CN112111512A

CN112111512A - Method for researching blood vessel growth by conditional induction kdrl gene knockout in zebra fish

Info

Publication number: CN112111512A
Application number: CN202010718925.5A
Authority: CN
Inventors: 顾珊烨
Original assignee: Nanjing Xinjia Pharmaceutical Technology Co Ltd
Current assignee: Nanjing Xinjia Pharmaceutical Technology Co Ltd
Priority date: 2020-07-23
Filing date: 2020-07-23
Publication date: 2020-12-22

Abstract

The invention discloses a method for researching the growth of a kdrl (vegfr2) gene in blood vessels by conditional induction in zebra fish, which comprises the following steps: (1) preparing a kdrl conditional knockout strain by using non-homologous end joining; (2) crossing a transgenic line marked with vascular endothelial cells with a kdrl conditional knockout line to establish a double-transgenic line; (3) cre mRNA is injected into embryos generated by the double-transgenic line internal crossing to realize kdrl knockout, and the abnormality of blood vessel growth is observed and evaluated through fluorescence.

Description

Method for researching blood vessel growth by conditional induction kdrl gene knockout in zebra fish

Technical Field

The invention relates to the technical field of genetic engineering, in particular to a method for researching blood vessel growth by conditional induction kdrl gene knockout in zebra fish.

Background

The zebrafish kdrl gene (vascular growth factor receptor 2, vegfr2, also known as flk1) is important for vascular development. Aiming at the kdrl gene, the promoter of the gene can be used for specifically marking the vascular endothelial cells at present, which indicates that the gene is specifically expressed in the vascular endothelial cells. The importance of kdrl on vascular growth was also shown by mutant line studies of this gene (see references 1 and 2).

At present, a method for researching the growth of blood vessels by conditionally inducing kdrl gene knockout in zebrafish is lacked.

Disclosure of Invention

The invention aims to provide a method for researching the growth of blood vessels by combining the operation of a kdrl gene with a transgenic line for marking vascular endothelial cells and realizing conditional induction of kdrl knockout in zebrafish.

The purpose of the invention is realized by the following technical scheme: the invention relates to a zebra fish strain with a krrl knockout conditional prepared by non-homologous end connection, which researches the growth and development of blood vessels in vivo by marking a transgenic strain of vascular endothelial cells and a Cre system, and comprises the following steps:

(1) searching two specific recognition sites of nuclease at two ends of the 12 th exon of the zebra fish kdrl, wherein the specific recognition sites are a sgRNA1 target spot and a sgRNA2 target spot;

(2) constructing a knock-in plasmid with non-homologous end connection, wherein the knock-in plasmid contains a nucleotide sequence of a left homologous arm and a nucleotide sequence of the left homologous arm, the left arm contains one nuclease recognition site sgRNA1, the right arm contains the other nuclease recognition site sgRNA2, an exogenous gene sequence needing to be replaced is contained between the left arm and the right arm, and the exogenous gene sequence comprises loxP sites on two sides of a 12 th exon and cardiac muscle cell marker red fluorescent protein capable of being used for screening; injecting a nuclease system into the fertilized eggs of the zebra fish by microinjection; culturing the injected fertilized eggs into fish, and confirming that the zebra fish is knocked out conditionally by kdrl through fluorescence and genotype identification;

(3) hybridizing a transgenic strain marked with zebra fish vascular endothelial cells with the conditional knockout strain, and obtaining a double-transgenic strain through fluorescence screening;

(4) cre mRNA was injected into embryos generated by the double transgenic introgression described above, and zebrafish embryos were used after 3 days to identify deletion of kdrl, overall phenotypic observation, and phenotypic observation of vascular growth.

Further, in step (1), the nucleases are CRIPSR nuclease and Cas9 nuclease.

Further, in step (2), the nuclease system includes Cas9 protein or mRNA producing Cas9 protein, sgRNA1 and sgRNA2, kdrl knock-in plasmids.

Further, in step (2), the target sequence of sgRNA1 is: gtaaacagtctgtgaacccc, respectively; the target sequence of sgRNA2 is: gtgagaggggtacagtacgg are provided.

Further, in the step (2), the nucleotide sequence of the left homology arm is shown in SEQ ID NO:1, and the nucleotide sequence of the right homology arm is shown in SEQ ID NO:1, and the sequence of the foreign gene needing to be replaced is shown as SEQ ID NO: 693-2576 in 1.

