CN111171132B

CN111171132B - Snakehead antibacterial peptide

Info

Publication number: CN111171132B
Application number: CN202010082324.XA
Authority: CN
Inventors: 曾芳; 邹记兴; 张超楠; 周爱国; 范兰芬; 谢少林
Original assignee: South China Agricultural University
Current assignee: South China Agricultural University
Priority date: 2020-02-07
Filing date: 2020-02-07
Publication date: 2022-11-11
Anticipated expiration: 2040-02-07
Also published as: CN111171132A

Abstract

The invention discloses a snakehead antibacterial peptide, and an amino acid sequence of the snakehead antibacterial peptide comprises an amino acid sequence shown as SEQ ID NO. 1. The snakehead antibacterial peptide provided by the invention has broad-spectrum antibacterial activity, and can obviously inhibit the growth of pathogenic bacteria such as aeromonas veronii, streptococcus agalactiae, aeromonas hydrophila, staphylococcus aureus, providencia retheifer, escherichia coli and the like.

Description

Snakehead antibacterial peptide

Technical Field

The invention belongs to the technical field of biology, and particularly relates to an antibacterial peptide derived from snakeheads.

Background

At present, many microbial pathogenic bacteria have drug resistance to clinically common antibiotics, and the drug resistance of the antibiotics becomes one of outstanding medical problems to be solved at present. The search for new effective antibacterial agents is one of the effective ways to solve antibiotic resistance at present.

Antimicrobial peptides (AMPs) are a class of host defense polypeptides with broad-spectrum Antimicrobial properties, and are present in all forms of living bodies. For vertebrates, antimicrobial peptides have been found in a variety of fish, mammals and amphibians, and are found mainly in various types of cells of such animals, such as leukocytes (phagocytes, neutrophils, macrophages, natural killer cells, etc.), and in epithelial tissues in the oral cavity, lung tissues or skin. The antibacterial peptide is usually a cationic short peptide with an amphiphilic structure, and the amino acid sequence and the structure of the antibacterial peptide are various. Different antibacterial peptides differ in composition, structure and function and thus have different antibacterial mechanisms, but most of them act by causing defects in the function or structure of the cell membrane of microorganisms or by directly inhibiting certain ATP-dependent enzymes by interacting with ATP. The antibacterial peptide has wide antibacterial range, an antibacterial mechanism different from that of common antibiotics, is not easy to cause drug resistance, and is suitable for being developed into a new generation of antibiotics.

Snakeheads (Channa argus), commonly called talents and snakeheads, are the famous and precious fishes of fresh water with higher economic value and nutritional medical value. A single-maple publication, et al, entitled "isolation and purification of Murasbora obscura body surface mucus antibacterial peptide CSM14 and partial biological Activity" discloses that antibacterial peptide CSM14 can be isolated from Murasbora obscura body surface mucus, and discloses that the antibacterial peptide CSM14 has a broad spectrum of antibacterial activity, good thermostability, and no hemolytic activity (Single maple, zhang Honghong, guoweisheng, et al. Isolation and purification of Murasbora obscura body surface mucus antibacterial peptide CSM14 and partial biological activity [ J ]. Chinese preventive veterinary report, 2010,32 (3): 210-213.).

Disclosure of Invention

The invention aims to provide an antibacterial peptide derived from snakeheads.

The inventor obtains a snakehead antibacterial peptide (named caHep) gene sequence (shown as SEQ ID NO. 3) with an antibacterial peptide conserved gene structure and an amino acid sequence and a corresponding amino acid sequence according to comparative analysis of the conserved gene structure and the amino acid sequence of the teleost antibacterial peptide gene family and the snakehead genome sequence on NCBI, and provides the snakehead antibacterial peptide. Antibacterial tests prove that the snakehead antibacterial peptide provided by the invention has broad-spectrum antibacterial activity, and can obviously inhibit the growth of pathogenic bacteria such as aeromonas veronii, aeromonas hydrophila, streptococcus agalactiae, streptococcus aureus, providencia rethensis and escherichia coli.

