CN105861706A - Universal probe for real-time fluorescent PCR and detection method and application of universal probe - Google Patents
Universal probe for real-time fluorescent PCR and detection method and application of universal probe Download PDFInfo
- Publication number
- CN105861706A CN105861706A CN201610329478.8A CN201610329478A CN105861706A CN 105861706 A CN105861706 A CN 105861706A CN 201610329478 A CN201610329478 A CN 201610329478A CN 105861706 A CN105861706 A CN 105861706A
- Authority
- CN
- China
- Prior art keywords
- sequence
- probe
- real
- primer
- pcr
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6858—Allele-specific amplification
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Biophysics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Immunology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Analytical Chemistry (AREA)
- Physics & Mathematics (AREA)
- Biotechnology (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention relates to the field of real-time florescent PCR, in particular to a universal probe for real-time fluorescent PCR and a detection method and application of the universal probe. The universal probe comprises a positive chain probe and a negative chain probe, wherein the positive chain probe comprises an oligonucleotide positive chain sequence and a connector sequence which are connected in sequence from a 5' end to a 3' end; the negative chain probe comprises an oligonucleotide negative chain sequence which is supplemented with the oligonucleotide positive chain sequence; a fluorescent group is connected to the 5' end of the positive chain probe; a quenching group is connected to the 3' end of the negative chain probe. By adopting the detection method and the application of the universal probe for real-time fluorescent PCR, real-time detection can be achieved, no later PCR treatment is needed, the design and synthesis time can be shortened, the cost can be lowered, and the result is good in stability and easy to analyze.
Description
Technical field
The present invention relates to real-time fluorescence PCR field, particularly relate to a kind of general probe for real-time fluorescence PCR and inspection thereof
Survey methods and applications.
Background technology
In prior art, the application in PCR of the fluorescein labeling method, it is mainly reflected in fluorescent primer or fluorescent probe two
Individual aspect.
Wherein, the method for fluorescent primer, mainly there are direct labeled primer or labelling adapter-primer, and PCR primer uses
Genetic analyzer, as ABI genetic analyzer 310,3130,3130xl, 3730 etc., be generally used for detecting microsatellite and gene divide
Type, such as Chinese patent notification number are the patent of invention of CN104178566, i.e. disclose a kind of microsatellite that can be used for and detect many
Weight fluorescent PCR universal joint and detection method and application, its design of primers figure and overhaul flow chart are the most as depicted in figs. 1 and 2.
The shortcoming of this technology includes: a) can not realize detecting in real time；B) profiling results analyzes difficulty, easily judges by accident；C) locate after PCR primer needs
Reason, easy pollution detection environment.
Fluorescent probe can be divided into again hydrolysis probes and hybridization probe, the detection of its fluorescence signal mainly to pass through real time fluorescent quantitative
PCR instrument is carried out.Wherein, 1) hydrolysis probes: as it is shown on figure 3, illustrate as a example by TaqMan probe, the 5' end of hydrolysis probes and
3' end marked a reporter fluorescence group and a quenching fluorescence group respectively, when probe is complete, system excited donor and
The quenching group that the fluorescence signal produced is closed on absorbs, so now can't detect donor fluorescent signal；And during PCR
When Taq archaeal dna polymerase expands the site that probe combines masterplate, the activity of its 5'-3' exonuclease cuts away probe 5' end
The free reporter group of reporter group away from quenching group, break the transmission of energy, excite that reporter group produces is glimmering
Optical signal just can be detected by fluorescence detecting system, and detection is the accumulation of signal.This TaqMan probe technology, needs pin
Genes of interest or mutational site are designed specific probe, and different genes or mutational site need to redesign, synthesize, and there is cost
High and time-consuming problem.2) hybridization probe, during renaturation, two specific probe hybridization are in template, close to each other and produce detection letter
Number, to intensification denatured probe away from template, no signal, detection is real-time fluorescent signals.
Molecular beacon (Molecular beacon, MB) is that a kind of stem ring double labelling oligonucleotide in hairpin structure is visited
Pin, the nucleic acid array complementation pairing at two ends, fluorophor be marked at the quenching group of the other end immediately adjacent to, in renaturation temperature
Under, template not in the presence of, formed loop-stem structure, when heat denatured can make the stem ring double-strand of complementary pairing untie, as shown in Figure 4,
If with the presence of template ring sequence, molecular beacon will match with template.After matching with template, molecular beacon will become chain rather than send out
Clip-like so that fluorophor separates with quencher.When fluorophor is excited, quenching effect is released from, and sends excitation photon.
