CN108624676B

CN108624676B - Kit for detecting HLA-B5801 allele and detection method and application thereof

Info

Publication number: CN108624676B
Application number: CN201810499371.7A
Authority: CN
Inventors: 叶绍云; 万楠; 刘国凤; 杨小娟; 蒋峻峰; 袁海琴; 孟浩浩; 叶强
Original assignee: Genowise Corp
Current assignee: Genowise Corp
Priority date: 2018-05-23
Filing date: 2018-05-23
Publication date: 2022-04-01
Anticipated expiration: 2038-05-23
Also published as: CN108624676A

Abstract

The invention discloses a kit for detecting HLA-B5801 allele, a detection method and application thereof, belonging to the technical field of biological detection. The kit comprises a primer for determining the typing of a sample to be detected as HLA-B58 and a primer for determining the typing of the detected HLA-B58 sample as HLA-B5801; according to the invention, the false positive rate can be reduced by designing the primer of the target segment to be detected, enriching the primer by PCR amplification, and detecting the amplified detection primer of the target segment to be detected by PCR amplification; the detection result can be more accurate through the two pairs of designed specific primers and the two pairs of detection primers corresponding to the specific primers, wherein the first pair of specific primers and the first detection primer can determine that the sample to be detected is typed as HLA-B58; the second pair of specific primers and the second detection primer can determine that the type of the sample to be detected is HLA-B5801; the interference excluding non-specific amplification is strong.

Description

Kit for detecting HLA-B5801 allele and detection method and application thereof

Technical Field

The invention relates to a kit for detecting HLA-B5801 allele, a detection method and application thereof, belonging to the technical field of biological detection.

Background

At present, common medicaments for treating gout comprise colchicine, benzydomone, Allopurinol (Allopurinol) and the like; colchicine is a first-line medicament for treating gout at present, can inhibit the migration of multinucleated cells to joints and inhibit the phagocytic function of the multinucleated cells, and simultaneously inhibit cells entering joint cavities from releasing lactic acid and lysosome enzyme, prevent the mitosis of the cells and can quickly relieve pain. However, since colchicine has direct inhibition effect on bone marrow and can cause serious adverse reactions such as granulocytopenia, aplastic anemia and the like, the colchicine is only used as an analgesic in the acute attack stage of gout. The benzydomone and allopurinol are commonly used in the remission stage of gout symptoms, but the action mechanisms of the benzydomone and allopurinol are completely different, wherein the benzydomone is a uric acid excretion promoting drug and has strong and reversible inhibition effect on a renal proximal convoluted tubule urate-anion exchange system, so that the reabsorption of uric acid is reduced, and the effect of reducing the blood uric acid is achieved; allopurinol is used as a medicament for resisting uric acid synthesis, and both allopurinol and its metabolite oxypurinol can inhibit xanthine oxidase and prevent hypoxanthine and xanthine from being metabolized into uric acid, so that the generation of uric acid is reduced, the content of uric acid in blood and urine is reduced to a level below the solubility, and uric acid is prevented from forming crystals and depositing in other tissues. As an inhibitor of the last step of the uric acid synthesis process, allopurinol is one of a few medicines capable of inhibiting the production of uric acid at present; when the gout is serious, the medicine is combined with the uricosuric drug of the smelly strychnine to strengthen the curative effect.

Therefore, allopurinol is most suitable for primary and secondary gout patients who have excessive uric acid production, are allergic or ineffective to uric acid discharge drugs and are not suitable for using uric acid discharge drugs (such as renal insufficiency). Approximately 5% of patients taking allopurinol experience severe adverse skin reactions, including Steven-Johnson syndrome (SJS) and Toxic Epidermal Necrolysis (TEN). Steven-Johnson syndrome is characterized by severe erythema multiforme, can affect skin and mucosa, including mouth, nose, eye, vagina, urethra, gastrointestinal tract and lower respiratory tract mucosa, even has blindness, and further develops toxic epidermal necrolysis, general ulceration of the mucous membrane, and loose large blister or epidermal peeling on the erythema; if mild touch or pull can result in extensive peeling of the epidermis, the reported lethality rate for SJS/TEN can reach 26%.

