KR20150054302A - Method to transform bovine lactoferrin to Chlorella by electroporation - Google Patents

Abstract

The present invention relates to a method for expressing the cow-derived lactoferrin proteins by using microalgae chlorella. More precisely, the present invention builds recombinant lactoferrin expression vectors by inserting the lactoferrin genes optimized with the codons appropriate for the chlorella to pCAMBIA1304. The expression vectors prepared by using the method are transformed through an electroporation process using the chlorella to express the lactoferrin proteins. According to the present invention, the recombinant lactoferrin production is increased when the chlorella included in the recombinant lactoferrin expression system is mass-produced to use the recombinant lactoferrin proteins as a substitute of the antibiotics for animals.

Description

[0001] The present invention relates to a method for transforming a cow lactoferrin gene into chlorella by electroporation,

The present invention relates to a method for transforming a recombinant lactoferrin derived from a cow, which is a microalgae, into a recombinant lactoferrin derived from a cow, by transforming the lactoferrin gene of a cow into a chlorella with an appropriate codon-optimized lactoferrin gene for chlorella nucleotide by electrophoresis, Is expressed.

Lactoferrin is a type of transferrin, a protein that binds iron, and is mainly found in milk, milk, blood, saliva, tears, mucus secretions, and the like. The first lactoferrin was purified from bovine milk, and soon it was separated and purified in the milk of several mammals. When lactoferrin was first discovered, it was called 'red protein' in the sense that it was a reddish protein. This red color appears as a result of binding of lactoferrin to iron. The lactoferrin that is not bound to iron ion is colorless, and the property of lactoferrin bound to iron is a very important characteristic in the function of this protein in vivo. Lactoferrin derived from a cow is a glycoprotein with a molecular weight of about 70,000. It has two leaf-like lobes like ginkgo bilob, slightly overlapping each other, and each lobe has one binding site that binds with iron. Therefore, one molecule of lactoferrin is bound to two iron ions. The binding of lactoferrin to iron ion is about 260 times stronger than that of transferrin, and this property of lactoferrin has an essential function in capturing iron rather than the transport of iron.

 It has been reported that lactoferrin is an antimicrobial activity that is representative of the biological activity of lactoferrin, and it is reported to be effective in various aspects such as antiviral action, anti-cancer activity, anti-inflammatory action (YK Rye and WS Kim. Dairy Sci. Technol., Vol. 27 (1), pp. 19-28). Lactoferrin, which has such a good function, has a high content in lactose, and is most abundant in colostrum, which is a yellowish and diluted milk which is secreted for a few days after labor. It is contained in human colostrum 6 to 8 mg / The breast milk contains about 2mg / l. Colostrum of milk contains 1.2mg / ℓ and 0.1 ~ 0.2mg / ℓ in general milk. Currently, lactoferrin is purified from milk and used.

 Because of the very low production of this multifunctional lactoferrin, research and development has been conducted to produce recombinant proteins of this protein. There is a method of expressing human lactoferrin by recombinant lactoferrin from a mammal (Korean Patent Publication No. 0192718) and a method of expressing human lactoferrin using insect cells (Korean Patent Publication No. 0331981), but the cost for producing recombinant lactoferrin It is not economical because it is high. Microorganisms have also been used to express recombinant lactoferrin. (Korean Patent Publication No. 0543462) using a prokaryotic Bacillus strain (Korean Patent Publication No. 0543462), a method for producing a recombinant human lactoferrin using a fungus aspergillus as a eukaryotic organism (Korean Patent Publication No. 0383436) and a human lactoferrin production using a yeast strain (Korean Patent Publication No. 0468593). Plants were also utilized to express recombinant lactoferrin. A method for mass production of human lactoferrin in plant cell culture (Korean Patent Publication No. 0551713), and a method for producing human lactoferrin using rice (U.S. Patent No. 7,276,646).

Currently, lactoferrin is lactoferrin purified from milk rather than recombinant lactoferrin. First, lactoferrin is used for a variety of applications, but because the production is too small, various methods have been tried to increase the production of lactoferrin.

KR 0129159 A1

     Most of the commercial commercially available recombinant proteins are produced using bioreactors designed for the cultivation of bacteria, yeast or animal cells. Protein expression systems by bacteria are lacking in transcriptional or post-translational coordination processes such as splicing, glycation, and protein assembly. In addition, there is a high possibility that bacterial endotoxin and protease and other impurities are mixed. Eukaryotic expression system by yeast does not faithfully realize glycosylation process. Currently, most of the medical proteins are produced through animal cell cultivation, but mass production is not easy, the medium is expensive, is easily contaminated, and the expression amount is low and the production cost is high. Transgenic animals cost up to $ 500,000 per production, require labor-intensive management, and require a long time to mass-produce.

