KR20150057517A - Aptamers for mature white adipocytes and uses thereof - Google Patents

Abstract

The present invention relates to aptamers specifically bound to mature adipocytes and uses thereof. More specifically, aptamers having high binding affinity to 3T3-L1 mature adipocytes are selected in an aptamer library by using a FACS-based SELEX method, and it is confirmed that the selected aptamers are not bound to primary mature brown adipocytes, but to primary mature white adipocytes. Accordingly, the selected aptamers can be used for detection and quantification of mature white adipocytes, or obesity prevention and medicine screening.

Description

Nucleic acid aptamers specifically binding to mature white adipocytes and uses thereof Aptamers for mature white adipocytes and uses thereof

The present invention relates to a nucleic acid aptamer which specifically binds to mature white adipocytes and a use of the aptamer for the detection and quantification of mature white adipocytes or for the screening of therapeutic agents for obesity .

Today, many people suffer from various metabolic disorders. Obesity is one of the most controversial contemporary social problems that are the main cause of many metabolic disorders. Obesity causes type II diabetes, dyslipidemia and hypertension, and creates a risk of developing into cardiovascular diseases. Various approaches have been proposed to treat obesity, such as bariatric surgery, anti-obesity drugs (orlistat, rimonabant and sibutramine), and stem cell therapies. However, all of the existing methods have potential side effects, and the development of more effective methods for treating obesity is still required. Particularly, molecular probes specific to mature adipocyte cells are able to alleviate potential side effects, and interest is increasing.

Aptamers are widely used in the diagnosis and treatment of various diseases. An aptamer is an oligonucleic acid or peptide molecule having a tertiary structure for recognizing a target such as a protein, a chemical substance or heterogeneous cells (Famulok M et al. Chem Rev, 2007; 107: 3715-3743). The aptamer is a library pool (oligonucleic acid or peptide; 10) by the SELEX (Systemic Evolution of Ligands by EXponential Enrichment)^14-15Size starting pool). SELEX technology is in vitro (in vitro) Was developed by Dr. Larry Gold, who selected RNA ligands for T4 DNA polymerase (Tuerk C, Gold L. et al.Sciencen,1990; 249: 505-10). In the 1990s, SELEX technology was enhanced with CE-SELEX (cell SELEX capillary electrophoresis SELEX), Counter-SELEX and Toggle SELEX technology. Macugen, the first aptamer-based drug marketed by OSI Pharmaceuticals and approved by the US Food and Drug Administration (FDA), is used as an agent for the treatment of age-related macular degeneration (ADM). NeoVentures Biotechnology Inc. has also successfully commercialized the first aptamer-based diagnostic kit to detect mycotoxins. However, the aptamers used for diagnosis and treatment of obesity are not well known.

The adipose tissue that constitutes adipocytes is an important metabolic organ involved in the regulation of energy homeostasis. Obesity occurs when the body's energy balance is broken. In mammals, adipose tissue is generally classified as white adipose tissue (WAT) and brown adipose tissue (BAT) depending on function and form. White adipose tissue is used to store extra energy and contains a single lipid droplet in the cell. Brown adipose tissue is a specialized form of adipose tissue that generates heat for energy consumption as a thermodynamic organ. Brown adipose cells contain several small fat droplets. The characteristics of these adipose tissues suggest that the differentiation of white adipocytes is closely related to the development of obesity.

Accordingly, the present inventors have made efforts to discover a new aptamer and have completed the present invention by developing an aptamer having high binding affinity and specificity for mature white adipocytes.

It is an object of the present invention to provide a nucleic acid aptamer that specifically binds to mature white adipocytes.

Another object of the present invention is to provide a kit for detecting or quantifying mature white adipocytes comprising the nucleic acid aptamer of the present invention, and a method of using the same.

It is still another object of the present invention to provide a kit for screening for the prevention and treatment of obesity comprising a nucleic acid aptamer of the present invention and a method of using the same.

In order to accomplish the object of the present invention, the present invention provides a nucleic acid aptamer which specifically binds to mature white adipocytes.

The present invention also provides a composition for detecting or quantifying mature white adipocytes comprising a nucleic acid aptamer that specifically binds to mature white adipocytes.

The present invention also provides a kit for detecting or quantifying mature white adipocytes comprising a nucleic acid aptamer that specifically binds to mature white adipocytes.

The present invention also provides a kit for monitoring adipogenesis, comprising a nucleic acid aptamer that specifically binds to mature white adipocytes.

Also,

1) contacting a test sample with a nucleic acid aptamer that specifically binds to mature white adipocytes; And

2) detecting or quantifying the cell-aptamer complex obtained in step 1).

The present invention also provides a composition for screening for the prevention and treatment of obesity comprising a nucleic acid aptamer that specifically binds to mature white adipocytes.

In addition, the present invention provides a kit for screening for the prevention and treatment of obesity comprising a nucleic acid aptamer that specifically binds to mature white adipocytes.