This molecular beacons technology, is required for genes of interest or mutational site design specific probe, different genes or mutational site
Need to redesign, synthesize, there is costly and time consuming problem；Additionally need to be detected by melting curve Tm peak value, detection
Sensitivity is limited.
Summary of the invention
For solving above-mentioned technical problem, it is an object of the invention to provide a kind of realization and detect, without the follow-up place of PCR in real time
Reason, save design and generated time, reduction cost, result good stability and be prone to general for real-time fluorescence PCR analyzed
Probe and detection method thereof and application.
First aspect present invention provides a kind of general probe for real-time fluorescence PCR, visits including normal chain probe and minus strand
Pin, described normal chain probe includes oligonucleotide positive strand sequence and the joint sequence being sequentially connected by 5 ' ends to 3 ' ends, described negative
Chain probe includes the oligonucleotide negative strand sequence complementary with oligonucleotide positive strand sequence, and 5 ' ends of described normal chain probe connect
Having fluorophor, 3 ' end connections of described minus strand probe have quenching group.
Further, the Tm value of described oligonucleotide positive strand sequence is more than the Tm value of joint sequence.
It should be noted that, in order to realize the general probe general detection in the biology of a certain classification, described oligomerization core
Thuja acid positive strand sequence carry out the sequence that the purpose that detects is biological with this general probe of joint sequence and employing compared with without homology or
Sequence similarity is less than 30%.
It should be noted that, homology refers to come from the relation between germanus branch, homology in evolutionary process
Describe evolutionary relationship between species, so-called homologous sequence, refer to be formed through divergent evolution from a certain common ancestor
Different sequences.Similarity detects same DNA base between sequence and target sequence for describing during referring to sequence alignment
Or the height of amino acid residue order proportion.It is generally believed that the similarity (similarity) between sequence is the highest, sequence
Between the probability of homology the biggest.When similarity degree is higher than 50%, it is easier to speculate that detection sequence and target sequence may
It it is homologous sequence；And when degree of similarity is less than 20%, be just difficult to determine or cannot determine at all that both have homology.
About the design of general probe, if purpose biology is eukaryote, the most described oligonucleotide positive strand sequence can root
Design according to yeast genome sequence.
Further, described oligonucleotide positive strand sequence uses the nucleoside shown in as any one of SEQ ID NO:1-4
Acid sequence.Its sequence information is specific as follows:
R-CCCGCCGCGTAGATCGAATA (SEQ ID NO:1)
R-CCAAGGCCGATCGCATGTTC (SEQ ID NO:2)
R-ACCTTCGGATCGCGGGTCT (SEQ ID NO:3)
R-CCTCCGAATCCGCCGTCGTACAAG (SEQ ID NO:4)
Wherein, R represents fluorophor.
Accordingly, described oligonucleotide negative strand sequence uses the nucleotide shown in as any one of SEQ ID NO:5-8
Sequence.Its sequence information is specific as follows:
TATTCGATCTACGCGGCGGG-Q (SEQ ID NO:5)
GAACATGCGATCGGCCTTGG-Q (SEQ ID NO:6)
AGACCCGCGATCCGAAGGT-Q (SEQ ID NO:7)
CTTGTACGACGGCGGATTCGGAGG-Q (SEQ ID NO:8)
Wherein, Q represents quenching group.
If it should be noted that, purpose biology is eukaryote, the most described joint sequence can be according to the 16s rDNA of antibacterial
Sequential design forms.
Further, described joint sequence uses the nucleotide sequence shown in as any one of SEQ ID NO:9-12.Its
Sequence information is specific as follows:
TTCATTAGCGGCGCAATTT (SEQ ID NO:9)
CTAGCCCGAACGAATACTCA (SEQ ID NO:10)
TGATACAACCCGTAACCGT (SEQ ID NO:11)
ACTCATCGATCCCGCATAC (SEQ ID NO:12)
Further, described fluorophor includes but not limited to FAM, TET, Texas Red, VIC or Cy5, described cancellation
Group includes but not limited to BHQ1 or BHQ2.
