CN117903295B

CN117903295B - Kluyveromyces marxianus for secretory expression of lactoferrin and construction method and application thereof

Info

Publication number: CN117903295B
Application number: CN202410312817.6A
Authority: CN
Inventors: 田愉; 金城; 刘翔远
Original assignee: Beijing Guoke Xinglian Technology Co ltd
Current assignee: Beijing Guoke Xinglian Technology Co ltd
Priority date: 2024-03-19
Filing date: 2024-03-19
Publication date: 2024-05-31
Anticipated expiration: 2044-03-19
Also published as: CN117903295A

Abstract

The invention discloses Kluyveromyces marxianus for secretory expression of lactoferrin and a construction method and application thereof. The invention provides a method for constructing a Kluyveromyces marxianus engineering strain for secretory expression of human lactoferrin, which comprises the following steps: and (3) simultaneously expressing the human lactoferrin in Kluyveromyces marxianus receptor bacteria, and increasing the expression of disulfide isomerase Pdi by adopting a Gap3 promoter endogenous to Kluyveromyces marxianus, thereby obtaining the Kluyveromyces marxianus engineering strain for secretory expression of the human lactoferrin. The invention has important significance for improving the yield of the secretory expression lactoferrin of the Kluyveromyces marxianus.

Description

Kluyveromyces marxianus for secretory expression of lactoferrin and construction method and application thereof

Technical Field

The invention relates to the technical field of biology, in particular to Kluyveromyces marxianus for secretory expression of lactoferrin, and a construction method and application thereof.

Background

Lactoferrin (Lactoferrin, LF) is a non-heme iron-binding glycoprotein widely distributed in mammalian milk, possibly in addition to dogs and mice. The concentration of lactoferrin in milk depends on the lactation period. The LF content of colostrum has been shown to be 7 times that of mature milk. Human cells can produce lactoferrin, which is also found in many organs and cells of the human body. It is confirmed in kidney, lung, gall bladder, pancreas, intestine, liver, prostate, saliva, tears, sperm, cerebrospinal fluid, urine, bronchial secretions, vaginal secretions, synovial fluid, umbilical cord. Lactoferrin has a molecular weight of 80 kDa, is composed of 689 amino acids, is odorless and easily soluble in water, and consists of two spherical fragments, wherein the carboxyl and amino ends are connected by an alpha helix. Each lobe consists of two domain molecules, called C1, C2, N1 and N2, which form a β -sheet, and each lactoferrin molecule is capable of chelating two Fe ³⁺.

Lactoferrin is a multifunctional protein with iron binding/transferring, antibacterial, antiviral, antifungal, anti-inflammatory, anticancer properties, etc., thus having the functions of regulating cell growth, scavenging harmful free radicals and inhibiting the formation of several toxic compounds. The versatility of LF is due to the fact that it belongs to a hybrid protein, having both an ordered domain and an intrinsically disordered region of important function, comprising various post-translational modification sites, such as phosphorylation, acetylation, lipidation, ubiquitination or glycosylation, etc., thus affecting its biological function. Lactoferrin also has the ability to regulate lipid metabolism, which not only can better regulate the satiety mechanism, but also helps to combat the tendency of adipose tissue to accumulate. Thus, lactoferrin is considered a new antibacterial, anticancer drug. Currently, lactoferrin is added to many commercial products, such as infant formulas, nutritional supplements, toothpaste. Meanwhile, lactoferrin has functions of antioxidant activity, sterilization, melanin generation inhibition and skin injury repair, and is also often used as one of important additive components in cosmetics. With the health concerns, research workers are increasingly interested in the functional activity of lactoferrin.

