KR20150029810A - A kit and a method for simultaneously detecting HLA-B＊5801 and HLA-B＊5701 alleles - Google Patents

Abstract

The present invention relates to a method for simultaneously detecting HLA-B*5801 allele and HLA-B*5701 allele which are for predicting adverse drug reactions of allopurinol and abacavir, and to a kit thereof and, more specifically, to a method and a kit for simultaneously detecting HLA-B*5801 allele and HLA-B*5701 allele using reverse primer capable of specifically and simultaneously amplifying the HLA-B*5801 allele and HLA-B*5701 allele among various HLA-B alleles and forward primer capable of amplifying including regions showing sequence difference among the alleles.

Description

Methods for simultaneous detection of the HLA-B * 5801 allele and the HLA-B * 5701 allele and a kit for detecting the HLA-B * 5801 allele and the HLA-

The present invention relates to a method for simultaneous detection of an HLA-B * 5801 allele and an HLA-B * 5701 allele, and a kit thereof.

Human Leukocyte Antigen (HLA), a major histocompatibility complex (MHC) in human, is a cell surface antigen that recognizes the self and non-self in the body and the immune response to antigen stimulation , Modulation of cellular and humoral immunity, and susceptibility to disease. In addition, in organ transplantation, it acts as an important antigen next to ABO blood type in the survival of transplanted organs. These HLA genes are highly polymorphic, and the number of HLA-A, B, and C allele genes encoding HLA class I antigens is currently 1884, 2490, and 1384 (Marsh et al., Tissue Antigens 65 (4): 301 HLA-DRA1, -DRB1, -DQA1, -DQB1, -DPA1, and -DPB1 have been identified as 7, 1094, 47, 165, 34 and 155, respectively (IMGT / HLA Database).

The HLA-B * 5801 allele has been reported to be the most common type of HLA-B allele, and it has been reported that HLA-B * 5801 alleles are more susceptible to disease than other alleles. It exhibits severe skin adverse reactions to a commonly used drug, allopurinol (gyrolycin). Severe skin adverse events, such as Steven Johnson syndrome (SJS) or toxic epidermal necrolysis (TEN), account for 5% and 30% to 50%, respectively. Patients with these fatal allopurinol side effects have an HLA-B * 5801 allele (Hung et al., Proc Natl Acad Sci USA 2005 Mar 15; 102 (11): 4134-9), and these genes are found in 6-8% of Asians. Therefore, HLA-B * 5801 genetic testing can be performed in patients with prescription of allopurinol drugs to predict serious skin adverse events and recommend other medications. In addition, with the HLA-B * 5701 allele, hypersensitivity occurs in 48% -61% of patients treated with ABACAVIR (Mallal et al., Lancet, 2002 Mar 2; 359 (9308): 727-32.) In order to prescribe the drug, it is necessary to examine the allele.

Serologic tests were initially performed to confirm the HLA allele genotype, but DNA testing is now used primarily because of poor reliability and accuracy. Currently available commercialized HLA genotyping kits include nylon membrane, PCRSSO (sequence specific oligonucleotide), reverse blot PCR-SSO (hybridization probes), PCR-SSP (sequence specific primer), PCR- PCR-oligocapture sandwich assay, luminex bead array method and PCR-SBT (sequence based typing) method. However, these conventional kits have a high number of tests using a method capable of examining various genotypes belonging to the HLA-B gene and are inadequate for testing for detection of the HLA-B * 5801 allele or the HLA-B * 5701 allele.

The present invention discloses a method for accurately and efficiently detecting the HLA-B * 5801 allele and the HLA-B * 5701 allele simultaneously.

It is an object of the present invention to provide a method for simultaneously detecting an HLA-B * 5801 allele and an HLA-B * 5701 allele.

Another object of the present invention is to provide a kit for simultaneous detection of the HLA-B * 5801 allele and the HLA-B * 5701 allele.

Other objects and specific objects of the present invention will be described below.

As described above, it is necessary to confirm the compatibility of tissue transplantation according to the HLA allele genotype, to confirm susceptibility to diseases, and to predict the possibility of adverse reactions to drugs.

The presence of the HLA-B * 5801 allele of two HLA-B alleles from each parent increases the likelihood of a fatal side effect to allopurinol, which is used as a treatment for gout, arthritis and hyperuricemia, The presence of the -B * 5701 allele increases the likelihood of adverse reactions to abacavir known as HIV treatment. Therefore, it is essential to confirm the presence of the HLA-B * 5801 allele and the HLA-B * 5701 allele at the prescription of the drug, but currently developed kits are inefficient in terms of cost and time.

