctttcaata cgactcacta 1920 aagggcgagc gccgccatgg ggcctggagg gccagtgaat tccacccggg tgggcatcga 1980 tacgggatcc atcgagctcg agctgcaggg cctccagggc cgtcgactaa ttgagtgaat 2040 ctagactaaa gtagcccctt gaattccgag gcagtaggca cgtgaagttg cttcttggcc 2100 tcacctaggc tgcccgcgcc ggacttgtac agctcgtcca tgccgagagt gatcccggcg 2160 gcggtcacga actccagcag gaccatgtga tcgcgcttct cgttggggtc tttgctcagg 2220 gcggactggg tgctcaggta gtggttgtcg ggcagcagca cggggccgtc gccgatgggg 2280 gtgttctgct ggtagtggtc ggcgagctgc acgctgccgt cctcgatgtt gtggcggatc 2340 ttgaagttca ccttgatgcc gttcttctgc ttgtcggcca tgatatagac gttgtggctg 2400 ttgtagttgt actccagctt gtgccccagg atgttgccgt cctccttgaa gtcgatgccc 2460 ttcagctcga tgcggttcac cagggtgtcg ccctcgaact tcacctcggc gcgggtcttg 2520 tagttgccgt cgtccttgaa gaagatggtg cgctcctgga cgtagccttc gggcatggcg 2580 gacttgaaga agtcgtgctg cttcatgtgg tcggggtagc ggctgaagca ctgcacgccg 2640 taggtcaggg tggtcacgag ggtgggccag ggcacgggca gcttgccggt ggtgcagatg 2700 aacttcaggg tcagcttgcc gtaggtggca tcgccctcgc cctcgccgga cacgctgaac 2760 ttgtggccgt ttacgtcgcc gtccagctcg accaggatgg gcaccacccc ggtgaacagc 2820 tcctcgccct tgctcaccat ccgcggataa cttcgtataa agtatcctat acgaagttat 2880 gcatccgcta gccatgtaac ctctgatcta tagaattttt taaatgacta gaattaatgc 2940 ccatcttttt tttggaccta aattcttcat gaaaatatat tacgagggct tattcagaag 3000 ctttggactt cttcgccaga ggtttggtca agtctccaat caaggttgtc ggcttgtcta 3060 ccttgccaga aatttacgaa aagatggaaa agggtcaaat cgttggtaga tacgttgttg 3120 acacttctaa ataagcgaat ttcttatgat ttatgatttt tattattaaa taagttataa 3180 aaaaaataag tgtatacaaa ttttaaagtg actcttaggt tttaaaacga aaattcttat 3240 tcttgagtaa ctctttcctg taggtcaggt tgctttctca ggtatagcat gaggtcgctc 3300 ttattgacca cacctctacc ggccggtcga aattccccta ccctatgaac atattccatt 3360 ttgtaatttc gtgtcgtttc tattatgaat ttcatttata aagtttatgt acaaatatca 3420 taaaaaaacc tagggcatcc accatgaaaa agcctgaact caccgcgacg tctgtcgaga 3480 agtttctgat cgaaaagttc gacagcgtct ccgacctgat gcagctctcg gagggcgaag 3540 aatctcgtgc tttcagcttc gatgtaggag ggcgtggata tgtcctgcgg gtaaatagct 3600 gcgccgatgg tttctacaaa gatcgttatg tttatcggca ctttgcatcg gccgcgctcc 3660 cgattccgga agtgcttgac attggggagt tcagcgagag cctgacctat tgcatctccc 3720 gccgtgcaca gggtgtcacg ttgcaagacc tgcctgaaac cgaactgccc gctgttctgc 3780 agcttacata tggatcgatc catataactt cgtataatgt atgctatacg aagttatact 3840 agtaaggatt ttcttaactt cttcggcgac agcatcaccg acttcggtgg tactgttgga 3900 accacctaaa tcaccagttc tgatacctgc atccaaaacc tttttaactg catcttcaat 3960 ggccttacct tcttcaggca agttcaatga caatttcaac atcattgcag cagacaagat 4020 agtggcgata gggttgacct tattctttgg caaatctgca gcagaaccgt ggcatggttc 4080 gtacaaacca aatgcggtgt tcttgtctgg caaagaggcc aaggacgcag atggcaacaa 4140 acccaaggaa cctgggataa cggaggcttc atcggagatg atatcaccaa acatgttgct 4200 ggtgattata ataccattta ggtgggttgg gttcttaact aggatcatgg cggcagaatc 4260 aatcaattga tgttgaacct tcaatgtagg aaattcgttc ttgatggttt cctccacagt 4320 ttttctccat aatcttgaag aggccaaaac attagcttta tccaaggacc aaataggcaa 4380 tggtggctca tgttgtaggg ccatgaaagc ggccattctt gtgattcttt gcacttctgg 4440 aacggtgtat tgttcactat cccaagcgac accatcacca tcgtcttcct ttctcttacc 4500 aaagtaaata cctcccacta attctctgac aacaacgaag tcagtacctt tagcaaattg 4560 tggcttgatt ggagataagt ctaaaagaga gtcggatgca aagttacatg gtcttaagtt 4620 ggcgtacaat tgaagttctt tacggatttt tagtaaacct tgttcaggtc taacactacc 4680 tgtaccccat ttaggaccac ccacagcacc taacaaaacg gcatcaacct tcttggaggc 4740 ttccagcgcc tcatctggaa gtgggacacc tgtagcgtcg atagcagcac caccaattaa 4800 atgattttcg aaatcgaact