CN113355288B - Preparation method and application of universal chimeric antigen receptor T cell for treating COVID-19 - Google Patents

Preparation method and application of universal chimeric antigen receptor T cell for treating COVID-19 Download PDF

Info

Publication number
CN113355288B
CN113355288B CN202010150227.XA CN202010150227A CN113355288B CN 113355288 B CN113355288 B CN 113355288B CN 202010150227 A CN202010150227 A CN 202010150227A CN 113355288 B CN113355288 B CN 113355288B
Authority
CN
China
Prior art keywords
sequence
car
cell
ncovs
gene
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Active
Application number
CN202010150227.XA
Other languages
Chinese (zh)
Other versions
CN113355288A (en
Inventor
李建强
何晋元
王琳
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Hebei Senlang Biotechnology Co ltd
Original Assignee
Hebei Senlang Biotechnology Co ltd
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Hebei Senlang Biotechnology Co ltd filed Critical Hebei Senlang Biotechnology Co ltd
Priority to CN202010150227.XA priority Critical patent/CN113355288B/en
Publication of CN113355288A publication Critical patent/CN113355288A/en
Application granted granted Critical
Publication of CN113355288B publication Critical patent/CN113355288B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/705—Receptors; Cell surface antigens; Cell surface determinants
    • C07K14/70503—Immunoglobulin superfamily
    • C07K14/7051—T-cell receptor (TcR)-CD3 complex
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K39/0005—Vertebrate antigens
    • A61K39/0011—Cancer antigens
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/12—Antivirals
    • A61P31/14—Antivirals for RNA viruses
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
    • C12N15/86—Viral vectors
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/87—Introduction of foreign genetic material using processes not otherwise provided for, e.g. co-transformation
    • C12N15/90—Stable introduction of foreign DNA into chromosome
    • C12N15/902—Stable introduction of foreign DNA into chromosome using homologous recombination
    • C12N15/907—Stable introduction of foreign DNA into chromosome using homologous recombination in mammalian cells
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
    • C12N5/06—Animal cells or tissues; Human cells or tissues
    • C12N5/0602—Vertebrate cells
    • C12N5/0634—Cells from the blood or the immune system
    • C12N5/0636—T lymphocytes
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14—Hydrolases (3)
    • C12N9/16—Hydrolases (3) acting on ester bonds (3.1)
    • C12N9/22—Ribonucleases RNAses, DNAses
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide
    • C07K2319/01—Fusion polypeptide containing a localisation/targetting motif
    • C07K2319/02—Fusion polypeptide containing a localisation/targetting motif containing a signal sequence
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide
    • C07K2319/01—Fusion polypeptide containing a localisation/targetting motif
    • C07K2319/03—Fusion polypeptide containing a localisation/targetting motif containing a transmembrane segment
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/10—Type of nucleic acid
    • C12N2310/20—Type of nucleic acid involving clustered regularly interspaced short palindromic repeats [CRISPRs]
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2510/00—Genetically modified cells
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2740/00—Reverse transcribing RNA viruses
    • C12N2740/00011—Details
    • C12N2740/10011—Retroviridae
    • C12N2740/15011—Lentivirus, not HIV, e.g. FIV, SIV
    • C12N2740/15041—Use of virus, viral particle or viral elements as a vector
    • C12N2740/15043—Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Biomedical Technology (AREA)
  • Zoology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Wood Science & Technology (AREA)
  • Biotechnology (AREA)
  • Molecular Biology (AREA)
  • General Health & Medical Sciences (AREA)
  • General Engineering & Computer Science (AREA)
  • Biochemistry (AREA)
  • Immunology (AREA)
  • Microbiology (AREA)
  • Medicinal Chemistry (AREA)
  • Biophysics (AREA)
  • Plant Pathology (AREA)
  • Physics & Mathematics (AREA)
  • Virology (AREA)
  • Cell Biology (AREA)
  • Public Health (AREA)
  • Animal Behavior & Ethology (AREA)
  • Veterinary Medicine (AREA)
  • Mycology (AREA)
  • Oncology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Epidemiology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Toxicology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Communicable Diseases (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Hematology (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

The invention discloses a preparation method and application of a universal chimeric antigen receptor T cell for treating COVID-19. The invention discloses a preparation method of CAR-T cells, which comprises the following steps: introducing the coding gene of the chimeric antigen receptor into a T cell and expressing the coding gene to obtain a CAR-T cell, wherein the CAR-T cell contains ACE2 or an ACE2 fragment capable of being specifically combined with SARS-CoV-2; chimeric antigen receptors are proteins designated nCoVS-s-CAR or nCoVS-l-CAR, the nCoVS-s-CAR amino acid sequence is the sequence 3 protein, nCoVS-l-CAR is the amino acid sequence 5 protein. The CAR-T cells of the invention can be used to treat patients with COVID-19.

