CN110885887B

CN110885887B - Artificial simulation nucleic acid molecular beacon and kit for detecting rs1517114 site polymorphism of C8orf34 gene

Info

Publication number: CN110885887B
Application number: CN201811050329.3A
Authority: CN
Inventors: 葛猛; 潘世让; 余倩; 杜柏均; 王宏伟
Original assignee: Beijing Fuanhua Biotech Co ltd
Current assignee: Beijing Fuanhua Biotech Co ltd
Priority date: 2018-09-10
Filing date: 2018-09-10
Publication date: 2022-04-19
Anticipated expiration: 2038-09-10
Also published as: CN110885887A

Abstract

The invention discloses a typing detection method and a kit for rs1517114 site polymorphism of C8orf34 gene. The C8orf34 gene specific primers SEQ1 and SEQ2 are adopted to amplify a C8orf34 gene fragment, and meanwhile, a C8orf34 gene specific artificial simulated nucleic acid molecular beacon SEQ3-FAM and SEQ4-VIC are designed in an amplification region defined by the C8orf34 gene specific primers. The method for judging the rs1517114 site polymorphism of the C8orf34 gene based on the gene specificity PCR combined with the artificial simulation nucleic acid molecular beacon, provided by the invention, has the advantages of high accuracy, high detection speed, simplicity in operation, objective result interpretation, less closed-tube reaction pollution and the like, and is very suitable for large-scale development in clinic.

Description

Artificial simulation nucleic acid molecular beacon and kit for detecting rs1517114 site polymorphism of C8orf34 gene

Technical Field

The invention belongs to the technical field of biology, and particularly relates to a typing detection method and a kit for rs1517114 site polymorphism of a C8orf34 gene.

Background

Lung cancer is a common malignant tumor of the lung, and the vast majority of lung cancers originate in the bronchial mucosal epithelium. Lung cancer has become the leading cause of cancer deaths in humans, accounting for about one-third of all deaths, exceeding the sum of deaths due to breast, prostate and colorectal cancers. Colorectal cancer is a common malignant tumor in gastrointestinal tracts, and has unobvious early symptoms and systemic symptoms such as anemia and weight loss at late stage.

Irinotecan (Irinotecan) is one of the most commonly used chemotherapeutic drugs for patients with colorectal and lung cancer. Irinotecan is a semi-synthetic water-soluble camptothecin derivative. The product and its metabolite SN38 are DNA topoisomerase I inhibitors, and the complex formed by the product, topoisomerase I and DNA can cause DNA single strand break, prevent DNA replication and inhibit RNA synthesis, and is cell cycle S phase specificity. Some patients, however, suffer from the effects of irinotecan-related drug toxicity, such as diarrhea and neutropenia. Therefore, it is clinically essential to identify patients with severe diarrhea and a high risk of neutropenia.

C8orf34 encodes a protein associated with modulators of cAMP-dependent protein kinase, which mediates the secretory process of the intestinal tract and leads to severe diarrhea. This suggests that genetic variation in C8orf34 is associated with treatment-related severe diarrhea. Genome-wide association studies showed that the rs1517114 site in intron 3 of the C8orf34 gene is strongly associated with tertiary diarrhea caused by irinotecan. The rs1517114 locus is a CC genotype of a patient with non-small cell lung cancer, and compared with a GG genotype, the patient has a heavier diarrhea risk. Therefore, the detection of the rs1517114 site polymorphism of the C8orf34 gene is of great guiding significance for the evaluation of the drug administration risk of irinotecan of chemotherapy patients.

At present, methods for detecting gene polymorphism mainly include a PCR-Sanger sequencing method, a chip hybridization method, a high-resolution melting curve method and the like. Although these methods can detect gene polymorphisms to some extent, they have considerable limitations. The Sanger sequencing method has more steps, needs PCR post-treatment, is complex to operate, is easy to cause pollution, and cannot meet clinical requirements. The chip hybridization method is complicated in operation, and detection thereof depends on expensive equipment and instruments, resulting in high cost. The high-resolution dissolution curve method has high requirements on instruments, can be used only by a machine which is provided with high-resolution software and is sensitive to temperature, and has difficulty in clinical popularization. The fluorescent quantitative PCR based on the Taqman hydrolysis probe cuts off the probe to generate a fluorescent signal by utilizing the exonuclease activity of Taq enzyme, and the fluorescent quenching is not thorough due to the fact that a fluorescent group and a quenching group of the Taqman probe are not close to each other closely, and a background fluorescent signal exists. In addition, the Taqman probe has poor single base mismatch recognition capability, easily generates a non-specific fluorescent signal, interferes result interpretation, and further influences the detection accuracy. Therefore, a simple, convenient, high-sensitivity, accurate and reliable method for detecting gene polymorphism is urgently needed clinically.