      Transgenic plants are an expression system with relatively many advantages for the mass production of proteins with stability and functionality. For commercialization of vaccines, antibodies, enzymes, hormones, and medical proteins, the expression level should be at least 5% of the total amount of water-soluble proteins in the cell, generally in the range of 0.001 to 46.1%. In general, the major human pathogens, except for some toxic bacteria and fungi, such as Pseudomonas aeruginosa, do not host the plant. Plant viruses do not infect humans or animals, and animal viruses are known to not work on plants. Environmental pollution caused by genetically modified plants There are also problems such as an enzyme reaction on plant components, contamination of proteins, regulation of permission of pharmaceutical proteins.

 Eukaryotic microalgae, which have been developed and studied for over a decade or more, can be an alternative expression system to solve the problems of other strains. Recently, studies on the production of antibodies, insecticides and vaccines by microalgae have been conducted. Microalgae are subject to genetic manipulation for increased productivity of natural ingredients and synthesis of new substances because of the potential for large-scale cultivation under conditions of growth that are not suitable for general crops. Genetic engineering techniques for microalgae are still at a novice level and none of the recombinant products produced from microalgae have been commercialized yet.

Agrobacterium tumifaciens, microprojectile bombardment, glass-bead, and electroporation are used as methods for transforming a microalgae such as chlorella by introducing a foreign gene. Agrobacterium tumifaciens is the most common and economical method, but the process for transfection is about 7 days, including the transformation of the expression vector into Agrobacterium and the post-cocultivation process, except for the cultivation of competent cells do. However, the electroporation method can be transformed and cultured within a very short time with only competent cells and purified expression vectors. It is important to adjust the electrical shock conditions appropriately because the electroporation method involves insertion of the expression vector into host cells by electrical shock.

In order to accomplish the above object, the present invention provides codon optimization suitable for the chlorella nuclear gene codon in order to express the cow lactoferrin gene in microalgae chlorella. In the codon optimization, the N loop part of the antimicrobial core of lactoferrin optimized 990 bp (LfB-N). The optimized lactoferrin gene was inserted into the pCAMBIA1304 vector to construct an expression vector. And expressing the recombinant lactoferrin protein by transforming the expression vector with chlorella by electroporation.

The present invention is effective in providing a method of transforming lactoferrin derived from cow by electrophoresis in microalgae, chlorella. The present invention constructs an expression vector by inserting the chlorella codon-optimized Lfb-N gene into pCAMBIA1304. This expression vector was transformed into chlorella by electroporation to confirm recombinant lactoferrin expression. Therefore, it is expected that chlorella producing recombinant lactoferrin can be cultured by the method proposed by the present invention, and can be a new antibiotic substitute through extraction and purification.

1 Expression vector construction diagram
Spe I / BstE II; Restriction enzyme site
1-F / 1-R; Lfb-N? Expression vector pCAMLfb-N detection primer
2-F / 2-R; Transformant detection primers
Figure 2 Identification of the constructed expression vector in the library
Figure 3 Identification of expression vectors in transformed chlorella
Figure 4 Recombinant lactoferrin expression confirmation
a; Confirmation on SDS-PAGE
b; Confirmation by Immunodetection

(1) Optimization of lactoferrin gene codon and preparation of insert

In order to express a recombinant protein by introducing a foreign gene in microalgae, optimizing the codon for the microalgae nucleus gene to be expressed is one of methods for increasing the expression rate of the recombinant protein. For this reason, the cow lactoferrin gene was subjected to codon optimization to suit the chlorella gene. This optimization was codon optimized for lactoferrin N lobe part (990 bp) containing lactoperrice, an antimicrobial active core, by Biona 's gene synthesis service. Gene synthesis was initiated by inserting Spe I site at the 5 'end and 6 × His tag, TGA and BstE II site at the 3' end. The codon optimized lactoferrin gene (Lfb-N) constructed pLfb-N in the pGEM T easy vector and cloned into E. coli XL1 bule (Fig. 1). PLfb-N was extracted from the cloned E. coli, and the insert was prepared by digesting Spe I / BstE II restriction enzyme.

