KR101545183B1 - Aptamers for mature white adipocytes and uses thereof - Google Patents

Abstract

The present invention relates to an aptamer specifically binding to mature adipocytes and a use thereof. More specifically, the present invention relates to a method for screening 3T3-L1 mature adipocyte cells in an aptamer library using a FACS-based SELEX method, , And confirmed that the selected aptamer binds to primary mature white adipocytes but not to primary mature brown adipocytes so that the selected aptamers bind to primary mature white adipocytes, Can be usefully used for the detection and quantification of mature white adipocytes, or for the prevention and treatment of obesity.

Description

Nucleic acid aptamers specifically binding to mature white adipocytes and uses thereof {Aptamers for mature white adipocytes and uses thereof}

It relates to a nucleic acid aptamer that specifically binds to mature white adipocytes, and a use of the aptamer for detection and quantification of mature white adipocytes, or for screening for obesity prevention and treatment.

Today, many people suffer from a variety of metabolic disorders. Obesity is one of the most controversial contemporary social problems as a leading cause associated with many metabolic disorders. Obesity causes type II diabetes, dyslipidemia, and hypertension, and causes a risk of developing cardiovascular diseases. Through various studies, treatment methods related to obesity such as bariatric surgery, anti-obesity treatments (orlistat, rimonabant and sibutramine) and stem cell therapy have been proposed. However, all of the existing methods have potential side effects, and there is still a need to develop more effective methods for treating obesity. In particular, molecular probes specific for mature adipocyte cells can alleviate potential side effects, and thus, interest in this is increasing.

Aptamer is widely applied to diagnosis and treatment of various diseases. Aptamers are oligonucleotides or peptide molecules that have a tertiary structure for recognizing targets such as proteins, chemicals or heterogeneous cells (Famulok M et al., Chem Rev , 2007; 107: 3715-3743). Aptamers are separated from library pools (oligo nucleic acids or peptides; starting pools of size ^{10 14-15} ) by the SELEX (Systemic Evolution of Ligands by EXponential enrichment) method. The SELEX technology was developed by Dr. Larry Gold, which screened RNA ligands for T4 DNA polymerase in vitro (Tuerk C, Gold L. Sciencen , 1990; 249: 505-10). ). In the 1990s, SELEX technology was enhanced with cell SELEX capillary electrophoresis SELEX (CE-SELEX), Counter-SELEX and Toggle SELEX technologies. Macugen, the first aptamer-based drug sold by OSI Pharmaceuticals and approved by the US Food and Drug Administration (FDA), is being used as a treatment for age-related macular degeneration (ADM). In addition, NeoVentures Biotechnology Inc. successfully commercialized the first aptamer-based diagnostic kit to detect mycotoxin. However, the aptamer applied to the diagnosis and treatment of obesity is not yet well known.

Adipose tissue constituting adipocytes is an important metabolic organ involved in the regulation of energy homeostasis. Obesity occurs when the body's energy balance is broken. In mammals, adipose tissue is generally classified into white adipose tissue (WAT) and brown adipose tissue (BAT) according to function and shape. White adipose tissue is used to store excess energy and contains a single large lipid droplet in the cell. Brown adipose tissue is a specialized type of adipose tissue that generates heat for energy consumption as a thermodynamic organ. Brown fat cells contain several small fat droplets. It can be seen that the differentiation of white adipocytes is closely related to the development of obesity through the characteristics of these adipose tissues.

Accordingly, the present inventors have completed the present invention by developing an aptamer having high binding affinity and specificity for mature white adipocytes as a result of trying to discover a new aptamer.

An object of the present invention is to provide a nucleic acid aptamer that specifically binds to mature white adipocytes.

In addition, another object of the present invention is to provide a kit for detection or quantification of mature white adipocytes comprising the nucleic acid aptamer of the present invention, and a method of using the same.

In addition, another object of the present invention is to provide a kit for screening for prevention and treatment of obesity comprising the nucleic acid aptamer of the present invention and a method of using the same.

In order to achieve the object of the present invention, the present invention provides a nucleic acid aptamer that specifically binds to mature white adipocytes.

In addition, the present invention provides a composition for detecting or quantifying mature white adipocytes comprising a nucleic acid aptamer that specifically binds to mature white adipocytes.

In addition, the present invention provides a kit for detecting or quantifying mature white adipocytes comprising a nucleic acid aptamer that specifically binds to mature white adipocytes.

In addition, the present invention provides a kit for adipogenesis monitoring comprising a nucleic acid aptamer that specifically binds to mature white adipocytes.

In addition, the present invention

1) contacting the specimen with a nucleic acid aptamer that specifically binds to mature white adipocytes; And

2) It provides a method for detecting or quantifying mature white adipocytes comprising the step of detecting or quantifying the cell-aptamer complex obtained in step 1).

In addition, the present invention provides a composition for screening a therapeutic agent and preventing obesity comprising a nucleic acid aptamer that specifically binds to mature white adipocytes.

*In addition, the present invention provides a kit for screening for obesity prevention and treatment comprising a nucleic acid aptamer that specifically binds to mature white adipocytes.