According to the first aspect of the invention, the snakehead antibacterial peptide is provided, and the amino acid sequence of the snakehead antibacterial peptide comprises the amino acid sequence shown as SEQ ID NO. 1.

According to a second aspect of the present invention, there is provided a nucleotide sequence encoding the snakehead antibacterial peptide, comprising the nucleotide sequence shown in SEQ ID NO. 2.

In some embodiments, the nucleotide sequence of the snakehead antibacterial peptide can be shown as SEQ ID NO. 3.

In some embodiments, the PCR amplification primer for the nucleotide sequence of the snakehead antimicrobial peptide can be:

an upstream primer: 5 'CACCACAATCAGACAGGGG-3' (SEQ ID NO. 4);

a downstream primer: 5 'GCATCAAAATGTTCATTTATTTAT-3' (SEQ ID NO. 5).

According to a third aspect of the present invention, there is provided an expression vector comprising the nucleotide sequence of the snakehead antimicrobial peptide.

According to the fourth aspect of the invention, the application of the snakehead antibacterial peptide in preparing an antibacterial agent is provided.

In some embodiments, the above-described antibacterial agent may be used to inhibit the growth of one or more bacteria selected from the group consisting of Aeromonas veronii, streptococcus agalactiae, aeromonas hydrophila, staphylococcus aureus, providencia rettgeri, and Escherichia coli.

Compared with the prior art, the invention has the beneficial effects that: provides a gene sequence of antimicrobial peptide caHep derived from snakehead (Channa argus) and snakehead antimicrobial peptide expressed by the gene. The snakehead antibacterial peptide has broad-spectrum antibacterial activity and can obviously inhibit the growth of pathogenic bacteria such as streptococcus agalactiae (ATCC 13813), aeromonas veronii (ATCC 35624), aeromonas hydrophila (ATCC 35654), staphylococcus aureus (ATCC 25823), providencia rethensis (ATCC 9250), escherichia coli (ATCC 25922) and the like.

Drawings

FIG. 1 shows the bacteriostatic effect of HEK293 cell culture supernatants transfected with pTol2-caHep-EGFP plasmid and pTol2-EGFP plasmid; wherein the content of the first and second substances, ^** and ^* represents the difference between the two groups, respectively is P<0.01 and P<0.05；

FIG. 2 shows the antimicrobial effect of synthetic caHep mature peptide and control peptide on various bacteria; wherein the content of the first and second substances, ^** and ^* represents the difference between the two groups, respectively P<0.01 and P<0.05；

FIG. 3 shows the antimicrobial effect of the synthetic caHep mature peptide and the control peptide on Aeromonas veronii; wherein the content of the first and second substances, ^* represents the difference between the two groups as P<0.05；

FIG. 4 shows scanning electron micrographs of Aeromonas veronii treated with caHep mature peptide and control peptide, where the bacterial morphology, indicated by white arrows, has changed and the cell membrane lesions have subsided.

Detailed Description

The present invention will be described in further detail with reference to the following examples and the accompanying drawings. Unless otherwise specified, the reagents used in the examples are commercially available, and the techniques used are conventional techniques well known to those skilled in the art.

Example 1 cloning of caHep Gene and CDS region sequences

(1) After healthy snakeheads (Channa argus) are dissected, a proper amount of liver tissues are taken, and snakehead genome DNA is extracted according to an animal genome DNA rapid extraction kit. Then, according to the full-length gene sequence (SEQ ID NO. 3) of the snakehead antibacterial peptide caHep obtained by bioinformatics analysis software such as Blast and the like, an upstream primer and a downstream primer are designed on primer software to be used as primers for caHep gene cloning. PCR amplification is carried out by taking the snakehead genome DNA extracted as a template.