Further, in the step (2), constructing a left homologous arm and a right homologous arm of the knock-in plasmid connected with the non-homologous ends, taking a zebra fish genome as a template, and adding enzyme cutting sites and protective bases into a PCR primer for amplification to obtain the zebra fish genome; a sequence between two loxP sites of the fourth exon is amplified by taking a zebra fish genome as a template and a loxP-kdrl _ exon12-frt fusion sequence through a loxP and frt fusion sequence PCR primer, and the PCR primer is added with a restriction enzyme site and a protective base; the red fluorescent protein sequence can be marked by the screened cardiac muscle cells, the loxP-myl7-DsRed-pA-frt fusion sequence is obtained by amplifying the fusion sequence PCR primer of loxP and frt, and the PCR primer is added with the enzyme cutting site and the protective basic group.

Further, in step (2), the donor plasmid was knocked in and zebrafish zygotes were injected, and conditional knock-in strains that yielded tcf3a were selected.

Further, in the step (3), the zebra fish line for labeling the vascular endothelial cells is Tg (flk 1: EGFP).

Has the advantages that: the method allows in vivo and conditional investigation of vascular growth. According to the invention, the prepared kdrl conditional knockout zebra fish is combined with the transgenic zebra fish specifically labeled with vascular endothelial cells, so that the kdrl knockout after conditional induction can be well realized in vivo to study the vascular growth method.

The invention has the following advantages:

(1) the method provided by the invention is applied to research on the growth and development of zebra fish blood vessels, can induce the knockout of the kdrl gene at different times, can research the effect of kdrl in the growth and development of muscle blood vessels in different development stages, and is a latest method for applying an inducible gene knockout technology to the research on the zebra fish blood vessels.

(2) The invention utilizes zebra fish living model and observes the growth and development of the endothelial cells in the myoblood vessels by a fluorescent protein labeling method.

Drawings

For ease of illustration, the invention is described in detail by the following specific examples and figures:

FIG. 1 is a schematic diagram of the integration of a double loxP site mediated by non-homologous recombination into zebrafish kdrl gene according to the present invention;

the zebrafish kdrl gene plays an important role in the formation of the vascular network at an early developmental stage (ref.). sgRNA1 and sgRNA2 targets are indicated by red or blue arrows, respectively. In the kdrl conditioned donor (kdrl-loxP-exon12-frt-SM-frt-loxP), two loxP sites and homology arms (double-arrowed brown line) were added. The left and right arms were 686bps and 1297bps long, respectively. To reduce the effort of intensive screening for conditional alleles, a selectable marker (SM, 1.2kb) can express DsRed under the control of the myl7 promoter in the reverse direction of transcription compared to tcf3 a. SM also flanks the frt recombination site and can therefore be excised by Flp recombinase. Zebrafish kdrl has 30 exons and E12 (exon 12) contains 109 bps. After co-injection of the donor with sgRNA1, sgRNA2 and zCas9 mRNA, endogenous E12 was replaced at the kdrl site by kdrl-loxP-exon 12-frt-SM-frt-loxP. Black short arrows indicate primers used for validation (F1, R1, F2, R2).

FIG. 2 is a PCR and phenotypic characterization of kdrl conditional knockout lines of the invention after flp, Cre mRNA injection;

(C) in heterozygous embryos injected with flp mRNA at the single cell stage into kdrl conditional knockout lines, PCR at 3dpf identified deletion of SM. (D) No ("-Cre") or injection ("+ Cre") Cre mRNA into heterozygote Ki (kdrl) at the single cell stage^f1) Progeny from the intercross, PCR at 3dpf, identified a deletion of kdrl exon 12. Red arrow indicates

The other products of (A) are in principle derived from the original by Cre

And (4) cutting off the fragment. (E and F)3dpf large double transgene [ Tg (kdrl: EGFP); ki (kdrl)^fl/+)]Brightfield (top) and confocal (bottom) images of young fish produced by intercrossing. Cre mRNA injection, or not, at the single cell stage, indicates that Cre mRNA injection results in loss of cardiac DsRed expression (inset in E1) and vascular defects in the trunk (E2) and brain (E3). Scale bar: 250 μm (E1, F1), 100 μm (E2, E3, F2, F3).

Detailed Description

The present invention is further illustrated in detail by the following examples, but it should be noted that the scope of the present invention is not limited by these examples at all.

The invention relates to a zebra fish strain with a kdrl knockout conditional prepared by non-homologous end connection, which researches the growth and development of blood vessels in vivo by marking a transgenic strain of vascular endothelial cells and a Cre system, and comprises the following steps:

(1) searching two specific recognition sites of nuclease at two ends of the 12 th exon of the zebra fish kdrl, wherein the specific recognition sites are a sgRNA1 target spot and a sgRNA2 target spot; the nuclease is CRIPSR nuclease and Cas9 nuclease.