The nucleic acid aptamer of the present invention has excellent binding affinity and specificity for mature white adipocytes, and specifically binds to mature adipocytes by distinguishing between adipocytes and mature adipocytes. Since the mature brown adipocytes are distinguished from each other and specifically bind to the mature white adipocytes, it can be usefully used for detection or quantification of mature white adipocytes, and screening for obesity treatments.

1 is a diagram showing a schematic diagram of FACS-CELL SELEX for separation of aptamers that bind to mature adipocytes.
2 is a diagram showing the binding affinity of pre-adipocytes or mature adipocytes and aptamer pools after 1, 3, 5, 9 and 11 rounds of SELEX.
3 is a diagram showing the binding affinity of differentiated mature adipocytes and aptamer library and aptamer pool after 9 times SELEX:
control: control;
Library: Aptamer library and mixed group of mature adipocytes; And
MA-9 round: Mixed group of aptamer pool and mature adipocytes after 9 times SELEX.
Figure 4a is a diagram showing the binding affinity of 3T3-L1 adipocytes, 3T3-L1 mature adipocytes, HEK-293, C2C12 or HeLa cells with an aptamer library, and an aptamer pool (MA-12 round) after 12 times SELEX to be.
FIG. 4B is a diagram showing the binding affinity of trypsin-treated mature adipocytes or EDTA-treated mature adipocytes and Abnamer library, and aptamer pool (MA-12 round) after 12 times SELEX.
Figure 5 is a diagram showing the secondary structure of the selected aptamer MA-33 (top) and MA-91 (bottom).
6A is a diagram showing the binding affinity of 3T3-L1 adipocytes or 3T3-L1 mature adipocytes with an aptamer library, MA-33, and an aptamer pool (MA-12 round) after 12 times SELEX.
Figure 6b is a diagram showing the binding affinity of 3T3-L1 pre-adipocyte or 3T3-L1 mature adipocytes and aptamer library, MA-91 and aptamer pool (MA-12 round) after 12 times SELEX to be.
6C is a diagram showing the binding affinity between 3T3-L1 adipocytes and 3T3-L1 mature adipocytes and MA-33 (top) or MA-91 (bottom).
6D is a diagram showing the binding affinity between 3T3-L1 adipocytes, 3T3-L1 mature adipocytes, HEK-293, C2C12 or HeLa cells, and MA-33 and MA-91.
6E is a diagram showing the binding affinity between trypsin-treated mature adipocytes or EDTA-treated mature adipocytes and an aptamer library, MA-33 and MA-91.
7A is a diagram showing the binding affinity of differentiated 3T3-L1 adipocytes and aptamer libraries, adipo-8, MA-33, and MA-91.
7B is a diagram showing the binding affinity of mature adipocytes and aptamer libraries, Adipo-8, MA-33, and MA-91.
8A is a diagram showing primary white pre-adipocytes and primary white mature-adipocytes induced differentiation.
Figure 8b confirms the binding affinity of the initial white adipocytes and the aptamer library, MA-33 and MA-91 (top), and visualizes the binding of the initial white adipocytes to MA-33 and MA-91 (bottom ).
Figure 8c is to confirm the binding affinity of the early mature white adipocytes and the aptamer library, MA-33 and MA-91 (top), and visualize the binding of the early white adipocytes to MA-33 and MA-91 (bottom ).
9A is a diagram showing primary brown pre-adipocytes and primary brown mature-adipocytes induced differentiation.
Figure 9b is to confirm the binding affinity of the initial brown adipose progenitor cells and the aptamer library, MA-33 and MA-91 (top), and visualize the binding of the early brown adipose progenitor cells to MA-33 and MA-91 (bottom ).
Figure 9c is to confirm the binding affinity of the early mature brown adipocytes and the aptamer library, MA-33 and MA-91 (top), and visualize the binding of the early brown adipocytes to MA-33 and MA-91 (bottom ).

Hereinafter, the present invention will be described in detail.

The present invention provides a nucleic acid aptamer that specifically binds to mature white adipocytes composed of the nucleotide sequences of SEQ ID NOs: 1 to 3.

The aptamer preferably binds to the membrane protein of mature white adipocytes, but is not limited thereto.

The "nucleic acid aptamer" is a short single-stranded oligonucleotide that can form a three-dimensional structure capable of binding to a target substance with high affinity and specificity, and in most cases, it can only specifically bind to a target protein. In addition, it can effectively inhibit its function, so it can be used to find out the function of the target protein. The repeated in vitro screening process enables the selection of specific DNA molecules, that is, aptamers, from any DNA library. The size of the DNA library is large (10 ¹⁴ -10 ¹⁵ ), and DNA molecules are generated by the action of in vitro enzymes. Because of its ease, the DNA library is superior to other biological or synthetic libraries for screening for high affinity aptamers.

The aptamer is usually the SELEX method, its improved method [eg, Ellington et al., (1990) Nature, 346, 818-822; Tuerk et al., (1990) Science, 249, 505-510]. In the SELEX method, by increasing the number of rourou or using a competing substance, the aptamer with stronger binding power to the target substance is concentrated and selected. Therefore, by controlling the number of times of SELEX or by changing the race state, aptamers having different binding strengths, aptamers having different binding forms, and aptamers having the same binding power or binding form but different nucleotide sequences may be obtained. In addition, although the SELEX method includes a step of amplification by PCR, it becomes possible to perform SELEX with a greater variety of diversity by imparting mutations in the process by using manganese ions or the like.