(2) Dissecting healthy snakeheads (Channa argus), taking a proper amount of liver tissues, extracting total RNA by using a Trizol method, detecting the extracted total RNA to be qualified by agarose gel electrophoresis, measuring the concentration of the extracted total RNA by using a nucleic acid analyzer, taking 1 mu g of the total RNA, synthesizing first strand cDNA according to the operation instruction of a TaKaRa reverse transcription kit, and storing the first strand cDNA in a refrigerator at the temperature of-20 ℃ for later use. Then, according to the CDS region (SEQ ID NO. 2) of the obtained snakehead antibacterial peptide caHep, an upstream primer and a downstream primer are designed on primer software to be used as PCR amplification primers of the CDS region sequence of the caHep. And (3) carrying out PCR amplification by using the cDNA from the snakehead liver obtained by the treatment as a template.

(3) The PCR amplification reaction program comprises pre-denaturation at 95 deg.C for 3min, denaturation at 95 deg.C for 30s, denaturation at 56 deg.C for 45s, and elongation at 72 deg.C for 1min for 30s, for 34 cycles in total, and final extension at 72 deg.C for 10min. After the PCR product is separated and detected by 2.0% agarose gel electrophoresis, a TaKaRa gel recovery kit is used for separation and purification, then the PCR product is connected with a pMD19-T cloning vector and is transformed into a competent cell E.coli DH5 alpha, and positive clones are selected and sent to a company Limited in biological engineering (Shanghai) for sequencing. The upstream and downstream primers used for amplifying and sequencing cds region and full length of the caHep gene are respectively as follows:

caHep-cds-F：5'-CACTCGTGCTCGCCTTTA-3'(SEQ ID NO.6)；

caHep-cds-R：5'-CACAGCCCTTGGTCTTGC-3'(SEQ ID NO.7)；

caHep-F：5'-CACCACAATCAGACAGGGG-3'(SEQ ID NO.4)；

caHep-R：5'-GCATCAAATGTTCATTTATTTAT-3'(SEQ ID NO.5)。

(4) As a result:

the CDS region sequence (SEQ ID NO. 2) of the snakehead caHep antibacterial peptide is shown as follows:

ATGAAGGCATTCAGCATTGCAGTTGCAGTGACACTCGTGCTCGCCTTTATTTGCATTCTGGAGAGCTCTGCCGTCCCATTCAGCGGGGTGCGAGAGCTGGAGGAGGCAGGGAGCAATGACACTCCAGTTGCGGCACATCAAGAGATGTCAACGGAATCGTGGATGATGACGAATCACATCAGACAGAAGCGTCAGAGCCACATCTCCCTGTGCCGCTACTGCTGCAAATGCTGCAAGACCAAGGGCTGTGGTTTCTGCTGCAGCTTCTGA。

the snakehead caHep antibacterial peptide gene sequence (SEQ ID NO.3, 999 bp) is shown as follows, wherein a single underlined mark part is a cds region, and a double underlined mark part is an intron:

CACCACAATCAGACAGGGGAAGGACTGGACGAAGAGCTGACCAGGTTCACAGAAAGATCTGCAGAAATCTGCCTACTCAGACAATCGCCAGCCATCACTGGAGCTGAAGAATAAGCTGAAGATATTGTGTTGCTCTTTGGGGGCCTGACACTCATGACAAAGAAGACCTATCAACTGTAACCTCTGAACCCATTTAAAACCTGCGCTAAAATGAAGGCAT TCAGCATTGCAGTTGCAGTGACACTCGTGCTCGCCTTTATTTGCATTCTGGAGAGCTCTGCCGTCCCATTCAGCGGG

GTGCGAGAGCTGGAGGAGGCAGGGAGCAATGACACTCCAGTTGCGGCACATCAAG AGATGTCAACGGAATCGTGGATG

ATGACGAATCACATCAGAAGAAGCGTCAGAGCCACATCTCCCTGTGCCG CTACTGCTGCAAATGCTGCAAGACCAAGGGCTGTGGTTTCTGCTGCAGCTTCTGAGGATTCCCACAACCACTATGTTATGACTTTTAAAATCTCTCCAATGCCTTTCCTGTGCTATAAAGCCTTTGTATAATTAAAAAACTATATGATTCATGTAAGAGCACTGGAAAAAAAAAATACATATCTATATATATTGTATTTATTTTGTATGTTTGTAACAGTTCTTTTTTAAGCTCAATATTATGTCAGTTTGTTTTAACAATAATCAGTATTCTGTATGTATTTTAAGTCTGTCATAAATAAATGAACATTTGATGC。