At present, the most direct method for obtaining lactoferrin is to separate and extract the lactoferrin from cow milk, but the lactoferrin content in the cow milk is low, and 14-18 kg of high-quality milk is required for extracting 1g kg of high-purity lactoferrin. At the same time, the human body may have a certain negative effect, such as allergic reaction, by digesting and absorbing heterologous proteins. In order to solve the problems, researchers construct engineering strains by adopting a genetic engineering mode, and then ferment to obtain a large amount of lactoferrin. Current host cells for the production of lactoferrin include: coli, yeast, mammalian cells, and plant cells. Coli as a prokaryotic model organism has the advantages of low nutrition requirement, easy growth and short period, but has no shaped organelle and complete glycosylation modification system, thus the target protein with biological activity cannot be produced, and the factors such as easy pollution, strict requirement on growth environment, long growth period and the like of mammalian cells and plant cells are not suitable for being used as basal cells for mass production of lactoferrin.

Yeast cells can substantially avoid the disadvantages of the cells, and have basic production conditions as the simplest eukaryotic organisms. Researchers find that along with the enhancement of the expression level of the target protein, the secretion system of the cells cannot meet the secretion of the protein, so that the intracellular degradation of the protein is caused, the growth state of the cells is influenced, and the yield of the target protein is reduced. Therefore, in order to increase the yield of the target protein, the primary solution is that the protein can enter the endoplasmic reticulum to carry out correct folding modification, so that a large amount of secretion of the protein is realized.

Disclosure of Invention

In order to solve the technical problems, the method promotes the correct folding of lactoferrin in kluyveromyces marxianus, can be rapidly secreted outside cells, and realizes the enhancement of the high-efficiency expression of the lactoferrin. The invention not only realizes the purpose of improving the yield of human lactoferrin produced by fermenting Kluyveromyces marxianus, but also provides a method for increasing the secretion expression level of the lactoferrin in the Kluyveromyces marxianus.

In a first aspect, the invention claims a method of constructing a kluyveromyces marxianus engineered strain for secretory expression of human lactoferrin.

The method for constructing the Kluyveromyces marxianus engineering strain for secretory expression of human lactoferrin, which is claimed by the invention, can comprise the following steps: and (3) simultaneously expressing the human lactoferrin in Kluyveromyces marxianus receptor bacteria, and increasing the expression of disulfide isomerase Pdi by adopting a Gap3 promoter endogenous to Kluyveromyces marxianus, thereby obtaining the Kluyveromyces marxianus engineering strain for secretory expression of the human lactoferrin.

In this method, promoting secretory expression of the lactoferrin in kluyveromyces marxianus is achieved by increasing expression of the disulfide isomerase Pdi.

Wherein the disulfide isomerase Pdi may be derived from trichoderma reesei QM6a; further, the amino acid sequence of the disulfide isomerase Pdi is shown as SEQ ID No. 1. The amino acid sequence of the human lactoferrin is shown as SEQ ID No. 4.

Further, the expression of the human lactoferrin in the kluyveromyces marxianus recipient strain may be achieved by introducing a gene encoding the human lactoferrin into the kluyveromyces marxianus recipient strain.

Further, increasing the expression of the disulfide isomerase Pdi using the Gap3 promoter endogenous to kluyveromyces marxianus can be achieved by introducing a gene expression cassette of the disulfide isomerase Pdi into the kluyveromyces marxianus recipient; in the gene expression cassette of the disulfide isomerase Pdi, the expression of the gene encoding the disulfide isomerase Pdi is initiated by the Gap3 promoter endogenous to kluyveromyces marxianus.

Further, the nucleotide sequence of the encoding gene of the human lactoferrin is shown as SEQ ID No. 5.

Further, in the gene expression frame of the disulfide isomerase Pdi, the nucleotide sequence of the Gap3 promoter endogenous to kluyveromyces marxianus is shown as SEQ ID No. 3; the nucleotide sequence of the coding gene of the disulfide isomerase Pdi is shown as SEQ ID No. 2.

In a specific embodiment of the present invention, the gene expression cassette of disulfide isomerase Pdi is inserted into and replaces the Och1 gene in the genome of the kluyveromyces marxianus receptor. The Och1 gene was knocked out in order to block the high mannose glycosylation modification of yeast, in preparation for subsequent glycosylation modification. N-glycosylation modification in the endoplasmic reticulum of eukaryotes is highly conserved, except that after transport to the Golgi apparatus, yeast adds an alpha-1, 6 mannose to alpha-1, 3 mannose via the Och1 gene, and then other mannosyltransferases and phosphomannosyltransferases continue to add mannose on the basis of this sugar chain structure, ultimately forming a high mannose structure.