Aptamer can easily predict the secondary structure using the mfold program, and X-ray analysis or NMR analysis may be required for more accurate three-dimensional structure analysis. Based on this structural analysis and analysis of the conserved region appearing on multiple aptamer sequences, which nucleotide can be substituted or deleted through a truncation study in which a specific base is substituted or deleted, and where It is possible to predict to some extent whether a new nucleotide can be inserted. Through these studies, a more stable and powerful aptamer can be developed, and an important binding motif can be found out of the total nucleotide sequence of the aptamer. The aptamer of the predicted new sequence can be easily chemically synthesized, and whether or not the aptamer maintains activity can be confirmed by an existing analysis system.

In a specific embodiment of the present invention, in order to select an aptamer that specifically binds to mature adipocytes, the present inventors prepared a FITC-labeled aptamer library as shown in the schematic diagram of FIG. ) As a result of performing SELEX, a pool of aptamers specifically binding to mature adipocytes was selected. In addition, as a result of performing FACS and confocal microscopic imaging using the selected aptamer pool and various cells, the selected aptamer pool was 3T3-L1 adipocytes, HEK-293, C2C12 and It was confirmed that it did not bind to HeLa cells, but bound to the membrane proteins of differentiated 3T3-L1 mature adipocytes, in particular, mature adipocytes (see FIGS. 2, 3, and 4A and 4B).

In addition, the present inventors clone 91 aptamers from the selected aptamer pool and show binding affinity with mature adipocytes in a nanomolar range through sequencing analysis, secondary structure investigation, and dissociation equilibrium constant calculation. Three aptamers, MA-33 (SEQ ID NO: 1), MA-64 (SEQ ID NO: 2), and MA-91 (SEQ ID NO: 3) were selected (see Fig. 5). In addition, in order to confirm the binding affinity between the selected MA-33 and MA-91 and various cells, FACS and confocal microscopic imaging were performed. As a result, MA-33 and MA-91 were 3T3-L1 adipocytes. , It was confirmed that it did not bind to HEK-293, C2C12 and HeLa cells, but to the membrane proteins of differentiated 3T3-L1 mature adipocytes, especially mature adipocytes (see FIGS. 6A to 6E).

In addition, the present inventors performed FACS to confirm the binding change and binding target of the aptamer and cells selected during adipogenic differentiation of adipocytes, as a result of performing FACS, MA-33 and MA-91 are differentiated. It was confirmed that it binds to mature adipocytes and binds to other targets than adipo-8, which is well known as an aptamer that binds to mature adipocytes (see FIGS. 7A and 7B).

In addition, in order to confirm the binding of the selected aptamer and early adipocytes, the present inventors targeted FACS and targeting primary white adipocytes and primary brown adipocytes, which are representative early adipocytes. As a result of performing confocal microscopy imaging, it was confirmed that MA-33 and MA-91 bind only to the initial mature white fat tax (see FIGS. 8A to 8C, and FIGS. 9A to 9C).

Therefore, the selected aptamer of the present invention binds to early-mature white adipocytes but does not bind to early-mature brown adipocytes, so it can be usefully used for detection and quantification of mature white adipocytes, or screening for obesity prevention and treatment.

In addition, the present invention provides a composition for detecting or quantifying mature white adipocytes comprising a nucleic acid aptamer consisting of the nucleotide sequences of SEQ ID NOs: 1 to 3.

In addition, the present invention provides a kit for detecting or quantifying mature white adipocytes comprising a nucleic acid aptamer consisting of the nucleotide sequences of SEQ ID NOs: 1 to 3.

In addition, the present invention provides a kit for adipogenesis monitoring comprising a nucleic acid aptamer consisting of the nucleotide sequences of SEQ ID NOs: 1 to 3.

The selected aptamer of the present invention binds to early-mature white adipocytes but does not bind to early-mature brown adipocytes, so it is usefully used in a composition, kit for detection and quantification of mature white adipocytes, or a kit for adipocyte formation monitoring. I can.

In addition, the present invention

1) contacting the specimen with a nucleic acid aptamer consisting of the nucleotide sequences of SEQ ID NOs: 1 to 3; And

2) It provides a method for detecting or quantifying mature white adipocytes comprising the step of detecting or quantifying the cell-aptamer complex obtained in step 1).

The detection or quantification of step 2) is enzymatic immunoassay (EIA), radioimmunoassay (RIA), fluorescence immunoassay (FIA), western blotting, immunohistochemical staining, cell sorting, enzyme-substrate coloring. It is preferable to detect or quantify by any one method selected from the group consisting of a method, a chemiluminescent substance binding method, and a gold particle complex method, but is not limited thereto.

The method for detecting or quantifying mature white adipocytes comprising the above steps is preferably used in any one selected from the following group, but is not limited thereto:

1) detection or quantification of mature adipocytes in adipocytes and mature adipocytes; And

2) Detection or quantification of mature white adipocytes in mature white adipocytes and mature brown adipocytes.

The selected aptamer of the present invention binds to early-mature white adipocytes but does not bind to early-mature brown adipocytes, so it can be usefully used for detection and quantification of mature white adipocytes.