Description

Preparation method and application of universal chimeric antigen receptor T cell for treating COVID-19
Technical Field
The invention relates to a preparation method and application of a universal chimeric antigen receptor T cell for treating COVID-19 in the field of biomedicine.
Background
SARS-CoV-2 (2019novel Coronavir, 2019-nCoV) belongs to the order of nested viruses, the family of coronaviridae, and can cause novel coronavirus pneumonia, and is named as COVID-19 by WHO. All viruses of the order nested are enveloped and contain a very large RNA viral genome, with coronaviruses having the largest RNA genome, approximately 30kb. By freezing the 3D structure of the coronavirus obtained by the electron tomography, it can be found that the coronavirus is apparently spherical in shape with an envelope diameter of about 85nm, and a clubbed spike can be seen on the surface of the coronavirus, which is also the source of the coronavirus name. The genome and subgenome of coronaviruses comprises at least 6 Open Reading Frames (ORFs), typically having 5' cap (leader) and 3' end (ends) sequences, the 5' cap open reading frames encoding for the production of a variety of nonstructural proteins that are involved in transcription and replication of the virus; coronaviruses have at least 4 major structural proteins, including spike (S), membrane (M), envelope (E) and nucleocapsid (N) proteins, all encoded in the 3' ORF of the viral genome, which are important for virus-cell receptor binding; they are all necessary for the production of structurally intact viral particles.
The novel coronavirus is combined with ACE2 on human cells through S protein, enters the cells to perform protein expression and genome replication, and finally virus particles are released outside the cells through budding.
The novel coronavirus pneumonia has proved that the contagious property of human passers is very strong, the serious cases and the death rate are high, the coronavirus pneumonia is an acute infectious disease which is rare in recent years and is declared as an international emergent public health incident by the world health organization. However, no specific medicine for the new coronavirus on the market exists so far, and some antiviral medicines and traditional Chinese medicines have been used for clinically treating the new coronavirus pneumonia, but the curative effect is not exact. Therefore, according to the structure of coronavirus, the search for targeted, highly effective and low-toxicity drugs for treating the virus is the urgent priority of China and the international medical community at present.
Chimeric Antigen Receptor (CAR) -T cells are immune T cells that are genetically modified and are capable of binding to a target antigen via CAR molecules expressed on a membrane, and upon binding of the CAR to the target antigen, the CAR-T cells are activated, further killing the target antigen-expressing cells of interest.
Disclosure of Invention
The technical problems to be solved by the invention are how to treat COVID-19 and how to inhibit SARS-CoV-2.
In order to solve the above technical problems, the present invention first provides a method for preparing a CAR-T cell, the method comprising: introducing a coding gene of a chimeric antigen receptor into a T cell and expressing the coding gene to obtain a CAR-T cell; the CAR-T cell externally contains ACE2 or an ACE2 fragment capable of specifically binding to SARS-CoV-2.
In the above method, the chimeric antigen receptor is obtained by sequentially connecting ACE2, one or more hinge domains or spacer domains, a transmembrane domain, one or more intracellular costimulatory signaling domains, and a primary signaling domain, or by sequentially connecting the ACE2 fragment, one or more hinge domains or spacer domains, a transmembrane domain, one or more intracellular costimulatory signaling domains, and a primary signaling domain.
In the above method, ACE2 may be derived from a human.
In the above method, the expression of the coding gene may be driven by a MND promoter. The sequence of the MND promoter can be a DNA fragment shown by 3230-3628 th site of a sequence 1 in a sequence table.
In the above method, the gene encoding the chimeric antigen receptor is introduced into a T cell and the encoding gene is expressed by introducing an expression cassette containing the encoding gene into the T cell, and the expression cassette is referred to as a CAR expression cassette. The CAR expression cassette contains the MND promoter. The CAR expression cassette can be introduced into the T cell by a vector containing the encoding gene.
In the above method, the ACE2 fragment may be any one peptide fragment having a length of 400 to 600 amino acids, which contains at least the amino acid sequence of positions 1 to 400 of ACE2 at the N-terminus, and extends from the amino acid residue at position 400 to the C-terminus along the sequence of ACE 2.
Further, the ACE2 fragment may be from positions 1-400 or from positions 1-600 of ACE 2. Specifically, the 1 st to 400 th positions of ACE2 may be the 1 st to 400 th positions of the sequence 3, and the 1 st to 600 th positions of ACE2 may be the 1 st to 600 th positions of the sequence 5.
In the above methods, the chimeric antigen receptor comprises a CAR functional region comprising one or more hinge or spacer domains, a transmembrane domain, and one or more intracellular costimulatory signaling domains, and a primary signaling domain.
The CAR functional region can be a protein shown in the 401 th to 622 th positions of the sequence 3 or a protein which is obtained by substituting and/or deleting and/or adding one or more amino acid residues into the protein and has 75% or more than 75% of identity with the 401 th to 622 th positions of the sequence 3 and has the same function. The identity of 75% or more than 75% is 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity.
In the above method, the chimeric antigen receptor may be a protein designated nCoVS-s-CAR or nCoVS-l-CAR as follows A1), A2) or A3):
a1 Protein whose amino acid sequence is sequence 3;
a2 Protein with the same function obtained by substituting and/or deleting and/or adding one or more amino acid residues of the amino acid sequence shown in the sequence 3 in the sequence table;
a3 A fusion protein obtained by connecting a label to the N terminal or/and the C terminal of A1) or A2);
the nCoVS-l-CAR is B1), B2) or B3) as follows:
b1 Protein whose amino acid sequence is sequence 5;
b2 Protein with the same function obtained by substituting and/or deleting and/or adding one or more amino acid residues to the amino acid sequence shown in the sequence 5 in the sequence table;
b3 A fusion protein obtained by attaching a tag to the N-terminus or/and the C-terminus of B1) or B2).
In order to facilitate the purification of the protein of A1) or B1), a tag as shown in the following table may be attached to the amino terminus or the carboxy terminus of the protein consisting of the amino acid sequence shown in sequence 3 or 5 in the sequence listing.
Table: sequence of tags
Label (R) Residue of Sequence of
Poly-Arg 5-6 (typically 5) RRRRR
Poly-His 2-10 (generally 6) HHHHHH
FLAG 8 DYKDDDDK
Strep-tag II 8 WSHPQFEK
c-myc 10 EQKLISEEDL
The protein in A2) is a protein having 75% or more identity to the amino acid sequence of the protein shown in SEQ ID NO. 3 and having the same function. B2 The protein of (1) above is a protein having 75% or more identity to the amino acid sequence of the protein represented by SEQ ID No. 5 and having the same function. The identity of 75% or more than 75% is 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity.
The protein in A2) or B2) can be artificially synthesized, or can be obtained by synthesizing the coding gene and then performing biological expression.
The gene encoding the protein of A2) above can be obtained by deleting one or several amino acid residues from the DNA sequence shown in SEQ ID No. 4, and/or by carrying out missense mutation of one or several base pairs, and/or by attaching the coding sequence of the tag shown in the above table to the 5 'end and/or 3' end thereof. Wherein, the DNA molecule shown in sequence 4 encodes the protein shown in sequence 3.
The gene encoding the protein of B2) above can be obtained by deleting one or several codons of amino acid residues from the DNA sequence shown in SEQ ID No. 6, and/or by carrying out missense mutation of one or several base pairs, and/or by attaching the coding sequence of the tag shown in the above table to the 5 'end and/or 3' end thereof. Wherein, the DNA molecule shown in sequence 6 encodes the protein shown in sequence 5.
In the above method, the encoding gene may be a nucleic acid molecule named nCoVS-s-CAR gene or nCoVS-l-CAR gene;
the nCoVS-s-CAR gene is a 11) or a 12) or a 13) as follows:
a11 ) the coding sequence is cDNA molecule or DNA molecule of sequence 4 in the sequence table;
a12 A cDNA or DNA molecule having 75% or more identity to the nucleotide sequence defined in a 11) and encoding said nCoVS-s-CAR;
a13 A cDNA molecule or a DNA molecule which hybridizes under stringent conditions with the nucleotide sequence defined in a 11) or a 12) and codes for the nCoVS-s-CAR;
the nCoVS-l-CAR gene is the following b 11) or b 12) or b 13):
b11 ) the coding sequence is cDNA molecule or DNA molecule of sequence 6 in the sequence table;
b12 A cDNA or DNA molecule having 75% or more identity to the nucleotide sequence defined in b 11) and encoding said nCoVS-l-CAR;
b13 A cDNA molecule or DNA molecule which hybridizes under stringent conditions with the nucleotide sequence defined in b 11) or b 12) and codes for the nCoVS-l-CAR.
Wherein the nucleic acid molecule may be DNA, such as cDNA, genomic DNA or recombinant DNA; the nucleic acid molecule may also be RNA, such as mRNA or hnRNA, etc.
The nucleotide sequences of the invention which code for nCoVS-s-CAR or nCoVS-l-CAR proteins can be readily mutated by a person skilled in the art using known methods, such as directed evolution and point mutation. Those nucleotides which have been artificially modified to have 75% or more identity to the nucleotide sequence of the protein of the present invention are derived from and identical to the nucleotide sequence of the present invention as long as they encode nCoVS-s-CAR or nCoVS-l-CAR and have the same protein function.
The term "identity" as used herein refers to sequence similarity to a native nucleic acid sequence. "identity" includes nucleotide sequences that are 75% or greater, or 85% or greater, or 90% or greater, or 95% or greater identical to the nucleotide sequence of a protein consisting of the amino acid sequence set forth in coding sequence 3 or 5 of the present invention. Identity can be assessed visually or by computer software. Using computer software, the identity between two or more sequences can be expressed in percent (%), which can be used to assess the identity between related sequences.
In the above application, the stringent conditions may be as follows: 50 ℃ in 7% Sodium Dodecyl Sulfate (SDS), 0.5M NaPO 4 And 1mM EDTA, and rinsed in 2 XSSC, 0.1% SDS at 50 ℃.
The above-mentioned identity of 75% or more may be 80%, 85%, 90% or 95% or more.
The method can further comprise knocking out an α β TCR gene in the T cell and/or introducing a coding gene targeting an shRNA of SARS-CoV-2 into the T cell and allowing the coding gene to be expressed.
Further, the alpha beta TCR gene in the T cell can be knocked out by introducing Cas9 and a guide nucleotide sequence (gTRAC for short) targeting a T cell antigen recognition receptor (TCR) alpha chain into the T cell, wherein the gTRAC is the 3087 th to 3182 th position of the sequence 1.
In the above method, the CAR-T cell may express gTRAC. The expression of gTRAC may be driven by the U6 promoter.
The shRNA targeting SARS-CoV-2 can be shRNA targeting the RNA dependent RNA polymerase (RdRp) sequence of SARS-CoV-2.
Further, the target fragment of the shRNA can be 3446-3493 of sequence 2.
In the above method, the CAR-T cell expresses the shRNA. The expression of the shRNA can be driven by a U6 promoter.
In the method, the U6 promoter can be a DNA fragment shown in 2838-3078 of a sequence 1 in a sequence table.
In the above method, the knockout of the α β TCR gene in the T cell can be achieved by introducing Cas9 and an expression cassette capable of expressing the gTRAC into the T cell, and the expression cassette is denoted as a gTRAC expression cassette. Further, the gTRAC expression cassette can be a DNA fragment shown in 2838-3182 th sites of a sequence 1 in a sequence table.
The introduction of the coding gene of the shRNA targeting SARS-CoV-2 into the T cell and the expression of the coding gene can be realized by introducing an expression cassette of the shRNA into the T cell, and the expression cassette is recorded as an shRNA expression cassette. Further, the shRNA expression cassette can be a DNA fragment shown in 3197-3493 th site of a sequence 2 in a sequence table.
In the above method, the gTRAC expression cassette may be introduced into the T cell via a vector comprising the coding gene. The shRNA expression cassette may be introduced into the T cell via a vector containing the encoding gene.
In the above method, the vector may be a viral, plasmid, cosmid or phage vector. The vector may be a lentiviral vector.
The coding gene of the chimeric antigen receptor, the alpha beta TCR gene in the T cell and the coding gene for introducing the shRNA targeting SARS-CoV-2 into the T cell can be realized by introducing a lentiviral vector into the T cell.
The lentivirus vector is obtained by packaging a recombinant vector. The recombinant vector can be pLVu-nCoVS-s or pLVu-nCoVS-l or pLVu-R-nCoVS-s or pLVu-R-nCoVS-l; the pLVu-nCoVS-s is a recombinant vector obtained by replacing a DNA fragment between Pac I and Not I recognition sequences of a vector pLV-U6-hTRAC-M1904-none (sequence 1) with a DNA fragment shown in sequence 4 in a sequence table; the pLVu-nCoVS-s is a recombinant vector obtained by replacing a DNA fragment between Pac I and Not I recognition sequences of the vector pLV-U6-hTRAC-M1904-none with a DNA fragment shown in a sequence 6 in a sequence table; the pLVu-R-nCoVS-s is a recombinant vector obtained by replacing a DNA fragment between Pac I and Not I recognition sequences of a vector pLV-U6-hTRAC-U6-shCoVRdRp-M1904-none (sequence 2) with a DNA fragment shown in a sequence 4 in a sequence table; the pLVu-R-nCoVS-l is a recombinant vector obtained by replacing a DNA fragment between Pac I and Not I recognition sequences of the vector pLV-U6-hTRAC-U6-shCoVRdRp-M1904-none with a DNA fragment shown in a sequence 6 in a sequence table.
Wherein, the 2838 th to 3078 th of the sequence 1 are U6 promoter sequences, the 3087 th to 3182 th are gTRAC (i.e. hTRAC guide DNA) sequences, the 3183 th to 3196 th are nonsense spacer sequences, the 3230 th to 3628 th are MND promoter sequences, the 3629 th to 3636 th are Pac I recognition sequences, and the 5119 th to 5126 th are Not I recognition sequences.
The 2838 th to 3078 th sites of the sequence 2 are a U6 promoter sequence, the 3087 th to 3182 th sites are a gTRAC sequence, the 3183 th to 3196 th sites are a nonsense spacer sequence, the 3197 th to 3437 th sites are a U6 promoter sequence, the 3446 th to 3493 th sites are a ShCoV RdRp sequence, the 3494 th to 3525 th sites are a nonsense spacer sequence, the 3532 th to 3930 th sites are an MND promoter sequence, the 3931 th to 3938 th sites are a Pac I recognition sequence, and the 5421 th to 5428 th sites are a Not I recognition sequence.
Wherein, the DNA fragment shown in the sequence 4 encodes a fusion protein shown in the sequence 3, namely a fusion protein formed by fusing CAR functional regions at the 1 st to 400 th positions of ACE2 protein, and is marked as nCoVS-s-CAR. Positions 1-400 of the ACE2 protein in the sequence 3 are positions 1-400, positions 401-622 are CAR functional regions, positions 401-470 are CD8TM, positions 471-512 are 4-1BB, and positions 513-622 are CD3zeta (namely CD3 z).
The DNA fragment shown in sequence 6 encodes a fusion protein shown in sequence 5, namely a fusion protein formed by fusing CAR functional regions at positions 1-600 of ACE2 protein, and is marked as nCoVS-l-CAR. Positions 1-600 of the ACE2 protein in the sequence 5 are positions 1-600, positions 601-822 are CAR functional regions, positions 601-670 are CD8TM, positions 671-712 are 4-1BB, and positions 713-822 are CD3zeta (i.e. CD3 z).
The CAR-T cell prepared by the preparation method of the CAR-T cell also belongs to the protection scope of the invention.
The invention also provides any one of the following M1-M5 products:
m1, the chimeric antigen receptor;
m2, the coding gene;
m3, biological material related to the coding gene; the biomaterial is any one of the following C1) to C4):
c1 An expression cassette containing the encoding gene;
c2 A recombinant vector containing the expression cassette described under C1);
c3 A recombinant microorganism containing the expression cassette described in C1), or a recombinant microorganism containing the recombinant vector described in C2);
c4 A cell line containing the expression cassette described in C1) or a cell line containing the recombinant vector described in C2);
m4, a kit comprising M1, M2 or M3;
m5, a vector with the name of pLV-U6-hTRAC-M1904-none or pLV-U6-hTRAC-U6-shCoVRdRp-M1904-none or pLV-puro-EGFP-RdRp or pLV-puro-CoVS, wherein the sequence of the pLV-U6-hTRAC-M1904-none is a sequence 1 in a sequence table, the sequence of the pLV-U6-hTRAC-U6-shCoVRdR-M1904-none is a sequence 2 in the sequence table, the sequence of the pLV-puro-EGFP-RdRp is a sequence 7 in the sequence table, and the sequence of the pLV-puro-CoVS is obtained by replacing 2839 th position to 3588 th position of the sequence 7 with a sequence 8.
C2 The recombinant vector may be the pLVu-nCoVS-s, the pLVu-nCoVS-l, the pLVu-R-nCoVS-s or the pLVu-R-nCoVS-l.
In the above product, the kit of M4 may have any one of the following uses:
y1, treatment and/or prevention COVID-19;
y2, inhibiting the replication of SARS-CoV-2;
y3, killing SARS-CoV-2.
In the above products, the kit of M4 may further comprise a substance for knocking out α β TCR gene and/or a substance targeting SARS-CoV-2 and/or T cell.
The alpha beta TCR gene knockout substance can be composed of Cas9 and gTRAC, and can also be composed of Cas9 and the gTRAC expression cassette.
The SARS-CoV-2 targeting agent can be the shRNA or the shRNA expression cassette.
M4 the kit may consist of any one, any two or three of the chimeric antigen receptor, the encoding gene or the biological material and the α β TCR gene knock-out agent, the SARS-CoV-2 targeting agent and the T cell.
In the above products, the cell line may or may not include propagation material.
The preparation method of the CAR-T cell, the CAR-T cell prepared by the preparation method of the CAR-T cell, or any application of the product, such as the following applications, also belong to the protection scope of the invention:
x1, preparation of a product for treating and/or preventing COVID-19;
x2, treatment and/or prevention COVID-19;
x3, preparing a product for inhibiting SARS-CoV-2 replication;
x4, inhibiting the replication of SARS-CoV-2;
x5, preparing a product for killing SARS-CoV-2;
x6, killing SARS-CoV-2.
The product may be a medicament or a vaccine.
The invention also provides a product comprising said CAR-T cells or a product as described in any of M1-M4 above, having any of the following functions:
y1, treatment and/or prevention COVID-19;