tgacattgga acgaacatca gaaatagctt taagaacctt 4860 aatggcttcg gctgtgattt cttgaccaac gtggtcacct ggcaaaacga cgatcttctt 4920 aggggcagac attagaatgg tatatccttg aaatatatat atatattgct gaaatgtaaa 4980 aggtaagaaa agttagaaag taagacgatt gctaaccacc tattggaaaa aacaataggt 5040 ccttaaataa tattgtcaac ttcaagtatt gtgatgcaag catttagtca tgaacgcttc 5100 tctattctat atgaaaagcc ggttccggcg ctctcacctt tcctttttct cccaattttt 5160 cagttgaaaa aggtatatgc gtcaggcgac ctctgaaatt aacaaaaaat ttccagtcat 5220 cgaatttgat tctgtgcgat agcgcccctg tgtgttctcg ttatgttgag gaaaaaaata 5280 atggttgcta agagattcga actcttgcat cttacgatac ctgagtattc ccacagttgg 5340 ggatctcgac tctagctaga ggatcaattc gtaatcatgg tcatagctgt ttcctgtgtg 5400 aaattgttat ccgctcacaa ttccacacaa catacgagcc ggaagcataa agtgtaaagc 5460 ctggggtgcc taatgagtga gctaactcac attaattgcg ttgcgctcac tgcccgcttt 5520 ccagtcggga aacctgtcgt gccagctgca ttaatgaatc ggccaacgcg cggggagagg 5580 cggtttgcgt attgggcgct cttccgcttc ctcgctcact gactcgctgc gctcggtcgt 5640 tcggctgcgg cgagcggtat cagctcactc aaaggcggta atacggttat ccacagaatc 5700 aggggataac gcaggaaaga acatgtgagc aaaaggccag caaaaggcca ggaaccgtaa 5760 aaaggccgcg ttgctggcgt ttttccatag gctccgcccc cctgacgagc atcacaaaaa 5820 tcgacgctca agtcagaggt ggcgaaaccc gacaggacta taaagatacc aggcgtttcc 5880 ccctggaagc tccctcgtgc gctctcctgt tccgaccctg ccgcttaccg gatacctgtc 5940 cgcctttctc ccttcgggaa gcgtggcgct ttctcatagc tcacgctgta ggtatctcag 6000 ttcggtgtag gtcgttcgct ccaagctggg ctgtgtgcac gaaccccccg ttcagcccga 6060 ccgctgcgcc ttatccggta actatcgtct tgagtccaac ccggtaagac acgacttatc 6120 gccactggca gcagccactg gtaacaggat tagcagagcg aggtatgtag gcggtgctac 6180 agagttcttg aagtggtggc ctaactacgg ctacactaga aggacagtat ttggtatctg 6240 cgctctgctg aagccagtta ccttcggaaa aagagttggt agctcttgat ccggcaaaca 6300 aaccaccgct ggtagcggtg gtttttttgt ttgcaagcag cagattacgc gcagaaaaaa 6360 aggatctcaa gaagatcctt tgatcttttc tacggggtct gacgctcagt ggaacgaaaa 6420 ctcacgttaa gggattttgg tcatgagatt atcaaaaagg atcttcacct agatcctttt 6480 aaattaaaaa tgaagtttta aatcaatcta aagtatatat gagtaaactt ggtctgacag 6540 ttaccaatgc ttaatcagtg aggcacctat ctcagcgatc tgtctatttc gttcatccat 6600 agttgcctga ctccccgtcg tgtagataac tacgatacgg gagggcttac catctggccc 6660 cagtgctgca atgataccgc gagacccacg ctcaccggct gcagatttat cagcaataaa 6720 ccagccagcc ggaagggccg agcgcagaag tggtcctgca actttatccg cctccatcca 6780 gtctattaat tgttgccggg aagctagagt aagtagttcg ccagttaata gtttgcgcaa 6840 cgttgttgcc attgctacag gcatcgtggt gtcacgctcg tcgtttggta tggcttcatt 6900 cagctccggt tcccaacgat caaggcgagt tacatgatcc cccatgttgt gcaaaaaagc 6960 ggttagctcc ttcggtcctc cgatcgttgt cagaagtaag ttggccgcag tgttatcact 7020 catggttatg gcagcactgc ataattctct tactgtcatg ccatccgtaa gatgcttttc 7080 tgtgactggt gagtactcaa ccaagtcatt ctgagaatag tgtatgcggc gaccgagttg 7140 ctcttgcccg gcgtcaatac gggataatac cgcgccacat agcagaactt taaaagtgct 7200 catcattgga aaacgttctt cggggcgaaa actctcaagg atcttaccgc tgttgagatc 7260 cagttcgatg taacccactc gtgcacccaa ctgatcttca gcatctttta ctttcaccag 7320 cgtttctggg tgagcaaaaa caggaaggca aaatgccgca aaaaagggaa taagggcgac 7380 acggaaatgt tgaatactca tactcttcct ttttcaatat tattgaagca tttatcaggg 7440 ttattgtctc atgagcggat acatatttga atgtatttag aaaaataaac aaataggggt 7500 tccgcgcaca tttccccgaa aagtgccacc tgacgtctaa gaaaccatta ttatcatgac 7560 attaacctat aaaaataggc gtatcacgag gccctttcgt ctcgcgcgtt tcggtgatga 7620 cggtgaaaac ctctgacaca tgcagctccc ggagacggtc acagcttgtc tgtaagcgga 7680 tgccgggagc agacaagccc gtcagggcgc gtcagcgggt gttggcgggt gtcggggctg 7740 