The nucleic acid aptamer of the present invention is excellent in binding affinity and specificity to mature white adipocytes and distinguishes mature adipocytes from adipocyte precursor cells and specifically binds to mature adipocytes. And mature brown adipocytes, and specifically binds to mature white adipocytes. Therefore, the compounds can be usefully used for the detection or quantification of mature white adipocytes and for screening therapeutic agents for obesity therewith.

FIG. 1 is a schematic diagram of FACS-CELL SELEX for the isolation of an aptamer binding to mature adipocytes. FIG.
FIG. 2 shows the binding affinities of pre-adipocyte or mature adipocytes and 1, 3, 5, 9 and 11 round SELEX post-appetamer pools.
Figure 3 shows the binding affinities of differentiated mature adipocytes and an aptamer library and a 9-fold SELEX post-appamer pool;
control: control group;
Library: aptamer library and mature adipocyte mixed group; And
MA-9 round: 9 times SELEX followed by a mixture of aptamer paste and mature adipocytes.
FIG. 4A is a graph showing the binding affinity of 3T3-L1 adipose precursor cells, 3T3-L1 mature adipocytes, HEK-293, C2C12 or HeLa cells and an aptamer library and 12 times SELEX-posterior aptamer pool (MA-12 round) to be.
FIG. 4B shows the binding affinity of mature adipocytes treated with trypsin or mature adipocytes treated with EDTA, and MA-12 rounds after 12 times SELEX.
FIG. 5 is a diagram illustrating the secondary structure of the selected aptamers MA-33 (top) and MA-91 (bottom). FIG.
FIG. 6A shows the binding affinities of 3T3-L1 adipose precursor cells or 3T3-L1 mature adipocytes and an aptamer library, MA-33 and a 12-fold SELEX-posterior aptamer pool (MA-12 round).
FIG. 6B is a graph showing the binding affinity of 3T3-L1 preadipocyte or 3T3-L1 mature adipocytes and an aptamer library, MA-91 and 12-times SELEX-aptamer pool (MA-12 round) to be.
FIG. 6C shows the binding affinities of 3T3-L1 adipose precursor cells and 3T3-L1 mature adipocytes and MA-33 (stomach) or MA-91 (lower).
FIG. 6d shows the binding affinities of 3T3-L1 adipose precursor cells, 3T3-L1 mature adipocytes, HEK-293, C2C12 or HeLa cells and MA-33 and MA-91.
FIG. 6E is a diagram showing the binding affinities of tryptic-treated mature adipocytes or EDTA-treated mature adipocytes and an aptamer library, MA-33 and MA-91.
FIG. 7A is a diagram showing the binding affinities of differentiating 3T3-L1 adipose precursor cells and adeptamer library, adipo-8, MA-33, and MA-91.
7B is a diagram showing the binding affinity of mature adipocytes and an aptamer library, adipo-8, MA-33 and MA-91.
FIG. 8A is a diagram showing primary white pre-adipocytes and primary white mature-adipocytes induced differentiation. FIG.
Figure 8b shows the binding affinity of the early white adipose precursor cells and the aptamer library, MA-33 and MA-91 (above), and visualizes the binding of early white lipid precursor cells to MA-33 and MA-91 Fig.
Figure 8c shows the binding affinity of early mature white adipocytes and the aptamer library, MA-33 and MA-91 (above), visualizes the binding of early white lipid precursor cells to MA-33 and MA-91 Fig.
FIG. 9A is a diagram showing primary brown pre-adipocytes and primary brown mature-adipocytes induced differentiation. FIG.
Figure 9b shows the binding affinity of early brown follicular progenitor cells and the aptamer library, MA-33 and MA-91 (above), visualizes the binding of early brown lipid precursor cells to MA-33 and MA-91 Fig.
FIG. 9c shows the binding affinity of early maturation brown adipocytes and the aptamer library, MA-33 and MA-91 (above), visualizes the binding of early brown adipose precursor cells to MA-33 and MA-91 Fig.

Hereinafter, the present invention will be described in detail.

The present invention provides a nucleic acid aptamer that specifically binds to mature white adipocytes composed of the nucleotide sequences of SEQ ID NOS: 1 to 3.

The aptamer preferably binds to the membrane protein of mature white adipocytes but is not limited thereto.

The "nucleic acid aptamer" is a short single-stranded oligonucleotide capable of forming a three-dimensional structure capable of binding to a target substance with high affinity and specificity, and in most cases can be specifically bound to a target protein But can be efficiently used to inhibit the function of the target protein. The repeated in vitro screening process enables selection of a specific DNA molecule, aptamer, from an arbitrary DNA library. The size of the DNA library is large (10 ¹⁴ -10 ¹⁵ ) and the DNA molecule is produced by an in vitro enzyme action Because of their ease, the DNA library is superior to other biological or synthetic libraries for screening high affinity aptamers.

The aptamer is usually prepared by the SELEX method, its modification method (e.g., Ellington et al., (1990) Nature, 346, 818-822; Tuerk et al., (1990) Science, 249, 505-510. With the SELEX method, the more abundant aptamers for the target substance are enriched and sorted by increasing the number of rourou or by using competing materials. Therefore, by controlling the number of SELEXs or by changing the contention state, aptamers having different binding strengths, aptamers having different binding forms, and aptamers having the same binding ability and binding pattern but different base sequences may be obtained. In addition, the SELEX method includes an amplification process by PCR, but it is possible to perform SELEX with more diversity by applying a mutation by using manganese ion or the like in the process.