The Molecular Beacon (Molecular Beacon) is in a hairpin type in spatial structure and consists of a circular region and a stem region, wherein the circular region is complementary with a target DNA sequence and is about 15-35 nucleotides long, the stem region is about 5-7 nucleotides long, the stem region is formed by a complementary sequence which has higher GC content and is irrelevant with the target sequence, and the 5 'end of the Molecular Beacon is marked with a fluorescent group (F) and the 3' end of the Molecular Beacon is marked with a quenching group (Q). In the case of molecular beacons, the fluorescent group is close to the quencher group (about 7-10nm) in the free state. At the moment, fluorescence resonance energy transfer occurs, so that fluorescence emitted by the fluorescent group is absorbed by the quenching group and emitted in a thermal form, the fluorescence is almost completely quenched, and the fluorescence background is extremely low. When the circular region of the molecular beacon is hybridized with target DNA with completely complementary sequence to form a double-stranded hybrid, the stem region of the molecular beacon is pulled apart, and the distance between the fluorescent group and the quenching group is increased. According to Foerster's theory, the efficiency of central fluorescence energy transfer is inversely proportional to the 6 th power of the distance between the two, and therefore, the fluorescence of the molecular beacon is almost 100% recovered after hybridization, and the detected fluorescence intensity is proportional to the amount of target DNA in solution (FIG. 1). Thus, the ideal molecular beacon is more efficient than the Taqman hydrolysis probe. However, the introduction of a stem region in the molecular beacon, which is not related to the target sequence, often results in some non-specific interaction between the molecular beacon and the template sequence, which leads to an increase in background signal, and thus, affects the detection efficiency. To eliminate this background signal, high requirements are imposed on the design of the molecular beacon, especially on the sequence design of the stem region. In addition, studies have shown that molecular beacons have a good effect for detecting gene mutations (including single-base mismatches, deletions, or insertion mutations) when the sequence of the loop region is short, but in practice, in many cases, the sequence of the loop region is too long due to the low GC content of a specific target sequence region, thereby affecting the detection efficiency. Therefore, it is often difficult to obtain an ideal molecular beacon.

Modification of bases, i.e.the development of artificially simulated non-natural nucleotide pairs, has been known for almost 40 yearsWherein isocytosine deoxynucleotide-isoguanine deoxynucleotide (isoC-isoG) and its derivative 5-methylisocytosine deoxynucleotide-isoguanine deoxynucleotide (iso)^MeC-isoG) is classical. The work on the nucleotide pairs in isoC-isoG was first carried out by the American famous synthetic biologist Benner SA, whose team realized the entire central principle of replication, transcription and even translation of isocytosine deoxynucleotide-isoguanine deoxynucleotide (isoC-isoG) artificial expanded nucleic acids in vitro. As shown in FIG. 2, isoC and isoG are isomers of natural nucleotides C and G, respectively, which can perfectly pair themselves but cannot form a pair with natural nucleotides.

In addition to the above manual modification of base structure, there is a large class of non-natural nucleic acids based on modification of base sugar rings, such as Locked Nucleic Acids (LNA). LNA, which broadly refers to an oligonucleotide sequence containing one or more LNA monomers (locked nucleotides), is an artificial mimic nucleic acid that has been rapidly developed in recent years and has been widely used in the fields of molecular diagnostics, gene therapy, and the like. As shown in fig. 3, a methylene bridge is formed between the 2 '-O and 4' -C of the pentose ring of the LNA monomer. LNA does not alter the base pairing of natural nucleic acids, but has greater affinity and greater mismatch recognition relative to natural nucleic acids.

Disclosure of Invention

The invention aims to provide a novel typing detection method and a kit for the rs1517114 polymorphic site of the C8orf34 gene based on a molecular beacon of artificial simulated nucleic acid.

In order to achieve the purpose, the invention firstly provides a molecular beacon for detecting the rs1517114 site polymorphism of the human C8orf34 gene.

The molecular beacon for detecting the rs1517114 site polymorphism of the human C8orf34 gene consists of a molecular beacon A and a molecular beacon B;

the sequence of the molecular beacon A is a sequence 2 in a sequence table, wherein the 2 nd position of the sequence 2 is a 5-methyl isocytosine deoxynucleotide residue, the 3 rd position is an isoguanine deoxynucleotide residue, the 15 th position is a locked nucleotide residue, the 29 th position is a 5-methyl isocytosine deoxynucleotide residue, the 30 th position is an isoguanine deoxynucleotide residue, and the rest nucleotide residues are natural nucleotide residues;

the sequence of the molecular beacon B is a sequence 3 in a sequence table, wherein the 2 nd position of the sequence 3 is a 5-methyl isocytosine deoxynucleotide residue, the 3 rd position is an isoguanine deoxynucleotide residue, the 15 th position is a locked nucleotide residue, the 29 th position is a 5-methyl isocytosine deoxynucleotide residue, the 30 th position is an isoguanine deoxynucleotide residue, and the rest nucleotide residues are natural nucleotide residues.