     (2) Construction of expression vector

To transform chlorella, the GFP :: GUS region containing the report gene of the expression vector pCAMBIA1304 was digested with Spe I / BstE II restriction enzyme backbone. The insert Lfb-N and the backbone linear pCMABIA1304 were ligated with T4 DNA ligase at 25 ℃ for 2 hours to construct pCAMLfb-N and cloned into E. coli XL1 bule. To confirm the cloned library pCAMLfb-N, PCR was verified using primer 1-F / 1-R. Table 1 shows the primers used. PCR was performed at 95 ° C for 2 min, 30 cycles of denaturation at 94 ° C for 1 min, adherence at 58 ° C for 2 min, extension at 72 ° C for 3 min and final expansion at 72 ° C for 7 min. The results of the PCR analysis are shown in Fig. It was confirmed that among the 10 libraries, the expression vector pCAMLfb-N constructed in the remaining library except 1 and 7 was included.

primer The base sequence (5 '- > 3') 1-F CTAGTGTTCGATGGTGCACCATTTCCC 1-R CTCACACGTGGTGGTGGTGGTG

      (1) Chlorella transformation by electroporation

In order to transform chlorella by an electrorheological method, the cell concentration of chlorella was adjusted to 0.3 to 0.5 at an absorbance of 600 nm. After culturing, the culture supernatant was discarded by centrifugation at 6,000 rpm for 10 minutes. The cell pellet was discarded and suspended in osmosis buffer (0.2 M Mannitol, 0.2 M Sorbitol) and left for 1 hour. The cell suspension was centrifuged and the cells were suspended in 1 ml of electroporation buffer (0.5 M NaCl, 5 mM KCl, 5 mM CaCl ₂ , 20 mM Hepes, 0.2 M manitol, 0.2 M sorbitol, pH 7.2) Of pCAMLfb-N were added and mixed and left on ice for 10 minutes. The mixture of chlorella cells and pCAMLfb-N was transferred to a 2 mm electroporation cuvette and electroporator ECM 2001 was used for electroporation. The conditions were 500 to 5,000 V / cm, 25 μF, 200 Ω, and the mixture was inoculated in 5 mL of BG11 medium and cultured at 25 ° C. for 24 hours under dark conditions. After completion of the cultivation, the culture broth was centrifuged to take out cell pellets, suspended in 200 μl of BG11 medium, and inoculated into a selective medium (BG11 agar plate containing 20 mg / L of hygromycin). Transgenic colonies were observed for 5 days after inoculation with 4000 lux fluorescent lighting and incubation at 25 ℃. Table 2 shows the results. As a result of performing different electric shock strengths, about 184 colonies of chlorella transformant colonies were found at 5,000 V / cm, 104 at 4,000 V / cm, 71 at 3,000 V / cm, 46 at 2,000 V / , 12 colonies at 1,000V / cm, and 8 colonies at 500V / cm. Based on these results, we optimized the electroporation method at 5,000V / cm, 25μF, and 200Ω.

Field strength (V / cm) Number of colonies resistant to hygromycin 5000 184 ± 4 4000 104 ± 3 3000 71 ± 4 2000 46 ± 2 1000 12 ± 3 500 8 ± 2

     (2) Selection of chlorella transformant by PCR analysis

     Twelve transformed colonies were randomly selected and inoculated into BG11 liquid medium (10 ml) containing hygromycin (10 μg / ml) and cultured at 25 ° C. under 4,000 lux fluorescent lighting. At an OD value of 1.0 at a culture concentration absorbance of 600 nm, the culture was centrifuged at 12,000 rpm for 10 minutes to recover the cells. The recovered cells were extracted with DNeasy Plant Mini kit (QIAGEN). The extracted DNA was confirmed by PCR with the primer 2-F / 2-R shown in Table 3. Table 3 shows the primers used. PCR was performed at 95 ° C for 2 minutes, 30 cycles of denaturation at 94 ° C for 1 minute, adhesion reaction at 60 ° C for 2 minutes, extension reaction at 72 ° C for 3 minutes, and final expansion reaction at 72 ° C for 7 minutes. The results are shown in FIG. Lane 1 is the untransformed chlorella DNA, lane 2 is the purified pCAMLfb-N, and lane 3-14 (CT1-12) are listed as transformed chlorella DNA. Lane 1 showed no PCR amplified bands, lane 2 showed a PCR product of about 1.1 kb, lane 11 (CT9) and lane 14 (CT12) showed a PCR product of about 1.1 kb, PCR products were not detected in lane. As a result, CT9 and CT12 were identified as chlorella transformants containing the lactoferrin gene.

primer The base sequence (5 '- > 3') 2-F GAGAACACGGGGGACTCTTG 2-R GGGGAAATTCGAGCTGGTCA