y2, inhibiting the replication of SARS-CoV-2;
y3, killing SARS-CoV-2.
The product may be a medicament or a vaccine.
Herein, the T cell may be a CD3+ T cell. The T cell may be, but is not limited to, an alpha beta T cell, a gamma delta T cell, or an NK-T cell.
The invention utilizes the specific targeting technology of CAR-T cells to directionally and accurately kill coronavirus in a patient body, cuts off virus replication chains and saves critically ill patients. The method of the invention can be used for rapidly transforming the immune cells provided by healthy people into the immune killer cells which can provide foreign body use, and can be rapidly applied to patients. The CAR-T cell prepared by the invention can accurately and directionally kill coronavirus and infected cells, and can avoid the damage of other organs of a patient to the maximum extent. The slow virus vector of the CAR-T cell prepared by the invention contains a section of target shRNA sequence aiming at RdRp on SARS-CoV-2 genome, and can eliminate virus genome entering the cytoplasm of the CAR-T cell through ACE2 molecules, so that the CAR-T cell is prevented from being infected. In vitro experiments show that the CAR-T cells of the invention can effectively bind to novel coronaviruses, clear the viral concentration in vivo, and protect T cells from infection, and will have the opportunity to accurately and rapidly cure COVID-19 patients. In addition, the current restriction of CAR-T is autologous use, but in patients with new coronary patients, autologous T cells present with viral contamination, and the universal allogeneic CAR-T platform of the present invention can effectively address this restriction.
Drawings
FIG. 1 is a map of vector pLV-U6-hTRAC-M1904-none. U6-hTRAC-M-1904 represents the vector pLV-U6-hTRAC-M1904-none.
FIG. 2 is a map of vector pLV-U6-hTRAC-U6-shCoVRdRp-M1904-none. U6-hTRAC-U6-shCoVRdRp-M-1904 represents the vector pLV-U6-hTRAC-U6-shCoVRdRp-M1904-none.
FIG. 3 is a schematic diagram of the structures of four recombinant vector target fragments.
FIG. 4 is a map of the vector pLV-puro-EGFP-RdRp.
FIG. 5 shows the results of measurement of the expression of chimeric antigen receptor in T cells on the fifth day of culture. A is the flow result of the transfection positivity of CD3+ T cells which are not transfected by the virus and are cultured on the fifth day with LVu-nCoVS-s virus, LVu-nCoVS-l virus, LVu-R-nCoVS-s virus and LVu-R-nCoVS-l virus, and B is the CD137 activation ratio. nCoVS-s, nCoVS-l, R-nCoVS-s and R-nCoVS-l denote nCoVS-s CAR-T, nCoVS-l CAR-T, R-nCoVS-s CAR-T and R-nCoVS-l CAR-T cells, CAR denotes nCoVS-s-CAR or nCoVS-l-CAR.
FIG. 6 shows the expression of chimeric antigen receptor in T cells (A) and the knockout ratio of α β -T cell receptor (B). CAR represents nCoVS-s-CAR or nCoVS-l-CAR, and R-nCoVS-s and R-nCoVS-l represent cells of R-nCoVS-s CAR-T and R-nCoVS-l CAR-T.
FIG. 7 shows negative sorting of CAR-T cells using TCRab magnetic beads.
FIG. 8 shows the flow assay results. Control T represents blank control cells.
FIG. 9 shows the flow assay results. The upper panel shows the results of the analysis of the cells in the boxes of the corresponding panels in the upper panel for detecting the infection rates of LVu-nCoVS-s, LVu-R-nCoVS-s, LVu-nCoVS-l and LVu-R-nCoVS-l viruses.
FIG. 10 is a pLV-puro-CoVS vector map.
Figure 11 is the specific killing efficiency of CAR T cells. The abscissa is CAR T or number ratio of T cells to target cells and the ordinate is specific killing efficiency. T, nCoVS-s, nCoVS-l, R-nCoVS-s and R-nCoVS-l denote control T cells, nCoVS-s CAR-T, nCoVS-l CAR-T, R-nCoVS-s CAR-T and R-nCoVS-l CAR-T cells, respectively.
Detailed Description
The present invention is described in further detail below with reference to specific embodiments, which are given for the purpose of illustration only and are not intended to limit the scope of the invention. The experimental procedures in the following examples are conventional unless otherwise specified. Materials, reagents, instruments and the like used in the following examples are commercially available unless otherwise specified. The quantitative tests in the following examples, all set up three replicates and the results averaged. In the following examples, unless otherwise specified, the 1 st position of each nucleotide sequence in the sequence listing is the 5 'terminal nucleotide of the corresponding DNA/RNA, and the last position is the 3' terminal nucleotide of the corresponding DNA/RNA.
Example 1 preparation of α β TCR knockout CAR-T cells
1. CAR molecule construction
1. Taking an ACE2 plasmid (Beijing Yiqiao Shenzhou biotechnology limited, the product number is HG10108-M, the DNA sequence containing vascular tension Zhang Su convertase 2 (ACE 2), and the number on NCBI is NM _ 001371415) as a template, respectively carrying out PCR amplification by using primers ACE-F1 and ACE-R1 and ACE-F1 and ACE-600-R1, recording PCR products with correct sequences obtained by using the ACE-F1 and the ACE-R1 as fragments 1-1, wherein the length is 1197bp, and recording PCR products with correct sequences obtained by using the ACE-F1 and the ACE-600-R1 as fragments 1-2, wherein the length is 1800bp. The primer sequences used were as follows:
ACE-F1：5′-ATGTCAAGCTCTTCCTGGCTC-3′；
ACE-R1：5′-tccttcattagctccatttcttagc-3′；
ACE-600-R1：5′-cttgttctggtctttcagccag-3′。
2. artificially synthesizing a DNA fragment (namely a CAR functional region DNA fragment) shown in a sequence 10 in the sequence table, carrying out PCR amplification by using the DNA fragment as a template and using primers ACE-F2 and ACE-R2, and marking a PCR product with a correct sequence as a fragment 2 and the length of 594bp. The primer sequences are as follows:
ACE-F2：5′-CGTCCGGAGGCATGTAGAC-3′；
ACE-R2：5′-cagggcctgcatgtgaagag-3′。
3. and (3) respectively carrying out PCR amplification by taking the fragment 2 obtained in the step (2) as a template and using primers ACE-F2-1 and ACE-R2 and ACE-600-F2-1 and ACE-R2, recording PCR products with correct sequences obtained by using the primers ACE-F2-1 and ACE-R2 as fragments 3-1, wherein the length is 657bp, and recording PCR products with correct sequences obtained by using the primers ACE-600-F2-1 and ACE-R2 as fragments 3-2, wherein the length is 657bp. The primer sequences used were as follows:
ACE-F2-1：5′- GCTAAGAAATGGAGCTAATGAAGGATTCACTACCCCAGCACCGCGGCCACCCACCCCGGCTCCTACCATCGCCTCCC AGCCTCTGTCCCTGCGTCCGGAGGCATGTAGAC-3′；
ACE-600-F2-1：5′- CTGGCTGAAAGACCAGAACAAGACTACCCCAGCACCGCGGCCACCCACCCCGGCTCCTACCATCGCCTCCCAGCCTC TGTCCCTGCGTCCGGAGGCATGTAGAC-3′。
4. and mixing the fragments 1-1 and 3-1 to obtain a mixture 1, mixing the fragments 1-2 and 3-2 to obtain a mixture 2, taking the two mixtures as templates, respectively carrying out PCR amplification by using primers ACE-F1-PJ and ACE-R2-PJ, taking the mixture 1 as a template to obtain a PCR product with a correct sequence, marking the PCR product with the correct sequence as a fragment 4-1 and the length as 1921bp, and taking the mixture 2 as a template to obtain a PCR product with the correct sequence, marking the PCR product with the correct sequence as a fragment 4-2 and the length as 2521bp. The primer sequences used were as follows:
ACE-F1-PJ：5′-CAATAAAAGAGCCCATTAATTAAGCCACCATGTCAAGCTCTTCCTGGCTC-3' (underlined is the recognition sequence for Pac I);
ACE-R2-PJ：5′-ccggccgtttaaacggcggccgctcaccgaggcggcagggcctgcatgtgaagag-3' (the Not I recognition sequence is underlined).
5. Synthesizing a vector pLV-U6-hTRAC-M1904-none (the sequence of which is shown as sequence 1 in a sequence table and shown in figure 1), carrying out double enzyme digestion on the fragment 4-1 obtained in the step 4 by utilizing Pac I and Not I, recovering a large fragment, connecting a recovered product with a vector pLV-U6-hTRAC-M1904-none through a vector skeleton obtained by carrying out double enzyme digestion and recovery on Pac I and Not I, and marking the obtained recombinant vector with a correct sequence as pLVu-nCoVS-s. pLVu-nCoVS-s is a recombinant vector obtained by replacing the DNA fragment between Pac I and Not I recognition sequences of the vector pLV-U6-hTRAC-M1904-none with the DNA fragment between Pac I and Not I recognition sequences in the fragment 4-1 (the sequence of the DNA fragment is sequence 4 in the sequence table) (FIG. 3).
The 2838 th to 3078 th of the sequence 1 are U6 promoter sequences, the 3087 th to 3182 th are gTRAC (i.e. hTRAC guide DNA) sequences, the 3183 th to 3196 th are nonsense spacer sequences, the 3230 th to 3628 th are MND promoter sequences, the 3629 th to 3636 th are Pac I recognition sequences, and the 5119 th to 5126 th are Not I recognition sequences.
Wherein, the DNA fragment shown in the sequence 4 encodes a fusion protein shown in the sequence 3, namely a fusion protein formed by fusing CAR functional regions at the 1 st to 400 th positions of ACE2 protein, and is marked as nCoVS-s-CAR. Positions 1-400 of the ACE2 protein in the sequence 3 are positions 1-400, positions 401-622 are CAR functional regions, positions 401-470 are CD8TM, positions 471-512 are 4-1BB, and positions 513-622 are CD3zeta (namely CD3 z).
And (3) carrying out double enzyme digestion on the fragment 4-2 obtained in the step (4) by utilizing Pac I and Not I, recovering a large fragment, connecting a recovered product with a vector pLV-U6-hTRAC-M1904-none through a vector skeleton obtained by carrying out double enzyme digestion recovery on Pac I and Not I, and marking the obtained recombinant vector with a correct sequence as pLVu-nCoVS-l. pLVu-nCoVS-l is a recombinant vector obtained by replacing the DNA fragment between Pac I and Not I recognition sequences of the vector pLV-U6-hTRAC-M1904-none with the DNA fragment between Pac I and Not I recognition sequences in the fragment 4-2 (the sequence of the DNA fragment is sequence 6 in the sequence table) (FIG. 3).
Wherein, the DNA fragment shown in the sequence 6 encodes a fusion protein shown in the sequence 5, namely a fusion protein formed by fusing CAR functional regions at the 1 st to the 600 th positions of ACE2 protein, and is marked as nCoVS-l-CAR. Positions 1-600 of the ACE2 protein in the sequence 5 are positions 1-600, positions 601-822 are CAR functional regions, positions 601-670 are CD8TM, positions 671-712 are 4-1BB, and positions 713-822 are CD3zeta (i.e. CD3 z).
Synthesizing a vector pLV-U6-hTRAC-U6-shCoVRdRp-M1904-none (the sequence of which is shown as sequence 2 in a sequence table and is shown as figure 2), carrying out double enzyme digestion on the fragment 4-1 obtained in the step 4 by utilizing Pac I and Not I, recovering a large fragment, connecting a recovered product with a vector skeleton obtained by carrying out double enzyme digestion recovery on the vector pLV-U6-hTRAC-U6-shCoVRdRp-M1904-none through Pac I and Not I, and marking the obtained recombinant vector with a correct sequence as pLVu-R-nCoVS-s. pLVu-R-nCoVS-s is a recombinant vector obtained by replacing the DNA fragment between the Pac I and Not I recognition sequences of the vector pLV-U6-hTRAC-U6-shCoVRdRp-M1904-none with the DNA fragment between the Pac I and Not I recognition sequences of fragment 4-1 (FIG. 3).
The 2838 th to 3078 th sites of the sequence 2 are U6 promoter sequences, the 3087 th to 3182 th sites are gTRAC sequences, the 3183 th to 3196 th sites are nonsense spacer sequences, the 3197 th to 3437 th sites are U6 promoter sequences, the 3446 th to 3493 th sites are ShCoV RdRp sequences, the 3494 th to 3525 th sites are nonsense spacer sequences, the 3532 th to 3930 th sites are MND promoter sequences, the 3931 th to 3938 th sites are Pac I recognition sequences, and the 5421 th to 5428 th sites are Not I recognition sequences.
And (3) carrying out double enzyme digestion on the fragment 4-2 obtained in the step (4) by utilizing Pac I and Not I, recovering a large fragment, connecting a recovered product with a vector pLV-U6-hTRAC-U6-shCoVRdRp-M1904-none through a vector skeleton obtained by carrying out double enzyme digestion recovery on Pac I and Not I, and marking the obtained recombinant vector with a correct sequence as pLVu-R-nCoVS-l. pLVu-R-nCoVS-l is a recombinant vector obtained by replacing the DNA fragment between the Pac I and Not I recognition sequences of the vector pLV-U6-hTRAC-U6-shCoVRdRp-M1904-none with the DNA fragment between the Pac I and Not I recognition sequences of fragment 4-2 (FIG. 3).
2. Packaging of lentivirus recombinant plasmids
And (3) respectively packaging the recombinant vectors pLVu-nCoVS-s, pLVu-nCoVS-l, pLVu-R-nCoVS-s and pLVu-R-nCoVS-l obtained in the step one to obtain corresponding lentivirus particles. The method comprises the following specific steps:
(1) The CO content of 293FT cells (HEKFT-30001, product number: HEKFT-30001, available from Soy Hiroshima) grown to 80% -90% was reduced from 37 ℃ to 5% 2 The cell culture chamber (2) is taken out, after digestion, washed cells are collected, and 4.5X 10 cells are added into each 10cm cell culture dish 6 The cells were gently shaken with 9mL of DMEM complete medium (Gibco, product catalog No. 11965-084), incubated at 37 ℃ with 5% CO 2 Culturing in an incubator.
(2) On day 2, each dish was added a mixture of the following reagents: 500 μ L buffer (Polyplus Transfection, catalog number B161116), 6 μ g lentiviral recombinant vector pLVu-nCoVS-s, pLVu-nCoVS-L, pLVu-R-nCoVS-s or pLVu-R-nCoVS-L prepared in step one, 3 μ g psPAX2 (vast Ling Biotech limited, catalog number P026) and 1.5 μ g pMD2.G (Giusetts Hiroshima Biotech, catalog number 161220L 08) were mixed well, PEI (Polyplus Transfection, catalog number 114-15), 25 μ L/10cm petri dish was added to the system and mixed well again, and left to stand at room temperature for 10min to obtain a mixed solution.
(3) The 293FT cells for packaging the virus which completed step (1) were subjected to CO-conversion at 37 ℃ 5% 2 Taking out the cell culture box, and carrying out the stepThe mixture obtained in step (2) was added to each dish on average, shaken gently, and charged at 37 ℃ and 5% CO 2 And continuing culturing in the incubator. After 4h incubation, discard old medium, add 5mL of preheated PBS to wash the cells, add 9mL of fresh preheated DMEM complete medium containing 10% (volume fraction) FBS, place at 37 deg.C, 5% CO 2 The culture is continued for 48-72h in the incubator.
(4) Collecting the culture supernatant as virus stock solution after the step (3) is completed, filtering the collected virus stock solution into a 50mL centrifuge tube by using a 0.45 mu m filter, and centrifuging at 4 ℃ and 18500g for 2h at high speed. Discarding the supernatant, adding DMEM complete medium (the volume ratio of the added medium to the virus stock solution is 1.
(5) Subpackaging the virus concentrated solution obtained in the step (4) according to 50 mu L/tube, and storing the subpackaged concentrated solution in a refrigerator at the temperature of-80 ℃ for later use.
Synthesizing a vector pLV-puro-EGFP-RdRp (the sequence is shown as a sequence 7 in a sequence table and shown in a figure 4), replacing the recombinant vector with the vector pLV-puro-EGFP-RdRp according to the methods of the steps (1) to (5), keeping the other steps unchanged, and marking the obtained lentivirus as LV-puro-EGFP-RdRp.
Wherein, the 3556-3588 th site of the sequence 7 is the RdRp sequence of SARS-CoV-2 (NCBI: NC-045512.2).
Synthesizing a vector pLV-puro-CoVS (the sequence is obtained by replacing positions 2839-3588 of the sequence 7 with the sequence 8 (namely the sequence of a spike protein (namely an S protein) coding gene in the SARS-CoV gene sequence), and obtaining the lentivirus which is marked as LV-puro-CoVS by replacing the recombinant vector with the vector pLV-puro-CoVS according to the methods of the steps (1) - (5) and keeping the other steps unchanged.
3. Preparation of CAR-T cells
(1) Transferring fresh peripheral blood samples of healthy donors (namely healthy people not infected with SARS-CoV-2) informed by consent into a centrifuge tube, diluting with 0.9% physiological saline with the same volume, and mixing uniformly to obtain diluted blood samples;
(2) 15ml of lymphocyte separation solution (Beijing Oriental Huahui biomedical science and technology Co., ltd.; 25710) was put into a new centrifuge tube, and then 2 times volume (i.e., 30 ml) of the blood sample diluted in step (1) was slowly added to the upper layer of the lymphocyte separation solution, and centrifugation was carried out with the centrifugation parameter of 2000rpm (580 g) for 20min, and the 7-up and 4-down were carried out at 25 ℃;
(3) After the centrifugation is finished, the method is divided into four layers: transferring the diluted plasma layer, the monocyte layer, the lymphocyte separation liquid layer and the erythrocyte layer into a new centrifuge tube, and washing with normal saline;
(4) And (4) purifying the mononuclear cells obtained in the step (3) by using a kit to obtain CD3+ T cells, wherein the kit is a product of Meitian and whirlwind, and has the product number of 130-050-101.
(5) Taking purified CD3+ T cells 1X 10 7 Spreading culture bottles, adding CTS CD3/CD28Dynabeads (Gibco, 40203D) to stimulate activation culture, and recording the day of culture with the added CTS CD3/CD28Dynabeads as the 0 th day of culture;
(6) The next day of culture, a certain amount of LVu-nCoVS-s virus or LVu-nCoVS-l virus or LVu-R-nCoVS-l virus prepared in step two was added to the flask with CD3+ T cells at room temperature, and then the flask was placed in a centrifuge and centrifuged at 2000rpm (580 g) for 2h, 4. Sup.4. Sup. 4. Sup. 35 ℃ to complete lentivirus transduction, CAR T cells were obtained after centrifugation, nCoVS-s-CAR-expressing T cells obtained from LVu-nCoVS-s virus were recorded as nCoVS-s CAR-T, nCoVS-l-expressing T cells obtained from LVu-nCoVS-l virus (CAR-T), nCoVS-l-CAR-25-R-25-zxft-R-l expressing cells obtained from CoVS-345732 (CoVS-nCoVS-R-l) expressing CoVS-s-T cells obtained from LVu-nCoVS-s virus.
Continuing culturing the obtained CAR T cells;
(7) On the third day of culture, half-supplementing the cells in the culture flask (adding TexMACS containing 200IU of IL-2 (IL-2 and TexMACS are both American and whirly products, with the cargo numbers of 130-097-74 and 170-076-309 respectively), and continuing culture;
(8) On the fifth day of culture, the expression of chimeric antigen receptor in T cells was detected by flow cytometry, using CD3+ T cells without virus transfection as control (control T cells); the reagents used were as follows: 7AAD (Biolegend, 420403); CD3-APC/Cy7 (Biolegend, 300318); CD4-FITC (Biolegend, 317408); NCP-CoV S (RBD, mFc tag) (Sino Biological, 40592-V05H); anti-mFc-PE, abcam, ab5881; CD137-APC (Biolegend, 309810).
The results are shown in FIG. 5,A: flow results of virus transfection positivity of non-transfected virus CD3+ T cells, nCoVS-s CAR-T, nCoVS-l CAR-T, R-nCoVS-s CAR-T and R-nCoVS-l CAR-T cells cultured on the fifth day showed nCoVS-s-CAR-T transduction rate of 61.36%, nCoVS-l CAR-T transduction rate of 37.36%, R-nCoVS-s-CAR-T transduction rate of 42.91%, R-nCoVS-l CAR-T transduction rate of 23.97%, and control T cells of 0.13%. B: positive CAR-T cells were transfected with circovirus for analysis and observed for expression of CD137 following activation by S protein. The results showed that 57.7% of the nCoVS-s CAR-T positive cells expressed CD137 (i.e., 57.7% of the cells were activated), 70.9% of the nCoVS-l CAR-T cells expressed CD137 (i.e., 70.9% of the cells were activated), 53.1% of the R-nCoVS-s CAR-T positive cells expressed CD137 (i.e., 53.1% of the cells were activated), 62.2% of the R-nCoVS-l CAR-T cells expressed CD137 (i.e., 62.2% of the cells were activated), and 0.121% of the control T cells were activated.