Specifically, insertion and substitution of the gene expression cassette of the disulfide isomerase Pdi into the genome of the kluyveromyces marxianus receptor is achieved by homologous recombination. The sequence of the upstream homology arm for carrying out the homologous recombination is shown as SEQ ID No.6, and the sequence of the downstream homology arm is shown as SEQ ID No. 7.

In the specific embodiment of the invention, the Kluyveromyces marxianus receptor bacteria are Kluyveromyces marxianus KM, delta ura3; the Kluyveromyces marxianus KM is characterized in that Deltaura 3 is a strain obtained by knocking out Ura3 genes in Kluyveromyces marxianus FIM1 genome. The genomic Ura3 gene was knocked out because the production requirement did not require the introduction of a resistance selection marker.

In a second aspect, the invention claims a kluyveromyces marxianus engineered strain for secretory expression of human lactoferrin.

The Kluyveromyces marxianus engineering strain for secretory expression of human lactoferrin is constructed by the method in the first aspect.

In a third aspect, the invention claims the use of a kluyveromyces marxianus engineered strain as described in the second aspect above for secretory expression of human lactoferrin.

Experiments prove that when disulfide isomerase Pdi is integrated into a kluyveromyces marxianus host, secretion of lactoferrin is obviously improved, generation of degradation bands is reduced, and the expression quantity of the lactoferrin is found to be 5.1 times that of a control group through ELISA detection, so that 735 mug/L is achieved. The invention has important significance for improving the yield of lactoferrin produced by fermenting Kluyveromyces marxianus.

Drawings

FIG. 1 shows the results of colony PCR verification of the selected clone strain of interest. The arrow marks the obtained homozygote strain KM:. DELTA.ura 3:: pdi, the rest being wild type, i.e. the Pdi gene, without replacing the Och1 gene.

FIG. 2 shows the result of transcription of Pdi gene and LF gene.

FIG. 3 is a SDS-PAGE map of the expression level of lactoferrin. Wherein lane 1 is a lactoferrin standard; lane 2 is the negative control KM:. DELTA.ura 3/pUKDN119-LF supernatant; lane 3 is KM:. DELTA.ura 3:: pdi/pUKDN119,119-LF supernatant protein (two lanes 3 in the figure are two replicates). The arrow shows lactoferrin.

Detailed Description

The following detailed description of the invention is provided in connection with the accompanying drawings that are presented to illustrate the invention and not to limit the scope thereof. The examples provided below are intended as guidelines for further modifications by one of ordinary skill in the art and are not to be construed as limiting the invention in any way.

The experimental methods in the following examples, unless otherwise specified, are conventional methods, and are carried out according to techniques or conditions described in the literature in the field or according to the product specifications. Materials, reagents and the like used in the examples described below are commercially available unless otherwise specified.

Kluyveromyces marxianus FIM1 (CGMCC No. 10621): as described in "Liu Y, Mo WJ, Shi TF. Mutational Mtc6p attenuates autophagy and improves secretory expression of heterologous proteins in Kluyveromyces marxianus. Microb Cell Fact. 2018 Sep 14;17(1):144. doi: 10.1186/s12934-018-0993-9. PMID: 30217195; PMCID: PMC6138896.", the public is available from the applicant and can only be used for repeated experiments of the invention, and not for him. Kluyveromyces marxianus KM:. DELTA.ura 3 is a strain obtained by knocking out the Ura3 gene in the genome of Kluyveromyces marxianus FIM1, and is also described in the above-mentioned documents.