(2) Constructing a knock-in plasmid with non-homologous end connection, wherein the knock-in plasmid contains a nucleotide sequence of a left homologous arm and a nucleotide sequence of the left homologous arm, the left arm contains one nuclease recognition site sgRNA1, the right arm contains the other nuclease recognition site sgRNA2, an exogenous gene sequence needing to be replaced is contained between the left arm and the right arm, and the exogenous gene sequence comprises loxP sites on two sides of a 12 th exon and cardiac muscle cell marker red fluorescent protein capable of being used for screening; injecting a nuclease system into the fertilized eggs of the zebra fish by microinjection; culturing the injected fertilized eggs into fish, and confirming the kdrl conditional knockout zebra fish through fluorescence and genotype identification (see figure 1);

the nuclease system comprises Cas9 protein or mRNA for generating Cas9 protein, sgRNA1 and sgRNA2, and kdrl knock-in plasmids.

The target sequence of sgRNA1 is: gtaaacagtctgtgaacccc, respectively; the target sequence of sgRNA2 is: gtgagaggggtacagtacgg are provided.

The nucleotide sequence of the left homology arm is shown as SEQ ID NO:1, and the nucleotide sequence of the right homology arm is shown in SEQ ID NO:1, and the sequence of the foreign gene needing to be replaced is shown as SEQ ID NO: 693-2576 in 1.

Constructing a left homologous arm and a right homologous arm of a knock-in plasmid connected with a non-homologous end, taking a zebra fish genome as a template, and adding a restriction enzyme site and a protective base into a PCR primer for amplification to obtain the zebra fish genome; a sequence between two loxP sites of the fourth exon is amplified by taking a zebra fish genome as a template and a loxP-kdrl _ exon12-frt fusion sequence PCR primer, and the PCR primer is added with a restriction enzyme site and a protective base; the red fluorescent protein sequence can be marked by the screened cardiac muscle cells, the loxP-myl7-DsRed-pA-frt fusion sequence is obtained by amplifying the fusion sequence PCR primer of loxP and frt, and the PCR primer is added with the enzyme cutting site and the protective basic group.

The donor plasmid was knocked in and zebrafish zygotes were injected and screened for conditional knock-in lines to obtain tcf3 a.

(4) cre mRNA was injected into embryos generated by the above-described double transgenic introgression, and zebrafish embryos were used after 3 days to identify deletion of kdrl (see FIGS. 2C and 2D), observation of the overall phenotype, and observation of the phenotype of vascular growth (see FIGS. 2E and 2F).

The zebra fish product line for marking the vascular endothelial cells is Tg (flk 1: EGFP).

Example 1

In the embodiment, the main design idea is as follows:

1. designing specific guide RNA aiming at the sequences at both sides of the target segment of the target gene.

2. PDM-19T is used as a framework to construct donor plasmids. The plasmid comprises three parts: left arm sequence, exogenous sequence, and right arm sequence. The sequence of the left arm is the genomic sequence 5' upstream of the segment of interest and comprises the left guide RNA target sequence. The left arm sequence is followed by the exogenous sequence. Next is the right arm, the 3' downstream sequence of the right arm target segment, and contains the guide RNA target sequence on the right.

3. The above synthesized guide RNA and donor plasmid, together with optimized zebrafish Cas9 mRNA, were co-microinjected into one-cell stage zebrafish zygotes and further screened for conditional knockout lines.

4. Hybridizing a transgenic strain marked with the vascular endothelial cells of the zebra fish with the conditional strain, and screening the transgenic zebra fish specially by fluorescence;

5. the phenotype of zebrafish vascular growth and development was identified and analyzed by microinjection of Cre mRNA into embryos generated by double-heterozygous internal crossing of kdrl conditional knock-outs and Tg (flk 1: EGFP).

Materials and methods:

1. construction of knock-in Donor plasmid for loxP-kdrl _ exon12-frt-SM-frt-loxP

The genome of zebra fish and DsRed plasmid marking the heart of zebra fish are taken as templates, and loxP-kdrl _ exon12-frt-SM-frt-loxP fusion sequences are obtained by PCR primer amplification of the loxP and frt fusion sequences. Adding enzyme cutting sites and protecting bases into PCR primers.