gcttaactat gcggcatcag agcagattgt actgagagtg caccataacg catttaagca 7800 taaacacgca ctatgccgtt cttctcatgt atatatatat acaggcaaca cgcagatata 7860 ggtgcgacgt gaacagtgag ctgtatgtgc gcagctcgcg ttgcattttc ggaagcgctc 7920 gttttcggaa acgctttgaa gttcctattc cgaagttcct attctctagc tagaaagtat 7980 aggaacttca gagcgctttt gaaaaccaaa agcgctctga agacgcactt tcaaaaaacc 8040 aaaaacgcac cggactgtaa cgagctacta aaatattgcg aataccgctt ccacaaacat 8100 tgctcaaaag tatctctttg ctatatatct ctgtgctata tccctatata acctacccat 8160 ccacctttcg ctccttgaac ttgcatctaa actcgacctc tacatttttt atgtttatct 8220 ctagtattac tctttagaca aaaaaattgt agtaagaact attcatagag tgaatcgaaa 8280 acaatacgaa aatgtaaaca tttcctatac gtagtatata gagacaaaat agaagaaacc 8340 gttcataatt ttctgaccaa tgaagaatca tcaacgctat cactttctgt tcacaaagta 8400 tgcgcaatcc acatcggtat agaatataat cggggatgcc tttatcttga aaaaatgcac 8460 ccgcagcttc gctagtaatc agtaaacgcg ggaagtggag tcaggctttt tttatggaag 8520 agaaaataga caccaaagta gccttcttct aaccttaacg gacctacagt gcaaaaagtt 8580 atcaagagac tgcattatag agcgcacaaa ggagaaaaaa agtaatctaa gatgctttgt 8640 tagaaaaata gcgctctcgg gatgcatttt tgtagaacaa aaaagaagta tagattcttt 8700 gttggtaaaa tagcgctctc gcgttgcatt tctgttctgt aaaaatgcag ctcagattct 8760 ttgtttgaaa aattagcgct ctcgcgttgc atttttgttt tacaaaaatg aagcacagat 8820 tcttcgttgg taaaatagcg ctttcgcgtt gcatttctgt tctgtaaaaa tgcagctcag 8880 attctttgtt tgaaaaatta gcgctctcgc gttgcatttt tgttctacaa aatgaagcac 8940 agatgcttcg ttgct 8955 <210> 18 <211> 622 <212> PRT <213> Artificial Sequence <220> <223> SV40 LTag a.a sequence <400> 18 Gly Thr Asp Glu Trp Glu Gln Trp Trp Asn Ala Phe Asn Glu Glu Asn   1 5 10 15 Leu Phe Cys Ser Glu Glu Met Pro Ser Ser Asp Asp Glu Ala Thr Ala              20 25 30 Asp Ser Gln His Ser Thr Pro Pro Lys Lys Lys Arg Lys Val Glu Asp          35 40 45 Pro Lys Asp Phe Pro Ser Glu Leu Leu Ser Phe Leu Ser His Ala Val      50 55 60 Phe Ser Asn Arg Thr Leu Ala Cys Phe Ala Ile Tyr Thr Thr Lys Glu  65 70 75 80 Lys Ala Leu Leu Tyr Lys Lys Ile Met Glu Lys Tyr Ser Val Thr                  85 90 95 Phe Ile Ser Arg His His Ser Tyr Asn His Asn Ile Leu Phe Phe Leu             100 105 110 Thr Pro His Arg His Arg Val Ser Ala Ile Asn Asn Tyr Ala Gln Lys         115 120 125 Leu Cys Thr Phe Ser Phe Leu Ile Cys Lys Gly Val Asn Lys Glu Tyr     130 135 140 Leu Met Tyr Ser Ala Leu Thr Arg Asp Pro Phe Ser Val Ile Glu Glu 145 150 155 160 Ser Leu Pro Gly Gly Leu Lys Glu His Asp Phe Asn Pro Glu Glu Ala                 165 170 175 Glu Glu Thr Lys Gln Val Ser Trp Lys Leu Val Thr Glu Tyr Ala Met             180 185 190 Glu Thr Lys Cys Asp Asp Val Leu Leu Leu Leu Gly Met Tyr Leu Glu         195 200 205 Phe Gln Tyr Ser Phe Glu Met Cys Leu Lys Cys Ile Lys Lys Glu Gln     210 215 220 Pro Ser His Tyr Lys Tyr His Glu Lys His Tyr Ala Asn Ala Ala Ile 225 230 235 240 Phe Ala Asp Ser Lys Asn Gln Lys Thr Ile Cys Gln Gln Ala Val Asp                 245 250 255 Thr Val Leu Ala Lys Lys Arg Val Asp Ser Leu Gln Leu Thr Arg Glu             260 265 270 Gln Met Leu Thr Asn Arg Phe Asn Asp Leu Leu Asp Arg Met Met Asp Ile         275 280 285 Met Phe Gly Ser Thr Gly Ser Ala Asp Ile Glu Glu Trp Met Ala Gly     290 295 300 Val Ala Trp Leu His Cys Leu Leu Pro Lys Met Asp Ser Val Val Tyr 305 310 315 320 Asp Phe Leu Lys Cys Met Val Tyr Asn Ile Pro Lys Lys Arg Tyr Trp                 325 330 335 Leu Phe Lys Gly Pro Ile Asp Ser Gly Lys Thr Thr Leu Ala Ala Ala             340 345 350 Leu Leu Glu Leu Cys Gly Gly Lys Ala Leu Asn Val Asn Leu Pro Leu         