As shown in the following examples, the present inventors obtained DNA samples from human blood and specifically amplified only HLA-B * 5801 allele and HLA-B * 5701 allele of several HLA-B alleles simultaneously PCR amplification is carried out using a forward primer capable of amplifying the reverse primer that can be amplified, including a region showing sequence differences between these alleles, and if the amplification is performed, the nucleotide sequence of the amplification product is determined 5801 allele and / or the HLA-B * 5701 allele was present in the sample at the same time.

In view of the above experimental results, the present invention can be understood as a method for simultaneously detecting the HLA-B * 5801 allele and the HLA-B * 5701 allele.

The method for detecting the HLA-B * 5801 allele and the HLA-B * 5701 allele simultaneously comprises the steps of (a) separating DNA from a biological sample, (b) The forward primer is designed and constructed based on the sequence located upstream of the first region so that the first region, in which the B * 5701 allele shows a sequence difference, is amplified, and the reverse primer is the HLA-B * 5801 allele B * 5701 allele and HLA-B * 5701 allele so that only these allele genes can be specifically amplified and only the HLA-B * 5701 allele and the HLA-B * (C) amplifying the DNA using the primer, (d) confirming the presence or absence of an amplification product, and (e) amplifying the DNA in the step (d) When confirmed, the base sequence of the amplification product It is configured to include the steps:

In the method of the present invention, the first region and the second region are identifiable in FIG. 1 and FIG. 2, respectively, and will be described in more detail below.

In the method of the present invention, the biological sample of step (a) refers to a cell, tissue or body fluids (blood, saliva, urine, etc.) of the human body and can be used directly as obtained, Can be used after pretreatment. The pretreatment may be carried out, for example, by centrifugation of the sample (for example, separation of blood plasma or serum from the blood by centrifugation), reagent treatment (for example, citric acid to inhibit blood coagulation, EDTA, heparin Destruction of cells in the sample, dilution of the sample, filtration of the sample, distillation of the sample, concentration of the sample, inactivation of the interference component, and the like.

In the method of the present invention, the step of isolating the DNA of step (a) is well known in the art and can be carried out using any method known in the art. For example, ethanol separation, phenol / chloroform extraction, SDS extraction (Tai et al., Plant Mol. Biol. Reporter, 8: 297-303, 1990), CTAB separation method (Murray et al., Nuc. Res. (Ausubel et al., John Wiley & Sons, New York, 2007), Doyle et < RTI ID = 0.0 > al (1987) Phytochem Bull 19: 11-15, Want et al, 1993. Nucleic Acids Res 21: 4153-4154, Lodhi et al., 1994. Plant Mol Biol Rep 12 13], and the like. Normally, a DNA extraction kit will be produced and circulated by a biotechnology company. Examples of such a DNA extraction kit include Qiagen (QIAamp Blood Mini Kit, NL), RBC (Taiwan), Roche (Germany), Epicenter Technology Inc. (WI), XTRANA Co. And kits sold by Cepheid (CA) or Beckman Coulter (US).

In the method of the present invention, in step (b), the reverse primer is designed and constructed based on the second region, which is a sequence common only among HLA-B * 5801 allele and HLA-B * 5701 allele among several HLA- And the forward primer is designed and fabricated on the basis of the sequence on the first region which is the region where the HLA-B * 5801 allele and the HLA-B * 5701 allele show the sequence difference. Therefore, B * 5801 allele and HLA-B * 5701 allele are not present in the sample when both the HLA-B * 5801 allele and the HLA-B * 5701 allele are present in the sample, * If one or both of the 5701 alleles are present, an amplification product is generated. The amplification product may be an amplification product of only the HLA-B * 5801 allele or an amplification product of only the HLA-B * 5701 allele Or two conflicts It may be all of the electronic amplification product. Whether the amplification product contains the HLA-B * 5801 allele amplification product and / or the amplification product of the HLA-B * 5701 allele indicates that the amplification product encodes an HLA-B * 5801 allele and an HLA- Since it includes the first region showing the sequence difference between the genes, it can be confirmed by determining the sequence of the first region showing the sequence difference.

The results of comparing and aligning the sequences of several alleles of HLA-B are shown in FIG. 1, and the parts denoted by the hyphen (-) in the aligned sequence are HLA-B * 0702 (A, T, G, and C) is a region in which each allele has a sequence difference from the HLA-B * 0702 allele, and the nucleotide of the corresponding base It means you.