Example 1 disulfide isomerase Pdi optimization strategy

The disulfide isomerase Pdi used in the present invention is derived from Trichoderma reesei QM6a, and its amino acid sequence is shown in SEQ ID No. 1. Under the condition of unchanged amino acid sequence, the nucleotide sequence of the Kluyveromyces marxianus is optimized according to a high-use frequency table (table 1), and the optimized nucleotide sequence is shown as SEQ ID No. 2.

Example 2 amplification of donor DNA

The Kluyveromyces marxianus endogenous Gap3 promoter is selected to express the Pdi disulfide isomerase, the Gap3 promoter is a glucose carbon source promoter, and a carbon source used in the fermentation process is glucose, so that the transcription level of the Pdi gene is improved by the Gap3 promoter.

Using primers Up-F and Up-R (Table 2), PCR amplification was performed using Kluyveromyces marxianus KM:. DELTA.ura 3 genome as a template to obtain an Up homology arm (SEQ ID No. 6) knocked in to the Och1 site.

The primers Pdi-F and Pdi-R (Table 2) are used, recombinant plasmids pUC57-P _Gap3 -Pdi are used as templates for amplification to obtain a Gap3 promoter and a Pdi gene fragment, and the Gap3 promoter and the Pdi gene fragment are obtained by sequentially connecting SEQ ID No.3 (Gap 3 promoter) and SEQ ID No.2 (optimized Pdi gene) end to end. Wherein, the recombinant plasmid pUC57-P _Gap3 -Pdi is obtained by inserting a DNA fragment shown as SEQ ID No.3+SEQ ID No.2 into the EcoRV site of the pUC57 plasmid.

PCR amplification was performed using primers Down-F and Down-R (Table 2) and Kluyveromyces marxianus KM:. DELTA.ura 3 genome as a template to obtain a Down homology arm (SEQ ID No. 7) knocked in the Och1 site.

Further, the 3 amplified products obtained above were used as templates, and PCR amplification was performed using primers Up-F and Down-R to obtain Overlap PCR products. The product is a donor DNA fragment, and comprises an Up homology arm (SEQ ID No. 6), a Gap3 promoter (SEQ ID No. 3), a Pdi gene (SEQ ID No. 2) and a Down homology arm (SEQ ID No. 7) of the Och1 site from the 5 'end to the 3' end in sequence.

Example 3 construction of Gene editing plasmid

The LHZ531 plasmid (the complete sequence of which is shown in SEQ ID No.8, having the TEF1 promoter, cas9 gene, CYC1 terminator, ura3 promoter and its gene, ARS1 terminator, ampicillin gene, guide RNA, tRNA-gly) was digested first with SapI endonuclease (Takara, cat# 1631) and large fragments were recovered. Then find Och1 editing site in Kluyveromyces marxianus KM:. DELTA.ura 3 genome, find 20 bases before NGG target sequence in Och1 gene according to N20 sequence design requirement. The ligation-cohesive ends of the SapI cleavage site were added to the 5' end of the N20 primer (table 3), TCA and AAC, respectively. Two N20 primers (N20 in Table 3) were mixed 10. Mu.L each after dilution at 95℃at 3 min followed by 10: 10min at room temperature. Finally, the N20 sequence was ligated to LHZ531 large fragment using T4 ligase (Biolab, cat. B0202S) and transformed into DH5a competent, and ampicillin-coated LB plates. After the next day of verification, the primers were YY161F and N20-R, and if there was a PCR product of 1000 bp size, the plasmid construction was successful, and if there was no product, the construction failed. The primer sequences involved are shown in Table 3.

Note that: v in SEQ ID No.18 represents A or C or G.

Finally obtaining the gene editing plasmid which is named LHZ531-N20. Namely, a recombinant plasmid obtained by replacing a small fragment between two cleavage sites SapI of the LHZ531 plasmid with ACCGGCGTATAACATGTCAG (namely, the 4 th to 23 rd positions of SEQ ID No. 16).