355 360 365 Asp Arg Leu Asn Phe Glu Leu Gly Val Ala Ile Asp Gln Phe Leu Val     370 375 380 Val Phe Glu Asp Val Lys Gly Thr Gly Gly Glu Ser Arg Asp Leu Pro 385 390 395 400 Ser Gly Gln Gly Ile Asn Asn Leu Asp Asn Leu Arg Asp Tyr Leu Asp                 405 410 415 Gly Ser Val Lys Val Asn Leu Glu Lys Lys His Leu Asn Lys Arg Thr             420 425 430 Gln Ile Phe Pro Pro Gly Ile Val Thr Met Asn Glu Tyr Ser Val Pro         435 440 445 Lys Thr Leu Gln Ala Arg Phe Val Lys Gln Ile Asp Phe Arg Pro Lys     450 455 460 Asp Tyr Leu Lys His Cys Leu Glu Arg Ser Glu Phe Leu Leu Glu Lys 465 470 475 480 Arg Ile Ile Gln Ser Gly Ile Ala Leu Leu Leu Met Leu Ile Trp Tyr                 485 490 495 Arg Pro Val Ala Glu Phe Ala Gln Ser Ile Gln Ser Arg Ile Val Glu             500 505 510 Trp Lys Glu Arg Leu Asp Lys Glu Phe Ser Leu Ser Val Tyr Gln Lys         515 520 525 Met Lys Phe Asn Val Ala Met Gly Ile Gly Val Leu Asp Trp Leu Arg     530 535 540 Asn Ser Asp Asp Asp Asp Glu Asp Ser Glu Glu Asn Ala Asp Lys Asn 545 550 555 560 Glu Asp Gly Gly Glu Lys Asn Met Glu Asp Ser Gly His Glu Thr Gly                 565 570 575 Ile Asp Ser Gln Ser Gln Gly Ser Phe Gln Ala Pro Gln Ser Ser Gln             580 585 590 Ser Val His Asp His Asn Gln Pro Tyr His Ile Cys Arg Gly Phe Thr         595 600 605 Cys Phe Lys Lys Pro Pro Thr Pro Pro Pro Glu Pro Glu Thr     610 615 620 <210> 19 <211> 319 <212> PRT <213> Artificial Sequence <220> <223> Murine p53 a.a sequence <400> 19 Pro Val Thr Glu Thr Pro Gly Pro Val Ala Pro Ala Pro Ala Thr Pro   1 5 10 15 Trp Pro Leu Ser Ser Phe Val Ser Ser Gln Lys Thr Tyr Gln Gly Asn              20 25 30 Tyr Gly Phe His Leu Gly Phe Leu Gln Ser Gly Thr Ala Lys Ser Val          35 40 45 Met Cys Thr Tyr Ser Pro Pro Leu Asn Lys Leu Phe Cys Gln Leu Val      50 55 60 Lys Thr Cys Pro Val Gln Leu Trp Val Ser Ala Thr Pro Pro Ala Gly  65 70 75 80 Ser Arg Val Ala Met Ala Ile Tyr Lys Lys Ser Gln His Met Thr                  85 90 95 Glu Val Val Arg Arg Cys Pro His His Glu Arg Cys Ser Asp Gly Asp             100 105 110 Gly Leu Ala Pro Pro Gln His Leu Ile Arg Val Glu Gly Asn Leu Tyr         115 120 125 Pro Glu Tyr Leu Glu Asp Arg Gln Thr Phe Arg His Ser Val Val Val     130 135 140 Pro Tyr Glu Pro Pro Glu Ala Gly Ser Glu Tyr Thr Thr Ile His Tyr 145 150 155 160 Lys Tyr Met Cys Asn Ser Ser Cys Met Gly Gly Met Asn Arg Arg Pro                 165 170 175 Ile Leu Thr Ile Ile Thr Leu Glu Asp Ser Ser Gly Asn Leu Leu Gly             180 185 190 Arg Asp Ser Phe Glu Val Arg Cys Ala Cys Pro Gly Arg Asp Arg         195 200 205 Arg Thr Glu Glu Glu Asn Phe Arg Lys Lys Glu Val Leu Cys Pro Glu     210 215 220 Leu Pro Pro Gly Ser Ala Lys Arg Ala Leu Pro Thr Cys Thr Ser Ala 225 230 235 240 Ser Pro Pro Gln Lys Lys Lys Pro Leu Asp Gly Glu Tyr Phe Thr Leu                 245 250 255 Lys Ile Arg Gly Arg Lys Arg Phe Glu Met Phe Arg Glu Leu Asn Glu             260 265 270 Ala Leu Glu Leu Lys Asp Ala His Ala Thr Glu Glu Ser Gly Asp Ser         275 280 285 Arg Ala His Ser Ser Tyr Leu Lys Thr Lys Lys Gly Gln Ser Thr Ser     290 295 300 Arg His Lys Lys Thr Met Val Lys Lys Val Gly Pro Asp Ser Asp 305 310 315 <210> 20 <211> 34 <212> DNA <213> Artificial Sequence <220> <223> lox 2272 <400> 20 ataacttcgt ataaagtatc ctatacgaag ttat 34 <210> 21 <211> 34 <212> DNA <213> Artificial Sequence <220> <223> lox P <400> 21 ataacttcgt ataatgtatg ctatacgaag ttat 34 <210> 22 <211> 251 <212> PRT <213> Artificial Sequence <220> <223> DX2 (AIMP2-DX2) <400> 22 Met Pro