EXAMPLE 2 construction of pTol2-caHep-EGFP vector

A target sequence caHep-EGFP synthesized by Nanjing Kingsler Biotechnology Co., ltd is inserted into a plasmid pTol2-MCS (purchased from national zebra fish resource center CZRC Catalog ID: CZP 10) as a framework at the positions of enzyme cutting sites SmaI and XhoI to obtain a pTol2-caHep-EGFP vector, and the sequence of the pTol2-caHep-EGFP vector is shown as SEQ ID NO. 8. The target sequence caHep-EGFP comprises a CMV promoter, caHep, IRES2, EGFP and polyA, wherein the sequence of caHep is shown as SEQ ID NO. 2.

Example 3 bacteriostatic effect test

(1) The method for constructing the pTol2-caHep-EGFP vector with correct sequencing and the pTol2-EGFP vector of the control group (the construction method of the pTol2-EGFP vector is similar to that of the pTol2-caHep-EGFP vector, except that the sequence of the caHep is not contained, the bacterium liquid of the pTol2-caHep-EGFP vector is amplified and cultured for 12-16h at 37 ℃ for 220r/min in a shaking table, the bacterium liquid is collected for endotoxin-removing Plasmid extraction, and the Plasmid extraction process is operated according to the instruction of an E.Z.N.A.TM EndoFree Plasmid Mini Kit II Kit of an OMEGA company. 1 u L plasmid DNA using nucleic acid concentration instrument for quality detection, 260/280 value between 1.8-2.0 plasmid DNA for cell transfection experiment.

(2) The HEK293 cells were passaged to 6-well plates for culture, and when the cells grew to a confluence of about 80%, the pTol2-caHep-EGFP vector plasmid and the control vector plasmid pTol2-EGFP were liposome-mediated to transfect the HEK293 cells. Transfection assay procedure refer to Lipofectamine, life technologies ^TM LTX and PLUSTM Reagent kit instructions. Plasmid-transfected HEK293 cells and untransfected HEK293 of blank control groupCulturing the cells for 24h by using a serum-free culture medium for 24h, removing the culture medium, then re-suspending HEK293 cells by using PBS, placing the HEK293 cells in a refrigerator at the temperature of 20 ℃ below zero for 5min, taking out the HEK293 cells, placing the HEK293 cells in a water bath at the temperature of 37 ℃ for 5min, and repeating the steps for three times to fully release the polypeptides in the cells. The cell sap was centrifuged at 12000rpm at 4 ℃ and the supernatant was filtered through a 10kd ultrafiltration tube. And collecting the final filtrate as a liquid to be detected for detecting the bacteriostatic effect.

(3) Culturing Aeromonas veronii (ATCC 35624), streptococcus agalactiae (ATCC 13813), aeromonas hydrophila (ATCC 35654) and Staphylococcus aureus (ATCC 25823) in BHI culture medium at 37 deg.C and 200rpm/min to regulate OD ₆₀₀ After about 0.1, the bacterial suspension was diluted 10 times to obtain a starting bacterial suspension. Adding 50 microliters of initial bacterial liquid into a 96-well plate, adding 50 microliters of solution to be tested, and determining the OD of the mixture of the bacterial liquid and the solution to be tested ₆₀₀ Is the starting value. Culturing at 37 deg.C for 15 hr, and detecting OD ₆₀₀ . The results are shown in FIG. 1.

From the results in fig. 1, it can be seen that, compared with the control group, the culture supernatant of HEK293 cells expressing caHep can significantly inhibit the growth of aeromonas veronii, aeromonas hydrophila, streptococcus agalactiae and streptococcus aureus, which indicates that caHep polypeptide has significant inhibitory effect on the growth of aeromonas veronii, streptococcus agalactiae, aeromonas hydrophila and staphylococcus aureus, and caHep antimicrobial peptide has broad-spectrum bacteriostatic activity.