Second aspect present invention a kind of employing of offer is previously used for the detection method of the general probe of real-time fluorescence PCR, bag
Include following steps:
S1, the genomic DNA of extraction sample；
S2, general probe, specific upstream primer and downstream primer are mixed into mix primer by a certain percentage；
S3, preparation PCR reaction system, carry out real-time fluorescent PCR amplification；
The fluorescence signal intensity of S4, basis detection in real time carries out interpretation of result；
Wherein, described specific upstream primer includes the catenation sequence identical with general probe center tap sequence, Yi Jiyu
The specific primer sequences that the target sequence of target gene is complementary mutually.
It should be noted that, for low abundance target sample or the sample of nucleic acid of the low response rate, after step S1 also
Forward primer (FP) and the step of downstream primer (RP) amplification pre-to DNA profiling can be included, the most again by general probe, specificity
Forward primer (ADA-ASP) and downstream primer (RP) are mixed into mix primer by a certain percentage, then carry out PCR amplification；For
High abundance target sample or the nucleic acid of high-recovery, can directly by general probe, specific upstream primer (ADA-ASP) and
Downstream primer (RP) is mixed into mix primer by a certain percentage, then carries out PCR amplification.
Further, described forward primer and downstream primer and corresponding mix primer are disposed as many groups with simultaneously
Detect multiple target gene, or, described mix primer is set to many groups with the multiple genotype detecting target gene.
Third aspect present invention provides a kind of general probe being previously used for real-time fluorescence PCR, in gene type and sudden change
Application in gene test.
By such scheme, the present invention at least has the advantage that
1) compared with fluorescent primer, it is possible to achieve detect in real time, it is not necessary to PCR subsequent treatment；
2) compared with the fluorescent probe such as TaqMan, save design and generated time, reduce cost；
3) general probe has the dual-use function of probe and primer concurrently；
4) good stability；
5) result is prone to analyze.
Described above is only the general introduction of technical solution of the present invention, in order to better understand the technological means of the present invention,
And can be practiced according to the content of description, below with presently preferred embodiments of the present invention and coordinate accompanying drawing describe in detail as after.
Accompanying drawing explanation
Fig. 1 is multiple fluorescence PCR universal joint design of primers figure in prior art；
Fig. 2 is the detection method flow chart of the multiple fluorescence PCR universal joint detected for microsatellite in prior art；
Fig. 3 is the fundamental diagram of TaqMan probe in prior art；
Fig. 4 is the fundamental diagram of prior art Middle molecule beacon；
Fig. 5 is the general probe design drawing of real-time fluorescence PCR in first embodiment of the invention；
Fig. 6 is the design drawing of specific upstream primer, forward primer and downstream primer in first embodiment of the invention；
Fig. 7 is real-time fluorescence PCR flow chart in first embodiment of the invention；
Fig. 8 is mutant allele amplification figure in second embodiment of the invention；
Fig. 9 is mutant allele amplification figure in second embodiment of the invention；
Figure 10 is genotypic results figure in second embodiment of the invention；
Figure 11 is mutant allele amplification figure in third embodiment of the invention；
Figure 12 is mutant allele amplification figure in third embodiment of the invention；
Figure 13 is genotypic results figure in third embodiment of the invention；
Figure 14 is fourth embodiment of the invention medium sensitivity real-time amplification figure.
Detailed description of the invention
Below in conjunction with the accompanying drawings and embodiment, the detailed description of the invention of the present invention is described in further detail.Hereinafter implement
Example is used for illustrating the present invention, but is not limited to the scope of the present invention.
Embodiment one
A preferred embodiment of the present invention provides one group of general probe for real-time fluorescence PCR, including normal chain probe with negative
Chain probe, normal chain probe includes oligonucleotide positive strand sequence (SFP-R) and the joint sequence being sequentially connected by 5 ' ends to 3 ' ends
(ADA), minus strand probe includes the oligonucleotide negative strand sequence (SFP-Q) complementary with oligonucleotide positive strand sequence, and normal chain is visited
5 ' end connections of pin have fluorophor (R), and 3 ' end connections of minus strand probe have quenching group (Q).