LF：ctcggtacctcagtgataacaaggcctgt(SEQ ID NO:2)

LR：tatGAGCTCcagtttacttcctggggttc(SEQ ID NO:3)

MF：ctggagctcataacttcgtatagcatacattatacgaagttatataaatgggtatattgctcc(SEQ ID NO:4)

MR：taagcatgcgaagttcctatactttctagagaataggaacttccaatcaaatcaatcaaatca(SEQ ID NO:5)

SM-F:ttcgcatgcttaagatacattgatgagtt(SEQ ID NO:6)

SM-R: TATagatctGAAGTTCCTATACTTTCTAGAGAATAGGAACTTCtcatccatccttttcatccc (SEQ ID NO:7)

RF: TTCagatctATAACTTCGTATAGCATACATTATACGAAGTTATtttcatagtaaaagtatgag (SEQ ID NO:8)

RR:caggtcgacatctcctgtcttcattttta(SEQ ID NO:9)

loxP is a sequence recognized by Cre recombinase, and a sequence between two loxP sites in the same orientation can be deleted by Cre recombinase.

The amplified sequences were ligated sequentially into pMD-19T vector (purchased from Takara) to form the final donor plasmid.

2. Synthesis of sgRNA and zCas9 mRNA

Plasmid pGH-T7-ZCAS9 expressing ZCAS9 was obtained from the university of Beijing, Life sciences college. The plasmid was linearized with Xba I endonuclease and purified by transcription with mMACHINE T7 Ultra kit (Ambion) to obtain ZCAS9 mRNA.

The DNA sequences used to prepare the different sgrnas are shown below:

kdrl sgRNA 1: gtaaacagtctgtgaacccc (SEQ ID NO:10) (reverse strand, on the antisense strand);

kdrl sgRNA 2: gtgagaggggtacagtacgg (SEQ ID NO:11) (forward strand, on the sense strand);

the above sgRNA sequences were cloned into BbsI sites of pT7-sgRNA plasmid (obtained from Life sciences of Beijing university) respectively, transcribed in vitro by MaxiScript T7 kit (Ambion), and used with mirVana^TMAnd recovering the miRNA Isolation Kit (Ambion) Kit to obtain the guide RNA.

3. Zebra fish strain and breeding

The adult zebra fish is cultured in an aquatic animal culture system of Beijing Aisheng company in an environment with the water temperature of 28 ℃, the pH value of 7-8 and the photoperiod of 14 hours light/10 hours dark. Embryos were raised in 10% Hank's solution. The solution composition was as follows (millimoles): 140NaCl, 5.4KCl, 0.25Na₂HPO₄，0.44KH₂PO₄，1.3CaCl₂， 1.0MgSO₄And 4.2NaHCO₃(pH 7.2)。

4. Microinjection

zCas9 mRNA, sgRNA and donor plasmid were injected together by microinjection into one-cell stage zebrafish zygotes. Each fertilized egg was injected with 1nl of liquid. Containing 600 ng/. mu.l zcAS9 mRNA, 100 ng/. mu.l sgRNA, and 15 ng/. mu.l donor plasmid. The fertilized eggs can directly develop into the zebra fish under the in vitro culture condition (see 3. zebra fish feeding). The injection concentration of Cre mRNA was 100 ng/ul.

5. PCR validation of genomic substitutions

Extracting gene DNA of zebra fish embryo, identifying correct insertion and gene replacement by PCR method, using primers as follows:

kdrl-LF：TTGGCAGGGGTAAAGCACAG(SEQ ID NO:12)；

DsRed-R：CCCACAACGAGGACTACACC(SEQ ID NO:13)；

DsRed-F：CCCTTGGTCACCTTCAGCTT(SEQ ID NO:14)；

kdrl-RR：AACGTGCCACTTGACATCCA(SEQ ID NO:15)；

6. confocal imaging

Confocal imaging successive fluorescence pictures were taken in the Z-axis direction using FV1000 confocal microscope (Olympus, Japan) with 20-fold or 40-fold water scope (n.a., 0.80) in the form of optical sections. The resolution of all pictures is 1024 × 1024 or 800 × 600. The structural morphology was later reconstructed by ImageJ software (NIH).

The foregoing shows and describes the general principles, essential features, and advantages of the invention. It will be understood by those skilled in the art that the present invention is not limited to the embodiments described above, which are described in the foregoing description only for the purpose of illustrating the principles of the present invention, but that various changes and modifications may be made therein without departing from the spirit and scope of the invention as defined by the appended claims, specification and equivalents thereof.