4. Electrotransfer of CAR-T cells
1. After the third step is finished, removing the magnetic beads from the R-nCoVS-s CAR-T or R-nCoVS-l CAR-T cells cultured on the fifth day;
2. after the step 1 is finished, taking cells, suspending the cells uniformly, placing the cells in an EP tube, and staining trypan blue for counting;
3. after step 2, take 3X 10 6 Placing the cells in culture solution, placing in a new centrifuge tube, centrifuging at 1000rpm for 5min;
4. after the step 3 is finished, removing a supernatant culture solution to obtain the required cells, adding 1mL of D-PBS into the cells for resuspending the cells, and centrifuging the cells at 1000rpm for 5min;
5. after completion of step 4, the D-PBS was discarded, the required amount of 100. Mu.l of an electrotransfer buffer (Opti-MEM medium from Gibco, cat # 11058021) and 6.6. Mu.g of Cas9 protein (Takara, 632641) were added to the cell pellet, and gently mixed by pipetting to obtain a cell suspension;
6. electric conversion: after the step 5 is finished, adding the cell suspension mixed with the Cas9 protein into an H1 electric rotating cup according to 100 mu l/hole, inserting the electric rotating cup into a base, and selecting a correct electric rotating condition for electric rotating; (Voltage: 250V; pulse duration: 800. Mu.s; pulse number: 2. Electrotransformation appearance: suzhou Yi da H1.
7. After completion of step 6, the cells after electroporation were resuspended in 1ml of medium (TexMACS containing 200IU IL-2 and cultured for another 48 hours.
8. And 7, after completing step 7, detecting the expression condition of the chimeric antigen receptor in the T cell and the knockout ratio of the alpha beta-T cell receptor by using a flow cytometer after carrying out electrotransformation for 48 hours. The reagents used were: 7AAD (Biolegend, 420403); TCR ab-PE/Cy7 (Biolegend, 306720); CD3-APC/Cy7 (Biolegend, 300318); anti-mFc-PE, abcam, ab5881; NCP-CoV S (RBD, mFc tag) (Sino Biological, 40592-V05H).
The results are shown in FIG. 6, A: the positive rate of the R-nCoVS-s CAR-T cell chimeric antigen receptor is 66.5%, and the positive rate of the R-nCoVS-l CAR-T cell chimeric antigen receptor is 68.2%. B shows that the knockout ratio of TCR-. Alpha.beta. (α.beta. TCR) of R-nCoVS-s CAR-T cells and R-nCoVS-l CAR-T cells was 64.3% and 34.7%, respectively.
Cell sorting was performed after confirming α β TCR knockout, see step five.
5. Sorting process
1. Preparing a sorting buffer solution: HSA (human serum albumin, hebeida pharmaceutical Co., ltd., national Standard S20023010) and DPBS (Gibco, 14190-144) were mixed to obtain a sorting buffer, and the mass concentrations of HSA and DPBS in the sorting buffer were 0.5% and 95.5%, respectively.
2. Cell counting and collection: the cells to be sorted are mixed, sampled for counting, then centrifuged at 2000rpm for 5min, and the supernatant is discarded.
3. After completion of step 2, at 1X 10 per 80. Mu.L of sorting buffer 7 The cell suspension was obtained by resuspending the cells at a ratio of one cell.
4. After completion of step 3, the procedure was followed at 1X 10 7 And (2) cell: to the Cell suspension obtained in step 3, biotin-Antibody Cocktail (TCRg/d + T Cell Isolation Kit, miltenyi Biotec, 130-092-892) was added at a ratio of 20. Mu.L, mixed well and incubated at 4-8 ℃ for 10min to obtain a Cell suspension.
5. After completion of step 4, the procedure was followed at 1X 10 7 And (2) cell: and (4) adding the sorting buffer solution into the cell suspension obtained in the step (4) according to the proportion of every 1-2mL of the sorting buffer solution to clean the cells, adding the sorting buffer solution, centrifuging at 2000rpm for 5min, discarding the supernatant after the centrifugation is finished, and collecting cell precipitates.
6. After completion of step 5, 1X 10 cells were added to the cell pellet 7 And (2) cell: anti-Biotin MicroBeads (TCRg/d + T Cell Isolation Kit, miltenyi Biotec, 130-092-892) were added to 20. Mu.L of each Cell, mixed well and incubated at 4-8 ℃ for 15min to obtain a Cell suspension.
7. After completion of step 6, the procedure was followed at 1X 10 7 And (2) cell: and (3) adding the sorting buffer solution into the cell suspension obtained in the step (6) according to the proportion of every 1-2mL of the sorting buffer solution to clean the cells, adding the sorting buffer solution, centrifuging at 2000rpm for 5min, discarding the supernatant after the centrifugation is finished, and collecting cell precipitates.
8. After step 7 is completed, if the total cell count is less than 1X 10 8 The cells were resuspended in 500. Mu.L of sorting buffer if the total cell count was above 1X 10 8 The sorting buffer is proportioned so that the number of cells per 500. Mu.L buffer is not more than 1X 10 8 Thus, a cell suspension was obtained.
9. After step 8, the magnetic sorting column sorts the cells: magnetic sorting column LS Columns (Miltenyi Biotec, 130-042-401) were prepared and the column was rinsed 2 times with 3mL of buffer; and then adding the cell suspension obtained in the step 8 into a sorting column for sorting, adding 3mL of sorting buffer solution to clean the column after all liquid in the column drops, wherein the dropped cell suspension is the alpha beta TCR knocked-out CAR-T cell.
Flow analysis to detect the expression of TCR-alpha beta before and after sorting, the reagents used are: 7AAD (Biolegend, 420403); TCR ab-PE/Cy7 (Biolegend 306720); NCP-CoV S (RBD, mFc tag) (Sino Biological, 40592-V05H); anti-mFc-PE (Abcam, ab 5881).
The results are shown in FIG. 7, A: the knockout ratio of TCR- α β before sorting of nCoVS-s CAR-T and nCoVS-l CAR-T cells was 64.3% and 34.7%, respectively. B: neither CAR-T cell population expressed TCR- α β after sorting. Demonstrates that alpha beta TCR knockout and nCoVS-s-CAR expressing CAR-T cells and alpha beta TCR knockout and nCoVS-l-CAR expressing CAR-T cells are successfully obtained, and both CAR-T cells can generate shRNA sequences for identifying RdRp of SARS-CoV-2 and can be used for targeting SARS-CoV-2.
6. Construction of K562-EGFP-RdRp cell line
1. K562 cells in good growth state were grown at 3X 10 5 24-well plates were inoculated per well with 500 μ L1640 complete medium containing 10% (v/v) FBS per well (1640 complete medium is Gibco, cat 22400-089 is ExCell Bio, cat FND 500;
2. adding 5 mul of LV-puro-EGFP-RdRp lentivirus obtained in the second step into each hole, adding a Protamine Sulfate injection (a product of Yuekang pharmaceutical industry group Co., ltd., H11020246) with the use concentration of 8 mul/mL, and uniformly mixing to obtain a cell mixed solution of an experimental group; using the cell line without adding virus as a blank control;
3. centrifuging the cell mixture 872g obtained in step 2 at 35 deg.C for 2h, adding CO 5% 2 Culturing in an incubator;
4. on the next day after the step 3 is finished, supplementing 1640 complete culture medium for each hole by 500 mu L, continuously placing the cells in an incubator for culture, and recording the day of supplementing the liquid as the 1 st day of culture; on the 2 nd day of culture, 10. Mu.L of puromycin (Solarbio, P8230) with the concentration of 1mM was added to each well of a 24-well plate, and the mixture was mixed uniformly, and screening was started until all the blank control cells died, and the experimental cells that did not die were K562-EGFP-RdRp cell line, which was sampled at different time points for flow detection.
The results are shown in FIG. 8, the blank control cells have no EGFP expression (the EGFP expression rate of the cells is 0.019%), the EGFP expression rate of the cells infected by the virus LV-puro-EGFP-RdRp on the 2 nd day of culture is 66.4%, and the EGFP expression rate of the cells infected by the virus LV-puro-EGFP-RdRp on the 9 th day of culture after Puromycin screening is 98.9%, which indicates that the K562-EGFP-RdRp cell line is successfully obtained.
7. Knock down experiment
And (4) infecting the K562-EGFR-RdRp obtained in the sixth step with equivalent amounts of LVu-nCoVS-s, LVu-R-nCoVS-s, LVu-nCoVS-l and LVu-R-nCoVS-l viruses obtained in the second step respectively, and detecting the expression condition of the EGFP by flow detection after four days.
The results are shown in FIG. 9, with positive rates of infection of cells of LVu-nCoVS-s, LVu-R-nCoVS-s, LVu-nCoVS-l and LVu-R-nCoVS-l of 63.9%, 59.4%, 59.3% and 36.5%, respectively. EGFP expression was analyzed in infection-positive cells, and the positive rates for LVu-nCoVS-s and LVu-nCoVS-l virus-infected cells were still higher than 90% (93.8% and 92.3%), but decreased to 29.6% and 41.3% in LVu-R-nCoVS-s and LVu-R-nCoVS-l infected cells. Therefore, LVu-R-nCoVS-s and LVu-R-nCoVS-l carrying shCoV RdRp sequences can generate shRNA sequences for identifying RdRp of SARS-CoV-2 and knock down the expression capability of the shCoV RdRp sequences.
8. Preparation of target cells
Replacing the LV-puro-EGFP-RdRp lentivirus with the LV-puro-CoVS lentivirus obtained in the second step according to the method 1-4 in the sixth step, and obtaining the K562-CoVS cell (target cell) expressing the target protein without changing other steps.
9. Specific killing efficiency detection
The chimeric antigen receptor-expressing nCoVS-s CAR-T, nCoVS-l CAR-T, R-nCoVS-s CAR-T prepared above and R-nCoVS-l CAR-T cells were co-cultured with K562-CoVS cells (target cells), respectively, as follows:
experimental groups: target cells were stained with 1mg/ml Calcein (Calcein-AM, invitrogen, C3099) and then 2X 10 target cells were added to 200. Mu.l of cell culture medium (RPMI 1640 (Gibco, 22400-089) +10% (v/v) FBS (ExCelBio, FND 500)) 4 One of four CAR T cells were then added, with a CAR T cell count of 2 × 10 5 I.e. the CAR T cell to target cell ratio is 10, 1, 37 degreesAfter four hours of incubation, the released calcein in the supernatant was detected (detection with a microplate reader Multiskan Sky, detection conditions excitation 490nm, emission 515 nm).
Spontaneous release group: culturing equivalent target cells under the same condition for the same time, and directly detecting supernatant, wherein the number of the group is spontaneous fluorescence release;
complete release group: after adding 200. Mu.l of the cell culture medium to the same amount of the target cells, 2% of Triton X-100. Mu.l was added, and the supernatant was directly assayed after culturing under the same conditions for the same period of time, which was the complete release group.
The number of CAR T cells was adjusted to 6X 10 according to the above method 4 Or 2X 10 4 The specific killing efficiency of CAR T cells was tested at a CAR T cell to target cell ratio of 3:1 or 1:1.
CD3+ T cells obtained above were used as control T cells.
Specific killing efficiency of CAR T cells was calculated, specific killing efficiency (%) = (experimental fluorescence value-spontaneous release group fluorescence value)/(complete release group fluorescence value-spontaneous release group fluorescence value) × 100%.
Results as shown in figure 11 and table 1, killing efficiency increased with CAR-T cells compared to control T cells, while killing efficiency of ncovis-l and R-ncovis-l was higher than that of ncovis-s and R-ncovis-s, and both of ncovis-s CAR-T, nCoVS-l CAR-T, R-ncovis-s CAR-T and R-ncovis-l CAR-T cells were significantly higher than that of control T cells. It is demonstrated that the CAR T cells of the invention can specifically kill cells containing spike protein in SARS-CoV gene sequence.
TABLE 1 specific killing efficiency (%)
Figure BDA0002402171980000131
<110> Hebei Senlang Biotech Co., ltd
<120> preparation method and application of universal chimeric antigen receptor T cell for treating COVID-19
<160> 8
<170> PatentIn version 3.5
<210> 1
<211> 8202
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 1
acaccccttg tattactgtt tatgtaagca gacagtttta ttgttcatga ccaaaatccc 60
ttaacgtgag ttttcgttcc actgagcgtc agaccccgta gaaatccgcg cacatttccc 120
cgaaaagtgc cacctgacgt cgacggatcg ggagatctcc cgatccccta tggtgcactc 180
tcagtacaat ctgctctgat gccgcatagt taagccagta tctgctccct gcttgtgtgt 240
tggaggtcgc tgagtagtgc gcgagcaaaa tttaagctac aacaaggcaa ggcttgaccg 300
acaattgcat gaagaatctg cttagggtta ggcgttttgc gctgcttcgc gatgtacggg 360
ccagatatcg cgttgacatt gattattgac tagttattaa tagtaatcaa ttacggggtc 420
attagttcat agcccatata tggagttccg cgttacataa cttacggtaa atggcccgcc 480
tggctgaccg cccaacgacc cccgcccatt gacgtcaata atgacgtatg ttcccatagt 540
aacgccaata gggactttcc attgacgtca atgggtggag tatttacggt aaactgccca 600
cttggcagta catcaagtgt atcatatgcc aagtacgccc cctattgacg tcaatgacgg 660
taaatggccc gcctggcatt atgcccagta catgacctta tgggactttc ctacttggca 720
gtacatctac gtattagtca tcgctattac catggtgatg cggttttggc agtacatcaa 780
tgggcgtgga tagcggtttg actcacgggg atttccaagt ctccacccca ttgacgtcaa 840
tgggagtttg ttttggcacc aaaatcaacg ggactttcca aaatgtcgta acaactccgc 900
cccattgacg caaatgggcg gtaggcgtgt acggtgggag gtctatataa gcagcgcgtt 960
ttgcctgtac tgggtctctc tggttagacc agatctgagc ctgggagctc tctggctaac 1020
tagggaaccc actgcttaag cctcaataaa gcttgccttg agtgcttcaa gtagtgtgtg 1080
cccgtctgtt gtgtgactct ggtaactaga gatccctcag acccttttag tcagtgtgga 1140
aaatctctag cagtggcgcc cgaacaggga cttgaaagcg aaagggaaac cagaggagct 1200
ctctcgacgc aggactcggc ttgctgaagc gcgcacggca agaggcgagg ggcggcgact 1260
ggtgagtacg ccaaaaattt tgactagcgg aggctagaag gagagagatg ggtgcgagag 1320
cgtcagtatt aagcggggga gaattagatc gcgatgggaa aaaattcggt taaggccagg 1380
gggaaagaaa aaatataaat taaaacatat agtatgggca agcagggagc tagaacgatt 1440
cgcagttaat cctggcctgt tagaaacatc agaaggctgt agacaaatac tgggacagct 1500
acaaccatcc cttcagacag gatcagaaga acttagatca ttatataata cagtagcaac 1560
cctctattgt gtgcatcaaa ggatagagat aaaagacacc aaggaagctt tagacaagat 1620
agaggaagag caaaacaaaa gtaagaccac cgcacagcaa gcggccggcc gctgatcttc 1680
agacctggag gaggagatat gagggacaat tggagaagtg aattatataa atataaagta 1740
gtaaaaattg aaccattagg agtagcaccc accaaggcaa agagaagagt ggtgcagaga 1800
gaaaaaagag cagtgggaat aggagctttg ttccttgggt tcttgggagc agcaggaagc 1860
actatgggcg cagcgtcaat gacgctgacg gtacaggcca gacaattatt gtctggtata 1920
gtgcagcagc agaacaattt gctgagggct attgaggcgc aacagcatct gttgcaactc 1980
acagtctggg gcatcaagca gctccaggca agaatcctgg ctgtggaaag atacctaaag 2040
gatcaacagc tcctggggat ttggggttgc tctggaaaac tcatttgcac cactgctgtg 2100
ccttggaatg ctagttggag taataaatct ctggaacaga tttggaatca cacgacctgg 2160
atggagtggg acagagaaat taacaattac acaagcttaa tacactcctt aattgaagaa 2220
tcgcaaaacc agcaagaaaa gaatgaacaa gaattattgg aattagataa atgggcaagt 2280
ttgtggaatt ggtttaacat aacaaattgg ctgtggtata taaaattatt cataatgata 2340
gtaggaggct tggtaggttt aagaatagtt tttgctgtac tttctatagt gaatagagtt 2400
aggcagggat attcaccatt atcgtttcag acccacctcc caaccccgag gggacccgac 2460
aggcccgaag gaatagaaga agaaggtgga gagagagaca gagacagatc cattcgatta 2520
gtgaacggat cggcactgcg tgcgccaatt ctgcagacaa atggcagtat tcatccacaa 2580
ttttaaaaga aaagggggga ttggggggta cagtgcaggg gaaagaatag tagacataat 2640
agcaacagac atacaaacta aagaattaca aaaacaaatt acaaaaattc aaaattttcg 2700
ggtttattac agggacagca gagatccagt ttggttagta ccgggcccgc tctagaggat 2760
ccggctgtgg aatgtgtgtc agttagggtg tggaaagtcc ccaggctccc cagcaggcag 2820
aagtatgcaa agctagcgag ggcctatttc ccatgattcc ttcatatttg catatacgat 2880
acaaggctgt tagagagata attggaatta atttgactgt aaacacaaag atattagtac 2940
aaaatacgtg acgtagaaag taataatttc ttgggtagtt tgcagtttta aaattatgtt 3000
ttaaaatgga ctatcatatg cttaccgtaa cttgaaagta tttcgatttc ttggctttat 3060
atatcttgtg gaaaggacga aacaccgcag ggttctggat atctgtgttt tagagctaga 3120
aatagcaagt taaaataagg ctagtccgtt atcaacttga aaaagtggca ccgagtcggt 3180
gcttttttgg ccggccgaat tccaactttg tatagaaaag ttgctcgagt ttatttagtc 3240
tccagaaaaa ggggggaatg aaagacccca cctgtaggtt tggcaagcta ggatcaaggt 3300
taggaacaga gagacagcag aatatgggcc aaacaggata tctgtggtaa gcagttcctg 3360
ccccggctca gggccaagaa cagttggaac agcagaatat gggccaaaca ggatatctgt 3420
ggtaagcagt tcctgccccg gctcagggcc aagaacagat ggtccccaga tgcggtcccg 3480
ccctcagcag tttctagaga accatcagat gtttccaggg tgccccaagg acctgaaatg 3540
accctgtgcc ttatttgaac taaccaatca gttcgcttct cgcttctgtt cgcgcgcttc 3600
tgctccccga gctcaataaa agagcccatt aattaagcca ccatgctgct gctggtgacc 3660
agcctgctgc tgtgcgagct gccccacccc gcctttctgc tgatccccga catccagatg 3720
acccagacca cctccagcct gagcgccagc ctgggcgacc gggtgaccat cagctgccgg 3780
gccagccagg acatcagcaa gtacctgaac tggtatcagc agaagcccga cggcaccgtc 3840
aagctgctga tctaccacac cagccggctg cacagcggcg tgcccagccg gtttagcggc 3900
agcggctccg gcaccgacta cagcctgacc atctccaacc tggaacagga agatatcgcc 3960
acctactttt gccagcaggg caacacactg ccctacacct ttggcggcgg aacaaagctg 4020
gaaatcaccg gcagcacctc cggcagcggc aagcctggca gcggcgaggg cagcaccaag 4080
ggcgaggtga agctgcagga aagcggccct ggcctggtgg cccccagcca gagcctgagc 4140
gtgacctgca ccgtgagcgg cgtgagcctg cccgactacg gcgtgagctg gatccggcag 4200
ccccccagga agggcctgga atggctgggc gtgatctggg gcagcgagac cacctactac 4260
aacagcgccc tgaagagccg gctgaccatc atcaaggaca acagcaagag ccaggtgttc 4320
ctgaagatga acagcctgca gaccgacgac accgccatct actactgcgc caagcactac 4380
tactacggcg gcagctacgc catggactac tggggccagg gcaccagcgt gaccgtgagc 4440
agcactaccc cagcaccgcg gccacccacc ccggctccta ccatcgcctc ccagcctctg 4500
tccctgcgtc cggaggcatg tagacccgca gctggtgggg ccgtgcatac ccggggtctt 4560
gacttcgcct gcgatatcta catttgggcc cctctggctg gtacttgcgg ggtcctgctg 4620
ctttcactcg tgatcactct ttactgtaag cgcggtcgga agaagctgct gtacatcttt 4680
aagcaaccct tcatgaggcc tgtgcagact actcaagagg aggacggctg ttcatgccgg 4740
ttcccagagg aggaggaagg cggctgcgaa ctgcgcgtga aattcagccg cagcgcagat 4800
gctccagcct acaagcaggg gcagaaccag ctctacaacg aactcaatct tggtcggaga 4860
gaggagtacg acgtgctgga caagcggaga ggacgggacc cagaaatggg cgggaagccg 4920
cgcagaaaga atccccaaga gggcctgtac aacgagctcc aaaaggataa gatggcagaa 4980
gcctatagcg agattggtat gaaaggggaa cgcagaagag gcaaaggcca cgacggactg 5040
taccagggac tcagcaccgc caccaaggac acctatgacg ctcttcacat gcaggccctg 5100
ccgcctcggt gaactagtgc ggccgccgtt taaacggccg gccgcggtct gtacaagtag 5160
gattcgtcga gggacctaat aacttcgtat agcatacatt atacgaagtt atacatgttt 5220
aagggttccg gttccactag gtacaattcg atatcaagct tatcgataat caacctctgg 5280
attacaaaat ttgtgaaaga ttgactggta ttcttaacta tgttgctcct tttacgctat 5340
gtggatacgc tgctttaatg cctttgtatc atgctattgc ttcccgtatg gctttcattt 5400
tctcctcctt gtataaatcc tggttgctgt ctctttatga ggagttgtgg cccgttgtca 5460
ggcaacgtgg cgtggtgtgc actgtgtttg ctgacgcaac ccccactggt tggggcattg 5520
ccaccacctg tcagctcctt tccgggactt tcgctttccc cctccctatt gccacggcgg 5580
aactcatcgc cgcctgcctt gcccgctgct ggacaggggc tcggctgttg ggcactgaca 5640
attccgtggt gttgtcgggg aaatcatcgt cctttccttg gctgctcgcc tgtgttgcca 5700
cctggattct gcgcgggacg tccttctgct acgtcccttc ggccctcaat ccagcggacc 5760
ttccttcccg cggcctgctg ccggctctgc ggcctcttcc gcgtcttcgc cttcgccctc 5820
agacgagtcg gatctccctt tgggccgcct ccccgcatcg ataccgtcga cctcgatcga 5880
gacctagaaa aacatggagc aatcacaagt agcaatacag cagctaccaa tgctgattgt 5940
gcctggctag aagcacaaga ggaggaggag gtgggttttc cagtcacacc tcatgtacct 6000
ttaagaccaa tgacttacaa ggcagctgta gatcttagcc actttttaaa agaaaagggg 6060
ggactggaag ggctaattca ctcccaacga agacaagata tccttgatct gtggatctac 6120
cacacacaag gctacttccc tgattggcag aactacacac cagggccagg gatcagatat 6180
ccactgacct ttggatggtg ctacaagcta gtaccagttg agcaagagaa ggtagaagaa 6240
gccaatgaag gagagaacac ccgcttgtta caccctgtga gcctgcatgg gatggatgac 6300
ccggagagag aagtattaga gtggaggttt gacagccgcc tagcatttca tcacatggcc 6360
cgagagctgc atccggactg tactgggtct ctctggttag accagatctg agcctgggag 6420
ctctctggct aactagggaa cccactgctt aagcctcaat aaagcttgcc ttgagtgctt 6480