      (1) expression of recombinant lactoferrin

CT9 and CT12 were cultured in a 50 ml BG11 liquid medium supplemented with Hygromycin (10 ug / ml) for 7 days at 4000 lux fluorescent lighting and 25 ° C. The end culture ^{(1.0 × 10 7 cfu / ml} ) to 12,000 rpm and then the cells were collected by centrifugation for 10 minutes in 2ml total protein extraction buffer (50mM Hepes , 250mM KCl, 0.1mM EDTA, 1mM DTT, 0.5mM phenylmethylsulfonyl fluride. The cell suspension was sonicated (30 W, 10 min) to disrupt the cells and centrifuged at 12,000 rpm for 10 min to recover the supernatant. The recovered supernatant was concentrated with a 10 kDa membrane filter and 20 ug of total protein was confirmed by SDS-PAGE. The result is shown in Fig. 4-a. Lane 1 is the untransformed chlorella total protein sample, lane 2 is the total protein sample of CT9, and lane 3 is the total protein sample of CT12. SDS-PAGE showed no band of the desired protein size in the untransformed chlorella, while a band of about 35 kDa in the CT9 and CT12 target protein sizes was identified. The target protein was identified using a 6 × His tag coding at the C-terminal region of the protein to determine if it was a recombinant lactoferrin protein. To confirm this, western blotting and immunodetection were performed (Fig. 4-b). Mouse anti-6 × His monoclonal antibody was used as the primary antibody and anti-mouse IgG-Alkaline phosphatase was used as the secondary antibody. The result is shown in Fig. 4-b. Lane 1 is the untransformed chlorella total protein sample, lane 2 is the total protein sample of CT9, and lane 3 is the total protein sample of CT12. Immunodetection showed that a band of the target protein size was not detected in the untransformed chlorella, while a band of about 35 kDa in the CT9 and CT12 target protein sizes was identified.

Based on the above results, it has been established that a recombinant lactoferrin can be expressed in chlorella using electroporation.

V / cm; Voltage per 1 cm

<110> PARK, Bok Hee <120> Method to transform bovine lactoferrin to Chlorella by          electroporation <130> 1 <160> 1 <170> Kopatentin 2.0 <210> 1 <211> 1005 <212> DNA <213> Artificial Sequence <220> <223> bovine lactoferrin <400> 1 gtcgatggt gcaccatttc ccagcccgag tggttcaaat gccgccgatg gcagtggcgg 60 atgaagaagc tgggcgctcc ctctatcacc tgcgtccgca gggccttcgc gcttgagtgc 120 attcgggcca tcgcggagaa gaaggcggac gcggtgaccc tggatggtgg catggtgttt 180 gaggcgggcc gtgaccccta caagctgcgc cccgttgcag cagagatcta cgggacgaag 240 gagtcccccc agacccacta ctacgccgtg gccgtggtga agaagggcag caattttcag 300 ctggaccagc tgcaaggccg gaagtcctgc catacgggcc ttggccgctc cgctggttgg 360 atcatcccta tgggcatctt gcgcccgtac ctaagctgga cagagtccct cgagcccctc 420 cagggagctg tggccaagtt cttctcagca agctgcgtac cgtgcattga cagacaagca 480 taccctaacc tgtgtcagct gtgcaagggg gagggggaga accagtgcgc ctgctcctca 540 cgggagccat acttcggtta ctctggtgcc ttcaagtgtc tgcaagacgg ggctggcgac 600 gtggctttcg tcaaggagac tacagtgttc gagaacttgc cagagaaggc tgaccgcgac 660 cagtatgagt tgctttgcct gaacaacagc cgcgccccgg tggatgcgtt caaggaatgc 720 cacctggccc aggtcccgtc gcacgccgtc gtggcgcgaa gtgtggatgg caaggaggac 780 ctgatctgga agctcctcag caaggcacag gagaagtttg ggaagaacaa gtcgcggagc 840 tttcagctct tcggctctcc gccgggccag cgggacctgc tgttcaagga ctccgcactg 900 ggatttttgc gtattccgtc gaaggtggac tcggcgctgt acctgggctc ccgctacttg 960 accaccctga agaacctcag ggaacaccac caccaccacc actga 1005

Claims (6)

The nucleotide sequence of SEQ ID NO: 1 is a lactoferrin N lobe gene optimized for the codon of chlorella
An expression vector having the same characteristics as the gene map of Fig. 1 including the gene of SEQ ID NO: 1
Electric puncture that transforms chlorella with electric shock of 4,000 ~ 5,000V / cm
The method of claim 3, wherein the transformed chlorella containing the lactoferrin gene
The recombinant lactoferrin produced by the transformed chlorella of claim 4
Human and veterinary medicines or feed additives containing the recombinant lactoferrin of paragraph 5

Images