In addition, the present invention provides a composition for screening for preventing and treating obesity, comprising a nucleic acid aptamer composed of the nucleotide sequence of SEQ ID NO: 1 to 3.

In addition, the present invention provides a kit for screening for obesity prevention and treatment comprising a nucleic acid aptamer composed of the nucleotide sequences of SEQ ID NOs: 1 to 3.

The selected aptamer of the present invention binds to early-mature white adipocytes but does not bind to early-mature brown adipocytes, so it can be usefully used for screening for obesity prevention and treatment.

Hereinafter, the present invention will be described in detail by examples.

However, the following examples are merely illustrative of the present invention, and the contents of the present invention are not limited by the following examples.

<Example 1> Preparation of aptamer library

It is labeled with FITC (fluorescein isothiocyanate), has a conserved 19 nucleotide (nt) primer hybridization sequence at both ends for PCR amplification and cloning, and includes a random 40 nucleotide sequence. A single-stranded DNA (ssDNA) library was designed as shown in Table 1 below. In addition, for PCR amplification, the FITC-labeled forward primer for PCR amplification and the reverse primer for PCR amplification described in the following [Table 2] were used, and for cloning of the selected DNA pool, the following [Table 2] The forward primer for DNA full cloning described in [2] was used. The FITC-labeled aptamer (ssDNA) library was synthesized by commissioning Integrated DNA Technologies, Inc. (Coralville, IA, USA).

Aptamer library 5'-FITC-CGCGGAAGCGTGCTGGGCC (SEQ ID NO: 4)-N40-CATAACCCAGAGGTCGAT (SEQ ID NO: 5)-3'

primer order FITC-labeled forward primer for PCR amplification 5'-FITC-
GGGGAATTCGCGGAAGCGTGCTGGGCC (SEQ ID NO: 6)-3' Reverse primer for PCR amplification 5'-GGGGGGATCCATCGACCTCTGGGTTATG-3' (SEQ ID NO: 7) Forward primer for DNA full cloning 5'-GGGGAATTCGCGGAAGCGTGCTGGGCC-3' (SEQ ID NO: 8)

< Example 2> In vitro ( in vitro ) Mature fat cells adipocytes ) For aptamer separation and concentration

<2-1> FACS base SELEX For mature adipocytes using the method Aptamer Separation and concentration

In the present invention, a flow cytomery (FACS) based SELEX (FACS-CELL SELEX) method incorporating a Cell SELEX technology and a FACS sorting system was performed in order to separate amperes from mature adipocytes.

Specifically, in order to monitor the concentration of the aptamer pool during SELEX as shown in the schematic diagram of FIG. 1, the FITC-labeled ssDNA library (10 ¹⁴ ~ 10 ¹⁶ ) obtained by the method described in <Example 1> was used with target cells. Incubated together. Then, the ssDNA library-bound cells were sorted by FACS. The purified ssDNA for the next round was amplified by PCR using the primers shown in [Table 2], and the above process was repeated for concentration of the aptamer. After the last round of SELEX, the aptamer candidate was confirmed by cloning and sequencing using the primers shown in [Table 2].

<2-2> FACS base SELEX For mature adipocytes using the method Aptamer Grass sorting and concentration

In order to isolate and concentrate the aptamer for mature adipocytes in vitro , the FACS-CELL SELEX method was performed using adipocytes as target cells.

Specifically, 3T3-L1 cells, which are precipocytes derived from mouse embryonic fibroblasts, are high-glucose containing growth medium (1% antibiotic-antifungal solution and 10% graceful serum). glucose) DMEM) in 5% CO ₂ , incubated in an incubator at 37°C. In addition, in order to induce adipogenic differentiation, high-glucose DMEM, 10% FBS and MDI (0.5 mM 3-isobutyl-1-methylxanthine) were added to the fused 3T3-L1 cells. ), 1 M dexamethasone and 10 g/ml insulin) for 2 days, and then the medium once every two days with a differentiation medium containing high-glucose DMEM, 10% FBS and 10 g/ml insulin. It was cultured up to 12 days while replacing. Then, the FACS-CELL SELEX method was performed as in Example <2-1>. In the first SELEX, 3T3-L1 cells prepared by the above method were dissolved in adipocytes (day 0; negative cells) or mature adipocytes (cells cultured for 12-day in differentiation medium) and 20 µl sterile water. The FITC-labeled aptamer library (10 nmol) obtained by the method described in> was mixed, denatured at 95° C. for 5 minutes, and cooled on ice for 10 minutes to form a secondary structure. During the above step, salmon sperm DNA dissolved in 300 µl of a binding buffer solution (PBS containing 4.5 g/L glucose, 5 mM MgCl ₂ and 10% FBS) was used to inhibit non-specific binding. ⁶ Incubated with adipocytes or mature adipocytes. Then, the cells were mixed with an aptamer library (10 nmol) and bovine serum albumin (bovine serum albumin, Thermo Inc., Rockford, IL, USA) 1 mg/ml, incubated at 37° C. for 30 minutes, and then centrifuged. Separated, the supernatant was removed, and washed 5 times with 1 ml binding buffer. Thereafter, the cells bound to the aptamer library were sorted using a FACSAria cell sorter (BD Bioscience, San Jose, CA, USA) and heated at 95° C. for 5 minutes to extract the bound DNA from the sorted cells. The extracted DNA was purified by phenol-chloroform (Sigma) extraction, Sephadex G-25 column (Sigma), and ethanol precipitation to select ssDNA pools specific for the cells, and then FITC described in [Table 3]. -Amplified by PCR using the labeled primer. The amplified ssDNA pool was then used to perform SELEX. The selection was repeated 11 times, and negative selection was performed twice for adipocytes during 3 and 8 SELEX.