Sequence listing

<110> Nanjing and admire technology and technology Limited

<120> method for researching blood vessel growth by conditional induction kdrl gene knockout in zebra fish

<130> 2020

<160> 15

<170> SIPOSequenceListing 1.0

<210> 1

<211> 6538

<212> DNA

<213> Artificial sequence (nucleotide sequence of left and right homology arms)

<400> 1

ggtacctcag tgataacaag gcctgtttaa aagggttgga tttgtttaga gcgaattcct 60

ttctgtcacc tcatataaat tttccagctc tgtgaacaac aggctggtat ggtccatctc 120

aaatggtgcc ttttaaccat agaatgagaa atggccactt aaagacaaag taggaaggtc 180

attctaaatt gctgacaagg tcatcagaga aatgattaga aaagcttgat gtactttaat 240

gtgtaatgtc attacaggtt gagcctggtg aacattgtgt tgatcaattg aatttcagac 300

caatatttca atgcctagtt aaaatagatt ggtaaggcaa atagatggaa acatgcctgc 360

tttctcatgt atatttttgt gcagtgtgcc aattaaaaaa atcggcttca tgtaagacta 420

aacaacgaca tgccattgca ctacatcagc tccacagatt tacattaacc aaactccaca 480

cctcatttca gtctgttcaa cagtataacg ttgtgtacaa gagaaattct aagctttgta 540

aaaaattctt ttgcattaaa tatgagtgtt gtacatcttt acaaactaaa acagaaaaac 600

aattaaaata cctgttgttc agagccaacg ctgtatttct tcagtttcaa ataagtctta 660

taaacagtct gtgaacccca ggaagtaaac tggagctcat aacttcgtat agcatacatt 720

atacgaagtt atataaatgg gtatattgct ccagaaatac acccagagtg tttcatacct 780

ttgatgtgac ggccaagaaa acagatgtag tttgaaactg aaaacagagc ccagtaatct 840

ggtctcgtgc caaaaacctg catcattatt atgtctactt aggctattaa tgagttccag 900

ttgaatggta acaatattaa gcctggcatt ttaaatgtgt atgaggaaat tacatgggac 960

gtggacatgc cttctgtgat ttatgagatg tgaaaagttg tgttattacg ggttaaagaa 1020

tattttgatt aacacttcta ataatctttt ctcatcctct tagactataa gtaccctggt 1080

ggtgaaaaca gctaatgtgt ctggggtata ctcctgtaca gcaaggaatg aacttggcaa 1140

ccggaccatg agaatccctt tttatgtgga tggtatgtta gtcattttat atgtactgaa 1200

cgttaatgtc acatgttatt tgtggttttg tggcatatag atggtctgat ttgattgatt 1260

tgattggaag ttcctattct ctagaaagta taggaacttc gcatgcttaa gatacattga 1320

tgagtttgga caaaccacaa ctagaatgca gtgaaaaaaa tgctttattt gtgaaatttg 1380

tgatgctatt gctttatttg taaccattat aagctgcaat aaacaagtta acaacaacaa 1440

ttgcattcat tttatgtttc aggttcaggg ggaggtgtgg gaggtttttt aaagcaagta 1500

aaacctctac aaatgtggta tggctgatta tgatctagag tcgcggccgc tacaggaaca 1560

ggtggtggcg gccctcggcg cgctcgtact gctccacgat ggtgtagtcc tcgttgtggg 1620

aggtgatgtc cagcttggag tccacgtagt agtagccggg cagctgcacg ggcttcttgg 1680

ccatatagat agacttgaac tccaccaggt agtggccgcc gtccttcagc ttcagggcct 1740

tgtggatctc gcccttcagc acgccgtcgc gggggtacag gcgctcggtg gaggcctccc 1800

agcccatagt cttcttctgc attacggggc cgtcggaggg gaagttcacg ccgatgaact 1860

tcaccttgta gatgaaggag ccgtcctgca gggaggagtc ctgggtcacg gtcaccacgc 1920

cgccgtcctc gaagttcatc acgcgctccc acttgaagcc ctcggggaag gacagcttct 1980

tgtagtcggg gatgtcggcg gggtgcttca cgtacacctt ggagccgtac tggaactggg 2040

gggacaggat gtcccaggcg aagggcaggg ggccgccctt ggtcaccttc agcttggcgg 2100

tctgggtgcc ctcgtagggg cggccctcgc cctcgccctc gatctcgaac tcgtggccgt 2160

tcacggagcc ctccatgcgc accttgaagc gcatgaactc cttgatgacg tcctcggagg 2220

aggccatacc ggttcactgt ctgctttgct gttggtctgg gctcctgggt cactgactta 2280