The aptamer can easily predict the secondary structure using the mfold program, and X-ray analysis or NMR analysis may be required for more accurate steric structure analysis. Based on this structural analysis and the analysis of the same conserved region appearing on several apptamer sequences, it is possible to determine which nucleotides can be substituted or deleted by a truncation study in which specific bases are substituted or deleted, New nucleotides can be predicted to some extent to be insertable. Through these studies, it is possible to develop a more stable and powerful aptamer and to find a binding motif related to the binding of the entire base sequence of the aptamer. The predicted new sequence aptamer can be chemically synthesized easily and can be confirmed by existing analytical systems whether the aptamer remains active.

In a specific embodiment of the present invention, in order to select an aptamer specifically binding to mature adipocytes, an FITC-labeled aptamer library is prepared as shown in the schematic diagram of FIG. 1, and FACS (flow cytomery ) Based SELEX, a pool of aptamers specifically binding to mature adipocytes was selected. Further, FACS and confocal microscopic imaging were performed using the selected aptamer pools and various cells. As a result, the selected aptamer pools showed 3T3-L1 adipose precursor cells, HEK-293, C2C12, (Fig. 2, Fig. 3, and Fig. 4A and Fig. 4B), but did not bind to HeLa cells, but to membrane proteins of differentiated 3T3-L1 mature adipocytes, particularly mature adipocytes.

The present inventors also found that 91 aptamers from the selected aptamer pools were cloned and showed binding affinity with mature adipocytes in the nanomolar range through nucleotide sequence analysis, secondary structure investigation, and dissociation equilibrium constant calculation Three aptamers, MA-33 (SEQ ID NO: 1), MA-64 (SEQ ID NO: 2) and MA-91 (SEQ ID NO: 3) were selected (see FIG. MA-33 and MA-91 were analyzed by FACS and confocal microscopy in order to confirm the binding affinity between the selected MA-33 and MA-91 and various cells. As a result, MA-33 and MA- , But not to HEK-293, C2C12 and HeLa cells, but to membrane proteins of differentiated 3T3-L1 mature adipocytes, particularly mature adipocytes (see Figures 6a-6e).

In addition, we performed FACS to identify binding changes and binding targets of selected aptamer and cells during adipogenic differentiation of adipogenic precursor cells. As a result, MA-33 and MA-91 were differentiated Binds to mature adipocytes and binds to other targets with adipo-8, well known as an aptamer that binds to mature adipocytes (see Figures 7a and 7b).

In order to confirm the binding of the selected aptamer to the primary adipocyte, the present inventors used representative primary adipocytes (primary white adipocyte) and primary brown adipocyte Confocal microscopy imaging demonstrated that MA-33 and MA-91 bind only to early mature white local tax (see Figures 8a-8c and Figures 9a-9c).

Therefore, the selected aptamer of the present invention binds to early mature white adipocytes but does not bind to early mature brown adipocytes. Therefore, it can be useful for the detection and quantification of mature white adipocytes, or for the prevention of obesity and screening of therapeutic agents.

The present invention also provides a composition for detecting or quantifying mature white adipocytes comprising a nucleic acid aptamer consisting of the nucleotide sequences of SEQ ID NOS: 1 to 3.

The present invention also provides a kit for detecting or quantifying mature white adipocytes comprising a nucleic acid aptamer consisting of the nucleotide sequences of SEQ ID NOS: 1 to 3.

The present invention also provides a kit for monitoring adipogenesis comprising a nucleic acid aptamer consisting of the nucleotide sequences of SEQ ID NOS: 1 to 3.

Since the selected aptamer of the present invention binds to the early mature white adipocytes but does not bind to the early mature brown adipocytes, it may be advantageously used in a kit for the detection and quantification of mature white adipocytes, a kit, or a kit for monitoring the formation of adipocytes .

In addition,

1) contacting a test sample with a nucleic acid aptamer consisting of the nucleotide sequences of SEQ ID NOS: 1 to 3; And

2) detecting or quantifying the cell-aptamer complex obtained in step 1).

The detection or quantification of the above step 2) can be carried out by enzyme immunoassay (EIA), radioimmunoassay (RIA), fluorescent immunoassay (FIA), Western blotting, immunohistochemical staining, cell sorting, enzyme- A chemiluminescent substance binding method, and a gold particle complex method. However, the present invention is not limited thereto.

The mature white adipocyte detection or quantification method including the above step is preferably used in any one selected from the group consisting of:

1) detection or quantification of mature adipocytes in adipose precursor cells and mature adipocytes; And

2) Detection or quantification of mature white adipocytes in mature white adipocytes and mature brown adipocytes.

The selected aptamer of the present invention binds to early mature white adipocytes but does not bind to early mature brown adipocytes, and thus may be useful for the detection and quantification of mature white adipocytes.