The 7 th to 25 th sites of the molecular beacon A and the molecular beacon B are both circular region sequences, and the 1 st to 6 th sites and the 26 th to 31 th sites are both stem region sequences.

The loop regions of the molecular beacon A and the molecular beacon B are both targeted to the rs1517114 locus of the C8orf34 gene. Wherein the molecular beacon A targets the 'G' at the rs1517114 locus of the C8orf34 gene; the molecular beacon B targets the 'C' of the rs1517114 locus of the C8orf34 gene.

Furthermore, two ends of the molecular beacon A and the molecular beacon B are also marked with a fluorescent group and a quenching group, and the fluorescent groups marked by the molecular beacon A and the molecular beacon B are different. The molecular beacon A and the molecular beacon B can be the same or different in labeled quenching group.

In each molecular beacon, the fluorescence emitted by the fluorophore can be absorbed by the quencher. The fluorescent group and the quenching group can be respectively positioned at the 5 'terminal and the 3' terminal of the basic molecular beacon, and the positions of the fluorescent group and the quenching group can be exchanged as long as the requirement that the fluorescence emitted by the fluorescent group in the basic molecular beacon in a free state can be quenched by the quenching group is met.

Further, the fluorophore may be FAM, Hex, TET, Cy3, JOE; the quencher group can be Dabcyl, TAMRA. In the invention, the 5 'end of the molecular beacon A is marked with FAM fluorescent group, and the 3' end is marked with Dabcyl quenching group; the 5 'end of the molecular beacon B is marked with a VIC fluorescent group, and the 3' end is marked with a Dabcyl quenching group.

In order to achieve the purpose, the invention further provides a kit for detecting the rs1517114 site polymorphism of the human C8orf34 gene.

The kit for detecting the rs1517114 site polymorphism of the human C8orf34 gene comprises the molecular beacon and a primer pair which can be amplified from a human genome and contains a recognition sequence of the circular region of the molecular beacon.

In the above-mentioned kit, the primer pair is composed of a single-stranded DNA represented by sequence 4 in the sequence table and a single-stranded DNA represented by sequence 5 in the sequence table.

In the above kit, the molecular beacon and the primer pair are packaged independently. The molar ratio of the molecular beacon A to the molecular beacon B in the molecular beacon can be 1: 1; the molar ratio of the two single-stranded DNAs in the primer pair may be 1: 1. The molar ratio of the molecular beacon A and the molecular beacon B in the kit to the two single-stranded DNAs of the primer pair can be 2:2:5: 5.

In order to achieve the purpose, the invention also provides a kit for detecting the rs1517114 site polymorphism of the human C8orf34 gene.

The kit for detecting the rs1517114 site polymorphism of the human C8orf34 gene comprises the molecular beacon or the kit.

The kit can also comprise positive quality control, negative quality control and other reagents. The other reagents can be reaction buffer, dNTPs and MgCl₂Solution, DNA polymerase and/or nuclease-free water. The positive quality control comprises a recombinant plasmid 1, a recombinant plasmid 2 and a recombinant plasmid 3. The recombinant plasmid 1 is obtained by replacing a DNA fragment between EcoRV and SmaI recognition sequences in an escherichia coli cloning vector pUC57 with a DNA fragment shown in a sequence 1 (the locus rs1517114 of a C8orf34 gene in the sequence 1 is G); the recombinant plasmid 2 is obtained by replacing a DNA fragment between EcoRV and SmaI recognition sequences in an escherichia coli cloning vector pUC57 with a DNA fragment shown in a sequence 1 (the locus rs1517114 of a C8orf34 gene in the sequence 1 is C); the recombinant plasmid 3 is the recombinant plasmid 1 andthe recombinant plasmid 2 is obtained by mixing according to the molar ratio of 1: 1. The negative quality control can be specifically nuclease-free water. The DNA polymerase can be EX Taq DNA polymerase.

In order to achieve the above objects, the present invention also provides a novel use of the above molecular beacon or the above kit.

The invention provides application of the molecular beacon or the reagent set in detecting the rs1517114 site polymorphism of the human C8orf34 gene.

The invention also provides the application of the molecular beacon or the reagent set in predicting or assisting in predicting the diarrhea risk of a patient to be tested.

The invention also provides the application of the molecular beacon or the reagent set in predicting or assisting in predicting the neutropenia risk of a patient to be tested.

The invention also provides the application of the molecular beacon or the kit in evaluating or assisting in evaluating the medication risk of irinotecan in a patient to be tested.

In order to achieve the above object, the present invention finally provides a method for detecting the rs1517114 site polymorphism of the human C8orf34 gene.