<2-3> mature adipocytes and selected Aptamer Check the binding affinity of the pool

In order to confirm the binding affinity between the aptamer pool and mature adipocytes selected by the method described in Example <2-2>, FACS was performed.

Specifically, in order to monitor the concentration of the aptamer pool while performing the FACS-CELL SELEX by the method described in Example <2-2>, each 10 pmol ssDNA pool was added to 1×10 ⁶ adipocytes for 11 times SELEX. Together with 200 µl binding buffer solution at 37° C. for 7 minutes, followed by washing 5 times with 0.4 ㎖ binding buffer solution. After centrifugation, the pellet was suspended in 20 µl binding buffer, and the fluorescence of 10 µl cells was measured using a FACS caliber flow cytometer (BD Bioscience). In particular, four representative pools (3, 5, 9 and 11 times) ^{were cultured with 1×10 6} adipocytes and mature adipocytes in the above method during the 11 screening, and then fluorescence was measured using FACS.

As a result, as shown in FIG. 2, it was confirmed that each peak shift for mature adipocytes showed a tendency to move backwards than the library peak. In general, as the number of SELEX cycles increases, the fluorescence intensity for mature adipocytes increases, and specific aptamers with binding affinity to mature adipocytes increase in each pool. However, in the peak change of the aptamer pool for mature adipocytes, it was confirmed that the peak of pool 9 was behind the peak of pool 11 (FIG. 1A, bottom). On the other hand, there was no peak change in the adipocytes (Fig. 1a, above). Therefore, it was confirmed through the above results that the fluorescence intensity of the aptamer pool 9 times was high and the binding affinity to mature adipocytes was good (FIG. 1A).

<2-4> Specific to mature adipocytes Aptamer Grass screening

In order to select the aptamer pool with high binding affinity to mature adipocytes, an additional FACS-CELL SELEX method using the 9-time aptamer pool with good binding affinity selected through the results of Example <2-3> Was performed.

Specifically, as shown in FIG. 3, differentiated 3T3-L1 cells obtained by the method described in Example <2-2> and an aptamer library or 9 aptamer pools (MA-9 round) were used in Example <2- Incubation as in 3> and FACS was performed to measure SSC (side scattering, y-axis) values for FITC (x-axis). It is known that the SSC-A value of FACS is related to the degree of lipotyping. Therefore, the cells were divided into three parts according to the SSC value (P1<P2<P3; degree of differentiation) in the dot plot. Then, the cells of the P3 site having a high degree of differentiation were sorted using FACS, and the bound aptamer pool was extracted and purified as in Example <2-2>, and then amplified by PCR. FACS-CELL SELEX was additionally performed 3 times using the amplified aptamer pool, and a remarkably specific aptamer pool (MA-12 round) for mature adipocytes was selected by a total of 12 SELEX methods.

<2-5> Various cells and finally selected Aptamer Check for pool binding

In order to confirm the binding affinity between the aptamer pool and other cells specific to mature adipocytes selected by performing SELEX 12 times as in Example <2-4>, FACS and confocal micorscopic imaging Was performed.

Specifically, as in Example <2-3>, 12 10 pmol aptamer pools (MA-12 rounds) and aptamer libraries obtained by the method described in Example <2-4> were 1×10 ⁶ 3T3 After incubation with L1 adipocytes and mature adipocytes, HEK-293 cells, C2C12 cells or HeLa cells and centrifugation, the pellet was suspended in 20 µl binding buffer, and the fluorescence of 10 µl cells was measured on a FACS caliber flow cytometer ( BD Bioscience) (Fig. 4a, left). In addition, the remaining 10 μl cells were dropped on a glass slide, and the FITC signal of aptamer was visualized with an LSM 510 META confocal microscope (Zeiss, Thornwood, NY, USA) (Fig. 4A, right).

As a result, as shown in Fig. 4a, the peak change of the aptamer pool 12 times compared to the peak change of the library appears only in mature 3T3-L1 adipocytes (Fig. 4a, left), and the confocal analysis also shows mature 3T3-L1 cells. By confirming that fluorescence appears only in, it was confirmed that the aptamer pool after the 12 times SELEX was remarkably specific to mature adipocytes (FIG. 4A).

<2-6> of mature adipocytes Membrane Protein Department Final screened Aptamer Check for pool binding

In order to confirm whether the target of the aptamer pool specific to mature adipocytes selected by performing SELEX 12 times as in Example <2-3> is a membrane protein of mature adipocytes, FACS was performed using trypsin-treated cells. Performed.