The present invention also provides a composition for screening for the prevention and treatment of obesity comprising a nucleic acid aptamer consisting of the nucleotide sequences of SEQ ID NOS: 1 to 3.

The present invention also provides a kit for screening for the prevention and treatment of obesity comprising a nucleic acid aptamer consisting of the nucleotide sequences of SEQ ID NOS: 1 to 3.

The selected aptamer of the present invention binds to early mature white adipocytes but does not bind to early mature brown adipocytes, and thus can be usefully used for the prevention and treatment of obesity.

Hereinafter, the present invention will be described in detail with reference to examples.

It should be noted, however, that the following examples are illustrative of the present invention and are not intended to limit the scope of the present invention.

< Example  1> Aptamer ( aptamer ) Manufacture of library

The primers are labeled with FITC (fluorescein isothiocyanate) and have a conserved 19 nucleotide (nt) primer hybridization sequence for PCR amplification and cloning at both ends, with a sequence of 40 random nucleotides The single strand DNA (ssDNA) library was designed as shown in Table 1 below. For PCR amplification, the FITC-labeled forward primer for PCR amplification and the reverse primer for PCR amplification described in [Table 2] below were used. For cloning of the selected DNA pool, 2] was used as a forward primer for DNA full cloning. The FITC-labeled aptamer (ssDNA) library was synthesized with reference to Integrated DNA Technologies, Inc. (Coralville, IA, USA).

The aptamer library 5'-FITC-CGCGGAAGCGTGCTGGGCC (SEQ ID NO: 4) -N40-CATAACCCAGAGGTCGAT (SEQ ID NO: 5) -3 '

primer order FITC-labeled forward primer for PCR amplification 5'-FITC-
GGGGAATTCGCGGAAGCGTGCTGGGCC (SEQ ID NO: 6) -3 ' Reverse primer for PCR amplification 5'-GGGGGGATCCATCGACCTCTGGGTTATG-3 '(SEQ ID NO: 7) Forward primer for DNA pool cloning 5'-GGGGAATTCGCGGAAGCGTGCTGGGCC-3 '(SEQ ID NO: 8)

< Example  2> in vitro in vitro ) Mature adipocytes ( mature adipocytes ) For Apps Tommer separation and concentration

<2-1> FACS  base SELEX  Method for mature adipocytes Aptamer  Separation and concentration

In the present invention, a FACS (flow cytomery) -based SELEX (FACS-CELL SELEX) method integrating the Cell SELEX technology and the FACS classification system was performed for the amtamer isolation of mature adipocytes.

Specifically, as shown in the schematic diagram of FIG. 1, FITC-labeled ssDNA library (10 ¹⁴ to 10 ¹⁶ ) obtained by the method described in <Example 1> was incubated with target cells And cultured together. The ssDNA library binding cells were then classified as FACS. The purified ssDNA for the next round was amplified by PCR using the primers described in [Table 2], and the above procedure was repeated to concentrate the aptamer. After the last round of SELEX, the aptamer candidates were cloned using the primers described in [Table 2] and identified by sequencing.

<2-2> FACS  base SELEX  Method for mature adipocytes Aptamer  Pool selection and concentration

In vitro (in vitro FACS-CELL SELEX method was performed using adipocytes as target cells in order to isolate and concentrate aptamers on mature adipocytes.

Specifically, 3T3-L1 cells, a preadipocyte derived from mouse embryonic fibroblasts, were grown in growth medium (high-glucose containing 1% antibiotic-antifungal solution and 10% glucose) DMEM) in a 5% CO ₂ , 37 ° C incubator. In order to induce adipogenic differentiation, 3T3-L1 cells to be fused were inoculated with high glucose DMEM, 10% FBS and MDI (0.5 mM 3-isobutyl-1-methylxanthine ), 1 M dexamethasone and 10 g / ml insulin) for 2 days and then cultured twice a day with differentiation medium containing high-glucose DMEM, 10% FBS and 10 g / ml insulin And cultured for 12 days while being replaced. Then, the FACS-CELL SELEX method was performed as in the above Example <2-1>. In the first SELEX, the adipose precursor cells (0 days; negative cells) or mature adipocytes (12-day cultured cells in the differentiation medium) of 3T3-L1 cells prepared in the above manner and the above <Example 1 The FITC-labeled aptamer library (10 nmol) obtained by the method described in the above-mentioned method was mixed and denatured at 95 ° C for 5 minutes and cooled in ice for 10 minutes for secondary structure formation. During this step, salmon sperm DNA dissolved in 300 μl of binding buffer solution (PBS containing 4.5 g / L glucose, 5 mM MgCl ₂ and 10% FBS) was added to the above 1 × 10 ⁶ &lt; / RTI &gt; precursor cells or mature adipocytes. The cells were then mixed with 1 mg / ml of an aptamer library (10 nmol) and bovine serum albumin (Thermo Inc., Rockford, Ill., USA) and incubated at 37 ° C for 30 minutes. The supernatant was removed and washed 5 times with 1 ml binding buffer. Subsequently, the cells bound to the aptamer library were sorted using a FACSAria cell sorter (BD Bioscience, San Jose, Calif., USA) and heated at 95 ° C for 5 minutes to extract bound DNA from the sorted cells. The extracted DNA was purified by phenol-chloroform (Sigma) extraction, Sephadex G-25 column (Sigma) and ethanol precipitation, and ssDNA pools specific for the cells were selected. Then, FITC - labeled primers. The amplified ssDNA pool was used to perform the next SELEX. The selection was performed 11 times and the negative selection was performed twice for lipid precursor cells during 3 and 8 SELEX.