ctaatggagt ctttatgtat gaggactctt atcatttgtt cttctataaa ggtctgcagt 2340

gtttctgttc gtcccctaca tggacaccca gagcctccta aatacaggag ccctgataac 2400

tgcacaagtg ctcagattcc agcagggtgg aaaatgagat aaagtgtgca gatggggagg 2460

gggacgtgaa tgagagattt gagggatgaa aaggatggat gagaagttcc tattctctag 2520

aaagtatagg aacttcagat ctataacttc gtatagcata cattatacga agttattttc 2580

atagtaaaag tatgagaggg gtacagtacg gtggtcgaga gcatcttcat ccctttgaca 2640

gtacacttgt tgtaaattag tcacaacaca aacaagtaaa gaaacgcgca gcaaattgat 2700

cacaacactt gcaaatattc acgtaacaca acggaaatgt ttctagtgga ttaaaaaaca 2760

tgacggaccc tgctgagata tggatgtgtt attatgctgt gactgttgct cagtaaagtg 2820

attggtggtc tttgtttgta tctctcggcc accttcgtac agtggcgtag cggcaattgt 2880

aaaagtgggt gactgctgta tgtgacataa aggttaagca taatcatttg cttttttttt 2940

ttaaattaag gtataattcc ttaaaatatt gctgatcagt tcccaaacag tgccttaaaa 3000

tagtcagttc ccttttttat acaaatttca ctagttaggg catagcagta aatatttaaa 3060

agactaaaat tttataaagc atacttaggc aacaaacgac agcagaacct gatggacaaa 3120

tcttgaaaat tatttatggg gggcatgaca attataaggg ttggagaaca cgggtggaaa 3180

tattggagat aggtaaaaaa aaaaagtgct aacatgcaaa ctccacacag aaatgcccac 3240

tggtccagcc aggacttaaa ccgaagagct tctcactgtg tggcaacaac tgagccattg 3300

tgctgcccct ttattttcag atagaaaata aatatttgaa caattttctt gcaactttta 3360

tgtttatggt tgtcactata catgatctgt atgtcagcta ttctgaaaga aatgttttta 3420

tatatttaaa tgtatatttt gcatccttga ttgtttcagc tgttcagagc actatgtgtt 3480

ttattacatg gtgaattctg gctgacttct cgcctgtcaa cttaagcttg tgattgagca 3540

gtattggtgt taaaataaaa gttcctcact ctaggcaaaa acatgcaaat gtagttcctg 3600

ttcttctgct ccactctgga ttggactcag gcactaatat gccaactcct gttttaaaat 3660

gaatcacttt tatttgtcgc tgaccagggt caaatgtttc tgaaatgaga aacccattca 3720

cccagttatg taatgaagag tgtgtcggct gtcagacttt tcaaagctgc ttagattaga 3780

atgatgagaa aaaatgagct gcggtaaaca gcagccgtgg tttggagagg tgtaaaaaat 3840

gagaactgtg caataaaaat gaagacagga gatgtcgacc tgcaggcatg caagcttggc 3900

gtaatcatgg tcatagctgt ttcctgtgtg aaattgttat ccgctcacaa ttccacacaa 3960

catacgagcc ggaagcataa agtgtaaagc ctggggtgcc taatgagtga gctaactcac 4020

attaattgcg ttgcgctcac tgcccgcttt ccagtcggga aacctgtcgt gccagctgca 4080

ttaatgaatc ggccaacgcg cggggagagg cggtttgcgt attgggcgct cttccgcttc 4140

ctcgctcact gactcgctgc gctcggtcgt tcggctgcgg cgagcggtat cagctcactc 4200

aaaggcggta atacggttat ccacagaatc aggggataac gcaggaaaga acatgtgagc 4260

aaaaggccag caaaaggcca ggaaccgtaa aaaggccgcg ttgctggcgt ttttccatag 4320

gctccgcccc cctgacgagc atcacaaaaa tcgacgctca agtcagaggt ggcgaaaccc 4380

gacaggacta taaagatacc aggcgtttcc ccctggaagc tccctcgtgc gctctcctgt 4440

tccgaccctg ccgcttaccg gatacctgtc cgcctttctc ccttcgggaa gcgtggcgct 4500

ttctcatagc tcacgctgta ggtatctcag ttcggtgtag gtcgttcgct ccaagctggg 4560

ctgtgtgcac gaaccccccg ttcagcccga ccgctgcgcc ttatccggta actatcgtct 4620

tgagtccaac ccggtaagac acgacttatc gccactggca gcagccactg gtaacaggat 4680

tagcagagcg aggtatgtag gcggtgctac agagttcttg aagtggtggc ctaactacgg 4740

ctacactaga agaacagtat ttggtatctg cgctctgctg aagccagtta ccttcggaaa 4800