Met Tyr Gln Val Lys Pro Tyr His Gly Gly Gly Ala Pro Leu   1 5 10 15 Arg Val Glu Leu Pro Thr Cys Met Tyr Arg Leu Pro Asn Val His Gly              20 25 30 Arg Ser Tyr Gly Pro Ala Pro Gly Ala Gly His Val Gln Asp Tyr Gly          35 40 45 Ala Leu Lys Asp Ile Val Ile Asn Ala Asn Pro      50 55 60 Ser Leu Leu Val Leu His Arg Leu Leu Cys Glu His Phe Arg Val Leu  65 70 75 80 Ser Thr Val His Thr His Ser Ser Val Lys Ser Val Pro Glu Asn Leu                  85 90 95 Leu Lys Cys Phe Gly Glu Gln Asn Lys Lys Gln Pro Arg Gln Asp Tyr             100 105 110 Gln Leu Gly Phe Thr Leu Ile Trp Lys Asn Val Pro Lys Thr Gln Met         115 120 125 Lys Phe Ser Ile Gln Thr Met Cys Pro Ile Glu Gly Glu Gly Asn Ile     130 135 140 Ala Arg Phe Leu Phe Ser Leu Phe Gly Gln Lys His Asn Ala Val Asn 145 150 155 160 Ala Thr Leu Ile Asp Ser Trp Val Asp Ile Ala Ile Phe Gln Leu Lys                 165 170 175 Glu Gly Ser Ser Lys Glu Lys Ala Ala Val Phe Arg Ser Ser Met Asn Ser             180 185 190 Ala Leu Gly Lys Ser Pro Trp Leu Ala Gly Asn Glu Leu Thr Val Ala         195 200 205 Asp Val Val Leu Trp Ser Val Leu Gln Gln Ile Gly Gly Cys Ser Val     210 215 220 Thr Val Pro Ala Asn Val Gln Arg Trp Met Arg Ser Ser Cys Glu Asn Leu 225 230 235 240 Ala Pro Phe Asn Thr Ala Leu Lys Leu Leu Lys                 245 250 <210> 23 <211> 181 <212> PRT <213> Artificial Sequence <220> <223> Lamin A (Homo sapiens) <400> 23 Met Glu Ala Glu Phe Pro Gly Ile Ser Glu Glu Val Val Ser Arg Glu   1 5 10 15 Val Ser Gly Ile Lys Ala Ala Tyr Glu Ala Glu Leu Gly Asp Ala Arg              20 25 30 Lys Thr Leu Asp Ser Val Ala Lys Glu Arg Ala Arg Leu Gln Leu Glu          35 40 45 Leu Ser Lys Val Arg Glu Glu Phe Lys Glu Leu Lys Ala Arg Asn Thr      50 55 60 Lys Lys Glu Gly Asp Leu Ile Ala Ala Gln Ala Arg Leu Lys Asp Leu  65 70 75 80 Glu Ala Leu Leu Asn Ser Lys Glu Ala Ala Leu Ser Thr Ala Leu Ser                  85 90 95 Glu Lys Arg Thr Leu Glu Gly Glu Leu His Asp Leu Arg Gly Gln Val             100 105 110 Ala Lys Leu Glu Ala Ala Leu Gly Glu Ala Lys Lys Gln Leu Gln Asp         115 120 125 Glu Met Leu Arg Arg Val Asp Ala Glu Asn Arg Leu Gln Thr Met Lys     130 135 140 Glu Glu Leu Asp Phe Gln Lys Asn Ile Tyr Ser Glu Glu Leu Arg Glu 145 150 155 160 Thr Lys Arg Arg His Glu Thr Arg Leu Val Glu Ile Asp Arg Ile Arg                 165 170 175 Arg Pro Ala Ala Ala             180 <210> 24 <211> 450 <212> DNA <213> Artificial Sequence <220> <223> Gal1 promoter <400> 24 acggattaga agccgccgag cgggtgacag ccctccgaag gaagactctc ctccgtgcgt 60 cctcgtcttc accggtcgcg ttcctgaaac gcagatgtgc ctcgcgccgc actgctccga 120 acaataaaga ttctacaata ctagctttta tggttatgaa gaggaaaaat tggcagtaac 180 ctggccccac aaaccttcaa atgaacgaat caaattaaca accataggat gataatgcga 240 ttagtttttt agccttattt ctggggtaat taatcagcga agcgatgatt tttgatctat 300 taacagatat ataaatgcaa aaactgcata accactttaa ctaatacttt caacattttc 360 ggtttgtatt acttcttatt caaatgtaat aaaagtatca acaaaaaatt gttaatatac 420 ctctatactt taacgtcaag gagaaaaaac 450 <210> 25 <211> 267 <212> DNA <213> Artificial Sequence <220> <223> MFalpha 1 <400> 25 atgagatttc cttcaatttt tactgctgtt ttattcgcag catcctccgc attagctgct 60 ccagtcaaca ctacaacaga agatgaaacg gcacaaattc cggctgaagc tgtcatcggt 120 tactcagatt tagaagggga tttcgatgtt gctgttttgc cattttccaa cagcacaaat 180 aacgggttat tgtttataaa tactactatt gccagcattg ctgctaaaga agaaggggta 240 tctctcgaga aaagagaggc tgaagct 267 <210> 26 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> c-myc <400> 26 gagcaaaagc tcatttctga