The method for detecting the rs1517114 site polymorphism of the human C8orf34 gene comprises the following steps: and detecting a sample to be detected by using the molecular beacon or the reagent set, and determining the rs1517114 locus polymorphism of the C8orf34 gene in the sample to be detected according to the change of a fluorescence signal in the sample to be detected.

In the method, the step of detecting the sample to be detected by using the molecular beacon or the kit of reagents is to detect the DNA of the sample to be detected by using the molecular beacon or the kit of reagents.

The method for determining the rs1517114 site polymorphism of the C8orf34 gene in the sample to be detected according to the change of the fluorescence signal in the sample to be detected is as follows:

if the sample to be detected releases the FAM fluorescent signal, does not release the VIC fluorescent signal, and the value of the FAM fluorescent signal is continuously increased, the genotype of the rs1517114 locus of the C8orf34 gene of the sample to be detected is or is a candidate for the GG genotype;

if the sample to be detected releases the VIC fluorescent signal, does not release the FAM fluorescent signal, and the value of the VIC fluorescent signal is continuously increased, the genotype of the rs1517114 locus of the C8orf34 gene of the sample to be detected is or is a candidate of the CC genotype;

and if the sample to be detected releases the VIC fluorescence signal and the FAM fluorescence signal, and the FAM fluorescence signal value and the VIC fluorescence signal value are both continuously increased, determining that the genotype of the rs1517114 locus of the C8orf34 gene of the sample to be detected is or is a candidate of the GC genotype.

The GG genotype refers to a homozygote of G at the base of rs1517114 locus of C8orf34 gene on two homologous chromosomes of the DNA of a sample to be detected;

the CC genotype refers to a homozygote of bases of rs1517114 locus of C8orf34 gene on two homologous chromosomes of the DNA of a sample to be detected, which is C;

the GC genotype refers to a heterozygote of G and C in the base of rs1517114 locus of C8orf34 gene on two homologous chromosomes of the DNA of a sample to be detected.

In the above method, the sample to be tested may be a blood sample of a patient to be tested (e.g. a patient with colorectal cancer or lung cancer).

In the above molecular beacon or kit of parts or kit or use or method, the rs1517114 site of the C8orf34 gene is located at position 51 of sequence 1.

Compared with the prior art, the invention has the following beneficial effects: the method for judging the rs1517114 site polymorphism of the C8orf34 gene based on the gene specificity PCR combined with the artificial simulation nucleic acid molecular beacon, provided by the invention, has the advantages of high accuracy, high detection speed, simplicity in operation, objective result interpretation, less closed-tube reaction pollution and the like, and is very suitable for large-scale development in clinic.

Drawings

Fig. 1 shows the operation principle of the molecular beacon.

FIG. 2 shows the non-natural nucleotide isoguanine nucleotide residue (isoG) and the non-natural nucleotide 5-methylisocytosine deoxynucleotide residue (iso)^MeC) The structure of (1). Wherein each R represents a non-base portion of a deoxynucleotide.

FIG. 3 is the structure of locked nucleotide residues. Wherein Base represents a Base.

FIG. 4 is a diagram illustrating genotype-specific amplification curves of rs1517114 site GG of human C8orf34 gene in example 2 of the present invention. Where the abscissa is the number of cycles indicated by an even number from 0 to 40 and the ordinate is the corresponding fluorescence signal.

FIG. 5 is a schematic diagram of a CC genotype-specific amplification curve at site rs1517114 of the human C8orf34 gene in example 2 of the present invention. Where the abscissa is the number of cycles indicated by an even number from 0 to 40 and the ordinate is the corresponding fluorescence signal.

FIG. 6 is a diagram illustrating the GC genotype specific amplification curve of site rs1517114 of human C8orf34 gene in example 2 of the present invention. Where the abscissa is the number of cycles indicated by an even number from 0 to 40 and the ordinate is the corresponding fluorescence signal.

FIG. 7 is a schematic diagram of the amplification curve of the standard sample 1 detected by using the primer pair SEQ1 and SEQ2, the common Taqman probe SEQ5-FAM and SEQ 6-VIC.

FIG. 8 is a schematic diagram of the amplification curve of the standard sample 2 detected by using the primer pair SEQ1 and SEQ2, the common Taqman probe SEQ5-FAM and SEQ 6-VIC.

Detailed Description

The following examples are given to facilitate a better understanding of the invention, but do not limit the invention. The experimental procedures in the following examples are conventional unless otherwise specified. The test materials used in the following examples were purchased from a conventional biochemical reagent store unless otherwise specified. The quantitative tests in the following examples, all set up three replicates and the results averaged.

Example 1 establishment of typing detection method for rs1517114 polymorphism of C8orf34 Gene

Design of primer pair and molecular beacon

1. Design of primer pairs

Designing a specific primer pair capable of amplifying a DNA fragment containing rs1517114 locus of C8orf34 gene, wherein the specific primer pair consists of a primer SEQ1 and a primer SEQ2, and the sequence of the specific primer pair is as follows:

SEQ 1: 5'-TGGGTTGTAATTCAGAGTTAGGGA-3' (SEQ ID NO: 4);

SEQ 2: 5'-CCTATGGCTACAAGAAAATCCATAC-3' (SEQ ID NO: 5).