For the detection method of the general probe of real-time fluorescence PCR, comprise the following steps:
S1, the genomic DNA of extraction sample；
S2, addition forward primer and downstream primer carry out pre-amplification to target gene；
S3, general probe, specific upstream primer and downstream primer are mixed into mix primer by a certain percentage；
S4, preparation PCR reaction system, carry out real-time fluorescent PCR amplification；
The fluorescence signal intensity of S5, basis detection in real time carries out interpretation of result；
Wherein, described specific upstream primer includes the catenation sequence identical with general probe center tap sequence, Yi Jiyu
The specific primer sequences that the target sequence of target gene is complementary mutually.
As it is shown in figure 5, wherein, label SFP-M with SFP-W represents two groups of different general spies to the design principle of general probe
Pin, is respectively used to saltant type and the detection of wild type in genes of interest, i.e. SFP-M and SFP-W is the most respectively with corresponding
The specific upstream primer, forward primer and the downstream primer that detect for saltant type or wild type PCR are used in mixed way, and its main points exist
Catenation sequence in specific upstream primer is identical with the joint sequence of SFP-M and SFP-W respectively, and different specific upstream draw
Specific primer sequences in thing targeting saltant type and wild type genes of interest respectively.
The normal chain probe sequence of SFP-M is:
R-CCCGCCGCGTAGATCGAATATTCATTAGCGGCGCAATTT(SEQ ID NO:13)
Wherein, the part of labelling underscore is joint sequence (ADA-1).
The minus strand probe sequence of SFP-M is:
TATTCGATCTACGCGGCGGG-Q (SEQ ID NO:5)
The normal chain probe sequence of SFP-W is:
R-CCAAGGCCGATCGCATGTTCCTAGCCCGAACGAATACTCA(SEQ ID NO:14)
Wherein, the part of labelling underscore is joint sequence (ADA-2).
The minus strand probe sequence of SFP-W is:
TATTCGATCTACGCGGCGGG-Q (SEQ ID NO:6)
It should be noted that, the oligonucleotide positive strand sequence (SFP-R) in SFP-M and SFP-W and joint sequence (ADA)
Can independent assortment, it is not limited to foregoing sequences, the present embodiment only proposes a kind of embodiment.
The present invention uses two kinds of general probes, Jin Weizhi bio tech ltd, Suzhou synthesize.With genes of interest it is
As a example by Eukaryotic gene, SFP-M-R and SFP-M-Q sequence designs according to yeast genome sequence, 2 joint sequences
(ADA) it is the 16s sequential design according to antibacterial, it is therefore an objective to minimum with Eukaryotic sequence homology, it is to avoid non-specific
Amplification interference.Particular sequence information is as shown in table 1.
Table 1 is for the sequence information of the general probe of real-time fluorescence PCR
In table 1, R represents fluorophor, can be selected for FAM, TET, Texas Red, VIC and Cy5, and Q represents quenching group, can
Select BHQ1, BHQ2.
Additionally, it should be noted that the Tm value that the Tm value of SFP-M-R is more than ADA-1, SFP-W-R is more than ADA-2, for reality
The essential condition of row real-time fluorescence detection.
Fluorophor, be marked at SFP-R 5 ' end, and can with its combination in any, but the general spy of difference simultaneously used
The fluorophor of pin can not repeat, and need to set up one-to-one relationship.Existing fluorophor (FAM, TET, Texas Red, VIC,
Cy5 etc.), according to instrument sense channel and detection type selecting fluorophor, it is to avoid spectra overlapping.
Quenching group, be marked at SFP Q sequence 3 ' end, and can with its combination in any, but the difference simultaneously used lead to
Can not repeat with the quenching group between probe, one-to-one relationship need to be set up.Existing quenching group (BHQ1, BHQ2 etc.),
According to instrument sense channel and detection type selecting fluorophor, it is to avoid spectra overlapping.
As a example by the detection of gene type allelic, further illustrate specific upstream primer, forward primer and under
The design process of trip primer.As shown in Figure 6, (in this example, i.e. the allele-specific shown in figure draws specific upstream primer
Thing), including the catenation sequence (ADA) being sequentially connected with to 3 ' ends by 5 ' ends and specific primer sequences (ASP), wherein catenation sequence
(ADA-1, ADA-2) is identical with the joint sequence of SFP-M and SFP-W (ADA-1, ADA-2) respectively.For low abundance target sample
Product or the nucleic acid of the low response rate, forward primer (FP) and downstream primer (RP) are used for amplification pre-to DNA profiling, then by general
Probe, specific upstream primer (ADA-ASP) and downstream primer (RP) are mixed into mix primer by a certain percentage, then carry out
PCR expands；For high abundance target sample or the nucleic acid of high-recovery, can directly general probe, specific upstream be drawn
Thing (ADA-ASP) and downstream primer (RP) are mixed into mix primer by a certain percentage, then carry out PCR amplification.