aagagttggt agctcttgat ccggcaaaca aaccaccgct ggtagcggtg gtttttttgt 4860

ttgcaagcag cagattacgc gcagaaaaaa aggatctcaa gaagatcctt tgatcttttc 4920

tacggggtct gacgctcagt ggaacgaaaa ctcacgttaa gggattttgg tcatgagatt 4980

atcaaaaagg atcttcacct agatcctttt aaattaaaaa tgaagtttta aatcaatcta 5040

aagtatatat gagtaaactt ggtctgacag ttaccaatgc ttaatcagtg aggcacctat 5100

ctcagcgatc tgtctatttc gttcatccat agttgcctga ctccccgtcg tgtagataac 5160

tacgatacgg gagggcttac catctggccc cagtgctgca atgataccgc gagacccacg 5220

ctcaccggct ccagatttat cagcaataaa ccagccagcc ggaagggccg agcgcagaag 5280

tggtcctgca actttatccg cctccatcca gtctattaat tgttgccggg aagctagagt 5340

aagtagttcg ccagttaata gtttgcgcaa cgttgttgcc attgctacag gcatcgtggt 5400

gtcacgctcg tcgtttggta tggcttcatt cagctccggt tcccaacgat caaggcgagt 5460

tacatgatcc cccatgttgt gcaaaaaagc ggttagctcc ttcggtcctc cgatcgttgt 5520

cagaagtaag ttggccgcag tgttatcact catggttatg gcagcactgc ataattctct 5580

tactgtcatg ccatccgtaa gatgcttttc tgtgactggt gagtactcaa ccaagtcatt 5640

ctgagaatag tgtatgcggc gaccgagttg ctcttgcccg gcgtcaatac gggataatac 5700

cgcgccacat agcagaactt taaaagtgct catcattgga aaacgttctt cggggcgaaa 5760

actctcaagg atcttaccgc tgttgagatc cagttcgatg taacccactc gtgcacccaa 5820

ctgatcttca gcatctttta ctttcaccag cgtttctggg tgagcaaaaa caggaaggca 5880

aaatgccgca aaaaagggaa taagggcgac acggaaatgt tgaatactca tactcttcct 5940

ttttcaatat tattgaagca tttatcaggg ttattgtctc atgagcggat acatatttga 6000

atgtatttag aaaaataaac aaataggggt tccgcgcaca tttccccgaa aagtgccacc 6060

tgacgtctaa gaaaccatta ttatcatgac attaacctat aaaaataggc gtatcacgag 6120

gccctttcgt ctcgcgcgtt tcggtgatga cggtgaaaac ctctgacaca tgcagctccc 6180

ggagacggtc acagcttgtc tgtaagcgga tgccgggagc agacaagccc gtcagggcgc 6240

gtcagcgggt gttggcgggt gtcggggctg gcttaactat gcggcatcag agcagattgt 6300

actgagagtg caccatatgc ggtgtgaaat accgcacaga tgcgtaagga gaaaataccg 6360

catcaggcgc cattcgccat tcaggctgcg caactgttgg gaagggcgat cggtgcgggc 6420

ctcttcgcta ttacgccagc tggcgaaagg gggatgtgct gcaaggcgat taagttgggt 6480

aacgccaggg ttttcccagt cacgacgttg taaaacgacg gccagtgaat tcgagctc 6538

<210> 2

<211> 29

<212> DNA

<213> Artificial sequence (LF)

<400> 2

ctcggtacct cagtgataac aaggcctgt 29

<210> 3

<211> 29

<212> DNA

<213> Artificial sequence (LR)

<400> 3

tatgagctcc agtttacttc ctggggttc 29

<210> 4

<211> 63

<212> DNA

<213> Artificial sequence (MF)

<400> 4

ctggagctca taacttcgta tagcatacat tatacgaagt tatataaatg ggtatattgc 60

tcc 63

<210> 5

<211> 63

<212> DNA

<213> Artificial sequence (MR)

<400> 5

taagcatgcg aagttcctat actttctaga gaataggaac ttccaatcaa atcaatcaaa 60

tca 63

<210> 6

<211> 29

<212> DNA

<213> Artificial sequence (SM-F)

<400> 6

ttcgcatgct taagatacat tgatgagtt 29

<210> 7

<211> 63

<212> DNA

<213> Artificial sequence (SM-R)

<400> 7

tatagatctg aagttcctat actttctaga gaataggaac ttctcatcca tccttttcat 60

ccc 63

<210> 8

<211> 63

<212> DNA

<213> Artificial sequence (RF)

<400> 8

ttcagatcta taacttcgta tagcatacat tatacgaagt tattttcata gtaaaagtat 60

gag 63

<210> 9

<211> 29

<212> DNA

<213> Artificial sequence (RR)