Example 4 Yeast chemical transformation of the editing plasmid LHZ531-N20 and donor DNA

Selecting Kluyveromyces marxianus KM: culturing a single colony of Deltaura 3 in a 30 mL YPD culture medium until OD ₆₀₀ is larger than 10, centrifuging the obtained bacterial solution in a2 mL Ep tube to obtain a precipitate, taking 3mL of 1M LiAc and 3mL of 10 xTE (formula: 100 mM EDTA-HCl, 10 mM EDTA is used for adjusting pH=8.0) and adding sterile water to 30 mL, uniformly mixing to obtain a 1 xLiAc/TE buffer solution, washing the precipitate twice by using the 1 xLiAc/TE buffer solution, removing the supernatant, then adding 5 [ mu ] L CARRIER DNA (Takara, cat number 630440) in the center of the precipitate, adding 1 [ mu ] g of donor DNA fragment obtained in example 2 and 500 ng [ mu ] of the edited plasmid LHZ531-N20 constructed in example 3, gently mixing by using a gun head, finally adding 300 [ mu ] L of PEG/LiAc/TE solution (preparation method: 40: g PEG is dissolved in water to a scale line of 80 mL,115 ℃, 20: min), adding sterile 1: M LiAC and 10 xTE mL into the medium, uniformly mixing at the temperature of 1: mM ℃ for 20:35, performing water bath at the final mixing for 3:35, and finally carrying out water bath 35 for 3:35, and finally, uniformly mixing for a medium for 15 days, filtering, and finally, carrying out a water bath culture medium for a medium for 30:3715 days, and a medium for a medium, such as 15:3535, and a water bath for 3:3715, and finally, uniformly filtering the obtained bacterial colony.

Example 5 Chassis cell transformation of expression plasmid pUKDN-LF

The pUKDN119,119 plasmid (full sequence shown in SEQ ID No.9, which contains the elements PKD1 fragment, inulase promoter and signal peptide, PMD18-T, inulase terminator, ura3 promoter, ura3 gene) was digested with SacII (NEB, R0157S) and SpeI (NEB, R3133S) endonucleases, and the large fragment was recovered. And then using a primer LF-F/R to amplify the lactoferrin coding gene by taking a plasmid containing the lactoferrin coding gene synthesized by the engineering as a template, adding corresponding enzyme cutting sites at two ends of the primer, simultaneously cutting, mixing the obtained mixture with pUKDN119,119 large carrier fragments according to a molar ratio of 1:4 after recovery treatment, and connecting the obtained mixture by using T4 ligase, wherein the obtained recombinant plasmid is named pUKDN-LF. The structure of the recombinant plasmid is described as follows: the small fragment between the cleavage sites SacII and SpeI of the pUKDN plasmid was replaced with the recombinant plasmid obtained after the human lactoferrin encoding gene (SEQ ID No. 5). The amino acid sequence of human lactoferrin is shown as SEQ ID No.4, and the corresponding coding gene sequence is shown as SEQ ID No. 5.

Finally, the recombinant plasmid pUKDN-LF was transformed into the chassis cell KM::. DELTA.ura 3:: pdi obtained in example 4, and the procedure was as described in example 4. After single colonies were grown, they were verified using primers PINU-F and LF-R, and single colonies with a band of 2200 bp were amplified as correct, followed by sequencing. The primers according to this example are shown in Table 4. The final positive transformant was designated KM::. DELTA.ura 3:: pdi/pUKDN119,119-LF.

Meanwhile, the recombinant plasmid pUKDN-LF is transformed into chassis cell KM:. DELTA.ura 3 as a negative control, and the obtained transformant is named KM:. DELTA.ura 3/pUKDN119-LF.