The sequence region partitioned into boxes in [Figure 1] is a region in which the sequences are common (that is, coincident) between the HLA-B * 5801 allele and the HLA-B * 5701 allele, B * 5801 allele and HLA-B * 5701 allele of HLA-B alleles are amplified when a reverse primer is designed and manufactured based on this region.

In Figure 1, the HLA-B * 5701 allele and the HLA-B * 5701 allele show sequence differences, while the HLA-B * 5701 gene shows T (thymine) and C (cytosine) In the HLA-B * 5801 gene, C (cytosine) and A (adenine) are included in the amplification product. When the forward primer is designed and constructed based on the upper sequence of this site, And thus it is possible to confirm whether the HLA-B * 5801 allele and / or the HLA-B * 5701 allele is present in the sample when sequencing the sequence of this site of the amplification product.

The result of aligning the sequences of the HLA-B * 5701 allele (GenBank accession No.:AJ458991.3, SEQ ID No. 1) and the HLA-B * 5801 allele (GenBank accession No.:AB008102.1, SEQ ID No. 2) 2, the portion divided by the box in Fig. 1 is indicated as the second region in Fig. 2, and the portion showing the sequence difference indicated by the arrow in Fig. 1 is shown in Fig. 2, As shown in FIG.

More specifically, the first region and the second region are sequences identified by TGGC as a sequence from the 635th nucleotide to the 638th nucleotide in the sequence of the HLA-B * 5701 allele of SEQ ID NO: 1, In the HLA-B * 5801 allele sequence of SEQ ID NO: 2, the sequence is a CGGA-designated sequence from the 206th nucleotide to the 209th nucleotide sequence, and the second region is the 685th sequence in the sequence of the HLA-B * 5701 allele of SEQ ID NO: (SEQ ID NO: 7) as the sequence from the nucleotide to the 714th nucleotide of the HLA-B * 5801 allele in SEQ ID NO: 2 and the sequence from the 256th nucleotide to the 285th nucleotide in the HLA-B * 5801 allele sequence of SEQ ID NO: 2 as well as ggggag acacggaaca tgaaggcctc is a sequence specified by cgcg (SEQ ID NO: 7).

The forward primer is designed so that the first region is included in the amplification product, so that the forward primer can be designed and manufactured based on the sequence located above the first region. Therefore, the sequences that serve as the basis for the design and construction of the forward primer are arbitrarily selected among the sequences (matching positions) between the HLA-B * 5801 allele and the HLA-B * 5701 allele in the sequence above the first region Can be selected.

The reverse primer specifically designed to amplify only the allele of HLA-B * 5801 allele and HLA-B * 5701 allele of several HLA-B genes and designed and manufactured based on the sequence of the second region In this case, it may be designed and manufactured based on a part or all of the second region sequence, or may be designed and manufactured based on a sequence including a part of a peripheral sequence in the upper and lower regions.

The primer used in the example of the present invention was designed and manufactured based on the underlined part in [Fig. 2]. Specifically, the forward primer is shown in SEQ ID NO: 3 and the reverse primer is shown in SEQ ID NO:

 In the present specification, the term "primer" refers to a single strand oligonucleotide capable of specifically binding to template DNA and serving as a starting point of DNA synthesis. Such primers can be RNA as well as DNA, and can also be RNA, including nucleases or thermostable peptide nucleic acid (PNA), locked nucleic acid (LNA), hexapeptide nucleic acid (HNA), altruol nucleic acid (ANA), mannitol nucleic acid ), And RNA (Ribose Nucleic Acids).

In the present specification, "forward primer" and "reverse primer" refer to primers that respectively bind to the 3 'and 5' ends of a specific site of a gene amplified by a gene amplification reaction and act as a starting point of DNA synthesis.

The length of such a primer is not particularly limited as long as it can specifically bind template DNA to form a stable complementary bond and serve as a starting point for DNA synthesis. The length of the primer will be determined in consideration of amplification conditions such as temperature, salt concentration of the buffer, and the like. Usually, it is designed and manufactured to have a length in the range of 10 to 100 nucleotides, but it is designed to have a length of 15 to 50 nucleotides since a non-specific binding with the template DNA can be formed when the length of the primer is too short or too long .

The sequence of the primer need not be completely complementary to the template DNA, but it may be designed and manufactured to have a sequence complementarity of preferably 80% or more, in order to form a template-specific binding and obtain a desired amplification product. More preferably, And can be designed and manufactured to have a sequence complementarity of 90% or more.