<400> 9

caggtcgaca tctcctgtct tcattttta 29

<210> 10

<211> 20

<212> DNA

<213> Artificial sequence (kdrl sgRNA1)

<400> 10

gtaaacagtc tgtgaacccc 20

<210> 11

<211> 20

<212> DNA

<213> Artificial sequence (kdrl sgRNA2)

<400> 11

gtgagagggg tacagtacgg 20

<210> 12

<211> 20

<212> DNA

<213> Artificial sequence (kdrl-LF)

<400> 12

ttggcagggg taaagcacag 20

<210> 13

<211> 20

<212> DNA

<213> Artificial sequence (DsRed-R)

<400> 13

cccacaacga ggactacacc 20

<210> 14

<211> 20

<212> DNA

<213> Artificial sequence (DsRed-F)

<400> 14

cccttggtca ccttcagctt 20

<210> 15

<211> 20

<212> DNA

<213> Artificial sequence (kdrl-RR)

<400> 15

aacgtgccac ttgacatcca 20

Claims

1. A method for researching blood vessel growth by conditionally inducing kdrl gene knockout in zebra fish is characterized by comprising the following steps:

(2) constructing a non-homologous end-linked knock-in plasmid, wherein the knock-in plasmid contains a left homologous arm sequence and a left homologous arm sequence, the left arm contains one nuclease recognition site sgRNA1, the right arm contains the other nuclease recognition site sgRNA2, a nucleotide sequence of an exogenous gene to be replaced is contained between the left arm and the right arm, and the nucleotide sequence comprises loxP sites on two sides of a 12 th exon and a myocardial cell marker red fluorescent protein for screening; injecting a nuclease system into the fertilized eggs of the zebra fish by microinjection; culturing the injected fertilized eggs into fish, and confirming that the zebra fish is knocked out conditionally by kdrl through fluorescence and genotype identification;

2. The method for conditionally inducing kdrl gene knock-out in zebrafish according to claim 1 for studying vascular growth, characterized in that: in step (1), the nucleases are CRIPSR nuclease and Cas9 nuclease.

3. The method for conditionally inducing kdrl gene knock-out in zebrafish according to claim 1 for studying vascular growth, characterized in that: in step (2), the nuclease system includes Cas9 protein or mRNA producing Cas9 protein, sgRNA1 and sgRNA2, kdrl knock-in plasmid.

4. The method for conditionally inducing kdrl gene knock-out in zebrafish according to claim 3 for studying vascular growth, characterized in that: in step (2), the target sequence of sgRNA1 is: gtaaacagtctgtgaacccc, respectively; the target sequence of sgRNA2 is: gtgagaggggtacagtacgg are provided.

5. The method for conditionally inducing kdrl gene knock-out in zebrafish according to claim 4 for studying vascular growth, characterized in that: in the step (2), the nucleotide sequence of the left homology arm is shown as SEQ ID NO:1, and the nucleotide sequence of the right homology arm is shown in SEQ ID NO:1, and the nucleotide sequence of the foreign gene to be replaced between the right arms is shown as SEQ ID NO: 693-2576 in 1.

6. The method for conditionally inducing kdrl gene knock-out in zebrafish according to claim 5 for studying vascular growth, characterized in that: in the step (2), constructing the left homologous arm and the right homologous arm of the knock-in plasmid connected with the non-homologous ends, taking a zebra fish genome as a template, and adding enzyme cutting sites and protective bases into a PCR primer for amplification to obtain the zebra fish genome; a sequence between two loxP sites of the fourth exon is amplified by taking a zebra fish genome as a template and a loxP-kdrl _ exon12-frt fusion sequence through a loxP and frt fusion sequence PCR primer, and the PCR primer is added with a restriction enzyme site and a protective base; the red fluorescent protein sequence can be marked by the screened cardiac muscle cells, the loxP-myl7-DsRed-pA-frt fusion sequence is obtained by amplifying the fusion sequence PCR primer of loxP and frt, and the PCR primer is added with the enzyme cutting site and the protective basic group.

7. The method for conditionally inducing kdrl gene knock-out in zebrafish according to claim 6 for studying vascular growth, characterized in that: in step (2), the donor plasmid was knocked in and zebrafish zygotes were injected and screened for conditional knock-in lines that yielded tcf3 a.

8. The method for conditionally inducing kdrl gene knock-out in zebrafish according to claim 5 for studying vascular growth, characterized in that: in the step (3), the zebra fish product line for marking the vascular endothelial cells utilizes a kdrl promoter to drive the expression of EGFP, and is named as Tg.