Example 4

The caHep mature peptide is consigned to be synthesized by Wuhan Jinkairui bioengineering limited company according to SEQ ID NO.1, and the amino acid sequence of the caHep mature peptide is as follows: QSHISLCRYCCKCCKTKGCGFCCSF (SEQ ID NO. 1). In addition, a control peptide (Neg-caHep, amino acid sequence: CQKCSCGYFCCFCKCSCTKGSRILCH) having the same length as the number of amino acids as that of the caHep mature peptide but having the same sequence as that of the mature peptide was synthesized as a control.

Then, 200. Mu.g/mL caHep peptide and control peptide were added to the bacterial solution, respectively, and cultured for a while to detect the OD of the bacterial solution ₆₀₀ The caHep mature peptide was found to have a growth tool for the common pathogenic bacteria providencia rettgeri (ATCC 9250), aeromonas veronii (ATCC 35624), aeromonas hydrophila (ATCC 35654), escherichia coli (ATCC 25922) compared to the control peptideHas inhibitory effect, as shown in FIG. 2.

Among them, the inhibition of growth of Aeromonas veronii at intervals of 1 hour is shown in FIG. 3, and it is understood from the results of FIG. 3 that the synthesized caHep mature peptide has a significant inhibitory effect on the growth of Aeromonas veronii as compared with the control group. Scanning electron microscope analysis shows (figure 4) that caHep mature peptide treatment has a significant effect on cell membrane damage of aeromonas veronii compared with the control group.

What has been described above are merely some of the embodiments of the present invention. It will be apparent to those skilled in the art that various changes and modifications can be made without departing from the inventive concept thereof, and these changes and modifications can be made without departing from the spirit and scope of the invention.

Sequence listing

<110> southern China university of agriculture

<120> snakehead antibacterial peptide

<130> 2020

<160> 8

<170> SIPOSequenceListing 1.0

<210> 1

<211> 25

<212> PRT

<213> Artificial sequence ()

<400> 1

Gln Ser His Ile Ser Leu Cys Arg Tyr Cys Cys Lys Cys Cys Lys Thr

1 5 10 15

Lys Gly Cys Gly Phe Cys Cys Ser Phe

20 25

<210> 2

<211> 270

<212> DNA

<213> Artificial sequence ()

<400> 2

atgaaggcat tcagcattgc agttgcagtg acactcgtgc tcgcctttat ttgcattctg 60

gagagctctg ccgtcccatt cagcggggtg cgagagctgg aggaggcagg gagcaatgac 120

actccagttg cggcacatca agagatgtca acggaatcgt ggatgatgac gaatcacatc 180

agacagaagc gtcagagcca catctccctg tgccgctact gctgcaaatg ctgcaagacc 240

aagggctgtg gtttctgctg cagcttctga 270

<210> 3

<211> 999

<212> DNA

<213> Artificial sequence ()