The nucleotide sequence of the DNA fragment containing the rs1517114 site of the C8orf34 gene amplified by the primer SEQ1 and the primer SEQ2 is as follows (bold bases indicate the rs1517114 site of the human C8orf34 gene): TGGGTTGTAATTCAGAGTTAGGGAGGGAGTATGATAATTTTCCTGATAGCNCTTATTCCTAGAGAGTTTAGCAAGTGTATGGATTTTCTTGTAGCCATAGG (SEQ ID NO: 1), wherein N is G and/or C.

2. Design of molecular beacons

Design to contain a non-natural nucleotide pair iso^MeThe artificial mimic nucleic acid molecular beacon SEQ3-FAM and SEQ4-VIC of C-isoG, the sequences of which are as follows:

SEQ 3-FAM: FAM-5 '-C × GACACCTGATAG + CGCTTATTCCTTGT × C × GG-3' (sequence 2) -Dabcyl;

SEQ 4-VIC: VIC-5 '-C GACACCTGATAG + CCCTTATTCCTTGT C GG-3' (sequence 3) -Dabcyl.

In the artificial mimic nucleic acid molecular beacon SEQ3-FAM, the 1 st to 6 th and 26 th to 31 th positions are stem region sequences, and the 7 th to 25 th positions are loop region sequences. FAM is a fluorescent group, and Dabcyl is a quenching group; the 2 nd nucleotide from the 5' end is a 5-methylisocytosine deoxynucleotide residue (iso)^MeC) The nucleotide at position 3 is an isoguanine deoxynucleotide residue (isoG), the nucleotide at position 15 is a locked nucleotide residue (+ C), and the nucleotide at position 29 is a 5-methylisocytosine deoxynucleotide residue (iso)^MeC) The 30 th nucleotide is an isoguanine deoxynucleotide residue (isoG), and the remaining nucleotide residues are natural nucleotide residues.

In the artificial mimic nucleic acid molecular beacon SEQ4-VIC, positions 1-6 and positions 26-31 are stem region sequences, and positions 7-25 are loop region sequences. VIC is a fluorescent group, and Dabcyl is a quenching group; the 2 nd nucleotide from the 5' end is a 5-methylisocytosine deoxynucleotide residue (iso)^MeC) The nucleotide at position 3 is an isoguanine deoxynucleotide residue (isoG), the nucleotide at position 15 is a locked nucleotide residue (+ C), and the nucleotide at position 29 is a 5-methylisocytosine deoxynucleotide residue (iso)^MeC) The 30 th nucleotide is an isoguanine deoxynucleotide residue (isoG), and the remaining nucleotide residues are natural nucleotide residues.

II, typing detection method of rs1517114 polymorphism of C8orf34 gene

1. Preparation of test Normal human genomic DNA

Collecting a normal human blood sample, extracting genome DNA (deoxyribonucleic acid) by using a blood genome extraction kit (purchased from Kangji century Biotechnology Co., Ltd., product number CW2087), and diluting the concentration of the extracted genome DNA to 1-50 ng/mu L.

2. Synthesis of specific primers and molecular beacons

The primers SEQ1 and SEQ2 and the artificial mimic nucleic acid molecular beacons SEQ3-FAM and SEQ4-VIC are designed in the synthesis step I of Beijing catalpi-xi biotechnology Limited company for detecting the polymorphism of the rs1517114 gene of C8orf 34.

3. Reaction system and reaction conditions and optimization thereof

The basic system and conditions for optimizing the reaction system and reaction conditions are as follows:

20 μ L reaction: the qPCR mixture (Table 1) contained 10. mu. L, SEQ 11. mu.L (concentration in the reaction system: 0.5. mu.M), SEQ 21. mu.L (concentration in the reaction system: 0.5. mu.M), SEQ3-FAM 0.5. mu.L (concentration in the reaction system: 0.2. mu.M), SEQ4-VIC 0.5. mu.L (concentration in the reaction system: 0.2. mu.M), 1. mu.L of the template, and 6. mu.L of nuclease-free water. The detection reagents EX Taq DNA polymerase, dNTPs and reaction buffer are all products of TAKARA company.

TABLE 1 concentration of each component of the qPCR mixed reaction solution in the reaction system

After the reaction system is prepared, the machine is operated, and a quantitative PCR instrument ABI7500 is used for PCR. The basic reaction conditions were as follows: pre-denaturation at 95 ℃ for 10 min, pre-denaturation at 95 ℃ for 15 sec, amplification at 62 ℃ for 40 sec, and amplification at 62 ℃ for 40 sec for 40 cycles, fluorescence was collected at 62 ℃ for 40 sec.