agaggacttg 30 <210> 27 <211> 48 <212> DNA <213> Artificial Sequence <220> <223> Glycine / Serine linker <400> 27 gctagtggtg gtggtggttc tggtggtggt ggttctggtg gtggtggt 48 <210> 28 <211> 1053 <212> DNA <213> Artificial Sequence <220> <223> Ag alpha I <400> 28 cttgatacca tagcaaatac tacgtacgct acgcaattct cgactactag ggaatttatt 60 gtttatcagg gtcggaacct cggtacagct agcgccaaaa gctcttttat ctcaaccact 120 actactgatt taacaagtat aaacactagt gcgtattcca ctggatccat ttccacagta 180 gaaacaggca atcgaactac atcagaagtg atcagccatg tggtgactac cagcacaaaa 240 ctgtctccaa ctgctactac cagcctgaca attgcacaaa ccagtatcta ttctactgac 300 tcaaatatca cagtaggaac agatattcac accacatcag aagtgattag tgatgtggaa 360 accattagca gagaaacagc ttcgaccgtt gtagccgctc caacctcaac aactggatgg 420 acaggcgcta tgaatactta catctcgcaa tttacatcct cttctttcgc aacaatcaac 480 agcacaccaa taatctcttc atcagcagta tttgaaacct cagatgcttc aattgtcaat 540 gtgcacactg aaaatatcac gaatactgct gctgttccat ctgaagagcc cacttttgta 600 aatgccacga gaaactcctt aaattccttc tgcagcagca aacagccatc cagtccctca 660 tcttatacgt cttccccact cgtatcgtcc ctctccgtaa gcaaaacatt actaagcacc 720 agttttacgc cttctgtgcc aacatctaat acatatatca aaacgaaaaa tacgggttac 780 tttgagcaca cggctttgac aacatcttca gttggcctta attcttttag tgaaacagca 840 gtctcatctc agggaacgaa aattgacacc tttttagtgt catccttgat cgcatatcct 900 tcttctgcat caggaagcca attgtccggt atccaacaga atttcacatc aacttctctc 960 atgatttcaa cctatgaagg taaagcgtct atatttttct cagctgagct cggttcgatc 1020 atttttctgc ttttgtcgta cctgctattc taa 1053 <210> 29 <211> 1134 <212> DNA <213> Artificial Sequence <220> <223> CRE recombinase <400> 29 atgactaaat ctcattcaga agaagtgatt gtacctgagt tcaattctag cgcaaaggaa 60 ttaccaagac cattggccga aaagtgcgga attcaaatgt ctaatttgtt gactgttcat 120 caaaatttgc cagctttgcc agttgatgca acgtctgatg aggtaagaaa gaatttgatg 180 gatatgttta gagatagaca agcattctct gaacatactt ggaaaatgtt gttgtctgtt 240 tgtagatctt gggctgcttg gtgtaaatta aataatagaa aatggtttcc agctgaacca 300 gaagatgtta gagattattt gttgtatttg caagctagag gtttggctgt taaaactata 360 caacaacatt tgggtcaatt aaatatgttg cataggagat ctggtttgcc tagaccatct 420 gattctaatg ctgtatcttt ggttatgaga aggattagaa aagaaaatgt tgatgcaggt 480 gaaagagcta aacaagcatt ggcgtttgaa agaactgatt ttgatcaagt tagatctttg 540 atggaaaatt ctgatagatg tcaagatata agaaacttgg ctttcttggg aattgcttat 600 aatacattgt tgagaattgc tgaaattgct agaattagag ttaaagacat ttctagaact 660 gatggtggta gaatgttgat tcatattggt agaactaaaa cattggtttc aactgctggc 720 gttgagaaag cattgtcttt gggtgttact aaattggttg aaagatggat ttctgtatct 780 ggtgtggctg atgacccaaa taattattta ttttgtagag ttagaaagaa tggtgttgcg 840 gctccatctg ctacatctca gctctctacc cgtgccttgg aaggaatttt tgaagcaact 900 catagattga tttatggtgc taaagatgat tctggtcaaa gatatttagc atggtctggt 960 cattctgcta gagttggtgc cgctagagat atggctagag ctggggtatc tattcctgaa 1020 attatgcaag ctggtggttg gactaatgtt aacatcgtca tgaactatat tagaaatttg 1080 gattctgaaa ctggtgcaat ggttagactc ttggaagatg gtgatcccgg gtag 1134

Claims (46)

A first promoter;
A DBD coding sequence that binds to the promoter of a host cell reporter gene;
A first cloning site for insertion of a bait protein coding sequence;
A first site-specific recombination site;
A second cloning site for insertion of a barcode sequence representing the bait protein; And
And a second site-specific recombinase recognition sequence.
2. The donor vector of claim 1, further comprising a linker sequence between the DBD coding sequence and the first cloning site.