<400> 3

caccacaatc agacagggga aggactggac gaagagctga ccaggttcac agaaagatct 60

gcagaaatct gcctactcag acaatcgcca gccatcactg gagctgaaga ataagctgaa 120

gatattgtgt tgctctttgg gggcctgaca ctcatgacaa agaagaccta tcaactgtaa 180

cctctgaacc catttaaaac ctgcgctaaa atgaaggcat tcagcattgc agttgcagtg 240

acactcgtgc tcgcctttat ttgcattctg gagagctctg ccgtcccatt cagcggggta 300

agagttggac ttgccttcat ttgcttatta gctataaatg ctttgtcagc aggctaagat 360

gtgacaccta aatgtgcata attcattaac aggtgcgaga gctggaggag gcagggagca 420

atgacactcc agttgcggca catcaagaga tgtcaacgga atcgtggatg gtatgttcaa 480

ttgactggat gaattaagcc aattaccatg agcaaattaa aatttaaggg gatgtgtttt 540

ccctccggag tacccccggt gctctccctg tgcaggggag aggatgaaat gcaggaggtg 600

aacactttgc tcacgtctcg tgtctttcat gcagatgacg aatcacatca gaagaagcgt 660

cagagccaca tctccctgtg ccgctactgc tgcaaatgct gcaagaccaa gggctgtggt 720

ttctgctgca gcttctgagg attcccacaa ccactatgtt atgactttta aaatctctcc 780

aatgcctttc ctgtgctata aagcctttgt ataattaaaa aactatatga ttcatgtaag 840

agcactggaa aaaaaaaata catatctata tatattgtat ttattttgta tgtttgtaac 900

agttcttttt taagctcaat attatgtcag tttgttttaa caataatcag tattctgtat 960

gtattttaag tctgtcataa ataaatgaac atttgatgc 999

<210> 4

<211> 19

<212> DNA

<213> Artificial sequence ()

<400> 4

caccacaatc agacagggg 19

<210> 5

<211> 23

<212> DNA

<213> Artificial sequence ()

<400> 5

gcatcaaatg ttcatttatt tat 23

<210> 6

<211> 18

<212> DNA

<213> Artificial sequence ()

<400> 6

cactcgtgct cgccttta 18

<210> 7

<211> 18

<212> DNA

<213> Artificial sequence ()

<400> 7

cacagccctt ggtcttgc 18

<210> 8

<211> 5429

<212> DNA

<213> Artificial sequence ()