(1) Optimization of primer concentration: under otherwise identical conditions in the reaction system, the concentrations of the primers SEQ1 and SEQ2 were adjusted so that the concentrations of the primers in the reaction system were 0.1. mu.M, 0.2. mu.M, 0.4. mu.M, 0.5. mu.M, 0.6. mu.M, 0.8. mu.M and 1.0. mu.M, respectively. The reaction conditions were the same as the basic reaction conditions.

As a result, the amplification effect was the best in the reaction system at a primer concentration of 0.5. mu.M, and it was confirmed that the optimal primer concentration in the reaction system was 0.5. mu.M.

(2) Optimization of probe concentration: under the condition that other conditions of the reaction system are the same, the concentrations of SEQ3-FAM and SEQ4-VIC are adjusted, and the concentrations of SEQ3-FAM and SEQ4-VIC in the reaction system are 0.05. mu.M, 0.1. mu.M, 0.2. mu.M, 0.3. mu.M, 0.4. mu.M and 0.5. mu.M, respectively. The reaction conditions were the same as the basic reaction conditions.

The results showed that the amplification effect of the reaction system was the best at the concentration of SEQ3-FAM and SEQ4-VIC of 0.2. mu.M, and that the optimal concentration of SEQ3-FAM and SEQ4-VIC in the reaction system was 0.2. mu.M.

(3) And (3) optimizing the enzyme: under the same conditions as other conditions in the reaction system, different DNA polymerases are used, the DNA polymerases used are EX Taq DNA polymerase, Pfu DNA polymerase and rTaq DNA polymerase, respectively, one DNA polymerase is used for each reaction system, and the concentrations of the DNA polymerases in the reaction systems are the same. The reaction conditions were the same as the basic reaction conditions.

As a result, it was found that the amplification effect of the reaction system of EX Taq DNA polymerase was the best, and it was confirmed that EX Taq DNA polymerase was the most preferable DNA polymerase.

(4) Optimization of magnesium ion concentration: under the same conditions as the other conditions of the reaction system, the concentrations of magnesium ions in the reaction system were adjusted to 0.5mM, 1.0mM, 2.0mM, 3.0mM and 4.0mM, respectively. The reaction conditions were the same as the basic reaction conditions.

The results showed that the amplification effect of the reaction system was the best when the magnesium ion concentration was 2mM, and it was determined that the optimum magnesium ion concentration in the reaction system was 2 mM.

(5) Optimization of annealing temperature: the reaction system is a basic reaction system, and under the condition that other conditions of the reaction are the same, the annealing temperature is adjusted to carry out gradient PCR, wherein the annealing temperature is respectively 58 ℃, 60 ℃, 62 ℃ and 64 ℃.

The results showed that the amplification effect of the reaction system was the best when the annealing temperature was 62 ℃ and that the optimum annealing temperature was 62 ℃.

The basic reaction system is the optimal reaction system, and the basic reaction conditions are the optimal reaction conditions.

4. Preparation of the kit

The primer pair SEQ1 and SEQ2, the artificial mimic nucleic acid molecular beacon SEQ3-FAM and SEQ4-VIC, reaction buffer solution, dNTPs and MgCl₂The solution, EX Taq DNA polymerase and nuclease-free water are used as components of the kit to prepare the kit for detecting rs1517114 polymorphism of C8orf34 gene.

The kit can also comprise positive quality control and negative quality control. The positive quality control is artificially synthesized recombinant plasmids of DNA fragments containing rs1517114 locus of C8orf34 gene, including recombinant plasmid 1, recombinant plasmid 2 and recombinant plasmid 3. The recombinant plasmid 1 is obtained by replacing a DNA fragment between EcoRV and SmaI recognition sequences in an Escherichia coli cloning vector pUC57 (Saimer Feishell science and technology (China) Co., Ltd.) with a DNA fragment shown in a sequence 1 (the locus rs1517114 of a C8orf34 gene in the sequence 1 is G); the recombinant plasmid 2 is obtained by replacing a DNA fragment between EcoRV and SmaI recognition sequences in an escherichia coli cloning vector pUC57 with a DNA fragment shown in a sequence 1 (the locus rs1517114 of a C8orf34 gene in the sequence 1 is C); the recombinant plasmid 3 is obtained by mixing the recombinant plasmid 1 and the recombinant plasmid 2 according to a molar ratio of 1: 1. Negative quality control was nuclease-free water.