As a example by mutated genes site in detection allele, specific experiment flow process is as follows:
S1, design general probe, specific upstream primer, forward primer and downstream primer；
S2, forward primer (FP) and downstream primer (RP) configuration reaction system, carry out DNA profiling and expand in advance；
S3, general probe (SFP), downstream primer (RP) and specific primer sequences (ADA-ASP) are mixed by a certain percentage
For mix primer, configure reaction system, carry out real-time fluorescence quantitative PCR detection with pre-amplified production, its amplification flow process such as Fig. 7 institute
Showing, in figure, AMPLICON represents different amplified production respectively, and fluorescence signal intensity is linear with AMPLICON-4 product；
Reaction system is 10 μ L, including 2X TaKaRa TaqTMHS Perfect Mix 5ul, mix primer 1.2 μ L, glimmering
Signal joint 0.5 μ L, deionized water 1 μ L, DNA 20ng.
S4, interpretation of result, generate examining report.
Embodiment two
The present invention provides a kind of real-time fluorescence PCR instrument to use general probe to carry out the side of Rs1801133 Genotyping
Method, specifically comprises the following steps that
S1, synthesis specific upstream primer (allele-specific primers 1, allele-specific primers 2), upstream are drawn
Thing (FP) and downstream primer (RP)；
The sequence of allele-specific primers 1 is:
Wherein, the part of labelling underscore is joint sequence (ADA-1), and the base pair of square frame labelling should be Rs1801133
Site mutation type.
The sequence of allele-specific primers 2 is:
Wherein, the part of labelling underscore is joint sequence (ADA-2), and the base pair of square frame labelling should be Rs1801133
Site wild type.
The sequence of forward primer is:
TGTGTCAGCCAAAGAAAAGC (SEQ ID NO:17)
The sequence of downstream primer is:
AGGCTGACCAAGCACTTGA (SEQ ID NO:18)
S2, choose people's saliva sample, extract the genomic DNA of sample；
S3, FP and RP choosing newly synthesized Rs1801133 site carry out pre-amplification to DNA profiling；
S4, the general probe (SFP-M and SFP-W) used in embodiment 1, and by it with allele-specific primers 1,
Allele-specific primers 2, downstream primer (RP) (mol ratio) according to a certain percentage mix, mixing group on turbine mixer
Become mix primer；
S5, mix primer is configured to PCR reaction system, carries out real-time fluorescent PCR amplification with pre-amplified production；
The fluorescence signal intensity of S6, basis detection in real time carries out interpretation of result；Saltant type and the reality of wild-type allele
Time amplification figure respectively the most as shown in Figure 8 and Figure 9, it is seen that fluorescence signal intensity with to expand number of times the most linear, general probe
(SFP-M and SFP-W) can realize real-time fluorescent PCR amplification.Gene type is carried out, its result such as figure according to fluoroscopic examination result
Shown in 10, it is seen that two sets general probe (SFP-M and SFP-W) can be well by saltant type and the wild type of genes of interest to be measured
Separately.
Embodiment three
The present invention provides a kind of real-time fluorescence PCR instrument to use general probe to carry out RS267606617 and RS267606619 position
The method of point gene typing, specifically comprises the following steps that
S1, synthesis specific upstream primer (allele-specific primers 1, allele-specific primers 2), upstream are drawn
Thing (FP) and downstream primer (RP)；
Wherein:
1) design of primers of RS267606617
The sequence of allele-specific primers 1 is:
Wherein, the part of labelling underscore is joint sequence (ADA-1), and the base pair of square frame labelling should be
RS267606617 site mutation type.
The sequence of allele-specific primers 2 is:
Wherein, the part of labelling underscore is joint sequence (ADA-2), and the base pair of square frame labelling should be
RS267606617 site wild type.
The sequence of forward primer is:
GTCCAAGTGCACTTTCCAGT (SEQ ID NO:21)
The sequence of downstream primer is:
CCCTCCTCAAGTATACTTCAAAGGACA (SEQ ID NO:22)
2) design of primers of RS267606619
The sequence of allele-specific primers 1 is:
Wherein, the part of labelling underscore is joint sequence (ADA-1), and the base pair of square frame labelling should be
RS267606619 site mutation type.