In the method of the present invention, the amplification step of step (c) may be performed by a polymerase chain reaction (PCR) using primers as described above, Or < / RTI > In general, a kit for amplification of DNA will be used. The DNA amplification kit can be used not only for general PCR but also for SSP (sequence specific primer) -PCR method, NASBA (Nucleic acid sequence-based amplification, transcription-mediated amplification (TMA), strand displacement amplification (SDA), polymerase ligase chain reaction, Gap-filling Ligase Chain Reaction (GCR) Modified PCR reaction methods such as -start PCR, Nested PCR, Multiplex PCR, DOP (degenerate oligonucleotide primer) PCR, Quantitative RT-PCR, In-Situ PCR, Micro PCR or Lab- circle amplification and the like (LCR, Wu, DY et al., Genomics 4: 560, 1989; Barany, PCR Methods and Appl., 1: 5-16, 1991, WO 90/01069; EP 439,182; Kwoh et al., PNAS, USA, 86: 1173, 1989; 5,130,238).

In the method of the present invention, the step of confirming the presence or absence of the amplification product of step (d) may also be carried out using a method known in the art. Generally, an agarose gel or polyacrylamide gel will be used to electrophore amplified products. After electrophoresis, an intercalator such as ethidium bromide, ethidium homodimer-1, ethidium homodimer-2, ethidium derivatives, acridine, acridine orange, acridine derivatives, ethidium-acridine Heterodimers, ethidium monoazides, and the like can be treated to detect and confirm amplification products. Specific detection and confirmation methods are well known in the art. For example, the method described in Nucleic Acid Microarray and the Latest PCR Method, published by Shujunsha, Japan can be referred to.

In the method of the present invention, the step of determining the nucleotide sequence of step (e) may also be carried out using any method known in the art. Methods known in the art include chain terminator sequencing designed by Frederick Sanger based on PCR, chemical degradation sequencing (Maxam-Gilbert Sequencing) designed by Allan Maxam and Walter Gilbert, or Pal Nyren Sequencing, Bridge PCR, Massively parallel signature sequencing (MPSS), Polony sequencing, Illumina (Solexa) sequencing, and Sequencing and Sequencing, respectively, are examples of application and modification of these methods, and pyrosequencing method designed by Mostafa Ronaghi. In addition, it is possible to exemplify SOLiD sequencing, Ion semiconductor sequencing, single molecule real time (SMRT) sequencing, and Nanopore DNA sequencing. Specifically, Sanger et al., Proc Natl Acad Sci USA 1977 Dec; ): 5463-7), Maxam AM and Gilbert W, Proc. Natl. Acad. Sci. U.S.A. 1977 74 (2): 560-4, Ronaghi et al., Science. 1998 Jul 17; 281 (5375): 363-365). Typically, the PRISM® BigDye ™ Terminator Cycle Sequencing ready (ABI) kit or the GS FLX Titanium Sequencing kit XLR70 (454, Roche, Basel), the BigDye® Direct Sanger Sequencing Kit (Invitrogen), Sequenase Version 2.0 DNA Sequencing Kit (affymetrix), AccuPower® DNA Sequencing Kit (bioneer) and PyroMark Q24 Tests (Qiagen) kit.

Through the step of determining the nucleotide sequence of the amplification products, it is possible to simultaneously detect the HLA-B * 5801 allele and the HLA-B * 5701 allele by comparing the calculated nucleotide sequence and the sequence corresponding to the first region.

In another aspect, the present invention relates to a kit for simultaneously detecting an HLA-B * 5801 allele and an HLA-B * 5701 allele.

The kit of the present invention comprises a forward primer designed and constructed on the basis of a sequence located above the first region so that a first region in which HLA-B * 5801 allele and HLA-B * 5701 allele show sequence differences, B * 5801 allele and HLA-B * 5701 allele of the HLA-B * 5801 allele and the HLA-B * 5701 allele to amplify only these alleles And a reverse primer designed and manufactured based on a second region that is a sequence common only between genes.

Specific details of these primers can be found in the above description.

The kit of the present invention can be used as a means for separating DNA from a biological sample, a pretreatment means for a biological sample, a means for amplifying a DNA sequence such as a DNA amplification kit, a means for detecting and confirming an amplification product such as an intercalator, A means for determining the sequence, and the like, and may further include a manual that teaches how to use the kit of the present invention.

The instructions that teach the method of using the kit of the present invention may include a sequence in which some or all of the sequences disclosed by the present invention and / or a part or all of the sequences disclosed by the present invention are compared and aligned, CD, disk, DVD, or the like.

As described above, according to the present invention, it is possible to provide a method and a kit for simultaneously detecting the HLA-B * 5801 allele and the HLA-B * 5701 allele.