<2-3> mature adipocytes and selected Aptamer  Confirmation of pool affinity

FACS was performed to confirm binding affinity between the aptamer pool and mature adipocytes selected by the method described in the above Example <2-2>.

Specifically, in order to monitor the concentration of the aptamer pool during the FACS-CELL SELEX by the method described in the above Example <2-2>, 10 pmol ssDNA pool of each time during 11 times of SELEX was added to 1 x 10 ⁶ fat cells And incubated for 7 min at 37 [deg.] C with 200 [mu] l binding buffer, followed by 5 washes with 0.4 ml binding buffer. After centrifugation, the pellet was suspended in 20 [mu] l binding buffer, and fluorescence of 10 [mu] l cells was measured using a FACS caliber flow cytometer (BD Bioscience). Specifically, fluorescence was measured using FACS after four representative rounds (3, 5, 9, and 11 times) were cultured with 1 x 10 ⁶ lipid precursor cells and mature adipocytes in this manner during 11 rounds of selection.

As a result, as shown in Fig. 2, it was confirmed that each peak shift of mature adipocytes tended to move backward from the library peak. In general, an increase in the number of SELEX con- centrations results in an increase in the fluorescence intensity for mature adipocytes and a rise in specific aptamers with binding affinity for mature adipocytes in each pool. However, it was confirmed that in the peak change of the aptamer pool relative to the mature adipocytes, the peak of 9 pools was behind the peak of 11 pools (Fig. 1A, lower). On the other hand, there was no peak change in lipid precursor cells (Fig. 1a, top). Therefore, it was confirmed that the fluorescence intensity of 9 times aptamer pool was high and the binding affinity to mature adipocytes was good (FIG. 1A).

<2-4> Specificity for mature adipocytes Aptamer  Pool selection

In order to select an aptamer pool having a high affinity for mature adipocytes, an additional FACS-CELL SELEX method using the 9-step aptamer pool having good binding affinity selected through the results of Example <2-3> Respectively.

Specifically, the differentiated 3T3-L1 cells and the aptamer library or the 9-times aptamer pool (MA-9 round) obtained by the method described in Example <2-2>3> and FACS was performed to measure SSC (side scattering, y axis) value of FITC (x axis). The SSC-A value of FACS is known to be related to the degree of adipogenic differentiation. Therefore, the cells were divided into three parts according to the SSC value (P1 <P2 <P3; degree of differentiation) in the dot plot. Then, cells of P3 region with high degree of differentiation were classified using FACS, and the combined aptamer pools were extracted and purified as in Example <2-2>, and then amplified by PCR. Three additional rounds of FACS-CELL SELEX were performed using the amplified aptamer pool to select a specific aptamer pool (MA-12 round) in mature adipocytes by a total of 12 SELEX methods.

&Lt; 2-5 > Various cells and finally selected Aptamer  Confirmation of pool bonding

FACS and confocal micoscopic imaging were performed to confirm the binding affinity between the aptamer pool and other cells specific to the mature adipocytes selected by performing the SELEX 12 times as in the above Example <2-4> Respectively.

Twelve 10 pmol aptamer pools (MA-12 round) and an aptamer library obtained by the method described in Example <2-4> as described in Example <2-3> were diluted to 1 × 10 ⁶ 3T3 -L1 lipo-precursor cells and mature adipocytes, HEK-293 cells, C2C12 cells or HeLa cells and centrifuged, the pellet was suspended in 20 mu l binding buffer, and the fluorescence of 10 mu l cells was analyzed with a FACS caliber flow cytometer BD Bioscience) (Fig. 4A, left). In addition, the remaining 10 [mu] l cells were plated on glass slides and visualized with a LSM 510 META confocal microscope (Zeiss, Thornwood, NY, USA) for aptamer FITC signals (Fig.

As a result, as shown in Fig. 4A, peak changes of 12 aptamer pools were observed only in mature 3T3-L1 adipocytes (Fig. 4A, left) compared with the peak change of the library, and mature 3T3-L1 cells Confirming that fluorescence appears only in the mature adipocytes, it was confirmed that the above-mentioned 12 times SELEX aptamer paste was remarkably specific to mature adipocytes (Fig. 4A).

<2-6> Mature adipocytes Membrane protein  Finally selected Aptamer  Confirmation of pool bonding

In order to confirm that the target of aptamer pool specific to mature adipocytes selected by performing 12 times of SELEX as described in Example <2-3> was membrane protein of mature adipocytes, FACS using trypsin- Respectively.