Therefore, the clinical use of allopurinol is greatly limited at present, but due to the uniqueness of the action mechanism, no other medicine can replace the inhibition effect on the generation of uric acid, and an indication patient only can take the medicine at the risk of having serious adverse reaction at any time. Meanwhile, as a delayed-type anaphylactic reaction, the SJS/TEN usually has symptoms after being taken for a plurality of weeks, and patients generally see a diagnosis at first in dermatology after dermatitis appears, so that missed diagnosis and misdiagnosis are easily caused once the medication history is unclear, and the timing of stopping taking medicine and treating is delayed.

The HLA (human leukocyte antigen) system is encoded by multiple alleles closely linked to the short arm of human chromosome 6, is the region with the highest gene density and most abundant polymorphism in the currently known human chromosomes, and is mainly responsible for mutual recognition among cells, induction of immune response and regulation of immune response in the immune system. Mainly comprises HLA-A, HLA-B, HLA-C, HLA-DR, HLA-DQ and HLA-DP. Polymorphism of HLA genes determines differences in the HLA protein molecules expressed between individuals and also determines differences in the ability of different individuals to process and present the same antigen, which is the most fundamental point of induction and regulation of immune responses, so that immune responses of different individuals to the same antigen may exhibit individual differences. Such individual differences either produce protective immunity, or develop immune tolerance, or develop an autoimmune predisposition, or manifest as an HLA-associated disease. Such as: HLA-B5801, HLA-B1502 allele are all associated with drug allergy; the HLA-B × 5801 allele is associated with allopurinol caused Stevens-Johnson syndrome/toxic epidermal necrolysis (Stevens-Johnson syndrome/toxin epiermal necrolysis, SJS/TEN). 100% of patients with severe adverse reactions after taking allopurinol were present, while in patients without adverse reactions (tolerant group) and normal control group, the carrying rate was only 15% and 20% of those with HLA-B5801 positive in Han nationality of China and Thailand were higher than that in white people (6-8% to 2%), and the risk of developing hypersensitivity was greater.

Given the high degree of polymorphism and complexity of the HLA system and the numerous studies that demonstrate that severe allopurinol-related hypersensitivity is closely related to leukocyte anti-HLA-B5801, it was determined that the method of HLA allele detection is different from that of the common polymorphic sites. The existing detection methods mainly comprise an electrophoresis technology, a fluorescent probe technology, a sequencing technology and the like.

However, because of sequence polymorphism of HLA gene family, this technique has been rarely applied to the detection of HLA-B x 5801 allele in comparison with the detection of HLA allele, and the fundamental reason is that many HLA-B alleles have extremely high sequence homology (90% or more) with HLA-B x 5801, and it is very difficult to design a primer probe set suitable for multicolor fluorescence PCR reaction to amplify HLA-B x 5801 allele with high specificity.

Disclosure of Invention

The invention aims to provide a kit for detecting HLA-B5801 allele, a detection method and application thereof, so that the HLA-B5801 allele can be detected by a fluorescence PCR method, the specificity is high, and the detection result is accurate.

Unless otherwise indicated, "R" and "Q" herein are referred to as "fluorescent groups" and "quenching groups", respectively.

Unless otherwise indicated, the terms "HLA-B5801-P1" and "HLA-B5801-P2" are used herein to refer to two detection sites, respectively, and the primers thereof are referred to as a first pair of specific primers and a second pair of specific primers, respectively.

In order to achieve the purpose, the invention provides the following technical scheme:

the first purpose of the invention is to provide a primer for detecting HLA-B5801 allele, which comprises a primer for determining the typing of a sample to be detected as HLA-B58 and a primer for determining the typing of the determined HLA-B58 sample as HLA-B5801.

In one embodiment of the present invention, the primers for determining the type of the sample to be detected as HLA-B58 comprise a first pair of specific primers and a first detection primer, wherein:

the upstream primer in the first pair of specific primers comprises a nucleotide sequence shown as SEQ ID NO. 1 and 0-5 arbitrary bases connected with the upstream primer at the 5' end,

SEQ ID NO:1：GTCTGCGCGGAGGCCTTCAT；

the downstream primer in the first pair of specific primers comprises a nucleotide sequence shown as SEQ ID NO. 2 and 0-5 arbitrary bases connected with the 5' end of the downstream primer,