According to the present invention, it is possible to specifically detect only the HLA-B * 5801 allele and the HLA-B * 5701 allele, and it is possible to accurately distinguish these two alleles.

Figure 1 shows the sequence of HLA-B * 5701 allele and HLA-B allele including HLA-B * 5801 allele in comparison and alignment, while the HLA-B * 5701 allele and HLA- And the region showing the sequence difference and sequence common between the genes.
Fig. 2 shows an alignment of some sequences of the HLA-B * 5701 allele and the HLA-B * 5801 allele.
Figure 3 shows the electrophoresis results of the PCR amplification products specific for the HLA-B * 5701 allele and the HLA-B * 5801 allele.
Fig. 4 is the nucleotide sequence (sequencing) result of the PCR amplification product.

Hereinafter, the present invention will be described with reference to examples. However, the scope of the present invention is not limited to these embodiments.

< Example  1> DNA  Get samples

To obtain the DNA to be used for the experiment, human whole blood was collected and DNA was isolated with QIAamp Blood Mini kit (QIAGEN, USA).

Specifically, 20 μl of QIAGEN protease was dispensed into a 1.5 ml tube and 200 μl of EDTA-treated whole blood was added. 200 μl of AL buffer was added, and the mixture was vortexed for 15 seconds, followed by incubation for 10 minutes. Thereafter, 200 μl of ethanol (96% -100%) was added to the centrifuged solution for 5 seconds and vortexed. The centrifuged solution for 5 seconds was carefully placed on the QIAamp spin column and centrifuged at 8000 rpm for 1 minute. The column was transferred to a new 2 ml collection tube and 500 μl of AW2 buffer was added and centrifuged at 13000 rpm for 3 min. The filtered solution was discarded and centrifuged again at 13000 rpm for 1 min. After inserting the column into a new 1.5 ml tube, 100 μl of sterilized distilled water or AE buffer was added, followed by incubation at room temperature for 1 minute and centrifugation at 8000 rpm for 1 minute to obtain DNA.

< Example  2> SSP - PCR  Perform

Using the DNA obtained in Example 1, SSP-PCR was performed under the same conditions as in [Table 1]. Taq DNA polymerase (f-Taq, Solgent, Korea) was used for PCR reaction and the temperature, time and number of rotations were controlled with XP-cycler (Bioer, india). The primer sequences for detecting the HLA-B * 5801 allele and the HLA-B * 5701 allele and the beta-globin sequence for the internal control are shown in Table 2. The design of the forward and reverse primers to detect the HLA-B * 5801 allele and the HLA-B * 5701 allele was based on the underlined portion in FIG.

SSP-PCR conditions PCR reaction solution PCR conditions Sterile distilled water 16.4ul 94 ° C, 5 min 1 cycle 10X buffer 2.5ul DNA denaturation 94 ℃, 30 seconds
35 cycles
2 mM dNTP 2ul DNA annealing 62 ° C, 30 seconds Forward primer 0.1ul (10 pmol) DNA extension 72 ° C, 1 minute Reverse primer 0.1ul (10 pmol) 72 ° C, 5 min 1 cycle 5U taq polymerase 0.1ul (0.5 U) DNA 2ul Total volume 25ul

Primer base sequence primer Base sequence HLA-B * 5801 and HLA-B * 5701 primers Forward (SEQ ID NO: 3) GTTCGTGAGGTTCGACAGCGA product size: 121bp Reverse (SEQ ID NO: 4) CTGCGCGGAGGCCTTCATGT Beta globin primer
Forward (SEQ ID NO: 5) GGAGAGCCAAGGACAGGTACG product size: 270bp Reverse (SEQ ID NO: 6) ACCAACTTCATCCACGTTCACC

The PCR product was electrophoresed on 3% agarose gel for 20 minutes and confirmed on UV.

As shown in the results of the experiment shown in FIG. 3, the beta-globin amplification products of the internal control were detected in all the 8 samples. In the samples 5 and 6, the HLA-B * 5801 allele and the HLA-B * 5701 allele No PCR amplification product was detected. These results suggest that the 6 DNA samples except 5 and 6 contain at least one of the HLA-B * 5801 allele and the HLA-B * 5701 allele.

< Example  3> Perform sequencing

After confirming the amplification products generated by the PCR reaction, the presence of HLA-B * 5801 allele and HLA-B * 5701 allele was confirmed by sequencing.