Specifically, 3T3-L1 mature adipocytes obtained by the method described in Example <2-2> were treated with trypsin to isolate membrane proteins or treated with 2% EDTA as a control group for 5 minutes, &Lt; / RTI > Then, 12 times aptamer pool and aptamer library obtained by the method described in Example <2-4> were incubated with 1 × 10 ⁶ cells as described in Example <2-3>, and then FACS Respectively.

As a result, as shown in Fig. 4B, when the 12 hour aptamer pool was bound to the tryptic-treated 3T3-L1 cells, no peak change was observed. However, mature 3T3-L1 adipocytes in which the membrane protein was preserved were treated with 2% EDTA It was confirmed that the peak change moves backward. Therefore, it was confirmed from the above results that the major binding partner of the 12th aptamer pool was the membrane protein of mature adipocytes (FIG. 4B).

< Example  3> finally selected Aptamer  Specific to mature adipocytes from the pool Aptamer  Screening and identification of binding affinity with mature adipocytes

<3-1> Final selection Aptamer  Specific to mature adipocytes from the pool Aptamer  Selection

Based on the data from the last 12 selected aptamer pools, aptamer candidates with high affinity to mature adipocytes within the 12th aptamer pool were selected.

Specifically, 91 aptamers were cloned into a pTOP TA V2 vector (TOPcloner ^™ TA kit, Enzynmics, Korea) from a 12-time aptamer pool obtained by the method described in Example <2-4> DH5 [alpha] cells. The clones inserted with the 91 aptamers were purified using a miniprep kit, and analyzed with a base sequence of Solgent to select the most thermodynamically stable aptamer having a predicted structure. We also examined the secondary structure of 91 aptamers using the mfold program ( http://mfold.rna.lbany.edu ). Next, as shown in the above Example <2-3>, the 91 aptamers and 3T3-L1 adipose precursor cells (negative cells) or 3T3-L1 mature adipocytes (benign cells) were cultured and then subjected to FACS The average fluorescence intensity of the tamar coated cells was measured and the average value was calculated using SigmaPlot (Jandel, San Rafael, CA, USA) by applying the following equation 1 and the equilibrium dissociation constant ( K d) Respectively.

As a result of the above sequence analysis and calculation of the dissociation equilibrium constants, MA-33, MA-64 and MA-91 among the five aptamers having high affinity to matured adipocytes, as shown in the following Table 3, ) Showed affinity with mature adipocytes. Therefore, MA-33 and MA-91, which have the highest affinity with mature adipocytes, were selected based on the dissociation constant value and the secondary structure was confirmed (FIG. 5).

Aptamer order K d (nM) MA-33 5'-GTTACCGCGGTGAAGGGTGGATGTGTCTGGACGCTATATC-3 '(SEQ ID NO: 1) 142.96 ± 3.82 MA-64 5'-AAGATGACAAATTGCTGGAGTGTCGTGGCGAGGATGTCGG-3 '(SEQ ID NO: 2) 213.56 ± 3.20 MA-91 5'-CACCGGCAGGCCAAATAACAGGCATCACACACACTGCAGG-3 '(SEQ ID NO: 3) 33.12 ± 2.89

<3-2> Screening for mature adipocytes Of app tamer  Confirmation of binding affinity

FACS was performed to confirm the binding affinities of mature adipocytes and two aptamers, MA-33 and MA-91 selected as in Example <3-1> above.

Specifically, a 400 nM aptamer library, MA-33 and 12 times aptamer pool (MA-12 round) were coated with 1 x 10 ⁶ 3T3-L1 adipose precursor cells or mature adipocytes as described in Example <2-3> After incubation together, FACS was performed (FIG. 6A) and fluorescence intensity was graphed (FIG. 6C, top).

In addition, a 400 nM aptamer library, MA-91 and 12 times aptamer pool (MA-12 round) were incubated with 1 x 10 ⁶ 3T3-L1 adipose precursor cells or mature adipocytes After incubation, FACS was performed (FIG. 6B) and fluorescence intensity was graphed (FIG. 6C, bottom).

As a result, as shown in Figs. 6A to 6C, neither MA-33 nor MA-91 showed a peak change with respect to adipocyte precursor cells, but peak shifts toward mature adipocytes were shifted backward, By significantly increasing in adipocytes, the MA-33 and MA-91 aptamers bind specifically to mature adipocytes without binding to undifferentiated adipose precursor cells, and thus the two aptamers bind to lipogenic precursor cells And mature adipocytes can be efficiently distinguished (Figs. 6A to 6C).

&Lt; 3-3 > Of app tamer  Confirmation of binding affinity

Confocal microscopy imaging was performed using HEK-293 cells, C2C12 cells and HeLa cells to confirm that the two selected aptamers, MA-33 and MA-91, were specific for other cells.

Specifically, 400 nM MA-33 and MA-91 were incubated with 1 × 10 ⁶ 3T3-L1 mature adipocytes or adipose precursor cells, C2C12 cells, HeLa cells or HEK-293 cells as in Example <2-5> After culturing, visualization was performed using a confocal microscope.

As a result, it was confirmed that MA-33 and MA-91 aptamers significantly bind to mature adipocytes only, as shown in Fig. 6D (Fig. 6D).