SEQ ID NO:2：CGCGAGTCCGAGGACGGA；

the first detection primer is a nucleotide sequence shown as SEQ ID NO. 3,

GCCTTCATGTTCCGTGTCTCCCC(SEQ ID NO:3)；

the primers for detecting the determined HLA-B58 sample with the HLA-B5801 typing comprise a second pair of specific primers and a second detection primer, wherein,

the upstream primer in the second pair of specific primers comprises a nucleotide sequence shown as SEQ ID NO. 4 and 0-5 arbitrary bases connected with the 5' end of the upstream primer,

SEQ ID NO:4：CCGTGTGGCGGAGCAGCT；

the downstream primer in the second pair of specific primers comprises a nucleotide sequence shown as SEQ ID NO. 5 and 0-5 arbitrary bases connected with the 5' end of the downstream primer,

SEQ ID NO:5：CCGCGCGCTGCAGCGTCT；

the second detection primer is a nucleotide sequence shown as SEQ ID NO. 6,

SEQ ID NO:6：GAGCCTACCTGGAGGGCCT。

in one embodiment of the invention, the first detector primer is linked to linker sequence 1 at the 5 'end and the second detector primer is linked to linker sequence 2 at the 5' end; or the first detection primer is connected with the joint sequence 2 at the 5 'end, and the second detection primer is connected with the joint sequence 1 at the 5' end;

the linker sequence 1 is a nucleotide sequence shown as SEQ ID NO: 17:

SEQ ID NO:17：TTCATTAGCGGCGCAATTT；

the linker sequence 2 comprises a nucleotide sequence shown as SEQ ID NO. 18 and 0-5 arbitrary bases connected with the 5' end:

SEQ ID NO:18：CTAGCCCGAACGAATACTCA。

the second purpose of the invention is to provide the application of the primer in detecting HLA-B5801 allele.

The third purpose of the invention is to provide a kit for detecting HLA-B5801 allele, which comprises the primer.

In one embodiment of the invention, the primer also comprises an internal reference primer, wherein the upstream primer of the internal reference primer comprises the nucleotide sequence shown in SEQ ID NO. 7,

7, SEQ ID NO: R-TCGCTCCGTCAGGCTTTCGGTGACGTGGACATCCGC AAA, wherein R represents a fluorescent group, and 0-5 arbitrary bases are connected between the R and the 5' end;

the downstream primer of the internal reference primer comprises a nucleotide sequence shown in SEQ ID NO. 8,

8, SEQ ID NO: GGAAAGACACCCACCTTGATCT-Q, wherein Q represents a quencher gene, and 0-5 arbitrary bases are connected between Q and the 5' end.

In one embodiment of the invention, the fluorescent probe comprises a positive strand probe and a negative strand probe, wherein the positive strand probe comprises an oligonucleotide positive strand sequence and a linker sequence II, and the negative strand probe comprises an oligonucleotide negative strand sequence complementary to the oligonucleotide positive strand sequence; the oligonucleotide positive strand sequence adopts a sequence shown as SEQ ID NO: 9-12; the oligonucleotide negative strand sequence adopts a sequence shown as SEQ ID NO: 13-16; the linker sequence II is represented by SEQ ID NO: 19-22; the 5 'end of the positive strand probe is connected with a fluorescent group, and the 3' end of the negative strand probe is connected with a quenching group.

In one embodiment of the invention, the fluorophore comprises FAM, TET, Texas Red, VIC or Cy5 and the quencher comprises BHQ1 and/or BHQ 2.

A fourth object of the present invention is to provide a method for detecting HLA-B x 5801 allele, comprising the steps of:

1) mixing the upstream and downstream primers of the first pair of specific primers and the upstream and downstream primers of the second pair of specific primers into a mixed primer 1;

2) mixing the universal fluorescent probe, the first detection primer, the second detection primer, the downstream primer of the first pair of specific primers and the downstream primer of the second pair of specific primers into a mixed primer 2;

3) extracting the genome DNA of the sample;

4) configuring the mixed primer 1 into a PCR reaction system, and carrying out PCR amplification on the genomic DNA extracted in the step 3) to obtain a target fragment to be detected;

5) configuring the mixed primer 2 into a PCR reaction system, and carrying out real-time fluorescence PCR detection on the target fragment to be detected obtained by amplification in the step 4)

6) And analyzing the result according to the fluorescence signal intensity detected in real time.