EXAMPLE 6 determination of disulfide isomerase and lactoferrin transcript levels in recombinant Kluyveromyces marxianus

The positive transformants KM obtained in example 5 above were subjected to Deltaura 3:: pdi/pUKDN-LF were first cultured in YPD medium (formulation: 20 g/L tryptone, 10 g/L yeast powder, 20 g/L glucose) for 16 h until OD ₆₀₀ was greater than 10, then centrifuged to collect the cells, resuspended in 100. Mu.L of sterilized water, and applied to PS stability screening plates (formulation: adding 5-fluorouracil and agar powder to YPD medium at a 5-fluorouracil final concentration of 2 g/L and agar powder at a final concentration of 20 g/L) in a 30℃incubator until single colonies were grown. Then, the plate is turned over to a PS plate, single colonies are picked up in YPD plates the next day, thalli are collected by centrifugation, the thalli are washed twice by sterile water, total RNA (Zhuang Meng organisms, ZP 407-1) is extracted by using a yeast RNA extraction kit, and the operation steps are detailed in the specification. cDNA was obtained according to the instructions of the reverse transcription kit (Takara, Y1621), and the transcript levels of disulfide isomerase Pdi and lactoferrin in the different cells were further determined by the fluorescent quantitation kit of KAPA (cat# KK 4601). The detection primers are shown in Table 5.

As a result, as shown in FIG. 2, the transcription level of the Pdi gene was 0.14 and the transcription level of the LF gene was 3.71, with the 18s rDNA as the reference gene and the 18s rDNA transcription level as 1. The result shows that the addition of the Pdi gene is beneficial to the transcription of the LF gene and has an auxiliary effect on the secretion of the subsequent complete lactoferrin.

EXAMPLE 7 detection of the translation level of lactoferrin in recombinant Kluyveromyces marxianus

The single colony KM:. DELTA.ura 3:: pdi/pUKDN-LF of the positive transformant obtained in example 5 above was picked up in YG medium (formulation: yeast powder 20 g/L, glucose 40 g/L) and fermented continuously in a shaker at 200 rpm and 30℃for 3 days. Then, the supernatant was collected by centrifugation at 8000 rpm for 15 min using a table-type refrigerated centrifuge, 1M trichloroacetic acid was added to the supernatant in a volume of 10% to precipitate secreted proteins in the supernatant, the supernatant was collected by centrifugation at 12000 rpm,20 min,4 c the next day overnight at 4 ℃, the supernatant was washed twice with pre-chilled absolute ethanol 2mL, the supernatant was discarded and then placed on ice with an opening to volatilize ethanol, and finally 50 mM Tris-HCl at pH 8.5 was added to dissolve the precipitate to obtain secreted proteins. Lactoferrin was quantitatively analyzed using SDS-PAGE.

SDS-PAGE of lactoferrin expression levels is shown in FIG. 3. From the figure, KM:. DELTA.ura 3: pdi/pUKDN119,119-LF was able to express intact LF, and the negative control KM:. DELTA.ura 3/pUKDN119,119-LF showed no intact-sized LF fragment in the supernatant, indicating that disulfide isomerase Pdi has an enhancing effect on the integrity and secretion of LF.

Example 8 Elisa detection of secretion of lactoferrin in recombinant Kluyveromyces marxianus

The supernatant obtained by initial centrifugation in example 7 was diluted 5-fold with the coating liquid while using LF (Saputo, 1001102) as a standard curve at an initial concentration of 10mg/L, followed by stepwise dilution 5-fold to 1.28X10- ^-4 mg/L with 100. Mu.L of the coating liquid per well (formulation: 1.59 g Na ₂CO₃,2.93 g NaHCO₃, dilution with distilled water to 1000 mL), refrigerator 2h at 4℃and pouring out the liquid in the wells, adding 150. Mu.L of the washing liquid (formulation: 0.2 g KH ₂PO₄,2.9 g Na₂HPO₄•12H₂ O,0.5 mL Tween-20; addition of distilled water to 1000 mL), standing 3 min, and washing repeatedly 3 times to remove the washing liquid. 100. Mu.L of a blocking solution (formula: 5 g skimmed milk is dissolved in 100 mL washing solution), and the mixture is left at 37℃for 2h and washed 3 times, and then diluted 2000-fold of primary anti-rabbit anti-lactoferrin (Bioss, bs-5810R) 0.1 mL is added to each reaction well, incubated at 37℃for 1h, and then washed. Adding 0.1 mL times of diluted enzyme-labeled secondary antibody-goat anti-rabbit (Bio-technology, SA 00001-2) into each reaction hole, incubating at 37 ℃ for 1: 1h, and then washing. Adding 0.1 mL of TMB substrate solution temporarily prepared into each reaction hole, reacting at room temperature for 3-10 min, adding 50 mu L of H ₂SO₄ with the concentration of 2 mol/L into each hole to stop the reaction, reading the value on an ELISA detector at 450 nm, detecting the lactoferrin expressed by constructed chassis cells (namely, positive transformant single colony KM obtained in example 5: deltaura 3: pdi/pUKDN 119-LF), and calculating the yield of the lactoferrin according to an LF standard curve y=0.0556x+0.0758 (y is OD450 reading value, x is LF concentration, R ² =0.9575) after OD450 value is measured, wherein the average value of the secretion yield of the lactoferrin measured repeatedly for three times is 735 mu g/L. Specifically, the results are shown in Table 6.