&Lt; 3-3 > Membrane protein  Selected Of app tamer  Confirm binding

FACS was performed to confirm that the binding partners of two selected aptamers, MA-33 and MA-91 selected as in Example <3-1> were membrane proteins of mature adipocytes.

Specifically, 400 nM aptamer library, MA-33 and MA-91 were incubated with 3T3-L1 mature fat cells treated with 1 × 10 ⁶ trypsin or mature fat treated with 2% EDTA The cells were incubated together and then subjected to FACS (Fig. 6E).

As a result, as shown in FIG. 6E, when MA-33 and MA-91 were mixed with mature adipocytes treated with 2% EDTA compared to the control and tryptic mature adipocytes, it was confirmed that the peaks were shifted to the right , And that the targets of the two selected aptamers were expressed on the surface of mature adipocytes (Fig. 6E).

< Example  4> adipogenic differentiation ( adipogenic differentiation ) Of app tamer  Confirm binding

FACS was performed to confirm the binding changes of selected aptamer and cells during lipogenesis differentiation of lipid precursor cells.

Specifically, the 3T3-L1 cells were cultured in the same manner as described in Example <2-2> above, using a 400 nM aptamer library during adipogenic differentiation, adipo-8, MA-33 and MA-91 were cultured together for 0, 2, 4, 6, 8, 10, or 12 days, and FACS was performed as in Example 2-3 (FIG. 7A).

3T3-L1 cells were cultured with an aptamer library, adipo-8, MA-33 or Ma-91 as in the case of Example <2-3>, followed by FACS (FIG.

As a result, as shown in Figs. 7A and 7B, MA-33 and MA-91 did not bind to the cells until day 4 after lipogenesis differentiation, but suddenly bound to cells on day 6, (Fig. 7A). Also, confirming that the peak shifts of MA-33 and MA-91 are similar but different from the peak change pattern of adipo-8, the binding partners of the two aptamers are similar to each other, (Fig. 7B). Thus, these results confirmed that MA-33 and MA-91 bind to adipogenic differentiated mature adipocytes and bind to adipo-8 and other targets.

< Example  5> Selected To app tamer  by Early white fat cells ( primary white adipocytes ) And early brown fat cells ( primary brown adipocyte ) Identify distinction

<5-1> Selected With app tamer Of early white adipocytes  Confirm binding

To confirm whether aptamer specifically binds to early adipocytes, early white adipocytes, which are early adipocytes, were induced to differentiate into mature white adipocytes, and FACS and confocal microscopic imaging were performed.

Specifically, white adipose precursor cells were cultured in subcutaneous areas (inguinal and epididymal fat) and in 8-week-old male ICR mice (Jackson Laboratory, Bar Harbor, ME, USA) visceral adipose ) Tissue (upper mesenteric fat). The extracted tissues were resuspended in separate buffer solution (pH 7.4, 123 mM NaCl, 5 mM KCl, 1.3 mM CaCl2, 5 mM glucose, 100 mM HEPES, 4% filtered BSA, and 1 mg / ml collagenase type II)) at 37 < 0 > C for 45 min. Non-degraded tissue was removed with a 100-μm cell strainer, and the remaining cells were centrifuged at 1300 rpm for 3 minutes to precipitate white lipid precursor cells. The precipitated white adipose precursor cells were cultured in DMEM / F12 [1: 1; DMEM / F12] containing 1% antibiotic-antifungal solution and 10% BCS. Gibco-Invitrogen]. Fused cells were treated with MDI containing DMEM / F12 containing 1 μM rosiglitazone, and after 2 days, the medium was replaced with DMEM / F12 medium containing 10 μg / ml insulin and 1 μM rosiglitazone And maintained for 20 days. The isolated white adipose precursor cells were induced with lipogenic formation by the method described in Example <2-2>, washed twice with PBS, and fixed with 10% formalin for 30 minutes at room temperature. Then, the cells were washed with sterilized water and stained with 0.3% filtered Oil-Red-O solution dissolved in 60% isopropanol (Sigma) for 30 minutes at room temperature and washed five times with sterilized water And dried. The combined oil-red-O dyes were then extracted with isopropanol and measured for a 510 nm scintillation index using a GeneQuant 1300 spectrophotometer (GE Healthcare, Sweden). The experiment was repeated three times to obtain an average (FIG. 8A).

In addition, 400 nM aptamer library, MA-33 or MA-91 and the white adipose precursor cells (FIG. 8B) or mature white adipocytes (FIG. 8C) were cultured as described in Example <2-5> Analysis and confocal microscopy imaging were performed.

As a result, as shown in FIG. 8A, it was confirmed that the induction of differentiation of white adipocytes was confirmed by confirming the fat accumulation of mature white adipocytes (FIG. 8A).

In addition, as shown in Figs. 8B and 8C, the peaks of MA-31 and MA-91 were not observed in the case of white adipose precursor cells, but in the case of mature white adipocytes, peak shifts to the right and binding to cells Confirming that the MA-33 and MA-91 aptamers bind to early mature white adipocytes but do not recognize early white adipose precursor cells (Figs. 8b and 8c).