The sequence of allele-specific primers 2 is:
Wherein, the part of labelling underscore is joint sequence (ADA-2), and the base pair of square frame labelling should be
RS267606619 site wild type.
The sequence of forward primer is:
ACTTACCATGTTACGACTTGTCTCC (SEQ ID NO:25)
The sequence of downstream primer is:
GGTGGCAAGAAATGGGCTAC (SEQ ID NO:26)
S2, choose people's whole blood sample, extract the genomic DNA of sample, DNA is uniformed same concentration；
S3, FP, the RP choosing newly synthesized RS267606617 and RS267606619 carry out pre-expansion to sample DNA template
Increase；
S4, the general probe (SFP-M and SFP-W) used in embodiment 1, and by its respectively with RS267606617 and
The allele-specific primers 1 of RS267606619, allele-specific primers 2, downstream primer (RP) are according to a certain percentage
(mol ratio) mixes, mixing composition mix primer on turbine mixer；
S5, mix primer is configured to PCR reaction system, carries out real-time fluorescent PCR amplification with pre-amplified production；
The fluorescence signal intensity of S6, basis detection in real time carries out interpretation of result；
The fluorescence signal intensity of S7, basis detection in real time carries out interpretation of result；Saltant type and the reality of wild-type allele
Time amplification figure respectively the most as is illustrated by figs. 11 and 12, it is seen that fluorescence signal intensity with to expand number of times the most linear, general spy
Pin can realize real-time fluorescent PCR amplification.Carrying out gene type according to fluoroscopic examination result, its result is as shown in figure 13, it is seen that
Saltant type and the wild type of genes of interest to be measured can be separated by general probe well, it is adaptable to the gene of multiple gene locis
Typing detects.
Embodiment four
The present invention provides a kind of real-time fluorescence PCR instrument to use the method that general probe carries out tumor mutant gene detection, prominent
Displacement point RS113488022, specifically comprises the following steps that
S1, synthesis specific upstream primer, forward primer (FP) and downstream primer (RP)；
Wherein:
The sequence of specific upstream primer is:
Wherein, the part of labelling underscore is joint sequence (ADA-1), and the base pair of square frame labelling should be
RS113488022 site mutation type.
The sequence of forward primer is:
GTCCAAGTGCACTTTCCAGT (SEQ ID NO:27)
The sequence of downstream primer is:
CCCTCCTCAAGTATACTTCAAAGGACA (SEQ ID NO:28)
S2, choose people's wild type sample and mutant cell system sample, extract the genomic DNA of sample, measure concentration；
S3, differently configured sudden change content sample, for sensitivity technique；
S4, FP and RP choosing newly synthesized RS113488022 carry out pre-amplification to DNA profiling；
S5, select synthesized general probe (SFP-M), the specific upstream primer of newly synthesized RS113488022, downstream
Primer RP (mol ratio) according to a certain percentage mixes, mixing composition mix primer on turbine mixer；
S6, mix primer is configured to PCR reaction system, carries out real-time fluorescent PCR amplification；
The fluorescence signal intensity of S7, basis detection in real time carries out interpretation of result；
S8, sensitivity real-time amplification figure are as shown in figure 14, it is seen that general probe goes for diluting variable concentrations (1%
M, 10%M and 50%M) sample mutant gene detection, sensitivity is higher.
The above is only the preferred embodiment of the present invention, is not limited to the present invention, it is noted that for this skill
For the those of ordinary skill in art field, on the premise of without departing from the technology of the present invention principle, it is also possible to make some improvement and
Modification, these improve and modification also should be regarded as protection scope of the present invention.
Claims (10)
1. the general probe for real-time fluorescence PCR, it is characterised in that: include normal chain probe and minus strand probe, described just
Chain probe includes oligonucleotide positive strand sequence and the joint sequence being sequentially connected by 5 ' ends to 3 ' ends, and described minus strand probe includes
The oligonucleotide negative strand sequence complementary with oligonucleotide positive strand sequence, 5 ' end connections of described normal chain probe have fluorescent base
Group, 3 ' end connections of described minus strand probe have quenching group.