Specifically, 3T3-L1 mature adipocytes obtained by the method described in Example <2-2> were treated with trypsin for separating membrane proteins or 2% EDTA as a control and incubated for 5 minutes, followed by binding buffer solution Washed twice. Then, as in Example <2-3>, 12 times the aptamer pool and aptamer library obtained by the method described in Example <2-4> and the cells 1×10 ⁶ were cultivated together, and then FACS Was performed.

As a result, as shown in FIG. 4B, when the aptamer pool was bound 12 times to trypsin-treated 3T3-L1 cells, the peak change did not appear, but the membrane protein-preserved mature 3T3-L1 adipocytes were treated with 2% EDTA. In case it was confirmed that the peak change moved backward. Therefore, through the above results, it was confirmed that the major binding partner of the 12-time aptamer pool was the membrane protein of mature adipocytes (Fig. 4b).

<Example 3> determine the binding affinity and specificity of aptamer selection and mature adipocytes from the final screening aptamer pool in mature adipocytes.

<3-1> specific aptamer in mature fat cells from the final screening aptamer pools Selection

Based on the data of the final selected 12 aptamer pool, aptamer candidates showing high affinity for mature adipocytes in the 12 aptamer pool were selected.

Specifically, 91 aptamers from the 12-time aptamer pool obtained by the method described in Example <2-4> were cloned into a pTOP TA V2 vector (TOPcloner ^TM TA kit, Enzynmics, Korea), and then the vector was DH5α cells were transformed. The 91 clones into which the aptamers were inserted were purified using a miniprep kit, and then subjected to Solgent Co., Ltd. to analyze the nucleotide sequence to select the aptamer with the most thermodynamically stable predicted structure. In addition, the secondary structure of 91 aptamers was investigated using the mfold program (http://mfold.rna.lbany.edu). Then, as in Example <2-3>, after culturing with the 91 aptamers and 3T3-L1 adipocytes (negative cells) or 3T3-L1 mature adipocytes (positive cells), FACS was performed to The average fluorescence intensity of the tarmer-coated cells was measured, and the average value was calculated with SigmaPlot (Jandel, San Rafael, CA, USA) by applying the following [Equation 1], and the equilibrium dissociation constant ( K d) was calculated. Obtained.

As a result of the sequencing analysis and calculation of the dissociation equilibrium constant, among the five aptamers having high affinity for mature adipocytes, as shown in the following [Table 3], MA-33, MA-64 and MA-91 are nanomolar (nanomolar ), it was confirmed that the affinity with mature adipocytes was shown. Therefore, MA-33 and MA-91 having the highest affinity with mature adipocytes were selected based on the average dissociation constant value, and the secondary structure was confirmed (FIG. 5).

Aptamer order K d(nM) MA-33 5'-GTTACCGCGGTGAAGGGTGGATGTGTCTGGACGCTATATC-3' (SEQ ID NO: 1) 142.96±3.82 MA-64 5'-AAGATGACAAATTGCTGGAGTGTCGTGGCGAGGATGTCGG-3' (SEQ ID NO: 2) 213.56±3.20 MA-91 5'-CACCGGCAGGCCAAATAACAGGCATCACACACACTGCAGG-3' (SEQ ID NO: 3) 33.12±2.89

<3-2> Selected for mature adipocytes Aptamer Check binding affinity

In order to confirm the binding affinity between the two aptamers, MA-33 and MA-91, selected as in Example <3-1> and mature adipocytes, FACS was performed.

Specifically, as in Example <2-3>, a 400 nM aptamer library, MA-33 and 12 aptamer pools (MA-12 round) were used to ^{prepare 1×10 6} 3T3-L1 adipocytes or mature adipocytes. After culturing together, FACS was performed (FIG. 6A), and fluorescence intensity was graphed (FIG. 6C, above).

In addition, as in Example <2-3>, a 400 nM aptamer library, MA-91, and 12 rounds of aptamers (MA-12 round) were mixed with 1×10 ⁶ 3T3-L1 adipocytes or mature adipocytes. After incubation, FACS was performed (FIG. 6B), and fluorescence intensity was graphed (FIG. 6C, bottom).

As a result, as shown in Figs. 6A to 6C, neither MA-33 nor MA-91 shows a peak change for adipocytes, but the peak change for mature adipocytes moves backward, and the fluorescence intensity is also mature. By doing a marked increase in adipocytes, the MA-33 and MA-91 aptamers do not bind to undifferentiated adipocytes and specifically bind only to mature adipocytes, and thus, the two aptamers are adipocytes. And it was confirmed that it is possible to efficiently distinguish mature adipocytes (FIGS. 6A to 6C ).

<3-3> Selected for various cells Aptamer Check binding affinity

Confocal microscopy imaging was performed using HEK-293 cells, C2C12 cells and HeLa cells in order to confirm whether the two selected aptamers, MA-33 and MA-91 have specificity for other cells.

Specifically, as in Example <2-5>, 400 nM MA-33 and MA-91 were ^{mixed with 1×10 6} 3T3-L1 mature adipocytes or adipocytes, C2C12 cells, HeLa cells, or HEK-293 cells. After incubation, it was visualized using a confocal microscope.

As a result, as shown in Fig. 6d, it was confirmed that MA-33 and MA-91 aptamers significantly bind only to mature adipocytes (Fig. 6d).