Specifically, 2 μl of the Exo / SAP enzyme mixed solution was added to the PCR amplification product generated through Experimental Example 2, and the reaction was carried out at 37 ° C for 20 minutes and at 80 ° C for 15 minutes. 1 μl of BigDye terminator, 3 μl of 5X sequencing buffer, 1 μl of primer and 5 μl of distilled water were added to 1 μl of the solution, and the mixture was subjected to 25 rotations at 96 ° C. for 20 seconds and at 50 ° C. for 30 seconds using an XP-cycler (Bioer, India) Followed by sequencing PCR at 60 ° C for 2 minutes. The sequencing PCR products were ethanol precipitated and sequenced using ABI3130xl automatic DNA sequencer. The results of the analysis are shown in Fig.

4, 5'-CGGA-3 'base was observed in a specific region (first region) in the case of HLA-B * 5801 whereas 5'-TGGC-3 'Base is observed. As a result, samples No. 1, No. 2, No. 3 and No. 4 were identified as HLA-B * 5801 and samples No. 7 and No. 8 were identified as HLA-B * 5701.

Sample Analysis Results Sample No. HLA-B Sample No. HLA-B One. B5801 5. - 2. B5801 6. - 3. B5801 7. B5701 4. B5801 8. B5701

<110> TW international patent <120> A kit and a method for detecting HLA-B5801 and HLA-B5701 <130> P2013-0001 <160> 7 <170> Kopatentin 2.0 <210> 1 <211> 3384 <212> DNA <213> Homo sapiens <400> 1 tggtgtagga gaagagggat caggacgaag tcccaggtcc cggacggggc tctcagggtc 60 tcaggctccg agagccttgt ctgcattggg gaggcgcagc gttggggatt ccccactccc 120 acgagtttca cttcttctcc caacctgtgt cgggtccttc ttccaggata ctcgtgacgc 180 gtccccattt cccactccca ttgggtgtcg ggtgtctaga gaagccaatc agcgtcgccg 240 cggtcccagt tctaaagtcc ccacgcaccc acccggactc agaatctcct cagacgccga 300 gatgcgggtc acggcacccc gaaccgtcct cctgctgctc tggggggcag tggccctgac 360 cgagacctgg gccggtgagt gcgggtcggc agggaaatgg cctctgtagg gaggagcaag 420 gggaccgcag gcgggggcgc aggacccggg gagccgcgcc gggaggaggg tcgggcgggt 480 ctcagcccct cctcgccccc aggctcccac tccatgaggt atttctacac cgccatgtcc 540 cggcccggcc gcggggagcc ccgcttcatc gcagtgggct acgtggacga cacccagttc 600 gtgaggttcg acagcgacgc cgcgagtccg aggatggcgc cccgggcgcc atggatagag 660 cggaggggc cggagtattg ggacggggag acacggaaca tgaaggcctc cgcgcagact 720 taccgagaga acctgcggat cgcgctccgc tactacaacc agagcgaggc cggtgagtga 780 ccccggcccg gggcgcaggt cacgactccc catcccccac gtacggcccg ggtcgccccg 840 agtctccggg tccgagatcc acccccctga ggccgcggga cccgcccaga ccctcgaccg 900 gcgagagccc caggcgcgtt tacccggttt cattttcagt tgaggccaaa atccccgcgg 960 gttggtcagg gcggggcggg gctcgggggg acggggctga ccgcggggcc ggggccaggg 1020 tctcacatca tccaggtgat gtatggctgc gacgtggggc cggacgggcg cctcctccgc 1080 gggcatgacc agtccgccta cgacggcaag gattacatcg ccctgaacga ggacctgagc 1140 tcctggaccg cggcggacac ggcggctcag atcacccagc gcaagtggga ggcggcccgt 1200 gtggcggagc agctgagagc ctacctggag ggcctgtgcg tggagtggct ccgcagatac 1260 ctggagaacg ggaaggagac gctgcagcgc gcgggtacca ggggcagtgg ggagccttcc 1320 ccatctccta taggtcgccg gggatggcct cccacgagaa gaggaggaaa atgggatcag 1380 cgctagaatg tcgccctccc ttgaatggag aatggcatga gttttcctga gtttcctctg 1440 cgctgaggaa agacagtccc tagaatactg atcaggggtc ccctttgacc cctgcagcag ccttgggaac 1560 cgtgactttt cctctcaggc cttgttctct gcctcacact cagtgtgttt ggggctctga 1620 ttccagcact tctgagtcac tttacctcca ctcagatcag gagcagaagt ccctgttccc 1680 cgctcagaga ctcgaacttt ccaatgaata ggagattatc ccaggtgcct gcgtccaggc 1740 tggtgtctgg gttctgtgcc ccttccccac cccaggtgtc ctgcccattc tcaggctggt 1800 cacatgggtg gtcctagggt gtcccatgag agatgcaaag cgcctgaatt ttctgactct 1860 tcccatcaga ccccccaaag acacatgtga cccaccaccc catctctgac catgaggcca 1920 ccctgaggtg ctgggccctg ggcttctacc