2. The donor vector according to claim 1, wherein the first and second site-specific recombinase recognition sequences are in the same orientation.
2. The donor vector according to claim 1, wherein the first or second site-specific recombinase recognition sequence is selected from the group consisting of lox site, rox site, att site, dif site and frt site.
[Claim 2] The method according to claim 1, wherein the first or second site-specific recombinase recognition sequence is selected from the group consisting of lox P and a variant thereof, rox and a variant thereof, att P and a variant thereof, dif and a variant thereof, A donor vector.
5. The method of claim 4, wherein the lox site comprises loxB, loxL, loxR, loxP, loxP3, loxP23, loxA86, loxA117, loxP511, loxC2, loxP2272, loxP5171, loxP71, loxP66, M2, M3, M7, Lt; RTI ID = 0.0 &gt; a &lt; / RTI &gt; donor vector.
2. The donor vector according to claim 1, wherein the first and second site-specific recombinase recognition sequences are loxP and loxP mutants (mutant loxP).
The donor vector according to claim 1, further comprising at least one marker gene between the second cloning site and the second site-specific recombinase recognition sequence.
9. The method according to claim 8, wherein the marker gene
(i) a drug resistance gene;
(ii) a fluorescent protein coding gene;
(iii) an auxotrophic marker gene;
(Iv) a transcription factor gene; And
(V) a cell surface marker gene
&Lt; / RTI &gt; wherein the donor vector is selected from the group consisting of:
9. The method according to claim 8,
Wherein the promoter is operatively linked to a second promoter located downstream of the marker gene and in an opposite transcriptional orientation to the first promoter.
4. The method of claim 1, wherein the donor vector is sequentially sequenced between a second cloning site and a second site-specific recombinase recognition sequence
Marker genes; And
A second promoter that is opposite in transcriptional orientation to the first promoter and is operably linked to the marker gene
Further comprising a donor vector.
12. The donor vector according to claim 11, wherein the marker gene is an antibiotic resistance gene.
4. The method of claim 1, wherein the donor vector is sequentially sequenced between a second cloning site and a second site-specific recombinase recognition sequence
A first marker gene;
A second promoter that is opposite in transcriptional orientation to the first promoter and is operably linked to the first marker gene; And
The first marker gene and the other second marker gene
Further comprising a donor vector.
14. The donor vector according to claim 13, wherein the first marker gene is an antibiotic resistance gene.
14. The donor vector according to claim 13, wherein the second marker gene is a fluorescent protein coding gene.
The method according to claim 1, wherein the donor vector further comprises at least one selected from the group consisting of a promoter, an origin of replication, an operator, a polyadenylation signal, an enhancer and an secretion signal, and an affinity tag Vector donation.
2. The method of claim 1, wherein the donor vector
The multiple cloning site (MCS) was removed from the plasmid pGBKT7, the multiple cloning site (MCS) was replaced with two Sfi I restriction sites, followed by the lox2272 sequence and the barcode insertion site, the kanamycin antibiotic resistance gene and promoter, the GFP gene pDBD-donor vector &lt; RTI ID = 0.0 &gt;
Vector illustration.