<3-4> of mature adipocytes Membrane Protein Department Selected Aptamer Bonding check

In order to confirm whether the binding partners of the two aptamers, MA-33 and MA-91 selected as in Example <3-1>, were membrane proteins of mature adipocytes, FACS was performed.

Specifically, as in Example <2-3>, 400 nM aptamer library, MA-33 and MA-91 ^{treated with 1×10 6} trypsin 3T3-L1 mature adipocytes or 2% EDTA-treated mature fat After culturing the cells together, FACS was performed (Fig. 6e).

As a result, as shown in Figure 6e, when compared with the control and trypsin-treated mature adipocytes, MA-33 and MA-91 confirmed that the peak shifted to the right when mixed with 2% EDTA-treated mature adipocytes. , It was confirmed that the targets of the two selected aptamers were proteins expressed on the surface of mature adipocytes (FIG. 6E).

<Example 4> binding of the aptamer selection for lipogenesis differentiation (adipogenic differentiation) OK

FACS was performed to confirm the change in binding between the selected aptamer and cells during adipogenesis of adipocytes.

Specifically, in the method described in Example <2-2>, the 400 nM aptamer library, Adipo-8, which is well known as an Abjamer specific for mature adipocytes, was used to convert 3T3-L1 cells during adipogenesis. After culturing MA-33 and MA-91 together for 0, 2, 4, 6, 8, 10 or 12 days, FACS was performed as in Example <2-3> (FIG. 7A).

In addition, as in Example <2-3>, 3T3-L1 cells were cultured with an aptamer library, Adipo-8, MA-33, or Ma-91, and then FACS was performed (FIG. 7B).

As a result, as shown in Figs. 7A and 7B, MA-33 and MA-91 do not bind to cells until the 4th day after adipogenic differentiation, but abruptly bind to the cells on the 6th day, and the final stage of adipogenic differentiation. It was confirmed that the binding was maintained until (Fig. 7a). In addition, by confirming that the peak change of MA-33 and MA-91 is similar, but different from the peak change pattern of Adipo-8, the binding partners of the two aptamers are similar to each other, but the binding partner of Adipo-8. It was confirmed that it was significantly different from (Fig. 7b). Therefore, through the above results, it was confirmed that MA-33 and MA-91 bind to adipogenic mature adipocytes and bind to Adipo-8 and other targets.

< Example 5> Identification of primary white adipocytes and primary brown adipocytes by the selected aptamer

<5-1> Confirmation of binding of the selected aptamer and early white adipocytes

In order to confirm whether aptamer specifically binds to the initial adipocytes, the early adipocytes, which are early white adipocytes, were induced to differentiate into mature white adipocytes, and then FACS and confocal microscopic imaging were performed.

Specifically, white adipose progenitor cells are subcutaneous areas (inguinal and epididymal fat) and visceral adipose of 8-week-old male ICR mice (Jackson Laboratory, Bar Harbor, ME, USA). ) Isolated from tissue (upper mesenteric fat). The extracted tissue was a separation buffer solution (pH 7.4, 123 mM NaCl, 5 mM KCl, 1.3 mM CaCl2, 5 mM glucose, 100 mM HEPES, 4% filtered BSA, and 1 mg/ml type II collagenase). II)) at 37° C. for 45 minutes. The undigested tissue was removed with a 100-µm cell strainer, and the remaining cells were centrifuged at 1300 rpm for 3 minutes to precipitate white adipocytes. The precipitated white adipose progenitor cells were DMEM/F12[1:1] containing 1% antibacterial-antifungal solution and 10% BCS; Gibco-Invitrogen]. The fused cells were treated with MDI containing DMEM/F12 containing 1 μM rosiglitazone, and after 2 days, the medium was changed every two days with DMEM/F12 medium containing 10 μM/ml insulin and 1 μM rosiglitazone. And maintained for 20 days. The isolated white adipose progenitor cells were subjected to lipotyping by the method described in Example <2-2>, washed twice with PBS, and fixed at room temperature for 30 minutes with 10% formalin. Then, after washing with sterile water, dyed with a 0.3% filtered Oil-Red-O solution dissolved in 60% isopropanol (Sigma) at room temperature for 30 minutes, and washed 5 times with sterile water. It was dry. Then, isopropphenol was added to extract the bound Oil-Red-O dye, and the 510 nm flaw intensity was measured using a GeneQuant 1300 spectrophotometer (GE HealthCare, Sweden). The experiment was repeated three times to obtain an average (FIG. 8A).

In addition, as in Example <2-5>, after culturing the 400 nM aptamer library, MA-33 or MA-91 and the white adipocytes (Fig. 8b) or mature white adipocytes (Fig. 8c), FACS Analysis and confocal microscopy imaging were performed.

As a result, as shown in FIG. 8A, by confirming the accumulation of fat in mature white adipocytes, it was confirmed that the differentiation of white adipocytes was well induced (FIG. 8A ).

In addition, as shown in Figs. 8b and 8c, in the case of white adipocytes, the peak changes of MA-31 and MA-91 do not appear, but in the case of mature white adipocytes, the peak change shifts to the right, and binding with the cells. By confirming, it was confirmed that the MA-33 and MA-91 aptamers bind to early mature white adipocytes, but do not recognize early white adipocytes (FIGS. 8B and 8C).