In an embodiment of the present invention, in step 5), the method further includes mixing an upstream primer and a downstream primer of the reference primer to obtain a mixed primer 3, and then performing real-time fluorescence PCR detection on the reference gene during the real-time fluorescence PCR detection on the target fragment to be detected.

The fifth purpose of the invention is to provide the application of the kit in detecting HLA-B5801 allele.

The invention has the beneficial effects that: by designing two primers of target fragments to be detected, enriching the primers by PCR amplification, and performing PCR amplification detection on the amplified two detection primers of the target fragments to be detected to determine that the sample to be detected is classified into HLA-B5801, the false positive rate can be reduced; the detection result can be more accurate through the two pairs of designed specific primers and the two pairs of detection primers corresponding to the specific primers, wherein the first pair of specific primers and the first detection primer can determine that the sample to be detected is typed as HLA-B58; the second pair of specific primers and the second detection primer can determine that the type of the sample to be detected is HLA-B5801; in addition, the detection accuracy can be further improved through the internal reference primer; and compared with the sequencing result, the detection accuracy reaches 100%; the single tube simultaneously detects the specific sequence and the characteristic sequence, the detection result is easy to be distinguished, and the method is compared with a single probe detection method to eliminate the interference of non-specific amplification, such as HLA-B5802 and the like; compared with an electrophoresis method, the method realizes the simultaneous detection of two sites of a single tube, has no pollution and high accuracy; the expensive TaqMan probe does not need to be synthesized, and the research and development cost and the detection cost are extremely low.

The foregoing description is only an overview of the technical solutions of the present invention, and in order to make the technical solutions of the present invention more clearly understood and to implement them in accordance with the contents of the description, the following detailed description is given with reference to the preferred embodiments of the present invention and the accompanying drawings.

Drawings

FIG. 1 is a schematic diagram showing the design of a first pair of specific primers in an embodiment of the present invention;

FIG. 2 is a schematic diagram showing the design of a second pair of specific primers in the example of the present invention;

FIG. 3 is a graph showing the amplification results of a target fragment in examples of the present invention;

FIG. 4 is a graph showing the amplification results of the reference primers in the examples of the present invention;

FIG. 5 is a graph showing the results of detection of a sample to be detected in the example of the present invention;

FIG. 6 shows the sequencing results of the positive samples after the specific primers HLA-B5801-P1 were amplified in the present example, and HLA-B5801-P1 and HLA-B5801-P2;

FIG. 7 is a graph showing the results of sequencing after amplification of specific primers for HLA-B5801-P2 in a positive sample according to an embodiment of the present invention;

FIG. 8 is a graph showing the results of testing 101 clinical samples according to the present invention.

Detailed Description

The following detailed description of embodiments of the present invention is provided in connection with the accompanying drawings and examples. The following examples are intended to illustrate the invention but are not intended to limit the scope of the invention.

Unless otherwise indicated, the reagents in the following examples are of analytical grade and are commercially available from a regular channel.

Example 1: design of primers

The data of all HLA alleles required for PCR primer design are derived from HLAAlles, and the specific website is as follows: http:// hla. allolines. org/allolines/text _ index. html. The primers are designed by adopting a manual method, and are compared in an IMGT database, so that the primers are confirmed to be capable of specifically binding to HLA-B5801 allele. Two sites are selected to design primers, one site is marked as HLA-B5801-P1, the corresponding primers are a first pair of specific primers, one site is marked as HLA-B5801-P2, the corresponding primers are a second pair of specific primers, the design principle of the first pair of specific primers is shown in figure 1, and the design principle of the second pair of specific primers is shown in figure 2.

The design of the internal reference primer and the universal fluorescent probe specifically refers to patent CN 105861706A. The universal fluorescent probe comprises a positive strand probe and a negative strand probe, wherein the positive strand probe comprises an oligonucleotide positive strand sequence and a linker sequence II which are sequentially connected from a5 'end to a 3' end, and the negative strand probe comprises an oligonucleotide negative strand sequence which is complementary with the oligonucleotide positive strand sequence;

the oligonucleotide positive strand sequence adopts a sequence shown as SEQ ID NO: 9-12;

R-CCCGCCGCGTAGATCGAATA(SEQ ID NO：9)

R-CCAAGGCCGATCGCATGTTC(SEQ ID NO：10)