caagtagtgt gtgcccgtct gttgtgtgac tctggtaact agagatccct cagacccttt 6540
tagtcagtgt ggaaaatctc tagcagcatg tgagcaaaag gccagcaaaa ggccaggaac 6600
cgtaaaaagg ccgcgttgct ggcgtttttc cataggctcc gcccccctga cgagcatcac 6660
aaaaatcgac gctcaagtca gaggtggcga aacccgacag gactataaag ataccaggcg 6720
tttccccctg gaagctccct cgtgcgctct cctgttccga ccctgccgct taccggatac 6780
ctgtccgcct ttctcccttc gggaagcgtg gcgctttctc atagctcacg ctgtaggtat 6840
ctcagttcgg tgtaggtcgt tcgctccaag ctgggctgtg tgcacgaacc ccccgttcag 6900
cccgaccgct gcgccttatc cggtaactat cgtcttgagt ccaacccggt aagacacgac 6960
ttatcgccac tggcagcagc cactggtaac aggattagca gagcgaggta tgtaggcggt 7020
gctacagagt tcttgaagtg gtggcctaac tacggctaca ctagaagaac agtatttggt 7080
atctgcgctc tgctgaagcc agttaccttc ggaaaaagag ttggtagctc ttgatccggc 7140
aaacaaacca ccgctggtag cggtggtttt tttgtttgca agcagcagat tacgcgcaga 7200
aaaaaaggat ctcaagaaga tcctttgatc ttttctacgg ggtctgacgc tcagtggaac 7260
gaaaactcac gttaagggat tttggtcatg agattatcaa aaaggatctt cacctagatc 7320
cttttaaatt aaaaatgaag ttttaaatca atctaaagta tatatgagta aacttggtct 7380
gacagctaga aaaactcatc gagcatcaaa tgaaactgca atttattcat atcaggatta 7440
tcaataccat atttttgaaa aagccgtttc tgtaatgaag gagaaaactc accgaggcag 7500
ttccatagga tggcaagatc ctggtatcgg tctgcgattc cgactcgtcc aacatcaata 7560
caacctatta atttcccctc gtcaaaaata aggttatcaa gtgagaaatc accatgagtg 7620
acgactgaat ccggtgagaa tggcaaaagt ttatgcattt ctttccagac ttgttcaaca 7680
ggccagccat tacgctcgtc atcaaaatca ctcgcatcaa ccaaaccgtt attcattcgt 7740
gattgcgcct gagcgagacg aaatacgcga tcgctgttaa aaggacaatt acaaacagga 7800
atcgaatgca accggcgcag gaacactgcc agcgcatcaa caatattttc acctgaatca 7860
ggatattctt ctaatacctg gaatgctgtt ttcccaggga tcgcagtggt gagtaaccat 7920
gcatcatcag gagtacggat aaaatgcttg atggtcggaa gaggcataaa ttccgtcagc 7980
cagtttagtc tgaccatctc atctgtaaca tcattggcaa cgctaccttt gccatgtttc 8040
agaaacaact ctggcgcatc gggcttccca tacaatcgat agattgtcgc acctgattgc 8100
ccgacattat cgcgagccca tttataccca tataaatcag catccatgtt ggaatttaat 8160
cgcggcctag agcaagacgt ttcccgttga atatggctca ta 8202
<210> 2
<211> 8504
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 2
acaccccttg tattactgtt tatgtaagca gacagtttta ttgttcatga ccaaaatccc 60
ttaacgtgag ttttcgttcc actgagcgtc agaccccgta gaaatccgcg cacatttccc 120
cgaaaagtgc cacctgacgt cgacggatcg ggagatctcc cgatccccta tggtgcactc 180
tcagtacaat ctgctctgat gccgcatagt taagccagta tctgctccct gcttgtgtgt 240
tggaggtcgc tgagtagtgc gcgagcaaaa tttaagctac aacaaggcaa ggcttgaccg 300
acaattgcat gaagaatctg cttagggtta ggcgttttgc gctgcttcgc gatgtacggg 360
ccagatatcg cgttgacatt gattattgac tagttattaa tagtaatcaa ttacggggtc 420
attagttcat agcccatata tggagttccg cgttacataa cttacggtaa atggcccgcc 480
tggctgaccg cccaacgacc cccgcccatt gacgtcaata atgacgtatg ttcccatagt 540
aacgccaata gggactttcc attgacgtca atgggtggag tatttacggt aaactgccca 600
cttggcagta catcaagtgt atcatatgcc aagtacgccc cctattgacg tcaatgacgg 660
taaatggccc gcctggcatt atgcccagta catgacctta tgggactttc ctacttggca 720
gtacatctac gtattagtca tcgctattac catggtgatg cggttttggc agtacatcaa 780
tgggcgtgga tagcggtttg actcacgggg atttccaagt ctccacccca ttgacgtcaa 840
tgggagtttg ttttggcacc aaaatcaacg ggactttcca aaatgtcgta acaactccgc 900
cccattgacg caaatgggcg gtaggcgtgt acggtgggag gtctatataa gcagcgcgtt 960
ttgcctgtac tgggtctctc tggttagacc agatctgagc ctgggagctc tctggctaac 1020
tagggaaccc actgcttaag cctcaataaa gcttgccttg agtgcttcaa gtagtgtgtg 1080
cccgtctgtt gtgtgactct ggtaactaga gatccctcag acccttttag tcagtgtgga 1140
aaatctctag cagtggcgcc cgaacaggga cttgaaagcg aaagggaaac cagaggagct 1200
ctctcgacgc aggactcggc ttgctgaagc gcgcacggca agaggcgagg ggcggcgact 1260
ggtgagtacg ccaaaaattt tgactagcgg aggctagaag gagagagatg ggtgcgagag 1320
cgtcagtatt aagcggggga gaattagatc gcgatgggaa aaaattcggt taaggccagg 1380
gggaaagaaa aaatataaat taaaacatat agtatgggca agcagggagc tagaacgatt 1440
cgcagttaat cctggcctgt tagaaacatc agaaggctgt agacaaatac tgggacagct 1500
acaaccatcc cttcagacag gatcagaaga acttagatca ttatataata cagtagcaac 1560
cctctattgt gtgcatcaaa ggatagagat aaaagacacc aaggaagctt tagacaagat 1620
agaggaagag caaaacaaaa gtaagaccac cgcacagcaa gcggccggcc gctgatcttc 1680
agacctggag gaggagatat gagggacaat tggagaagtg aattatataa atataaagta 1740
gtaaaaattg aaccattagg agtagcaccc accaaggcaa agagaagagt ggtgcagaga 1800
gaaaaaagag cagtgggaat aggagctttg ttccttgggt tcttgggagc agcaggaagc 1860
actatgggcg cagcgtcaat gacgctgacg gtacaggcca gacaattatt gtctggtata 1920
gtgcagcagc agaacaattt gctgagggct attgaggcgc aacagcatct gttgcaactc 1980
acagtctggg gcatcaagca gctccaggca agaatcctgg ctgtggaaag atacctaaag 2040
gatcaacagc tcctggggat ttggggttgc tctggaaaac tcatttgcac cactgctgtg 2100
ccttggaatg ctagttggag taataaatct ctggaacaga tttggaatca cacgacctgg 2160
atggagtggg acagagaaat taacaattac acaagcttaa tacactcctt aattgaagaa 2220
tcgcaaaacc agcaagaaaa gaatgaacaa gaattattgg aattagataa atgggcaagt 2280
ttgtggaatt ggtttaacat aacaaattgg ctgtggtata taaaattatt cataatgata 2340
gtaggaggct tggtaggttt aagaatagtt tttgctgtac tttctatagt gaatagagtt 2400
aggcagggat attcaccatt atcgtttcag acccacctcc caaccccgag gggacccgac 2460
aggcccgaag gaatagaaga agaaggtgga gagagagaca gagacagatc cattcgatta 2520
gtgaacggat cggcactgcg tgcgccaatt ctgcagacaa atggcagtat tcatccacaa 2580
ttttaaaaga aaagggggga ttggggggta cagtgcaggg gaaagaatag tagacataat 2640
agcaacagac atacaaacta aagaattaca aaaacaaatt acaaaaattc aaaattttcg 2700
ggtttattac agggacagca gagatccagt ttggttagta ccgggcccgc tctagaggat 2760
ccggctgtgg aatgtgtgtc agttagggtg tggaaagtcc ccaggctccc cagcaggcag 2820
aagtatgcaa agctagcgag ggcctatttc ccatgattcc ttcatatttg catatacgat 2880
acaaggctgt tagagagata attggaatta atttgactgt aaacacaaag atattagtac 2940
aaaatacgtg acgtagaaag taataatttc ttgggtagtt tgcagtttta aaattatgtt 3000
ttaaaatgga ctatcatatg cttaccgtaa cttgaaagta tttcgatttc ttggctttat 3060
atatcttgtg gaaaggacga aacaccgcag ggttctggat atctgtgttt tagagctaga 3120
aatagcaagt taaaataagg ctagtccgtt atcaacttga aaaagtggca ccgagtcggt 3180
gcttttttgg ccggccgagg gcctatttcc catgattcct tcatatttgc atatacgata 3240
caaggctgtt agagagataa ttggaattaa tttgactgta aacacaaaga tattagtaca 3300
aaatacgtga cgtagaaagt aataatttct tgggtagttt gcagttttaa aattatgttt 3360
taaaatggac tatcatatgc ttaccgtaac ttgaaagtat ttcgatttct tggctttata 3420
tatcttgtgg aaaggacgaa acaccgcaga cctcgtctat gctttactcg agtaaagcat 3480
agacgaggtc tgctttttga attccaactt tgtatagaaa agttgctcga gtttatttag 3540
tctccagaaa aaggggggaa tgaaagaccc cacctgtagg tttggcaagc taggatcaag 3600
gttaggaaca gagagacagc agaatatggg ccaaacagga tatctgtggt aagcagttcc 3660
tgccccggct cagggccaag aacagttgga acagcagaat atgggccaaa caggatatct 3720
gtggtaagca gttcctgccc cggctcaggg ccaagaacag atggtcccca gatgcggtcc 3780
cgccctcagc agtttctaga gaaccatcag atgtttccag ggtgccccaa ggacctgaaa 3840
tgaccctgtg ccttatttga actaaccaat cagttcgctt ctcgcttctg ttcgcgcgct 3900
tctgctcccc gagctcaata aaagagccca ttaattaagc caccatgctg ctgctggtga 3960
ccagcctgct gctgtgcgag ctgccccacc ccgcctttct gctgatcccc gacatccaga 4020
tgacccagac cacctccagc ctgagcgcca gcctgggcga ccgggtgacc atcagctgcc 4080
gggccagcca ggacatcagc aagtacctga actggtatca gcagaagccc gacggcaccg 4140
tcaagctgct gatctaccac accagccggc tgcacagcgg cgtgcccagc cggtttagcg 4200
gcagcggctc cggcaccgac tacagcctga ccatctccaa cctggaacag gaagatatcg 4260
ccacctactt ttgccagcag ggcaacacac tgccctacac ctttggcggc ggaacaaagc 4320
tggaaatcac cggcagcacc tccggcagcg gcaagcctgg cagcggcgag ggcagcacca 4380
agggcgaggt gaagctgcag gaaagcggcc ctggcctggt ggcccccagc cagagcctga 4440
gcgtgacctg caccgtgagc ggcgtgagcc tgcccgacta cggcgtgagc tggatccggc 4500
agccccccag gaagggcctg gaatggctgg gcgtgatctg gggcagcgag accacctact 4560
acaacagcgc cctgaagagc cggctgacca tcatcaagga caacagcaag agccaggtgt 4620
tcctgaagat gaacagcctg cagaccgacg acaccgccat ctactactgc gccaagcact 4680
actactacgg cggcagctac gccatggact actggggcca gggcaccagc gtgaccgtga 4740
gcagcactac cccagcaccg cggccaccca ccccggctcc taccatcgcc tcccagcctc 4800
tgtccctgcg tccggaggca tgtagacccg cagctggtgg ggccgtgcat acccggggtc 4860
ttgacttcgc ctgcgatatc tacatttggg cccctctggc tggtacttgc ggggtcctgc 4920
tgctttcact cgtgatcact ctttactgta agcgcggtcg gaagaagctg ctgtacatct 4980
ttaagcaacc cttcatgagg cctgtgcaga ctactcaaga ggaggacggc tgttcatgcc 5040
ggttcccaga ggaggaggaa ggcggctgcg aactgcgcgt gaaattcagc cgcagcgcag 5100
atgctccagc ctacaagcag gggcagaacc agctctacaa cgaactcaat cttggtcgga 5160
gagaggagta cgacgtgctg gacaagcgga gaggacggga cccagaaatg ggcgggaagc 5220
cgcgcagaaa gaatccccaa gagggcctgt acaacgagct ccaaaaggat aagatggcag 5280
aagcctatag cgagattggt atgaaagggg aacgcagaag aggcaaaggc cacgacggac 5340
tgtaccaggg actcagcacc gccaccaagg acacctatga cgctcttcac atgcaggccc 5400
tgccgcctcg gtgaactagt gcggccgccg tttaaacggc cggccgcggt ctgtacaagt 5460
aggattcgtc gagggaccta ataacttcgt atagcataca ttatacgaag ttatacatgt 5520
ttaagggttc cggttccact aggtacaatt cgatatcaag cttatcgata atcaacctct 5580
ggattacaaa atttgtgaaa gattgactgg tattcttaac tatgttgctc cttttacgct 5640
atgtggatac gctgctttaa tgcctttgta tcatgctatt gcttcccgta tggctttcat 5700
tttctcctcc ttgtataaat cctggttgct gtctctttat gaggagttgt ggcccgttgt 5760
caggcaacgt ggcgtggtgt gcactgtgtt tgctgacgca acccccactg gttggggcat 5820
tgccaccacc tgtcagctcc tttccgggac tttcgctttc cccctcccta ttgccacggc 5880
ggaactcatc gccgcctgcc ttgcccgctg ctggacaggg gctcggctgt tgggcactga 5940
caattccgtg gtgttgtcgg ggaaatcatc gtcctttcct tggctgctcg cctgtgttgc 6000
cacctggatt ctgcgcggga cgtccttctg ctacgtccct tcggccctca atccagcgga 6060
ccttccttcc cgcggcctgc tgccggctct gcggcctctt ccgcgtcttc gccttcgccc 6120
tcagacgagt cggatctccc tttgggccgc ctccccgcat cgataccgtc gacctcgatc 6180
gagacctaga aaaacatgga gcaatcacaa gtagcaatac agcagctacc aatgctgatt 6240
gtgcctggct agaagcacaa gaggaggagg aggtgggttt tccagtcaca cctcatgtac 6300
ctttaagacc aatgacttac aaggcagctg tagatcttag ccacttttta aaagaaaagg 6360
ggggactgga agggctaatt cactcccaac gaagacaaga tatccttgat ctgtggatct 6420
accacacaca aggctacttc cctgattggc agaactacac accagggcca gggatcagat 6480
atccactgac ctttggatgg tgctacaagc tagtaccagt tgagcaagag aaggtagaag 6540
aagccaatga aggagagaac acccgcttgt tacaccctgt gagcctgcat gggatggatg 6600
acccggagag agaagtatta gagtggaggt ttgacagccg cctagcattt catcacatgg 6660
cccgagagct gcatccggac tgtactgggt ctctctggtt agaccagatc tgagcctggg 6720
agctctctgg ctaactaggg aacccactgc ttaagcctca ataaagcttg ccttgagtgc 6780
ttcaagtagt gtgtgcccgt ctgttgtgtg actctggtaa ctagagatcc ctcagaccct 6840
tttagtcagt gtggaaaatc tctagcagca tgtgagcaaa aggccagcaa aaggccagga 6900
accgtaaaaa ggccgcgttg ctggcgtttt tccataggct ccgcccccct gacgagcatc 6960
acaaaaatcg acgctcaagt cagaggtggc gaaacccgac aggactataa agataccagg 7020
cgtttccccc tggaagctcc ctcgtgcgct ctcctgttcc gaccctgccg cttaccggat 7080
acctgtccgc ctttctccct tcgggaagcg tggcgctttc tcatagctca cgctgtaggt 7140
atctcagttc ggtgtaggtc gttcgctcca agctgggctg tgtgcacgaa ccccccgttc 7200
agcccgaccg ctgcgcctta tccggtaact atcgtcttga gtccaacccg gtaagacacg 7260
acttatcgcc actggcagca gccactggta acaggattag cagagcgagg tatgtaggcg 7320
gtgctacaga gttcttgaag tggtggccta actacggcta cactagaaga acagtatttg 7380
gtatctgcgc tctgctgaag ccagttacct tcggaaaaag agttggtagc tcttgatccg 7440
gcaaacaaac caccgctggt agcggtggtt tttttgtttg caagcagcag attacgcgca 7500
gaaaaaaagg atctcaagaa gatcctttga tcttttctac ggggtctgac gctcagtgga 7560
acgaaaactc acgttaaggg attttggtca tgagattatc aaaaaggatc ttcacctaga 7620
tccttttaaa ttaaaaatga agttttaaat caatctaaag tatatatgag taaacttggt 7680
ctgacagcta gaaaaactca tcgagcatca aatgaaactg caatttattc atatcaggat 7740
tatcaatacc atatttttga aaaagccgtt tctgtaatga aggagaaaac tcaccgaggc 7800
agttccatag gatggcaaga tcctggtatc ggtctgcgat tccgactcgt ccaacatcaa 7860
tacaacctat taatttcccc tcgtcaaaaa taaggttatc aagtgagaaa tcaccatgag 7920
tgacgactga atccggtgag aatggcaaaa gtttatgcat ttctttccag acttgttcaa 7980
caggccagcc attacgctcg tcatcaaaat cactcgcatc aaccaaaccg ttattcattc 8040
gtgattgcgc ctgagcgaga cgaaatacgc gatcgctgtt aaaaggacaa ttacaaacag 8100
gaatcgaatg caaccggcgc aggaacactg ccagcgcatc aacaatattt tcacctgaat 8160
caggatattc ttctaatacc tggaatgctg ttttcccagg gatcgcagtg gtgagtaacc 8220
atgcatcatc aggagtacgg ataaaatgct tgatggtcgg aagaggcata aattccgtca 8280
gccagtttag tctgaccatc tcatctgtaa catcattggc aacgctacct ttgccatgtt 8340
tcagaaacaa ctctggcgca tcgggcttcc catacaatcg atagattgtc gcacctgatt 8400
gcccgacatt atcgcgagcc catttatacc catataaatc agcatccatg ttggaattta 8460
atcgcggcct agagcaagac gtttcccgtt gaatatggct cata 8504
<210> 3
<211> 622
<212> PRT
<213> Artificial sequence (Artificial sequence)
<400> 3
Met Ser Ser Ser Ser Trp Leu Leu Leu Ser Leu Val Ala Val Thr Ala
1 5 10 15
Ala Gln Ser Thr Ile Glu Glu Gln Ala Lys Thr Phe Leu Asp Lys Phe
20 25 30
Asn His Glu Ala Glu Asp Leu Phe Tyr Gln Ser Ser Leu Ala Ser Trp
35 40 45
Asn Tyr Asn Thr Asn Ile Thr Glu Glu Asn Val Gln Asn Met Asn Asn
50 55 60
Ala Gly Asp Lys Trp Ser Ala Phe Leu Lys Glu Gln Ser Thr Leu Ala
65 70 75 80
Gln Met Tyr Pro Leu Gln Glu Ile Gln Asn Leu Thr Val Lys Leu Gln
85 90 95
Leu Gln Ala Leu Gln Gln Asn Gly Ser Ser Val Leu Ser Glu Asp Lys
100 105 110
Ser Lys Arg Leu Asn Thr Ile Leu Asn Thr Met Ser Thr Ile Tyr Ser
115 120 125
Thr Gly Lys Val Cys Asn Pro Asp Asn Pro Gln Glu Cys Leu Leu Leu
130 135 140
Glu Pro Gly Leu Asn Glu Ile Met Ala Asn Ser Leu Asp Tyr Asn Glu
145 150 155 160
Arg Leu Trp Ala Trp Glu Ser Trp Arg Ser Glu Val Gly Lys Gln Leu
165 170 175
Arg Pro Leu Tyr Glu Glu Tyr Val Val Leu Lys Asn Glu Met Ala Arg
180 185 190
Ala Asn His Tyr Glu Asp Tyr Gly Asp Tyr Trp Arg Gly Asp Tyr Glu
195 200 205
Val Asn Gly Val Asp Gly Tyr Asp Tyr Ser Arg Gly Gln Leu Ile Glu
210 215 220
Asp Val Glu His Thr Phe Glu Glu Ile Lys Pro Leu Tyr Glu His Leu
225 230 235 240
His Ala Tyr Val Arg Ala Lys Leu Met Asn Ala Tyr Pro Ser Tyr Ile
245 250 255
Ser Pro Ile Gly Cys Leu Pro Ala His Leu Leu Gly Asp Met Trp Gly
260 265 270
Arg Phe Trp Thr Asn Leu Tyr Ser Leu Thr Val Pro Phe Gly Gln Lys
275 280 285
Pro Asn Ile Asp Val Thr Asp Ala Met Val Asp Gln Ala Trp Asp Ala
290 295 300
Gln Arg Ile Phe Lys Glu Ala Glu Lys Phe Phe Val Ser Val Gly Leu
305 310 315 320
Pro Asn Met Thr Gln Gly Phe Trp Glu Asn Ser Met Leu Thr Asp Pro
325 330 335
Gly Asn Val Gln Lys Ala Val Cys His Pro Thr Ala Trp Asp Leu Gly
340 345 350
Lys Gly Asp Phe Arg Ile Leu Met Cys Thr Lys Val Thr Met Asp Asp
355 360 365
Phe Leu Thr Ala His His Glu Met Gly His Ile Gln Tyr Asp Met Ala
370 375 380
Tyr Ala Ala Gln Pro Phe Leu Leu Arg Asn Gly Ala Asn Glu Gly Phe
385 390 395 400
Thr Thr Pro Ala Pro Arg Pro Pro Thr Pro Ala Pro Thr Ile Ala Ser
405 410 415
Gln Pro Leu Ser Leu Arg Pro Glu Ala Cys Arg Pro Ala Ala Gly Gly
420 425 430
Ala Val His Thr Arg Gly Leu Asp Phe Ala Cys Asp Ile Tyr Ile Trp
435 440 445
Ala Pro Leu Ala Gly Thr Cys Gly Val Leu Leu Leu Ser Leu Val Ile
450 455 460
Thr Leu Tyr Cys Lys Arg Gly Arg Lys Lys Leu Leu Tyr Ile Phe Lys
465 470 475 480
Gln Pro Phe Met Arg Pro Val Gln Thr Thr Gln Glu Glu Asp Gly Cys
485 490 495
Ser Cys Arg Phe Pro Glu Glu Glu Glu Gly Gly Cys Glu Leu Arg Val
500 505 510
Lys Phe Ser Arg Ser Ala Asp Ala Pro Ala Tyr Lys Gln Gly Gln Asn
515 520 525
Gln Leu Tyr Asn Glu Leu Asn Leu Gly Arg Arg Glu Glu Tyr Asp Val
530 535 540
Leu Asp Lys Arg Arg Gly Arg Asp Pro Glu Met Gly Gly Lys Pro Arg
545 550 555 560
Arg Lys Asn Pro Gln Glu Gly Leu Tyr Asn Glu Leu Gln Lys Asp Lys
565 570 575
Met Ala Glu Ala Tyr Ser Glu Ile Gly Met Lys Gly Glu Arg Arg Arg
580 585 590
Gly Lys Gly His Asp Gly Leu Tyr Gln Gly Leu Ser Thr Ala Thr Lys
595 600 605
Asp Thr Tyr Asp Ala Leu His Met Gln Ala Leu Pro Pro Arg
610 615 620
<210> 4
<211> 1869
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 4
atgtcaagct cttcctggct ccttctcagc cttgttgctg taactgctgc tcagtccacc 60
attgaggaac aggccaagac atttttggac aagtttaacc acgaagccga agacctgttc 120
tatcaaagtt cacttgcttc ttggaattat aacaccaata ttactgaaga gaatgtccaa 180
aacatgaata atgctgggga caaatggtct gcctttttaa aggaacagtc cacacttgcc 240
caaatgtatc cactacaaga aattcagaat ctcacagtca agcttcagct gcaggctctt 300
cagcaaaatg ggtcttcagt gctctcagaa gacaagagca aacggttgaa cacaattcta 360
aatacaatga gcaccatcta cagtactgga aaagtttgta acccagataa tccacaagaa 420
tgcttattac ttgaaccagg tttgaatgaa ataatggcaa acagtttaga ctacaatgag 480
aggctctggg cttgggaaag ctggagatct gaggtcggca agcagctgag gccattatat 540
gaagagtatg tggtcttgaa aaatgagatg gcaagagcaa atcattatga ggactatggg 600
gattattgga gaggagacta tgaagtaaat ggggtagatg gctatgacta cagccgcggc 660
cagttgattg aagatgtgga acataccttt gaagagatta aaccattata tgaacatctt 720
catgcctatg tgagggcaaa gttgatgaat gcctatcctt cctatatcag tccaattgga 780
tgcctccctg ctcatttgct tggtgatatg tggggtagat tttggacaaa tctgtactct 840
ttgacagttc cctttggaca gaaaccaaac atagatgtta ctgatgcaat ggtggaccag 900
gcctgggatg cacagagaat attcaaggag gccgagaagt tctttgtatc tgttggtctt 960
cctaatatga ctcaaggatt ctgggaaaat tccatgctaa cggacccagg aaatgttcag 1020
aaagcagtct gccatcccac agcttgggac ctggggaagg gcgacttcag gatccttatg 1080
tgcacaaagg tgacaatgga cgacttcctg acagctcatc atgagatggg gcatatccag 1140
tatgatatgg catatgctgc acaacctttt ctgctaagaa atggagctaa tgaaggattc 1200
actaccccag caccgcggcc acccaccccg gctcctacca tcgcctccca gcctctgtcc 1260
ctgcgtccgg aggcatgtag acccgcagct ggtggggccg tgcatacccg gggtcttgac 1320
ttcgcctgcg atatctacat ttgggcccct ctggctggta cttgcggggt cctgctgctt 1380
tcactcgtga tcactcttta ctgtaagcgc ggtcggaaga agctgctgta catctttaag 1440
caacccttca tgaggcctgt gcagactact caagaggagg acggctgttc atgccggttc 1500
ccagaggagg aggaaggcgg ctgcgaactg cgcgtgaaat tcagccgcag cgcagatgct 1560
ccagcctaca agcaggggca gaaccagctc tacaacgaac tcaatcttgg tcggagagag 1620
gagtacgacg tgctggacaa gcggagagga cgggacccag aaatgggcgg gaagccgcgc 1680
agaaagaatc cccaagaggg cctgtacaac gagctccaaa aggataagat ggcagaagcc 1740
tatagcgaga ttggtatgaa aggggaacgc agaagaggca aaggccacga cggactgtac 1800
cagggactca gcaccgccac caaggacacc tatgacgctc ttcacatgca ggccctgccg 1860
cctcggtga 1869
<210> 5
<211> 822
<212> PRT
<213> Artificial sequence (Artificial sequence)
<400> 5
Met Ser Ser Ser Ser Trp Leu Leu Leu Ser Leu Val Ala Val Thr Ala
1 5 10 15
Ala Gln Ser Thr Ile Glu Glu Gln Ala Lys Thr Phe Leu Asp Lys Phe
20 25 30
Asn His Glu Ala Glu Asp Leu Phe Tyr Gln Ser Ser Leu Ala Ser Trp
35 40 45
Asn Tyr Asn Thr Asn Ile Thr Glu Glu Asn Val Gln Asn Met Asn Asn
50 55 60
Ala Gly Asp Lys Trp Ser Ala Phe Leu Lys Glu Gln Ser Thr Leu Ala
65 70 75 80
Gln Met Tyr Pro Leu Gln Glu Ile Gln Asn Leu Thr Val Lys Leu Gln
85 90 95
Leu Gln Ala Leu Gln Gln Asn Gly Ser Ser Val Leu Ser Glu Asp Lys
100 105 110
Ser Lys Arg Leu Asn Thr Ile Leu Asn Thr Met Ser Thr Ile Tyr Ser
115 120 125
Thr Gly Lys Val Cys Asn Pro Asp Asn Pro Gln Glu Cys Leu Leu Leu
130 135 140
Glu Pro Gly Leu Asn Glu Ile Met Ala Asn Ser Leu Asp Tyr Asn Glu
145 150 155 160
Arg Leu Trp Ala Trp Glu Ser Trp Arg Ser Glu Val Gly Lys Gln Leu
165 170 175
Arg Pro Leu Tyr Glu Glu Tyr Val Val Leu Lys Asn Glu Met Ala Arg
180 185 190
Ala Asn His Tyr Glu Asp Tyr Gly Asp Tyr Trp Arg Gly Asp Tyr Glu
195 200 205
Val Asn Gly Val Asp Gly Tyr Asp Tyr Ser Arg Gly Gln Leu Ile Glu
210 215 220
Asp Val Glu His Thr Phe Glu Glu Ile Lys Pro Leu Tyr Glu His Leu
225 230 235 240
His Ala Tyr Val Arg Ala Lys Leu Met Asn Ala Tyr Pro Ser Tyr Ile
245 250 255
Ser Pro Ile Gly Cys Leu Pro Ala His Leu Leu Gly Asp Met Trp Gly
260 265 270
Arg Phe Trp Thr Asn Leu Tyr Ser Leu Thr Val Pro Phe Gly Gln Lys
275 280 285
Pro Asn Ile Asp Val Thr Asp Ala Met Val Asp Gln Ala Trp Asp Ala
290 295 300
Gln Arg Ile Phe Lys Glu Ala Glu Lys Phe Phe Val Ser Val Gly Leu
305 310 315 320
Pro Asn Met Thr Gln Gly Phe Trp Glu Asn Ser Met Leu Thr Asp Pro
325 330 335
Gly Asn Val Gln Lys Ala Val Cys His Pro Thr Ala Trp Asp Leu Gly
340 345 350
Lys Gly Asp Phe Arg Ile Leu Met Cys Thr Lys Val Thr Met Asp Asp
355 360 365
Phe Leu Thr Ala His His Glu Met Gly His Ile Gln Tyr Asp Met Ala
370 375 380
Tyr Ala Ala Gln Pro Phe Leu Leu Arg Asn Gly Ala Asn Glu Gly Phe
385 390 395 400
His Glu Ala Val Gly Glu Ile Met Ser Leu Ser Ala Ala Thr Pro Lys
405 410 415
His Leu Lys Ser Ile Gly Leu Leu Ser Pro Asp Phe Gln Glu Asp Asn
420 425 430
Glu Thr Glu Ile Asn Phe Leu Leu Lys Gln Ala Leu Thr Ile Val Gly
435 440 445
Thr Leu Pro Phe Thr Tyr Met Leu Glu Lys Trp Arg Trp Met Val Phe
450 455 460