ctgcggagat cacactgacc tggcagcggg 1980 atggcgagga ccaaactcag gacaccgagc ttgtggagac cagaccagca ggagatagaa 2040 ccttccagaa gtgggcagct gtggtggtgc cttctggaga agagcagaga tacacatgcc 2100 atgtacagca tgaggggctg ccaaagcccc tcaccctgag atggggtaag gagggggatg 2160 aggggtcata tctcttctca gggaaagcag gagcccttct ggagcccttc agcagggtca 2220 gggcccctca tcttcccctc ctttcccaga gccatcttcc caatccaccg tccccatcgt 2280 gggcattgtt gctggcctgg ctgtcctagc agttgtggtc atcggagctg tggtcgctgc 2340 tgtgatgtgt aggaggaaga gctcaggtag ggaaggggtg aggggtgggg tctgggtttt 2400 cttgtcccac tgggggtttc aagccccagg tagaagtgtt ccctgcctca ttactgggaa 2460 gcagcatgca cacaggggct aacgcagcct gggaccctgt gtgccagcac ttactctttt 2520 gtgcagcaca tgtgacaatg aaggacggat gtatcacctc gatggttgtg gtgttggggt 2580 cctgattcca gcattcatga gtcaggggaa ggtccctgct aaggacagac cttaggagag 2640 cagttggtcc aggacccaca cttgctttcc tcgtgtttcc tgatcctgcc ctgggtctgt 2700 agtcatactt ctggaaattc cttttgggtc caagacgagg aggttcctct aagatctcat 2760 ggccctgctt cctcccagtc ccctcacagg acattttctt cccacaggtg gaaaaggagg 2820 gagctactct caggctgcgt gtaagtggtg ggggtgggag tgtggaggag ctcacccacc 2880 ccataattcc tcctgtccca cgtctcctgc gggctctgac caggtcctgt ttttgttcta 2940 ctccaggcag cgacagtgcc cagggctctg atgtgtctct cacagcttga aaaggtgaga 3000 ttcttggggt ctagagtggg tgggggtggc gggtctgggg cggggtgggg cagaggggaa 3060 aggcctgggt aatggagatt ctttgattgg gatgtttcgc gtgtgtggtg ggctgttcag 3120 agtgtcatca cttaccatga ctcaccagaa tttgttcatg actgttgttt tctgtagcct 3180 gagacagctg tcttgtgagg gactgagatg caggatttct tcacgcctcc cctttgtgac 3240 ttcaagagcc tctggcatct ctttctgcaa aggcacctga atgtgtctgc gtccctgtta 3300 gcctaatgtg aggaggtgga gagacagccc aaccttgtgt ccactgtgac ccctgttccc 3360 atgctgacct gtgtttcctc ccca 3384 <210> 2 <211> 1093 <212> DNA <213> Homo sapiens <400> 2 atgcgggtca cggcgccccg aaccgtcctc ctgctgctct ggggggcagt ggccctgacc 60 gagacctggg ccggctccca ctccatgagg tatttctaca ccgccatgtc ccggcccggc 120 cgcggggagc cccgcttcat cgcagtgggc tacgtggacg acacccagtt cgtgaggttc 180 gacagcgacg ccgcgagtcc gaggacggag ccccgggcgc catggataga gcaggagggg 240 ccggagtatt gggacgggga gacacggaac atgaaggcct ccgcgcagac ttaccgagag 300 aacctgcgga tcgcgctccg ctactacaac cagagcgagg ccgggtctca catcatccag 360 aggatgtatg gctgcgacct ggggcccgac gggcgcctcc tccgcgggca tgaccagtcc 420 gcctacgacg gcaaggatta catcgccctg aacgaggacc tgagctcctg gaccgcggcg 480 gacaccgcgg ctcagatcac ccagcgcaag tgggaggcgg cccgtgtggc ggagcagctg 540 agagcctacc tggagggcct gtgcgtggag tggctccgca gatacctgga gaacgggaag 600 gagacgctgc agcgcgcgga ccccccaaag acacacgtga cccaccaccc cgtctctgac 660 catgaggcca ccctgaggtg ctgggccctg ggcttctacc ctgcggagat cacactgacc 720 tggcagcggg atggcgagga ccaaactcag gacactgagc ttgtggagac cagaccagca 780 ggagatagaa ccttccagaa gtgggcagct gtggtggtgc cttctggaga agagcagaga 840 tacacatgcc atgtacagca tgaggggctg ccgaagcccc tcaccctgag atgggagcca 900 tcttcccagt ccaccatccc catcgtgggc attgttgctg gcctggctgt cctagcagtt 960 gtggtcatcg gagctgtggt cgctactgtg atgtgtagga ggaagagctc aggtggaaaa 1020 ggagggagct actctcaggc tgcgtccagc gacagtgccc agggctctga tgtgtctctc 1080 acagcttgaa aag 1093 <210> 3 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Primer <400> 3 gttcgtgagg ttcgacagcg a 21 <210> 4 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Primer <400> 4 ctgcgcggag gccttcatgt 20 <210> 5 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Primer <400> 5 ggagagccaa ggacaggtac g 21 <210> 6 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Primer <400> 6 accaacttca tccacgttca cc 22 <210> 7 <211> 30 <212> DNA <213> Homo sapiens <400> 7 ggggagacac ggaacatgaa ggcctccgcg 30