<5-2> Selected With app tamer  Identification of early brown fat cells

In order to confirm whether aptamer specifically binds to early adipocytes, early brown adipose cells as early adipocytes were induced to differentiate into mature brown adipocytes, and FACS and confocal microscopic imaging were performed.

Specifically, the brown lipid progenitor cells were separated from the brown scarf of a mouse after birth by extracting an interscapular brown fat pad and precipitating brown lipid precursor cells as in Example <5-2>. For the differentiation of isolated brown lipid progenitor cells, fused brown lipid progenitor cells were cultured in DMEM, 20% FBS, and differentiation cocktail (0.5 mM 3-isobutyl-1-methyl xanthine, 125 μM indomethacin ), 0.5 μM dexamethasone, 20 nM insulin and 1 nM T3 (3,3 ', 5-triiodo-L-thyronine) for 2 days and then incubated with DMEM, 20% FBS, 1 nM T3 and 20 nM insulin Containing culture medium. The differentiated mature brown adipocytes were stained with Oil-Red-O by the method described in Example <5-1> to confirm fat accumulation (FIG. 9A).

In addition, the 400 nM aptamer library, MA-33 or MA-91 and the brown lipid precursor cells (FIG. 9B) or mature brown adipocytes (FIG. 9C) were cultured as described in Example <2-5> Analysis and confocal microscopy imaging were performed.

As a result, as shown in FIG. 9A, it was confirmed that the induction of differentiation of white adipocytes was confirmed by confirming the fat accumulation of mature brown adipocytes (FIG. 8A).

In addition, as shown in Figs. 9B and 9C, by confirming that neither MA-33 nor MA-91 showed a change in peak in brown adipose precursor cells and mature brown adipocytes, the aptamer did not bind brown adipocytes (Figs. 9B and 9C). Thus, the results of Example 5 demonstrate that the two selected aptamers can differentiate between white adipocytes and brown adipocytes, and in fact, the two selected aptamers specifically bind to mature white adipocytes Respectively.

<110> Korea Research Institute of Bioscience and Biotechnology <120> Aptamers for mature white adipocytes and uses thereof <130> 13p-10-42 <160> 8 <170> Kopatentin 2.0 <210> 1 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> MA-33 <400> 1 gttaccgcgg tgaagggtgg atgtgtctgg acgctatatc 40 <210> 2 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> MA-64 <400> 2 aagatgacaa attgctggag tgtcgtggcg aggatgtcgg 40 <210> 3 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> MA-91 <400> 3 caccggcagg ccaaataaca ggcatcacac acactgcagg 40 <210> 4 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> aptamer library <400> 4 cgcggaagcg tgctgggcc 19 <210> 5 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> aptamer library <400> 5 cataacccag aggtcgat 18 <210> 6 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> PCR amplifing forward primer <400> 6 ggggaattcg cggaagcgtg ctgggcc 27 <210> 7 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> PCR amplification reverse primar <400> 7 ggggggatcc atcgacctct gggttatg 28 <210> 8 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> DNA cloning forward primer <400> 8 ggggaattcg cggaagcgtg ctgggcc 27

Claims (10)

A nucleic acid aptamer that specifically binds to mature white adipocytes consisting of the nucleotide sequences of SEQ ID NOS: 1 to 3.
2. The nucleic acid aptamer of claim 1, wherein the aptamer specifically binds to mature white adipocytes.
A composition for detecting or quantifying mature white adipocytes comprising a nucleic acid aptamer consisting of the nucleotide sequences of SEQ ID NOS: 1 to 3.
A kit for detecting or quantifying mature white adipocytes comprising a nucleic acid aptamer consisting of the nucleotide sequences of SEQ ID NOS: 1 to 3.
A kit for monitoring adipogenesis, comprising a nucleic acid aptamer consisting of the nucleotide sequences of SEQ ID NOS: 1 to 3.
1) contacting a test sample with a nucleic acid aptamer consisting of the nucleotide sequences of SEQ ID NOS: 1 to 3; And
2) detecting or quantifying the cell-aptamer complex obtained in step 1).
The method according to claim 6, wherein the detection or quantification of the step 2) is performed using an enzyme immunoassay (EIA), a radioimmunoassay (RIA), a fluorescence immunoassay (FIA), Western blotting, immunohistochemical staining, ), An enzyme-substrate coloring method, a chemiluminescent substance-binding method, and a gold particle complex method. The method for detecting or quantifying mature white adipose cells according to any one of claims 1 to 5,
The method for detecting or quantifying mature white adipocytes according to claim 6, which is used for any one selected from the group consisting of:
1) detection or quantification of mature adipocytes in adipose precursor cells and mature adipocytes; And
2) Detection or quantification of mature white adipocytes in mature white adipocytes and mature brown adipocytes.
A composition for screening for the prevention and treatment of obesity comprising a nucleic acid aptamer consisting of the nucleotide sequences of SEQ ID NOS: 1 to 3.
A kit for screening for the prevention and treatment of obesity comprising a nucleic acid aptamer consisting of the nucleotide sequences of SEQ ID NOS: 1 to 3.

Images