Lys Gly Glu Ile Pro Lys Asp Gln Trp Met Lys Lys Trp Trp Glu Met
465 470 475 480
Lys Arg Glu Ile Val Gly Val Val Glu Pro Val Pro His Asp Glu Thr
485 490 495
Tyr Cys Asp Pro Ala Ser Leu Phe His Val Ser Asn Asp Tyr Ser Phe
500 505 510
Ile Arg Tyr Tyr Thr Arg Thr Leu Tyr Gln Phe Gln Phe Gln Glu Ala
515 520 525
Leu Cys Gln Ala Ala Lys His Glu Gly Pro Leu His Lys Cys Asp Ile
530 535 540
Ser Asn Ser Thr Glu Ala Gly Gln Lys Leu Phe Asn Met Leu Arg Leu
545 550 555 560
Gly Lys Ser Glu Pro Trp Thr Leu Ala Leu Glu Asn Val Val Gly Ala
565 570 575
Lys Asn Met Asn Val Arg Pro Leu Leu Asn Tyr Phe Glu Pro Leu Phe
580 585 590
Thr Trp Leu Lys Asp Gln Asn Lys Thr Thr Pro Ala Pro Arg Pro Pro
595 600 605
Thr Pro Ala Pro Thr Ile Ala Ser Gln Pro Leu Ser Leu Arg Pro Glu
610 615 620
Ala Cys Arg Pro Ala Ala Gly Gly Ala Val His Thr Arg Gly Leu Asp
625 630 635 640
Phe Ala Cys Asp Ile Tyr Ile Trp Ala Pro Leu Ala Gly Thr Cys Gly
645 650 655
Val Leu Leu Leu Ser Leu Val Ile Thr Leu Tyr Cys Lys Arg Gly Arg
660 665 670
Lys Lys Leu Leu Tyr Ile Phe Lys Gln Pro Phe Met Arg Pro Val Gln
675 680 685
Thr Thr Gln Glu Glu Asp Gly Cys Ser Cys Arg Phe Pro Glu Glu Glu
690 695 700
Glu Gly Gly Cys Glu Leu Arg Val Lys Phe Ser Arg Ser Ala Asp Ala
705 710 715 720
Pro Ala Tyr Lys Gln Gly Gln Asn Gln Leu Tyr Asn Glu Leu Asn Leu
725 730 735
Gly Arg Arg Glu Glu Tyr Asp Val Leu Asp Lys Arg Arg Gly Arg Asp
740 745 750
Pro Glu Met Gly Gly Lys Pro Arg Arg Lys Asn Pro Gln Glu Gly Leu
755 760 765
Tyr Asn Glu Leu Gln Lys Asp Lys Met Ala Glu Ala Tyr Ser Glu Ile
770 775 780
Gly Met Lys Gly Glu Arg Arg Arg Gly Lys Gly His Asp Gly Leu Tyr
785 790 795 800
Gln Gly Leu Ser Thr Ala Thr Lys Asp Thr Tyr Asp Ala Leu His Met
805 810 815
Gln Ala Leu Pro Pro Arg
820
<210> 6
<211> 2469
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 6
atgtcaagct cttcctggct ccttctcagc cttgttgctg taactgctgc tcagtccacc 60
attgaggaac aggccaagac atttttggac aagtttaacc acgaagccga agacctgttc 120
tatcaaagtt cacttgcttc ttggaattat aacaccaata ttactgaaga gaatgtccaa 180
aacatgaata atgctgggga caaatggtct gcctttttaa aggaacagtc cacacttgcc 240
caaatgtatc cactacaaga aattcagaat ctcacagtca agcttcagct gcaggctctt 300
cagcaaaatg ggtcttcagt gctctcagaa gacaagagca aacggttgaa cacaattcta 360
aatacaatga gcaccatcta cagtactgga aaagtttgta acccagataa tccacaagaa 420
tgcttattac ttgaaccagg tttgaatgaa ataatggcaa acagtttaga ctacaatgag 480
aggctctggg cttgggaaag ctggagatct gaggtcggca agcagctgag gccattatat 540
gaagagtatg tggtcttgaa aaatgagatg gcaagagcaa atcattatga ggactatggg 600
gattattgga gaggagacta tgaagtaaat ggggtagatg gctatgacta cagccgcggc 660
cagttgattg aagatgtgga acataccttt gaagagatta aaccattata tgaacatctt 720
catgcctatg tgagggcaaa gttgatgaat gcctatcctt cctatatcag tccaattgga 780
tgcctccctg ctcatttgct tggtgatatg tggggtagat tttggacaaa tctgtactct 840
ttgacagttc cctttggaca gaaaccaaac atagatgtta ctgatgcaat ggtggaccag 900
gcctgggatg cacagagaat attcaaggag gccgagaagt tctttgtatc tgttggtctt 960
cctaatatga ctcaaggatt ctgggaaaat tccatgctaa cggacccagg aaatgttcag 1020
aaagcagtct gccatcccac agcttgggac ctggggaagg gcgacttcag gatccttatg 1080
tgcacaaagg tgacaatgga cgacttcctg acagctcatc atgagatggg gcatatccag 1140
tatgatatgg catatgctgc acaacctttt ctgctaagaa atggagctaa tgaaggattc 1200
catgaagctg ttggggaaat catgtcactt tctgcagcca cacctaagca tttaaaatcc 1260
attggtcttc tgtcacccga ttttcaagaa gacaatgaaa cagaaataaa cttcctgctc 1320
aaacaagcac tcacgattgt tgggactctg ccatttactt acatgttaga gaagtggagg 1380
tggatggtct ttaaagggga aattcccaaa gaccagtgga tgaaaaagtg gtgggagatg 1440
aagcgagaga tagttggggt ggtggaacct gtgccccatg atgaaacata ctgtgacccc 1500
gcatctctgt tccatgtttc taatgattac tcattcattc gatattacac aaggaccctt 1560
taccaattcc agtttcaaga agcactttgt caagcagcta aacatgaagg ccctctgcac 1620
aaatgtgaca tctcaaactc tacagaagct ggacagaaac tgttcaatat gctgaggctt 1680
ggaaaatcag aaccctggac cctagcattg gaaaatgttg taggagcaaa gaacatgaat 1740
gtaaggccac tgctcaacta ctttgagccc ttatttacct ggctgaaaga ccagaacaag 1800
actaccccag caccgcggcc acccaccccg gctcctacca tcgcctccca gcctctgtcc 1860
ctgcgtccgg aggcatgtag acccgcagct ggtggggccg tgcatacccg gggtcttgac 1920
ttcgcctgcg atatctacat ttgggcccct ctggctggta cttgcggggt cctgctgctt 1980
tcactcgtga tcactcttta ctgtaagcgc ggtcggaaga agctgctgta catctttaag 2040
caacccttca tgaggcctgt gcagactact caagaggagg acggctgttc atgccggttc 2100
ccagaggagg aggaaggcgg ctgcgaactg cgcgtgaaat tcagccgcag cgcagatgct 2160
ccagcctaca agcaggggca gaaccagctc tacaacgaac tcaatcttgg tcggagagag 2220
gagtacgacg tgctggacaa gcggagagga cgggacccag aaatgggcgg gaagccgcgc 2280
agaaagaatc cccaagaggg cctgtacaac gagctccaaa aggataagat ggcagaagcc 2340
tatagcgaga ttggtatgaa aggggaacgc agaagaggca aaggccacga cggactgtac 2400
cagggactca gcaccgccac caaggacacc tatgacgctc ttcacatgca ggccctgccg 2460
cctcggtga 2469
<210> 7
<211> 8832
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 7
tggaagggct aattcactcc caaagaagac aagatatcct tgatctgtgg atctaccaca 60
cacaaggcta cttccctgat tagcagaact acacaccagg gccaggggtc agatatccac 120
tgacctttgg atggtgctac aagctagtac cagttgagcc agataaggta gaagaggcca 180
ataaaggaga gaacaccagc ttgttacacc ctgtgagcct gcatgggatg gatgacccgg 240
agagagaagt gttagagtgg aggtttgaca gccgcctagc atttcatcac gtggcccgag 300
agctgcatcc ggagtacttc aagaactgct gatatcgagc ttgctacaag ggactttccg 360
ctggggactt tccagggagg cgtggcctgg gcgggactgg ggagtggcga gccctcagat 420
cctgcatata agcagctgct ttttgcctgt actgggtctc tctggttaga ccagatctga 480
gcctgggagc tctctggcta actagggaac ccactgctta agcctcaata aagcttgcct 540
tgagtgcttc aagtagtgtg tgcccgtctg ttgtgtgact ctggtaacta gagatccctc 600
agaccctttt agtcagtgtg gaaaatctct agcagtggcg cccgaacagg gacttgaaag 660
cgaaagggaa accagaggag ctctctcgac gcaggactcg gcttgctgaa gcgcgcacgg 720
caagaggcga ggggcggcga ctggtgagta cgccaaaaat tttgactagc ggaggctaga 780
aggagagaga tgggtgcgag agcgtcagta ttaagcgggg gagaattaga tcgcgatggg 840
aaaaaattcg gttaaggcca gggggaaaga aaaaatataa attaaaacat atagtatggg 900
caagcaggga gctagaacga ttcgcagtta atcctggcct gttagaaaca tcagaaggct 960
gtagacaaat actgggacag ctacaaccat cccttcagac aggatcagaa gaacttagat 1020
cattatataa tacagtagca accctctatt gtgtgcatca aaggatagag ataaaagaca 1080
ccaaggaagc tttagacaag atagaggaag agcaaaacaa aagtaagacc accgcacagc 1140
aagcggccgg ccgctgatct tcagacctgg aggaggagat atgagggaca attggagaag 1200
tgaattatat aaatataaag tagtaaaaat tgaaccatta ggagtagcac ccaccaaggc 1260
aaagagaaga gtggtgcaga gagaaaaaag agcagtggga ataggagctt tgttccttgg 1320
gttcttggga gcagcaggaa gcactatggg cgcagcgtca atgacgctga cggtacaggc 1380
cagacaatta ttgtctggta tagtgcagca gcagaacaat ttgctgaggg ctattgaggc 1440
gcaacagcat ctgttgcaac tcacagtctg gggcatcaag cagctccagg caagaatcct 1500
ggctgtggaa agatacctaa aggatcaaca gctcctgggg atttggggtt gctctggaaa 1560
actcatttgc accactgctg tgccttggaa tgctagttgg agtaataaat ctctggaaca 1620
gatttggaat cacacgacct ggatggagtg ggacagagaa attaacaatt acacaagctt 1680
aatacactcc ttaattgaag aatcgcaaaa ccagcaagaa aagaatgaac aagaattatt 1740
ggaattagat aaatgggcaa gtttgtggaa ttggtttaac ataacaaatt ggctgtggta 1800
tataaaatta ttcataatga tagtaggagg cttggtaggt ttaagaatag tttttgctgt 1860
actttctata gtgaatagag ttaggcaggg atattcacca ttatcgtttc agacccacct 1920
cccaaccccg aggggacccg acaggcccga aggaatagaa gaagaaggtg gagagagaga 1980
cagagacaga tccattcgat tagtgaacgg atctcgacgg tatcgccttt aaaagaaaag 2040
gggggattgg ggggtacagt gcaggggaaa gaatagtaga cataatagca acagacatac 2100
aaactaaaga attacaaaaa caaattacaa aaattcaaaa ttttcgggtt tattacaggg 2160
acagcagaga tccagtttat cgataagctt gggagttccg cgttacataa cttacggtaa 2220
atggcccgcc tggctgaccg cccaacgacc cccgcccatt gacgtcaata atgacgtatg 2280
ttcccatagt aacgccaata gggactttcc attgacgtca atgggtggag tatttacggt 2340
aaactgccca cttggcagta catcaagtgt atcatatgcc aagtacgccc cctattgacg 2400
tcaatgacgg taaatggccc gcctggcatt atgcccagta catgacctta tgggactttc 2460
ctacttggca gtacatctac gtattagtca tcgctattac catggtgatg cggttttggc 2520
agtacatcaa tgggcgtgga tagcggtttg actcacgggg atttccaagt ctccacccca 2580
ttgacgtcaa tgggagtttg ttttggcacc aaaatcaacg ggactttcca aaatgtcgta 2640
acaactccgc cccattgacg caaatgggcg gtaggcgtgt acggtgggag gtctatataa 2700
gcagagctcg tttagtgaac cgtcagatcg cctggagacg ccatccacgc tgttttgacc 2760
tccatagaag acaccgactc tactagagga tcgctagcgc taccggactc agatctcgag 2820
ctcaagcttc gaattctgat ggtgagcaag ggcgaggagc tgttcaccgg ggtggtgccc 2880
atcctggtcg agctggacgg cgacgtaaac ggccacaagt tcagcgtgtc cggcgagggc 2940
gagggcgatg ccacctacgg caagctgacc ctgaagttca tctgcaccac cggcaagctg 3000
cccgtgccct ggcccaccct cgtgaccacc ctgacctacg gcgtgcagtg cttcagccgc 3060
taccccgacc acatgaagca gcacgacttc ttcaagtccg ccatgcccga aggctacgtc 3120
caggagcgca ccatcttctt caaggacgac ggcaactaca agacccgcgc cgaggtgaag 3180
ttcgagggcg acaccctggt gaaccgcatc gagctgaagg gcatcgactt caaggaggac 3240
ggcaacatcc tggggcacaa gctggagtac aactacaaca gccacaacgt ctatatcatg 3300
gccgacaagc agaagaacgg catcaaggtg aacttcaaga tccgccacaa catcgaggac 3360
ggcagcgtgc agctcgccga ccactaccag cagaacaccc ccatcggcga cggccccgtg 3420
ctgctgcccg acaaccacta cctgagcacc cagtccgccc tgagcaaaga ccccaacgag 3480
aagcgcgatc acatggtcct gctggagttc gtgaccgccg ccgggatcac tctcggcatg 3540
gacgagctgt actagacaat ggcagacctc gtctatgctt taaggcatcc gggatcccgc 3600
gactctagat aattctaccg ggtaggggag gcgcttttcc caaggcagtc tggagcatgc 3660
gctttagcag ccccgctggg cacttggcgc tacacaagtg gcctctggcc tcgcacacat 3720
tccacatcca ccggtaggcg ccaaccggct ccgttctttg gtggcccctt cgcgccacct 3780
tctactcctc ccctagtcag gaagttcccc cccgccccgc agctcgcgtc gtgcaggacg 3840
tgacaaatgg aagtagcacg tctcactagt ctcgtgcaga tggacagcac cgctgagcaa 3900
tggaagcggg taggcctttg gggcagcggc caatagcagc tttgctcctt cgctttctgg 3960
gctcagaggc tgggaagggg tgggtccggg ggcgggctca ggggcgggct caggggcggg 4020
gcgggcgccc gaaggtcctc cggaggcccg gcattctgca cgcttcaaaa gcgcacgtct 4080
gccgcgctgt tctcctcttc ctcatctccg ggcctttcga cctgcagccc aagcttacca 4140
tgaccgagta caagcccacg gtgcgcctcg ccacccgcga cgacgtcccc agggccgtac 4200
gcaccctcgc cgccgcgttc gccgactacc ccgccacgcg ccacaccgtc gatccggacc 4260
gccacatcga gcgggtcacc gagctgcaag aactcttcct cacgcgcgtc gggctcgaca 4320
tcggcaaggt gtgggtcgcg gacgacggcg ccgcggtggc ggtctggacc acgccggaga 4380
gcgtcgaagc gggggcggtg ttcgccgaga tcggcccgcg catggccgag ttgagcggtt 4440
cccggctggc cgcgcagcaa cagatggaag gcctcctggc gccgcaccgg cccaaggagc 4500
ccgcgtggtt cctggccacc gtcggcgtct cgcccgacca ccagggcaag ggtctgggca 4560
gcgccgtcgt gctccccgga gtggaggcgg ccgagcgcgc cggggtgccc gccttcctgg 4620
agacctccgc gccccgcaac ctccccttct acgagcggct cggcttcacc gtcaccgccg 4680
acgtcgaggt gcccgaagga ccgcgcacct ggtgcatgac ccgcaagccc ggtgcctgac 4740
cgcgtctgga acaatcaacc tctggattac aaaatttgtg aaagattgac tggtattctt 4800
aactatgttg ctccttttac gctatgtgga tacgctgctt taatgccttt gtatcatgct 4860
attgcttccc gtatggcttt cattttctcc tccttgtata aatcctggtt gctgtctctt 4920
tatgaggagt tgtggcccgt tgtcaggcaa cgtggcgtgg tgtgcactgt gtttgctgac 4980
gcaaccccca ctggttgggg cattgccacc acctgtcagc tcctttccgg gactttcgct 5040
ttccccctcc ctattgccac ggcggaactc atcgccgcct gccttgcccg ctgctggaca 5100
ggggctcggc tgttgggcac tgacaattcc gtggtgttgt cggggaagct gacgtccttt 5160
ccatggctgc tcgcctgtgt tgccacctgg attctgcgcg ggacgtcctt ctgctacgtc 5220
ccttcggccc tcaatccagc ggaccttcct tcccgcggcc tgctgccggc tctgcggcct 5280
cttccgcgtc ttcgccttcg ccctcagacg agtcggatct ccctttgggc cgcctccccg 5340
cctggaatta attctgcagt cgagacctag aaaaacatgg agcaatcaca agtagcaata 5400
cagcagctac caatgctgat tgtgcctggc tagaagcaca agaggaggag gaggtgggtt 5460
ttccagtcac acctcaggta cctttaagac caatgactta caaggcagct gtagatctta 5520
gccacttttt aaaagaaaag aggggactgg aagggctaat tcactcccaa cgaagacaag 5580
atatccttga tctgtggatc taccacacac aaggctactt ccctgattag cagaactaca 5640
caccagggcc aggggtcaga tatccactga cctttggatg gtgctacaag ctagtaccag 5700
ttgagccaga taaggtagaa gaggccaata aaggagagaa caccagcttg ttacaccctg 5760
tgagcctgca tgggatggat gacccggaga gagaagtgtt agagtggagg tttgacagcc 5820
gcctagcatt tcatcacgtg gcccgagagc tgcatccgga gtacttcaag aactgctgat 5880
atcgagcttg ctacaaggga ctttccgctg gggactttcc agggaggcgt ggcctgggcg 5940
ggactgggga gtggcgagcc ctcagatcct gcatataagc agctgctttt tgcctgtact 6000
gggtctctct ggttagacca gatctgagcc tgggagctct ctggctaact agggaaccca 6060
ctgcttaagc ctcaataaag cttgccttga gtgcttcaag tagtgtgtgc ccgtctgttg 6120
tgtgactctg gtaactagag atccctcaga cccttttagt cagtgtggaa aatctctagc 6180
agtagtagtt catgtcatct tattattcag tatttataac ttgcaaagaa atgaatatca 6240
gagagtgaga ggccttgaca ttgctagcgt tttaccgtcg acctctagct agagcttggc 6300
gtaatcatgg tcatagctgt ttcctgtgtg aaattgttat ccgctcacaa ttccacacaa 6360
catacgagcc ggaagcataa agtgtaaagc ctggggtgcc taatgagtga gctaactcac 6420
attaattgcg ttgcgctcac tgcccgcttt ccagtcggga aacctgtcgt gccagctgca 6480
ttaatgaatc ggccaacgcg cggggagagg cggtttgcgt attgggcgct cttccgcttc 6540
ctcgctcact gactcgctgc gctcggtcgt tcggctgcgg cgagcggtat cagctcactc 6600
aaaggcggta atacggttat ccacagaatc aggggataac gcaggaaaga acatgtgagc 6660
aaaaggccag caaaaggcca ggaaccgtaa aaaggccgcg ttgctggcgt ttttccatag 6720
gctccgcccc cctgacgagc atcacaaaaa tcgacgctca agtcagaggt ggcgaaaccc 6780
gacaggacta taaagatacc aggcgtttcc ccctggaagc tccctcgtgc gctctcctgt 6840
tccgaccctg ccgcttaccg gatacctgtc cgcctttctc ccttcgggaa gcgtggcgct 6900
ttctcatagc tcacgctgta ggtatctcag ttcggtgtag gtcgttcgct ccaagctggg 6960
ctgtgtgcac gaaccccccg ttcagcccga ccgctgcgcc ttatccggta actatcgtct 7020
tgagtccaac ccggtaagac acgacttatc gccactggca gcagccactg gtaacaggat 7080
tagcagagcg aggtatgtag gcggtgctac agagttcttg aagtggtggc ctaactacgg 7140
ctacactaga agaacagtat ttggtatctg cgctctgctg aagccagtta ccttcggaaa 7200
aagagttggt agctcttgat ccggcaaaca aaccaccgct ggtagcggtg gtttttttgt 7260
ttgcaagcag cagattacgc gcagaaaaaa aggatctcaa gaagatcctt tgatcttttc 7320
tacggggtct gacgctcagt ggaacgaaaa ctcacgttaa gggattttgg tcatgagatt 7380
atcaaaaagg atcttcacct agatcctttt aaattaaaaa tgaagtttta aatcaatcta 7440
aagtatatat gagtaaactt ggtctgacag ttaccaatgc ttaatcagtg aggcacctat 7500
ctcagcgatc tgtctatttc gttcatccat agttgcctga ctccccgtcg tgtagataac 7560
tacgatacgg gagggcttac catctggccc cagtgctgca atgataccgc gagacccacg 7620
ctcaccggct ccagatttat cagcaataaa ccagccagcc ggaagggccg agcgcagaag 7680
tggtcctgca actttatccg cctccatcca gtctattaat tgttgccggg aagctagagt 7740
aagtagttcg ccagttaata gtttgcgcaa cgttgttgcc attgctacag gcatcgtggt 7800
gtcacgctcg tcgtttggta tggcttcatt cagctccggt tcccaacgat caaggcgagt 7860
tacatgatcc cccatgttgt gcaaaaaagc ggttagctcc ttcggtcctc cgatcgttgt 7920
cagaagtaag ttggccgcag tgttatcact catggttatg gcagcactgc ataattctct 7980
tactgtcatg ccatccgtaa gatgcttttc tgtgactggt gagtactcaa ccaagtcatt 8040
ctgagaatag tgtatgcggc gaccgagttg ctcttgcccg gcgtcaatac gggataatac 8100
cgcgccacat agcagaactt taaaagtgct catcattgga aaacgttctt cggggcgaaa 8160
actctcaagg atcttaccgc tgttgagatc cagttcgatg taacccactc gtgcacccaa 8220
ctgatcttca gcatctttta ctttcaccag cgtttctggg tgagcaaaaa caggaaggca 8280
aaatgccgca aaaaagggaa taagggcgac acggaaatgt tgaatactca tactcttcct 8340
ttttcaatat tattgaagca tttatcaggg ttattgtctc atgagcggat acatatttga 8400
atgtatttag aaaaataaac aaataggggt tccgcgcaca tttccccgaa aagtgccacc 8460
tgacgtcgac ggatcgggag atcaacttgt ttattgcagc ttataatggt tacaaataaa 8520
gcaatagcat cacaaatttc acaaataaag catttttttc actgcattct agttgtggtt 8580
tgtccaaact catcaatgta tcttatcatg tctggatcaa ctggataact caagctaacc 8640
aaaatcatcc caaacttccc accccatacc ctattaccac tgccaattac ctgtggtttc 8700
atttactcta aacctgtgat tcctctgaat tattttcatt ttaaagaaat tgtatttgtt 8760
aaatatgtac tacaaactta gtagttttta aagaaattgt atttgttaaa tatgtactac 8820
aaacttagta gt 8832
<210> 8
<211> 3822
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 8
atgtttgttt ttcttgtttt attgccacta gtctctagtc agtgtgttaa tcttacaacc 60
agaactcaat taccccctgc atacactaat tctttcacac gtggtgttta ttaccctgac 120
aaagttttca gatcctcagt tttacattca actcaggact tgttcttacc tttcttttcc 180
aatgttactt ggttccatgc tatacatgtc tctgggacca atggtactaa gaggtttgat 240
aaccctgtcc taccatttaa tgatggtgtt tattttgctt ccactgagaa gtctaacata 300
ataagaggct ggatttttgg tactacttta gattcgaaga cccagtccct acttattgtt 360
aataacgcta ctaatgttgt tattaaagtc tgtgaatttc aattttgtaa tgatccattt 420
ttgggtgttt attaccacaa aaacaacaaa agttggatgg aaagtgagtt cagagtttat 480
tctagtgcga ataattgcac ttttgaatat gtctctcagc cttttcttat ggaccttgaa 540
ggaaaacagg gtaatttcaa aaatcttagg gaatttgtgt ttaagaatat tgatggttat 600
tttaaaatat attctaagca cacgcctatt aatttagtgc gtgatctccc tcagggtttt 660
tcggctttag aaccattggt agatttgcca ataggtatta acatcactag gtttcaaact 720
ttacttgctt tacatagaag ttatttgact cctggtgatt cttcttcagg ttggacagct 780
ggtgctgcag cttattatgt gggttatctt caacctagga cttttctatt aaaatataat 840
gaaaatggaa ccattacaga tgctgtagac tgtgcacttg accctctctc agaaacaaag 900
tgtacgttga aatccttcac tgtagaaaaa ggaatctatc aaacttctaa ctttagagtc 960
caaccaacag aatctattgt tagatttcct aatattacaa acttgtgccc ttttggtgaa 1020
gtttttaacg ccaccagatt tgcatctgtt tatgcttgga acaggaagag aatcagcaac 1080
tgtgttgctg attattctgt cctatataat tccgcatcat tttccacttt taagtgttat 1140
ggagtgtctc ctactaaatt aaatgatctc tgctttacta atgtctatgc agattcattt 1200
gtaattagag gtgatgaagt cagacaaatc gctccagggc aaactggaaa gattgctgat 1260
tataattata aattaccaga tgattttaca ggctgcgtta tagcttggaa ttctaacaat 1320
cttgattcta aggttggtgg taattataat tacctgtata gattgtttag gaagtctaat 1380
ctcaaacctt ttgagagaga tatttcaact gaaatctatc aggccggtag cacaccttgt 1440
aatggtgttg aaggttttaa ttgttacttt cctttacaat catatggttt ccaacccact 1500
aatggtgttg gttaccaacc atacagagta gtagtacttt cttttgaact tctacatgca 1560
ccagcaactg tttgtggacc taaaaagtct actaatttgg ttaaaaacaa atgtgtcaat 1620
ttcaacttca atggtttaac aggcacaggt gttcttactg agtctaacaa aaagtttctg 1680
cctttccaac aatttggcag agacattgct gacactactg atgctgtccg tgatccacag 1740
acacttgaga ttcttgacat tacaccatgt tcttttggtg gtgtcagtgt tataacacca 1800
ggaacaaata cttctaacca ggttgctgtt ctttatcagg atgttaactg cacagaagtc 1860
cctgttgcta ttcatgcaga tcaacttact cctacttggc gtgtttattc tacaggttct 1920
aatgtttttc aaacacgtgc aggctgttta ataggggctg aacatgtcaa caactcatat 1980
gagtgtgaca tacccattgg tgcaggtata tgcgctagtt atcagactca gactaattct 2040
cctcggcggg cacgtagtgt agctagtcaa tccatcattg cctacactat gtcacttggt 2100
gcagaaaatt cagttgctta ctctaataac tctattgcca tacccacaaa ttttactatt 2160
agtgttacca cagaaattct accagtgtct atgaccaaga catcagtaga ttgtacaatg 2220
tacatttgtg gtgattcaac tgaatgcagc aatcttttgt tgcaatatgg cagtttttgt 2280
acacaattaa accgtgcttt aactggaata gctgttgaac aagacaaaaa cacccaagaa 2340
gtttttgcac aagtcaaaca aatttacaaa acaccaccaa ttaaagattt tggtggtttt 2400
aatttttcac aaatattacc agatccatca aaaccaagca agaggtcatt tattgaagat 2460
ctacttttca acaaagtgac acttgcagat gctggcttca tcaaacaata tggtgattgc 2520
cttggtgata ttgctgctag agacctcatt tgtgcacaaa agtttaacgg ccttactgtt 2580
ttgccacctt tgctcacaga tgaaatgatt gctcaataca cttctgcact gttagcgggt 2640
acaatcactt ctggttggac ctttggtgca ggtgctgcat tacaaatacc atttgctatg 2700
caaatggctt ataggtttaa tggtattgga gttacacaga atgttctcta tgagaaccaa 2760
aaattgattg ccaaccaatt taatagtgct attggcaaaa ttcaagactc actttcttcc 2820
acagcaagtg cacttggaaa acttcaagat gtggtcaacc aaaatgcaca agctttaaac 2880
acgcttgtta aacaacttag ctccaatttt ggtgcaattt caagtgtttt aaatgatatc 2940
ctttcacgtc ttgacaaagt tgaggctgaa gtgcaaattg ataggttgat cacaggcaga 3000
cttcaaagtt tgcagacata tgtgactcaa caattaatta gagctgcaga aatcagagct 3060
tctgctaatc ttgctgctac taaaatgtca gagtgtgtac ttggacaatc aaaaagagtt 3120
gatttttgtg gaaagggcta tcatcttatg tccttccctc agtcagcacc tcatggtgta 3180
gtcttcttgc atgtgactta tgtccctgca caagaaaaga acttcacaac tgctcctgcc 3240
atttgtcatg atggaaaagc acactttcct cgtgaaggtg tctttgtttc aaatggcaca 3300
cactggtttg taacacaaag gaatttttat gaaccacaaa tcattactac agacaacaca 3360
tttgtgtctg gtaactgtga tgttgtaata ggaattgtca acaacacagt ttatgatcct 3420
ttgcaacctg aattagactc attcaaggag gagttagata aatattttaa gaatcataca 3480
tcaccagatg ttgatttagg tgacatctct ggcattaatg cttcagttgt aaacattcaa 3540
aaagaaattg accgcctcaa tgaggttgcc aagaatttaa atgaatctct catcgatctc 3600
caagaacttg gaaagtatga gcagtatata aaatggccat ggtacatttg gctaggtttt 3660
atagctggct tgattgccat agtaatggtg acaattatgc tttgctgtat gaccagttgc 3720
tgtagttgtc tcaagggctg ttgttcttgt ggatcctgct gcaaatttga tgaagacgac 3780
tctgagccag tgctcaaagg agtcaaatta cattacacat aa 3822