Note that: p <0.05 indicates a significant difference between the two.

The present application is described in detail above. It will be apparent to those skilled in the art that the present application can be practiced in a wide range of equivalent parameters, concentrations, and conditions without departing from the spirit and scope of the application and without undue experimentation. While the application has been described with respect to specific embodiments, it will be appreciated that the application may be further modified. In general, this application is intended to cover any variations, uses, or adaptations of the application following, in general, the principles of the application and including such departures from the present disclosure as come within known or customary practice within the art to which the application pertains.

Claims

1. A method of constructing a kluyveromyces marxianus engineered strain for secretory expression of human lactoferrin comprising the steps of: while expressing human lactoferrin in Kluyveromyces marxianus receptor bacteria, increasing the expression of disulfide isomerase Pdi by adopting a Gap3 promoter endogenous to Kluyveromyces marxianus, thereby obtaining Kluyveromyces marxianus engineering strain for secretory expression of human lactoferrin;

The amino acid sequence of the disulfide isomerase Pdi is shown in SEQ ID No. 1;

Increasing the expression of the disulfide isomerase Pdi by using the Gap3 promoter endogenous to kluyveromyces marxianus is achieved by introducing a gene expression cassette of the disulfide isomerase Pdi into the kluyveromyces marxianus recipient; in the gene expression frame of the disulfide isomerase Pdi, the expression of the encoding gene of the disulfide isomerase Pdi is started by a Gap3 promoter endogenous to the kluyveromyces marxianus;

the gene expression cassette of disulfide isomerase Pdi inserts and replaces the Och1 gene in the genome of the kluyveromyces marxianus recipient.

2. The method according to claim 1, characterized in that: the amino acid sequence of the human lactoferrin is shown as SEQ ID No. 4.

3. The method according to claim 1, characterized in that: expression of the human lactoferrin in the kluyveromyces marxianus recipient is achieved by introducing a gene encoding the human lactoferrin into the kluyveromyces marxianus recipient.

4. The method according to claim 1, characterized in that: the nucleotide sequence of the coding gene of the human lactoferrin is shown as SEQ ID No. 5.

5. The method according to claim 1, characterized in that: in the gene expression frame of the disulfide isomerase Pdi, the nucleotide sequence of the Gap3 promoter endogenous to kluyveromyces marxianus is shown as SEQ ID No. 3; the nucleotide sequence of the coding gene of the disulfide isomerase Pdi is shown as SEQ ID No. 2.

6. The method according to any one of claims 1-5, wherein: the Kluyveromyces marxianus receptor is Kluyveromyces marxianus KM, delta ura3; the Kluyveromyces marxianus KM is characterized in that Deltaura 3 is a strain obtained by knocking out Ura3 genes in Kluyveromyces marxianus FIM1 genome.

7. A kluyveromyces marxianus engineering strain for secretory expression of human lactoferrin, characterized in that: the Kluyveromyces marxianus engineering strain is constructed by adopting the method of any one of claims 1-6.

8. The use of the kluyveromyces marxianus engineered strain of claim 7 for secretory expression of human lactoferrin.