R-ACCTTCGGATCGCGGGTCT(SEQ ID NO：11)

R-CCTCCGAATCCGCCGTCGTACAAG(SEQ ID NO：12)

the oligonucleotide negative strand sequence adopts a sequence shown as SEQ ID NO: 13-16;

TATTCGATCTACGCGGCGGG-Q(SEQ ID NO：13)

GAACATGCGATCGGCCTTGG-Q(SEQ ID NO：14)

AGACCCGCGATCCGAAGGT-Q(SEQ ID NO：15)

CTTGTACGACGGCGGATTCGGAGG-Q(SEQ ID NO：16)

the 5 'end of the positive strand probe is connected with a fluorescent group, and the 3' end of the negative strand probe is connected with a quenching group.

Fluorophores (R) include FAM, TET, Texas Red, VIC or Cy5, and quenching groups (Q) include BHQ1 and/or BHQ 2.

The linker sequence II is as shown in SEQ ID NO: 19-22, or a pharmaceutically acceptable salt thereof, wherein:

TTCATTAGCGGCGCAATTT(SEQ ID NO：19)

CTAGCCCGAACGAATACTCA(SEQ ID NO：20)

TGATACAACCCGTAACCGT(SEQ ID NO：21)

ACTCATCGATCCCGCATAC(SEQ ID NO：22)

the invention uses primer and general fluorescent probe, which are synthesized by Suzhou Jinzhi Biotechnology GmbH.

The specific primer design results are shown in table 1 below:

table 1 primer List

Example 2: amplification of target fragments in a test sample

S1, extracting genome DNA of the sample (the sample source comprises human saliva, blood, tissues and the like);

s2, mixing the upstream primer and the downstream primer of HLA-B5801-P1 and HLA-B5801-P2 to form a mixed primer 1 (namely the upstream primer and the downstream primer of the first pair of specific primers and the second pair of specific primers) for later use;

s3, configuring the mixed primer 1 into a PCR reaction system, and enriching the target fragment to be detected, wherein the PCR result is an enriched product; wherein the reaction system is 12 muL, and comprises 2 XTaKaRa TaqTMHS Perfect Mix 6u1, the mixed primer 1 is 1 muL, and the DNA5 muL.

The amplification results are shown in FIG. 3, which shows that the target fragments HLA-B5801-P1 and HLA-B5801-P2 are obtained by amplification.

Example 3: detection of a sample to be tested

S1, mixing the universal fluorescent probe, the first detection primer and the second detection primer as the upstream primer, the downstream primer of the first pair of specific primers and the downstream primer of the second pair of specific primers according to a certain proportion to form a mixed primer 2 for later use;

s2, mixing the upstream primer and the downstream primer of the internal reference primer into a mixed primer 3 according to a certain proportion for later use;

s3, placing the mixed primer 2 into a PCR reaction system, and carrying out real-time fluorescence PCR detection on the target fragment to be detected; wherein the reaction system is 15 mu L, comprises 2X TaKaRa TaqTMHS Perfect Mix 6 mu L, the mixed primer 2 is 4 mu L, and the enrichment product is 5 mu L;

s4, detecting an internal reference gene ACTB while carrying out real-time fluorescent PCR detection on the target fragment to be detected in the step S3; wherein the reaction system is 15 mu L, comprises 2X TaKaRa TaqTMHS Perfect Mix 6 mu L, the mixed primer 3 is 4 mu L, and the enrichment product is 5 mu L;

s5, analyzing the result according to the fluorescence signal intensity detected in real time, wherein the detection result of the reference gene ACTB is shown in figure 4, and the successful amplification of the reference gene can be seen from figure 4; the detection result of the target fragment to be detected is shown in FIG. 5, and it can be seen from FIG. 5 that the method of the present invention can well separate the target gene to be detected from other loci, and is suitable for genotyping detection of a plurality of gene loci. And (3) judging the specific detection result, namely judging that the sample contains the HLA-B5801 allele when the HLA-B5801-P1 and the HLA-B5801-P2 specific primers have detection fluorescent signals.

Example 4: testing and validation of test samples

101 clinical samples (obtained from the Hunan elegant three Hospital, Central and south university, and all patients signed informed consent) were tested according to the method of examples 2-3, and the results showed that 12 of the samples were positive, and the detection rate was 11.9%, and the specific results are shown in FIG. 8, in which 11.9% of the samples were positive only when tested using HLA-B5801-P1 and HLA-B5801-P2, i.e., the sample was typed as HLA-B5801.