General probe for real-time fluorescence PCR the most according to claim 1, it is characterised in that: described oligonucleotide
The Tm value of positive strand sequence is more than the Tm value of joint sequence.
General probe for real-time fluorescence PCR the most according to claim 1, it is characterised in that: described oligonucleotide
Without homology or sequence similarity compared with the sequence that positive strand sequence is biological with the purpose that employing general probe detects with joint sequence
Less than 30%.
General probe for real-time fluorescence PCR the most according to claim 1, it is characterised in that: described oligonucleotide
Positive strand sequence designs according to yeast genome sequence.
General probe for real-time fluorescence PCR the most according to claim 4, it is characterised in that: described oligonucleotide
Positive strand sequence uses the nucleotide sequence shown in as any one of SEQ ID NO:1-4.
General probe for real-time fluorescence PCR the most according to claim 1, it is characterised in that: described joint sequence root
Form according to the 16s rDNA sequential design of antibacterial.
General probe for real-time fluorescence PCR the most according to claim 6, it is characterised in that: described joint sequence is adopted
With the nucleotide sequence shown in as any one of SEQ ID NO:9-12.
General probe for real-time fluorescence PCR the most according to claim 1, it is characterised in that: described fluorophor bag
Including but be not limited to FAM, TET, Texas Red, VIC or Cy5, described quenching group includes but not limited to BHQ1 or BHQ2.
9. use a detection method for the general probe for real-time fluorescence PCR according to any one of claim 1 to 8, its
It is characterised by: comprise the following steps:
S1, the genomic DNA of extraction sample；
S2, general probe, specific upstream primer and downstream primer are mixed into mix primer by a certain percentage；
S3, preparation PCR reaction system, carry out real-time fluorescent PCR amplification；
The fluorescence signal intensity of S4, basis detection in real time carries out interpretation of result；
Wherein, described specific upstream primer includes the catenation sequence identical with general probe center tap sequence and and target
The specific primer sequences that the target sequence of gene is complementary mutually.
10. according to the general probe for real-time fluorescence PCR of any one of claim 1 to 8, in gene type and sudden change
Application in gene test.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610329478.8A CN105861706A (en) | 2016-05-18 | 2016-05-18 | Universal probe for real-time fluorescent PCR and detection method and application of universal probe |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610329478.8A CN105861706A (en) | 2016-05-18 | 2016-05-18 | Universal probe for real-time fluorescent PCR and detection method and application of universal probe |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN105861706A true CN105861706A (en) | 2016-08-17 |
Family
ID=56635190
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201610329478.8A Pending CN105861706A (en) | 2016-05-18 | 2016-05-18 | Universal probe for real-time fluorescent PCR and detection method and application of universal probe |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN105861706A (en) |
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106636409A (en) * | 2016-12-28 | 2017-05-10 | 健路生物科技（苏州）有限公司 | Universal fluorescent probe and detection method and application thereof |
| CN108220399A (en) * | 2016-12-14 | 2018-06-29 | 李保伟 | A kind of fluorescence quantifying PCR method based on general probe technology |
| CN108624676A (en) * | 2018-05-23 | 2018-10-09 | 健路生物科技（苏州）有限公司 | Kit and its detection method for detecting HLA-B*5801 allele and application |
| CN108642165A (en) * | 2018-05-22 | 2018-10-12 | 美林美邦（厦门）生物科技有限公司 | A kind of probe and its application method for real-time fluorescence PCR |
| CN114550817A (en) * | 2022-01-25 | 2022-05-27 | 云南大学 | CTCF (cytochrome c function) -mediated chromatin loop prediction method based on multiple characteristics |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104293913A (en) * | 2014-08-28 | 2015-01-21 | 广州和实生物技术有限公司 | Multiple mutation single tube rapid detection method and kit |
| CN105339505A (en) * | 2013-03-12 | 2016-02-17 | 生命技术公司 | Universal reporter-based genotyping methods and materials |
-
2016
- 2016-05-18 CN CN201610329478.8A patent/CN105861706A/en active Pending