<5-2> Confirmation of binding of the selected aptamer and early brown fat cells

In order to confirm whether aptamer specifically binds to the initial adipocytes, the early adipocytes, which are early brown adipocytes, were induced to differentiate into mature brown adipocytes, and then FACS and confocal microscopic imaging were performed.

Specifically, brown adipose progenitor cells were separated by extracting an interscapular brown fat pad between the scapula of a mouse one day after birth, and precipitating brown adipocytes as in Example <5-2>. For the differentiation of the isolated brown adipocytes, the fused brown adipocytes were mixed with high concentration-glucose DMEM, 20% FBS, and a differentiation cocktail (0.5 mM 3-isobutyl-1-methylxanthine, 125 μM indomethacin). ), 0.5 μM dexamethasone, 20 nM insulin and 1 nM T3 (3,3',5-triiodo-L-thyronine)) for 2 days, followed by DMEM, 20% FBS, 1 nM T3 and 20 nM insulin. It was cultured with a maintenance medium containing. The differentiated mature brown adipocytes were subjected to Oil-Red-O staining by the method described in Example <5-1> to confirm fat accumulation (FIG. 9A).

In addition, as in Example <2-5>, after culturing the 400 nM aptamer library, MA-33 or MA-91 and the brown adipose progenitor cells (Fig. 9b) or mature brown adipocytes (Fig. 9c), FACS Analysis and confocal microscopy imaging were performed.

As a result, as shown in Fig. 9A, by confirming the accumulation of fat in mature brown adipocytes, it was confirmed that the differentiation of white adipocytes was well induced (FIG. 8A).

In addition, as shown in FIGS. 9B and 9C, it was confirmed that both MA-33 and MA-91 had no peak changes in brown adipocytes and mature brown adipocytes, indicating that the aptamer did not bind to brown adipocytes. It was confirmed (Figs. 9b and 9c). Therefore, through the results of <Example 5>, the two selected aptamers can distinguish white adipocytes and brown adipocytes, and substantially, the two selected aptamers specifically bind to mature white adipocytes. Confirmed that.

<110> Korea Research Institute of Bioscience and Biotechnology <120> Aptamers for mature white adipocytes and uses thereof <130> 13p-10-42 <160> 8 <170> KopatentIn 2.0 <210> 1 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> MA-33 <400> 1 gttaccgcgg tgaagggtgg atgtgtctgg acgctatatc 40 <210> 2 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> MA-64 <400> 2 aagatgacaa attgctggag tgtcgtggcg aggatgtcgg 40 <210> 3 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> MA-91 <400> 3 caccggcagg ccaaataaca ggcatcacac acactgcagg 40 <210> 4 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> aptamer library <400> 4 cgcggaagcg tgctgggcc 19 <210> 5 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> aptamer library <400> 5 cataacccag aggtcgat 18 <210> 6 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> PCR amplifing forward primer <400> 6 ggggaattcg cggaagcgtg ctgggcc 27 <210> 7 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> PCR amplifing reverse primar <400> 7 ggggggatcc atcgacctct gggttatg 28 <210> 8 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> DNA cloning forward primer <400> 8 ggggaattcg cggaagcgtg ctgggcc 27

Claims (10)

A nucleic acid aptamer that specifically binds to mature white adipocytes consisting of the nucleotide sequence of SEQ ID NO: 1.
2. The nucleic acid aptamer of claim 1, wherein the aptamer specifically binds to mature white adipocytes.
1. A composition for detecting or quantifying mature white adipocytes comprising a nucleic acid aptamer consisting of the nucleotide sequence of SEQ ID NO: 1.
A kit for detecting or quantifying mature white adipocytes comprising a nucleic acid aptamer consisting of the nucleotide sequence of SEQ ID NO: 1.
A kit for monitoring adipogenesis, comprising a nucleic acid aptamer consisting of the nucleotide sequence of SEQ ID NO: 1.
1) contacting a test sample with a nucleic acid aptamer consisting of the nucleotide sequence of SEQ ID NO: 1; And
2) detecting or quantifying the nucleic acid aptamer and a mature white adipocyte complex in a sample of mature white adipocytes.
The method according to claim 6, wherein the detection or quantification of the step 2) is performed using an enzyme immunoassay (EIA), a radioimmunoassay (RIA), a fluorescence immunoassay (FIA), Western blotting, immunohistochemical staining, ), An enzyme-substrate coloring method, a chemiluminescent substance-binding method, and a gold particle complex method. The method for detecting or quantifying mature white adipose cells according to any one of claims 1 to 5,
The method for detecting or quantifying mature white adipocytes according to claim 6, which is used for any one selected from the group consisting of:
1) detection or quantification of mature adipocytes in adipose precursor cells and mature adipocytes; And
2) Detection or quantification of mature white adipocytes in mature white adipocytes and mature brown adipocytes.
1. A composition for screening for the prevention and treatment of obesity comprising a nucleic acid aptamer consisting of the nucleotide sequence of SEQ ID NO: 1.
A kit for screening for the prevention and treatment of obesity comprising a nucleic acid aptamer consisting of the nucleotide sequence of SEQ ID NO: 1.

Images