5. Gene validation result reading

The method for judging the genotype of the rs1517114 locus of the C8orf34 gene based on the combination of gene-specific PCR and the artificial simulated nucleic acid molecular beacon comprises the following steps: amplifying a C8orf34 gene fragment of a sample to be detected by using primers SEQ1 and SEQ2 specific to a C8orf34 gene, and designing a C8orf34 gene specific artificial simulated nucleic acid molecular beacon SEQ3-FAM and SEQ4-VIC in an amplification region defined by the primers specific to the C8orf34 gene; finally, the genotype of the rs1517114 locus of the C8orf34 gene of the sample to be detected is judged according to the release conditions of the FAM and VIC fluorescent signals in the sample to be detected:

if the sample to be detected releases the FAM fluorescent signal, does not release the VIC fluorescent signal, and the value of the FAM fluorescent signal is continuously increased, the genotype of the rs1517114 locus of the C8orf34 gene of the sample to be detected is GG;

if the sample to be detected releases the VIC fluorescent signal, does not release the FAM fluorescent signal, and the value of the VIC fluorescent signal is continuously increased, the genotype of the rs1517114 locus of the C8orf34 gene of the sample to be detected is CC;

and if the sample to be detected releases the FAM fluorescence signal and the VIC fluorescence signal, and the FAM fluorescence signal value and the VIC fluorescence signal value are both continuously increased, the genotype of the locus rs1517114 of the C8orf34 gene of the sample to be detected is GC.

The GG genotype refers to a homozygote of G at the base of rs1517114 locus of C8orf34 gene on two homologous chromosomes in a sample DNA to be detected; the CC genotype refers to a homozygote of bases of rs1517114 loci of C8orf34 genes on two homologous chromosomes in the DNA of a sample to be detected, which are C; the GC genotype refers to a heterozygote of G and C in basic groups of rs1517114 locus of C8orf34 gene on two homologous chromosomes in the DNA of a sample to be detected.

Example 2, specificity of the method for detecting rs1517114 polymorphism typing of C8orf34 gene in example 1

Firstly, preparation of sample to be tested

The recombinant plasmid 1 of example 1 was diluted to 1pg/uL with nuclease-free water to obtain a standard sample 1 that can mimic a clinical test sample.

The recombinant plasmid 2 of example 1 was diluted to 1pg/uL with nuclease-free water to obtain a standard sample 2 that can mimic a clinical test sample.

The recombinant plasmid 3 of example 1 was diluted to 1pg/uL with nuclease-free water to obtain a standard sample 3 that can mimic a clinical test sample.

Second, detection of rs1517114 polymorphism of C8orf34 gene

And (3) taking each standard sample prepared in the step one as a template, and detecting by respectively using the primer pair SEQ1 and SEQ2, the artificial mimic nucleic acid molecular beacon SEQ3-FAM and SEQ4-VIC of the example 1 according to the optimal reaction system and reaction conditions of the example 1.

For the standard sample 1, the FAM fluorescence signal is released, the VIC fluorescence signal is not released, and the FAM fluorescence signal value is continuously increased, which indicates that the genotype of the rs1517114 locus of the C8orf34 gene of the sample to be detected is GG (figure 4), and is consistent with the actual situation;

for the standard sample 2, the VIC fluorescence signal is released, the FAM fluorescence signal is not released, and the value of the VIC fluorescence signal is continuously increased, which indicates that the genotype of the locus rs1517114 of the C8orf34 gene of the sample to be detected is CC (fig. 5), and is consistent with the actual situation;

for the standard sample 3, the FAM fluorescence signal and the VIC fluorescence signal are released, and both the FAM fluorescence signal value and the VIC fluorescence signal value are continuously increased, which indicates that the genotype of the rs1517114 locus of the C8orf34 gene of the sample to be detected is GC (fig. 6), and is consistent with the actual situation.

Meanwhile, a synthetic common Taqman probe is designed and used as a reference, and the probe sequence is as follows:

SEQ 5-FAM: FAM-5 '-TCCTGATAGCGCTTATTCCTAGAG-BHQ 1-3' (SEQ ID NO: 6);

SEQ 6-VIC: VIC-5 '-TCCTGATAGCCCTTATTCCTAGAG-BHQ 1-3' (SEQ ID NO: 7).

The standard samples 1 and 2 were tested with the primer pair SEQ1 and SEQ2, the common Taqman probes SEQ5-FAM and SEQ6-VIC of example 1, respectively, and as a result, release of non-specific fluorescent signals was found, resulting in unreliable typing results (FIGS. 7 and 8).

The results show that the primer pair SEQ1 and SEQ2, the artificial mimic nucleic acid molecular beacon SEQ3-FAM and the artificial mimic nucleic acid molecular beacon SEQ4-VIC in example 1 have good specificity in detecting the genotype of the rs1517114 locus of the C8orf34 gene of the sample to be detected.

Example 3 detection of clinical samples Using the method for typing the polymorphism rs1517114 in C8orf34 Gene in example 1

1. Clinical sample to be tested

60 lung cancer patients (informed consent) were sampled and then genomic DNA was extracted (concentration and purity of genomic DNA were determined and the extracted genomic DNA concentration was diluted to 1-50 ng/. mu.L; OD260nm/OD280nm was between 1.8-2.0).