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105339505A (en) * | 2013-03-12 | 2016-02-17 | 生命技术公司 | Universal reporter-based genotyping methods and materials |
| CN104293913A (en) * | 2014-08-28 | 2015-01-21 | 广州和实生物技术有限公司 | Multiple mutation single tube rapid detection method and kit |
Non-Patent Citations (1)
| Title |
|---|
| HAN B. LEE,ET AL: "Allele-Specific Quantitative PCR for Accurate, Rapid,and Cost-Effective Genotyping", 《HUMAN GENE THERAPY》 * |
Cited By (8)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108220399A (en) * | 2016-12-14 | 2018-06-29 | 李保伟 | A kind of fluorescence quantifying PCR method based on general probe technology |
| CN108220399B (en) * | 2016-12-14 | 2023-04-14 | 李保伟 | Fluorescent quantitative PCR method based on universal probe technology |
| CN106636409A (en) * | 2016-12-28 | 2017-05-10 | 健路生物科技（苏州）有限公司 | Universal fluorescent probe and detection method and application thereof |
| CN108642165A (en) * | 2018-05-22 | 2018-10-12 | 美林美邦（厦门）生物科技有限公司 | A kind of probe and its application method for real-time fluorescence PCR |
| CN108624676A (en) * | 2018-05-23 | 2018-10-09 | 健路生物科技（苏州）有限公司 | Kit and its detection method for detecting HLA-B*5801 allele and application |
| CN108624676B (en) * | 2018-05-23 | 2022-04-01 | 健路生物科技（苏州）有限公司 | Kit for detecting HLA-B5801 allele and detection method and application thereof |
| CN114550817A (en) * | 2022-01-25 | 2022-05-27 | 云南大学 | CTCF (cytochrome c function) -mediated chromatin loop prediction method based on multiple characteristics |
| CN114550817B (en) * | 2022-01-25 | 2022-12-23 | 云南大学 | CTCF (CTCF-mediated chromatin loop) prediction method based on multiple characteristics |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN101845503B (en) | Kit for detecting drug resistant mycobacterium tuberculosis (MDR-TB) | |
| CN105861706A (en) | Universal probe for real-time fluorescent PCR and detection method and application of universal probe | |
| CN103757106B (en) | Based on people's mthfr gene polymorphic detection test kit and the method for Taqman-MGB probe | |
| KR102371222B1 (en) | Target nucleic acid amplification method and composition for target nucleic acid amplification | |
| US8877910B2 (en) | Probe for detecting polymorphism in exon 12 of NPM1 gene and use thereof | |
| US20130084568A1 (en) | Probe, and polymorphism detection method using the same | |
| EP3415636B1 (en) | Method for detecting target nucleic acid and nucleic acid probe used therein | |
| CN114807431A (en) | Improved nucleic acid visual detection technology based on CRISPR system mediation and application thereof | |
| CN101622363B (en) | Probe for detecting mutation in jak2 gene and use thereof | |
| CN107365850A (en) | The detection method of more SNPs in a kind of single tube | |
| CN106636409A (en) | Universal fluorescent probe and detection method and application thereof | |
| CN116179658B (en) | Fluorescent primer amplification blocking mutation system and application thereof | |
| CN101985659A (en) | Kit for testing schizophrenia related gene and preparation method thereof | |
| US20080220415A1 (en) | Detection Method of Dna Amplification Using Probe Labeled With Intercalating Dye | |
| CN113774141B (en) | Primer and probe composition for double-site cis-trans mutation detection and application thereof | |
| CN107937493B (en) | Hairpin modified primer for allele PCR | |
| CN104946748B (en) | General SNP typing probes in a kind of grass | |
| JP2015006197A (en) | Single nucleotide repeat polymorphism analyzing method and single nucleotide polymorphism analyzing method | |
| CN104450918B (en) | The method in detection FGF13 Exon 2 mutational site and test kit thereof | |
| CN105779570B (en) | A method of detection SNP site | |
| CN110885887B (en) | Artificial simulation nucleic acid molecular beacon and kit for detecting rs1517114 site polymorphism of C8orf34 gene | |
| JPWO2006070666A1 (en) | Simultaneous detection method of gene polymorphism | |
| KR20200044511A (en) | Probe for Discrimination of Genetic Variant related to Age-related Macular Degeneration(AMD) and Method Using the Same | |
| CN114875116B (en) | Self-quenching fluorescence primer and design method and application thereof | |
| CN113957158B (en) | Primer probe composition for detecting mitochondrial gene of Acipenser schrenki, kit and application of primer probe composition |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20160817 |
|
| RJ01 | Rejection of invention patent application after publication |