Then, positive samples are selected again, sequencing verification is carried out on the selected positive samples, the results are shown in fig. 6-7, and the results show that the positive samples are really HLA-B5801-P1 and HLA-B5801-P2 amplified by two pairs of designed specific primers, which shows that the accurate matching degree of the detection method is 100%, and the detection method is high in accuracy and strong in interference rejection capacity.

In addition, the applicant also adds 4-5 bases at the 5 ends of the primers with asterisks in the primers listed in the table 1 to carry out specific detection, and the results show that the primers can effectively determine the typing of the sample to be detected as HLA-B5801, and the accurate matching degree of the detection is 100 percent, further, the detection method is high in accuracy and strong in interference elimination capability.

The above-mentioned embodiments are merely preferred embodiments for fully illustrating the present invention, and the scope of the present invention is not limited thereto. The equivalent substitution or change made by the technical personnel in the technical field on the basis of the invention is all within the protection scope of the invention. The protection scope of the invention is subject to the claims.

Claims

1. A primer for detecting HLA-B5801 allele, which is characterized by comprising a primer for determining the typing of a sample to be detected as HLA-B58 and a primer for detecting the typing of the determined HLA-B58 sample as HLA-B5801;

the primers for determining the type of the sample to be detected as HLA-B58 comprise a first pair of specific primers and a first detection primer, wherein:

in the first pair of specific primers, the nucleotide sequence of the upstream primer is shown as SEQ ID NO. 1, the nucleotide sequence of the downstream primer is shown as SEQ ID NO. 2,

the nucleotide sequence of the first detection primer is shown as SEQ ID NO. 3;

the primers for detecting the determined HLA-B58 sample with the HLA-B5801 classification comprise a second pair of specific primers and a second detection primer, wherein:

in the second pair of specific primers, the nucleotide sequence of the upstream primer is shown as SEQ ID NO. 4, the nucleotide sequence of the downstream primer is shown as SEQ ID NO. 5,

the nucleotide sequence of the second detection primer is shown as SEQ ID NO. 6.

2. The primer for detecting HLA-B x 5801 allele according to claim 1, wherein the first detection primer is linked at the 5 'end to a linker sequence 1 and the second detection primer is linked at the 5' end to a linker sequence 2; or the first detection primer is connected with the joint sequence 2 at the 5 'end, and the second detection primer is connected with the joint sequence 1 at the 5' end; the nucleotide sequence of the linker sequence 1 is shown as SEQ ID NO: 17; the nucleotide sequence of the linker sequence 2 is shown in SEQ ID NO 18.

3. Use of a primer according to claim 1 or 2 for the preparation of a reagent for the detection of the HLA-B5801 allele.

4. A kit for detecting HLA-B5801 alleles, comprising: comprising the primer of claim 2.

5. The kit of claim 4, further comprising a universal fluorescent probe, wherein the universal fluorescent probe comprises a plus strand probe and a minus strand probe, the plus strand probe comprises a plus oligonucleotide strand sequence and a linker sequence II which are sequentially connected from 5 'end to 3' end, and the minus strand probe comprises a minus oligonucleotide strand sequence complementary to the plus oligonucleotide strand sequence; the oligonucleotide positive strand sequence is SEQ ID NO: 9-12; the oligonucleotide negative strand sequence is SEQ ID NO: 13-16; the linker sequence II is SEQ ID NO: 19-22; the 5 'end of the positive strand probe is connected with a fluorescent group, and the 3' end of the negative strand probe is connected with a quenching group.

6. A method for detecting HLA-B5801 alleles using the kit of claim 5 for non-diagnostic, non-therapeutic purposes, comprising the steps of:

3) extracting the genome DNA of the sample;

4) carrying out PCR amplification on the genomic DNA extracted in the step 3) by using the mixed primer 1 to obtain a target fragment to be detected;

5) and (3) carrying out real-time fluorescence PCR detection on the target fragment to be detected obtained by amplification in the step (4) by using the mixed primer 2.

7. Use of a kit according to claim 4 or 5 for the detection of the HLA-B5801 allele for non-diagnostic, non-therapeutic purposes.