18. The donor vector according to claim 17, wherein the pDBD-donor vector is represented by a cleavage map of Fig.
19. The donor vector of claim 18, wherein the pDBD-donor vector comprises SEQ ID NO: 15.
20. The donor vector according to claim 19, wherein the pDBD-donor vector is a vector deposited with Accession No. KCTC12790BP.
A first promoter;
An AD coding sequence to aid transcription of the host cell reporter gene;
A first cloning site for insertion of a pre-protein coding sequence;
A second cloning site for insertion of a barcode sequence representing said pre-protein;
A first site-specific recombination site; and
And a second site-specific recombinase recognition sequence.
22. The acceptor vector of claim 21, further comprising a linker sequence between the AD coding sequence and the first cloning site.
22. The acceptor vector of claim 21, wherein the first and second site-specific recombinase recognition sequences of the acceptor vector are in the same orientation.
22. The acceptor vector according to claim 21, wherein the first or second site-specific recombinase recognition sequence is selected from the group consisting of lox site, rox site, att site, dif site and frt site.
22. The method according to claim 21, wherein said first or second site-specific recombinase recognition sequence is selected from the group consisting of lox P and its variant, rox and its variant, att P and its variant, dif and its variant and frt and its variants &Lt; / RTI &gt;
26. The method of claim 24, wherein the lox site is selected from the group consisting of loxB, loxL, loxR, loxP, loxP3, loxP23, loxΔ86, loxΔ117, loxP511, loxC2, loxP2272, loxP5171, loxP71, loxP66, M2, M3, M7, Lt; RTI ID = 0.0 &gt; 1, &lt; / RTI &gt;
The acceptor vector according to claim 21, wherein the first and second site-specific recombinase recognition sequences are loxP and loxP mutants (mutant loxP).
22. The method of claim 21, wherein the first and second site-specific recombinase recognition sequences of the acceptor vector are identical to the first and second site-specific recombinase recognition sequences of the donor vector of claim 1, respectively, .
22. The acceptor vector according to claim 21, wherein the acceptor vector further comprises at least one marker gene downstream of the second site-specific recombinase recognition sequence.
30. The method of claim 29, wherein the marker gene is
(I) a drug resistance gene;
(Ii) a fluorescent protein coding gene;
(Iii) an auxotrophic marker gene;
(Iv) a transcription factor gene; And
(V) a cell surface marker gene
&Lt; / RTI &gt; wherein the acceptor vector is selected from the group consisting of:
31. The method according to claim 30,
Is operatively linked to a second promoter located downstream of the marker gene and in an opposite transcriptional orientation to the first promoter.
22. The method of claim 21, wherein the acceptor vector comprises a second site-specific recombinase recognition sequence,
A first marker gene from which a translation termination codon has been removed; And
A second promoter that is opposite in transcriptional orientation to the first promoter and is operably linked to the first marker gene
And an additional vector is further coupled to the acceptance vector.
33. The method of claim 32, wherein the acceptor vector is sequenced downstream of the second promoter
A second marker gene; And
Wherein the vector further comprises a third promoter that is opposite in transcriptional orientation to the first promoter and is operably linked to the second marker gene.
34. The acceptor vector of claim 33, wherein the second marker gene is an antibiotic resistance gene.
22. The method of claim 21, wherein the acceptor vector further comprises at least one selected from the group consisting of a promoter, an origin of replication, an operator, a polyadenylation signal, an enhancer and an secretion signal, and an affinity tag Acceptance vector.
22. The method of claim 21,
Characterized in that the loxP sequence is inserted at the LEU2 gene end of the plasmid pGADT7, the multiple cloning site (MCS) is replaced with two Sfi I restriction enzyme sites, followed by the barcode insertion site and the lox2272 sequence, acc vector
Phosphorylation.
37. The acceptor vector of claim 36, wherein said pAD-acc vector is represented by a cleavage map of Fig.
37. The acceptor vector of claim 36, wherein the pAD-acc vector is represented by a cleavage map of FIG.
38. The acceptor vector of claim 37, wherein said pAD-acc vector is of SEQ ID NO: 16.
39. The acceptor vector of claim 38, wherein the pAD-acc vector is of SEQ ID NO:
41. The acceptor vector of claim 40, wherein the pAD-acc vector is a vector deposited with Accession No. KCTC12791BP.
A kit for detecting protein interactions, comprising the donor vector of claim 1 and the acceptor vector of claim 21.
(a) preparing a bait library by introducing a bait protein coding sequence and a barcode sequence representing the bait protein into the donor vector of claim 1;
(b) introducing a prey protein coding sequence and a barcode sequence representing the pre-protein into the acceptor vector of claim 21 to prepare a pre-library;
(c) introducing the bait library and the prey library into a host cell expressing the recombinant enzyme as a reporter; And
(d) detecting the reporter expression from said host cell and detecting bait-prey protein binding pairs
Protein interaction detection method.
44. The method of claim 43, wherein the host cell is a prokaryotic or eukaryotic cell.
45. The method of claim 44, wherein the eukaryotic cell is selected from the group of eukaryotic cells consisting of fungi, insects and mammals.
45. The method of claim 44, wherein the prokaryotic cell is a bacteria.

Images