<400> 8

agaaccagag gtgtaaagta cttgagtaat tttacttgat tactgtactt aagtattatt 60

tttggggatt tttactttac ttgagtacaa ttaaaaatca atacttttac ttttacttaa 120

ttacattttt ttagaaaaaa aagtactttt tactccttac aattttattt acagtcaaaa 180

agtacttatt ttttggagat cacttagatc taactgcaga acgtacgaac ccgggatagt 240

aatcaattac ggggtcatta gttcatagcc catatatgga gttccgcgtt acataactta 300

cggtaaatgg cccgcctggc tgaccgccca acgacccccg cccattgacg tcaataatga 360

cgtatgttcc catagtaacg ccaataggga ctttccattg acgtcaatgg gtggagtatt 420

tacggtaaac tgcccacttg gcagtacatc aagtgtatca tatgccaagt acgcccccta 480

ttgacgtcaa tgacggtaaa tggcccgcct ggcattatgc ccagtacatg accttatggg 540

actttcctac ttggcagtac atctacgtat tagtcatcgc tattaccatg gtgatgcggt 600

tttggcagta catcaatggg cgtggatagc ggtttgactc acggggattt ccaagtctcc 660

accccattga cgtcaatggg agtttgtttt ggcaccaaaa tcaacgggac tttccaaaat 720

gtcgtaacaa ctccgcccca ttgacgcaaa tgggcggtag gcgtgtacgg tgggaggtct 780

atataagcag agctggttta gtgaaccgtc agatccgcta gcgccaccat gaaggcattc 840

agcattgcag ttgcagtgac actcgtgctc gcctttattt gcattctgga gagctctgcc 900

gtcccattca gcggggtgcg agagctggag gaggcaggga gcaatgacac tccagttgcg 960

gcacatcaag agatgtcaac ggaatcgtgg atgatgacga atcacatcag acagaagcgt 1020

cagagccaca tctccctgtg ccgctactgc tgcaaatgct gcaagaccaa gggctgtggt 1080

ttctgctgca gcttctgagg atccgcccct ctccctcccc cccccctaac gttactggcc 1140

gaagccgctt ggaataaggc cggtgtgcgt ttgtctatat gttattttcc accatattgc 1200

cgtcttttgg caatgtgagg gcccggaaac ctggccctgt cttcttgacg agcattccta 1260

ggggtctttc ccctctcgcc aaaggaatgc aaggtctgtt gaatgtcgtg aaggaagcag 1320

ttcctctgga agcttcttga agacaaacaa cgtctgtagc gaccctttgc aggcagcgga 1380

accccccacc tggcgacagg tgcctctgcg gccaaaagcc acgtgtataa gatacacctg 1440

caaaggcggc acaaccccag tgccacgttg tgagttggat agttgtggaa agagtcaaat 1500

ggctctcctc aagcgtattc aacaaggggc tgaaggatgc ccagaaggta ccccattgta 1560

tgggatctga tctggggcct cggtgcacat gctttacatg tgtttagtcg aggttaaaaa 1620

aacgtctagg ccccccgaac cacggggacg tggttttcct ttgaaaaaca cgatgataat 1680

atggccacaa ccatggtgag caagggcgag gagctgttca ccggggtggt gcccatcctg 1740

gtcgagctgg acggcgacgt aaacggccac aagttcagcg tgtccggcga gggcgagggc 1800

gatgccacct acggcaagct gaccctgaag ttcatctgca ccaccggcaa gctgcccgtg 1860

ccctggccca ccctcgtgac caccctgacc tacggcgtgc agtgcttcag ccgctacccc 1920

gaccacatga agcagcacga cttcttcaag tccgccatgc ccgaaggcta cgtccaggag 1980

cgcaccatct tcttcaagga cgacggcaac tacaagaccc gcgccgaggt gaagttcgag 2040

ggcgacaccc tggtgaaccg catcgagctg aagggcatcg acttcaagga ggacggcaac 2100

atcctggggc acaagctgga gtacaactac aacagccaca acgtctatat catggccgac 2160

aagcagaaga acggcatcaa ggtgaacttc aagatccgcc acaacatcga ggacggcagc 2220

gtgcagctcg ccgaccacta ccagcagaac acccccatcg gcgacggccc cgtgctgctg 2280

cccgacaacc actacctgag cacccagtcc gccctgagca aagaccccaa cgagaagcgc 2340

gatcacatgg tcctgctgga gttcgtgacc gccgccggga tcactctcgg catggacgag 2400

ctgtacaagt aaagcggccg cgactctaga tcataatcag ccataccaca tttgtagagg 2460

ttttacttgc tttaaaaaac ctcccacacc tccccctgaa cctgaaacat aaaatgaatg 2520

caattgttgt tgttaacttg tttattgcag cttataatgg ttacaaataa agcaatagca 2580

tcacaaattt cacaaataaa gcattttttt cactgcattc tagttgtggt ttgtccaaac 2640

tcatcaatgt atcttaaggc gtaaattgta agcgttaata ttttgttaaa attcgcgtta 2700

aatttttgtt aaatcagctc attttttaac caataggccg aaatcggcaa aatcccttat 2760

aaatcaaaag aatagaccga gatagggttg agtgctcgag aaaagcttaa acaagaatct 2820

ctagttttct ttcttgcttt tacttttact tccttaatac tcaagtacaa ttttaatgga 2880