Claims (6)

(a) separating DNA from the biological sample,
(b) the forward primer is designed and constructed based on the sequence located upstream of the first region so that the first region, in which the HLA-B * 5801 allele and the HLA-B * 5701 allele show sequence differences, B * 5801 allele and HLA-B * 5701 allele, so that only the allele gene can be amplified by specifically binding only to the HLA-B * 5801 allele and the HLA-B * 5701 allele. A step of designing and producing based on a second region which is a sequence common only between HLA-B * 5701 alleles,
(c) amplifying the DNA using the primer,
(d) confirming the presence or absence of an amplification product, and
(e) determining the base sequence of the amplification product when it is confirmed in the step (d)
The first region is a sequence specified by TGGC with a sequence from the 635th nucleotide to the 638th nucleotide in the sequence of the HLA-B * 5701 allele of SEQ ID NO: 1 and the sequence specified by TGGC in the HLA-B * 5801 allele sequence of SEQ ID NO: 2 To the 209 &lt; th &gt; nucleotide of the first nucleotide to the second nucleotide,
The second region is a sequence from the 685th nucleotide to the 714th nucleotide in the sequence of the HLA-B * 5701 allele of SEQ ID NO: 1 and the 285th nucleotide from the 256th nucleotide in the HLA-B * 5801 allele sequence of SEQ ID NO: Nucleotide sequence of SEQ ID NO: 7.
Methods for simultaneous detection of HLA-B * 5801 allele and HLA-B * 5701 allele.
The method according to claim 1,
Wherein said biological sample is blood.
The method according to claim 1,
The forward primer has the nucleotide sequence of SEQ ID NO: 3
Wherein the reverse primer has the nucleotide sequence of SEQ ID NO: 4.
(a) a forward primer designed and constructed on the basis of a sequence located above the first region so that a first region in which HLA-B * 5801 allele and HLA-B * 5701 allele show sequence differences is amplified
B * 5801 allele and HLA-B * 5701 allele in order to specifically bind only to the HLA-B * 5801 allele and the HLA-B * 5701 allele, A reverse primer designed and constructed based on a second region which is a sequence common only between 5701 alleles,
The first region is a sequence specified by TGGC with a sequence from the 635th nucleotide to the 638th nucleotide in the sequence of the HLA-B * 5701 allele of SEQ ID NO: 1 and the sequence specified by TGGC in the HLA-B * 5801 allele sequence of SEQ ID NO: 2 To the 209 &lt; th &gt; nucleotide of the first nucleotide to the second nucleotide,
The second region is the sequence from the 685th nucleotide to the 714th nucleotide in the sequence of the HLA-B * 5701 allele of SEQ ID NO: 1 and the 285th nucleotide from the 256th nucleotide in the HLA-B * 5801 allele sequence of SEQ ID NO: Nucleotide sequence of SEQ ID NO: 7.
HLA-B * 5801 allele and HLA-B * 5701 allele simultaneous detection kit.
5. The method of claim 4,
Wherein the forward primer has the nucleotide sequence of SEQ ID NO: 3,
Wherein the reverse primer has the nucleotide sequence of SEQ ID NO: 4.
5. The method of claim 4,
The kit includes means for isolating DNA from biological samples, means for pretreating biological samples, means for amplifying DNA sequences such as DNA amplification kits, means for detecting and confirming amplification products, means for determining DNA sequence identity, And one or more of the manuals instructing how to use the kit.

Images