2. Fluorescent PCR detection based on artificial simulated nucleic acid molecular beacon probe

The genomic DNA of each sample was used as a template, and the primers SEQ1 and SEQ2, the artificial mock nucleic acid molecular beacon SEQ3-FAM, and SEQ4-VIC of example 1 were used to perform detection according to the optimal reaction system and reaction conditions of example 1, wherein each reaction system was a sample of genomic DNA, each reaction system was provided with three replicates, and nuclease-free water was used as a negative control in place of the genomic DNA.

The genomic DNA of each sample was PCR amplified using both SEQ1 and SEQ2 primer pairs and the resulting PCR products were Sanger sequenced.

The results are shown in Table 2. The above 60 lung cancer patients detected 41 cases of GG type, 16 cases of GC positive and 3 cases of CC type, and the positive samples detected by the invention completely matched with the positive samples detected by the Sanger sequencing method.

TABLE 2 test results of clinical specimens

The result shows that the accuracy of the polymorphism detection of the rs1517114 gene of C8orf34 by using the primer pair SEQ1 and SEQ2, the artificial mimic nucleic acid molecular beacon SEQ3-FAM and SEQ4-VIC in example 1 is 100%. In addition, the method has the advantages of high detection speed, simplicity in operation, objective result interpretation, less pollution of closed-tube reaction and the like, and is very suitable for large-scale development in clinic.

Although the preferred embodiments of the present patent have been described in detail, the present patent is not limited to the above embodiments, and various changes can be made without departing from the spirit of the present patent within the knowledge of those skilled in the art.

Sequence listing

<110> Beijing FuanHua Biotech Co., Ltd

<120> artificial simulated nucleic acid molecular beacon and kit for detecting rs1517114 site polymorphism of C8orf34 gene

<160>7

<170>PatentIn version 3.5

<210>1

<211>101bp

<212>DNA

<213> Artificial sequence

<220>

<221>misc_feature

<222>51

<223> n = c or g

<400>1

tgggttgtaa ttcagagtta gggagggagt atgataattt tcctgatagc ncttattcct 60

agagagttta gcaagtgtat ggattttctt gtagccatag g 101

<210>2

<211>31

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>2

ccgacacctg atagcgctta ttccttgtcg g 31

<210>3

<211>31

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>3

ccgacacctg atagccctta ttccttgtcg g 31

<210>4

<211>24

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>4

tgggttgtaa ttcagagtta ggga 24

<210>5

<211>25

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>5

cctatggcta caagaaaatc catac 25

<210>6

<211>24

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>6

tcctgatagc gcttattcct agag 24

<210>7

<211>24

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>7

tcctgatagc ccttattcct agag 24

Claims

1. The molecular beacon for detecting the rs1517114 site polymorphism of the human C8orf34 gene consists of a molecular beacon A and a molecular beacon B;

2. The molecular beacon of claim 1, wherein: and fluorescent groups and quenching groups are marked at two ends of the molecular beacon A and the molecular beacon B, and the fluorescent groups marked by the molecular beacon A and the molecular beacon B are different.

3. The molecular beacon of claim 2, wherein: the molecular beacon A is marked with FAM fluorophore; the molecular beacon B is marked with a VIC fluorescent group.

4. A kit for detecting rs1517114 site polymorphism of human C8orf34 gene, which comprises the molecular beacon of any one of claims 1-3 and a primer pair capable of amplifying from human genome to obtain a primer pair containing the recognition sequence of the circular region of the molecular beacon of any one of claims 1-3; the primer pair consists of a single-stranded DNA shown in a sequence 4 in a sequence table and a single-stranded DNA shown in a sequence 5 in the sequence table.

5. A kit for detecting rs1517114 site polymorphism of human C8orf34 gene, comprising the molecular beacon of any one of claims 1 to 3 or the kit of parts of claim 4.

6. Use of the molecular beacon of any one of claims 1 to 3 or the kit of parts of claim 4 or the kit of parts of claim 5 for the preparation of a product for detecting the polymorphism at the rs1517114 site of the human C8orf34 gene.

7. Use of a molecular beacon according to any one of claims 1 to 3 or a kit of parts according to claim 4 or a kit according to claim 5 for the manufacture of a product for assessing or aiding in assessing the risk of irinotecan administration to a subject to be tested.

8. A method for detecting rs1517114 site polymorphism of human C8orf34 gene, comprising the following steps: detecting a sample to be detected by using the molecular beacon as claimed in any one of claims 1 to 3 or the reagent set as claimed in claim 4, and determining the rs1517114 site polymorphism of the C8orf34 gene in the sample to be detected according to the change of a fluorescence signal in the sample to be detected; the methods are for non-disease diagnostic and therapeutic purposes.