Claims (13)

1. A method of making a CAR-T cell, comprising: introducing a coding gene of a chimeric antigen receptor into a T cell and expressing the coding gene to obtain a CAR-T cell; the CAR-T cell externally contains ACE2 or an ACE2 fragment capable of specifically binding to SARS-CoV-2;
the chimeric antigen receptor is a protein designated nCoVS-s-CAR or nCoVS-l-CAR, the nCoVS-s-CAR is a protein whose amino acid sequence is sequence 3; the nCoVS-l-CAR is a protein with an amino acid sequence of sequence 5.
2. The method of claim 1, wherein: the coding gene is a nucleic acid molecule named ncoVS-s-CAR gene or ncoVS-l-CAR gene;
the nCoVS-s-CAR gene is a cDNA molecule or DNA molecule of which the coding sequence is a sequence 4 in a sequence table;
the nCoVS-l-CAR gene is a cDNA molecule or DNA molecule with a coding sequence of a sequence 6 in a sequence table.
3. The method according to claim 1 or 2, characterized in that: the method also comprises knocking out an alpha beta TCR gene in the T cell and/or introducing a coding gene of shRNA targeting SARS-CoV-2 into the T cell and expressing the coding gene;
further, the alpha beta TCR gene in the T cell is knocked out by introducing Cas9 and a guide nucleotide sequence targeting a T cell antigen recognition receptor (TCR) alpha chain into the T cell, and the sequence is marked as gTRAC which is 3087-3182 th of the sequence 1;
the shRNA of the targeting SARS-CoV-2 is the shRNA of the RdRp of the targeting SARS-CoV-2;
furthermore, the target segment of the shRNA is 3446-3493 of the sequence 2.
4. The method of claim 3, wherein: knocking out the alpha beta TCR gene in the T cell is realized by introducing Cas9 and an expression cassette which can enable the gTRAC to be expressed into the T cell, and the expression cassette is marked as a gTRAC expression cassette; further, the gTRAC expression cassette is a DNA fragment shown in 2838-3182 th site of a sequence 1 in a sequence table;
the introduction of the coding gene of the shRNA targeting SARS-CoV-2 into the T cell and the expression of the coding gene are realized by introducing an expression cassette of the shRNA into the T cell, and the expression cassette is marked as an shRNA expression cassette; further, the shRNA expression cassette is a DNA fragment shown in 3197-3493 th site of a sequence 2 in a sequence table.
5. A CAR-T cell prepared by the method of any one of claims 1-4.
6. Any one of the following M1-M5 products:
m1, the chimeric antigen receptor of claim 1 or 2;
m2, the gene encoding the polypeptide of claim 1 or 2;
m3, a biological material encoding a gene according to claim 1 or 2; the biological material is any one of the following C1) to C4):
c1 An expression cassette containing the encoding gene;
c2 A recombinant vector containing the expression cassette described under C1);
c3 A recombinant microorganism containing the expression cassette described in C1), or a recombinant microorganism containing the recombinant vector described in C2);
c4 A cell line containing the expression cassette described in C1) or a cell line containing the recombinant vector described in C2);
m4, a kit comprising M1, M2 or M3;
m5, a vector with the name of pLV-U6-hTRAC-M1904-none or pLV-U6-hTRAC-U6-shCoVRdRp-M1904-none or pLV-puro-EGFP-RdRp or pLV-puro-CoVS, wherein the sequence of the pLV-U6-hTRAC-M1904-none is a sequence 1 in a sequence table, the sequence of the pLV-U6-hTRAC-U6-shCoVRdR-M1904-none is a sequence 2 in the sequence table, the sequence of the pLV-puro-EGFP-RdRp is a sequence 7 in the sequence table, and the sequence of the pLV-puro-CoVS is obtained by replacing 2839 th position to 3588 th position of the sequence 7 with a sequence 8.
7. The product of claim 6, wherein: m4 the kit further comprises an alpha beta TCR gene knock-out substance and/or a SARS-CoV-2 targeting substance and/or a T cell;
the alpha beta TCR gene knockout substance consists of Cas9 and gTRAC, or consists of Cas9 and the gTRAC expression cassette;
the SARS-CoV-2 targeting substance is the shRNA or the shRNA expression box.
8. Use of a method according to any one of claims 1 to 4, or a CAR-T cell produced by a method according to any one of claims 1 to 4, or a product according to claim 6 or 7, in the manufacture of a medicament for the treatment of COVID-19.
9. Use of a method according to any one of claims 1 to 4, or a CAR-T cell prepared by a method according to any one of claims 1 to 4, or a product according to claim 6 or 7, for the manufacture of a medicament for inhibiting SARS-CoV-2 replication.
10. Use of the method of any one of claims 1-4, or CAR-T cells made using the method of any one of claims 1-4, or the product of claim 6 or 7, in the manufacture of a medicament for killing SARS-CoV-2.
11. The medicament for treating COVID-19 is characterized in that: the medicament contains the CAR-T cell of claim 5 or the product of any of M1-M4 of claim 6 or 7.
12. A medicament for inhibiting SARS-CoV-2 replication, characterized by: the medicament contains the CAR-T cell of claim 5 or the product of any of M1-M4 of claim 6 or 7.
13. The medicine for killing SARS-CoV-2 is characterized in that: the medicament contains the CAR-T cell of claim 5 or the product of any of M1-M4 of claim 6 or 7.
CN202010150227.XA 2020-03-06 2020-03-06 Preparation method and application of universal chimeric antigen receptor T cell for treating COVID-19 Active CN113355288B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN202010150227.XA CN113355288B (en) 2020-03-06 2020-03-06 Preparation method and application of universal chimeric antigen receptor T cell for treating COVID-19