gtactttttt acttttactc aagtaagatt ctagccagat acttttactt ttaattgagt 2940

aaaattttcc ctaagtactt gtactttcac ttgagtaaaa tttttgagta ctttttacac 3000

ctctgaattc gtaatcatgg tcatagctgt ttcctgtgtg aaattgttat ccgctcacaa 3060

ttccacacaa catacgagcc ggaagcataa agtgtaaagc ctggggtgcc taatgagtga 3120

gctaactcac attaattgcg ttgcgctcac tgcccgcttt ccagtcggga aacctgtcgt 3180

gccagctgca ttaatgaatc ggccaacgcg cggggagagg cggtttgcgt attgggcgct 3240

cttccgcttc ctcgctcact gactcgctgc gctcggtcgt tcggctgcgg cgagcggtat 3300

cagctcactc aaaggcggta atacggttat ccacagaatc aggggataac gcaggaaaga 3360

acatgtgagc aaaaggccag caaaaggcca ggaaccgtaa aaaggccgcg ttgctggcgt 3420

ttttccatag gctccgcccc cctgacgagc atcacaaaaa tcgacgctca agtcagaggt 3480

ggcgaaaccc gacaggacta taaagatacc aggcgtttcc ccctggaagc tccctcgtgc 3540

gctctcctgt tccgaccctg ccgcttaccg gatacctgtc cgcctttctc ccttcgggaa 3600

gcgtggcgct ttctcatagc tcacgctgta ggtatctcag ttcggtgtag gtcgttcgct 3660

ccaagctggg ctgtgtgcac gaaccccccg ttcagcccga ccgctgcgcc ttatccggta 3720

actatcgtct tgagtccaac ccggtaagac acgacttatc gccactggca gcagccactg 3780

gtaacaggat tagcagagcg aggtatgtag gcggtgctac agagttcttg aagtggtggc 3840

ctaactacgg ctacactaga agaacagtat ttggtatctg cgctctgctg aagccagtta 3900

ccttcggaaa aagagttggt agctcttgat ccggcaaaca aaccaccgct ggtagcggtg 3960

gtttttttgt ttgcaagcag cagattacgc gcagaaaaaa aggatctcaa gaagatcctt 4020

tgatcttttc tacggggtct gacgctcagt ggaacgaaaa ctcacgttaa gggattttgg 4080

tcatgagatt atcaaaaagg atcttcacct agatcctttt aaattaaaaa tgaagtttta 4140

aatcaatcta aagtatatat gagtaaactt ggtctgacag ttaccaatgc ttaatcagtg 4200

aggcacctat ctcagcgatc tgtctatttc gttcatccat agttgcctga ctccccgtcg 4260

tgtagataac tacgatacgg gagggcttac catctggccc cagtgctgca atgataccgc 4320

gagacccacg ctcaccggct ccagatttat cagcaataaa ccagccagcc ggaagggccg 4380

agcgcagaag tggtcctgca actttatccg cctccatcca gtctattaat tgttgccggg 4440

aagctagagt aagtagttcg ccagttaata gtttgcgcaa cgttgttgcc attgctacag 4500

gcatcgtggt gtcacgctcg tcgtttggta tggcttcatt cagctccggt tcccaacgat 4560

caaggcgagt tacatgatcc cccatgttgt gcaaaaaagc ggttagctcc ttcggtcctc 4620

cgatcgttgt cagaagtaag ttggccgcag tgttatcact catggttatg gcagcactgc 4680

ataattctct tactgtcatg ccatccgtaa gatgcttttc tgtgactggt gagtactcaa 4740

ccaagtcatt ctgagaatag tgtatgcggc gaccgagttg ctcttgcccg gcgtcaatac 4800

gggataatac cgcgccacat agcagaactt taaaagtgct catcattgga aaacgttctt 4860

cggggcgaaa actctcaagg atcttaccgc tgttgagatc cagttcgatg taacccactc 4920

gtgcacccaa ctgatcttca gcatctttta ctttcaccag cgtttctggg tgagcaaaaa 4980

caggaaggca aaatgccgca aaaaagggaa taagggcgac acggaaatgt tgaatactca 5040

tactcttcct ttttcaatat tattgaagca tttatcaggg ttattgtctc atgagcggat 5100

acatatttga atgtatttag aaaaataaac aaataggggt tccgcgcaca tttccccgaa 5160

aagtgccacc tgacgtctaa gaaaccatta ttatcatgac attaacctat aaaaataggc 5220

gtatcacgag gccctttcgt ctcgcgcgtt tcggtgatga cggtgaaaac ctctgacaca 5280

tgcagctccc ggagacggtc acagcttgtc tgtaagcgga tgccgggagc agacaagccc 5340

gtcagggcgc gtcagcgggt gttggcgggt gtcggggctg gcttaactat gcggcatcag 5400

agcagattgt actgagagtg caccatatg 5429

Claims

1. The application of the snakehead antibacterial peptide in preparing the antibacterial agent is characterized in that the amino acid sequence of the snakehead antibacterial peptide is shown in SEQ ID NO.1, and the antibacterial agent is used for inhibiting the growth of one or more bacteria selected from aeromonas veronii, aeromonas hydrophila, providencia rettgeri and escherichia coli.