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202010150227.XA CN113355288B (en) 2020-03-06 2020-03-06 Preparation method and application of universal chimeric antigen receptor T cell for treating COVID-19

Publications (2)

Publication Number Publication Date
CN113355288A CN113355288A (en) 2021-09-07
CN113355288B true CN113355288B (en) 2023-01-06

Family

ID=77523941

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202010150227.XA Active CN113355288B (en) 2020-03-06 2020-03-06 Preparation method and application of universal chimeric antigen receptor T cell for treating COVID-19

Country Status (1)

Country Link
CN (1) CN113355288B (en)

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20240058380A1 (en) * 2020-10-22 2024-02-22 Albert-Ludwigs-Universität Freiburg Corona virus-specific t cell receptor fusion constructs, vectors encoding the same, t cells comprising the same and uses thereof

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN106928326A (en) * 2015-12-31 2017-07-07 中国科学院动物研究所 A kind of coronavirus vaccine of the receptor binding domain subunit based on dimerization
CN107281210A (en) * 2016-04-11 2017-10-24 中国医学科学院药物研究所 Application of the azithromycin in anti infection of coronavirus

Family Cites Families (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US7491489B2 (en) * 2004-11-22 2009-02-17 The University Of Hong Knog Synthetic peptide targeting critical sites on the SARS-associated coronavirus spike protein responsible for viral infection and method of use thereof
EP4112070A1 (en) * 2014-04-25 2023-01-04 Dana Farber Cancer Institute, Inc. Middle east respiratory syndrome coronavirus neutralizing antibodies and methods of use thereof
WO2018081318A1 (en) * 2016-10-25 2018-05-03 The United States Of America, As Represented By The Secretary, Department Of Health And Human Services Prefusion coronavirus spike proteins and their use

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN106928326A (en) * 2015-12-31 2017-07-07 中国科学院动物研究所 A kind of coronavirus vaccine of the receptor binding domain subunit based on dimerization
CN107281210A (en) * 2016-04-11 2017-10-24 中国医学科学院药物研究所 Application of the azithromycin in anti infection of coronavirus

Non-Patent Citations (4)

* Cited by examiner, † Cited by third party
Title
2019新型冠状病毒的研究进展;刘协红 等;《实用休克杂志》;20200229;第4卷(第1期);全文 *
Neutralizing epitopes of the SARS-CoV S-protein cluster independent of repertoire, antigen structure or mAb technology;Jody D. Berry 灯;《Landes Bioscience》;20101231;第2卷(第1期);全文 *
SARS冠状病毒S蛋白的研究进展;蔡锦源 等;《国外医药抗生素分册》;20111231;第32卷(第1期);全文 *
γδT细胞抗原识别机制研究—含γδTCR CDR3δ序列嵌合抗体的构;胡洪波;《万方数据知识服务平台》;20101013;全文 *

Also Published As

Publication number Publication date
CN113355288A (en) 2021-09-07

Similar Documents

Publication Publication Date Title
KR102652494B1 (en) A two-component vector library system for rapid assembly and diversification of full-length T-cell receptor open reading frames.
CN109475619A (en) The gene therapy of neuronal waxy lipofuscinosis
KR102096592B1 (en) Novel crispr associated protein and use thereof
KR20220047623A (en) Compositions and methods for identifying modulators of cell type fate specification
CN113355296A (en) Recombinant oncolytic newcastle disease virus expressing human CCL19 and application thereof
US6544779B1 (en) Pseudo-type retroviral vectors with modifiable surface capsid proteins
RU2752858C1 (en) Integrative plasmid vector pveal2-s-rbd, providing the expression and secretion of the recombinant receptor-binding domain (rbd) of the sars-cov-2 coronavirus in mammalian cells, the recombinant cho-k1-rbd cell line strain and the recombinant sars-cov-2 rbd protein produced by the specified strain of the cell line cho-k1-rbd
CN105176936B (en) Replicate the subclone and preparation method and application of the Semliki forest virus of tolerance type
CN113355288B (en) Preparation method and application of universal chimeric antigen receptor T cell for treating COVID-19
CN112679617B (en) Mammal fusion protein display plasmid based on mesothelin anchoring, cell line and application
CN110734480B (en) Application of Escherichia coli molecular chaperone GroEL/ES in assisting synthesis of plant Rubisco
CN111171132B (en) Snakehead antibacterial peptide
CN114874332B (en) Use of modified RNF112 as a medicament for the treatment of ALS
CN110050065B (en) Early post-transfection isolation (EPIC) of cells for biologicals production
KR20200132958A (en) New EHV with UL18 and/or UL8 inactivated
CN107058390A (en) A kind of slow virus carrier, recombinant slow virus plasmid, virus and viral application
AU609183B2 (en) Antimalaria vaccines
KR102335519B1 (en) Vaccine composition for preventing or reducing clinical symptom of severe acute respiratory syndrome coronavirus 2
KR20230110271A (en) Olivetolic acid cyclase variants with improved activity for use in the production of plant cannabinoids
CN114438083A (en) sgRNA for identifying pig PERV gene and coding DNA and application thereof
CN106520837A (en) Recombinant vector and application thereof
CN111826397A (en) Method for producing recombinant target protein, overexpression vector and virus suspension
CN111867637B (en) Novel EHV insertion site UL43
CN114616239B (en) Chimeric antigen receptor and T cell expressing chimeric antigen receptor therein
CN104673832B (en) A method of assembling TALE/TALEN module

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant