KR20150021624A - Streptococcus pneumoniae producing hybrid polyserotype capsular polysaccharide and hybrid polyserotype capsular polysaccharide produced therefrom - Google Patents

Abstract

The present invention relates to Streptococcus pneumoniae producing hybrid polyserotype capsular polysaccharide and the hybrid polyserotype capsular polysaccharide produced from the Streptococcus. More specifically, the Streptococcus pneumoniae prepared by transfecting a vector comprising a repeat unit polymerase wzy19A gene of serotype 19A capsular polysaccharide into Streptococcus pneumoniae serotype 19F effectively produces a hybrid polyserotype capsular polysaccharide of 19A and 19F. Therefore, the Streptococcus pneumoniae and the hybrid polyserotype capsular polysaccharide produced therefrom can be useful as a vaccine for Streptococcus pneumonia.

Description

The present invention relates to a hybrid polysaccharide-producing polysaccharide and a hybrid polysaccharide polysaccharide produced therefrom,

The present invention relates to a method for the treatment of Streptococcus pneumoniae which produces a hybrid polysaccharide capsular polysaccharide pneumoniae strains and hybrid multicellular polysaccharides produced from the strains.

Streptococcus pneumoniae is a human pathogen well-known as pneumococcal or pneumococcal, and it causes mainly pneumonia, meningitis, sepsis and otitis media in children and the elderly. do. (S. pneumoniae) to S. pneumoniae polysaccharide is a film; are classified into 94 kinds of serotype according to the serological properties of (capsular polysaccharide capsular PS).

The antibody to the capsular polysaccharide may have a defense mechanism against S. pneumoniae expressing serotype capsules. Thus, currently developed vaccines for S. pneumoniae include mixtures of polysaccharides of various serotypes. For example, a polysaccharide vaccine, called the PS vaccine, includes 23 commonly found serotype polysaccharides, and the recently developed pneumococcal conjugate vaccine (PCV) It has a form associated with molecules. Early PCV has been developed to include seven serotypes (PCV7), but now vaccines containing serovar polysaccharides of 10 (PCV10) or 13 (PCV13) have been developed and used. With the introduction of PCV7, which was first used in the United States in 2000, the incidence of pneumococcal infections was significantly reduced in children and adults.

Recently, with the development of an effective pneumococcal vaccine, the infection rate of the serotype pneumococci contained in the vaccine has been greatly reduced, but infection with the non-vaccine serotype pneumococci not included in the vaccine is still continuing. Therefore, instead of developing a vaccine against the conventional vaccine serotypes, it has been proposed to use a non-vaccine serotype of pneumococcus, especially for the prevention and treatment of infection by serotype pneumococci such as 6A and 19A The development and dissemination of Korean vaccine is required.

In addition to the vaccine serotypes (4, 6B, 9V, 14, 18C, 19F and 23F) as a vaccine to improve PCV7, monitoring of the serotype of pneumococcal serotypes has been continuing, In addition, PCV10, including serotypes 1, 5 and 7F, has been developed and PCV13 has been developed and used in many countries around the world, including 6A and 19A, which are serotypes 6B and 19F. In addition to the 13 serotypes of PCV13, two serotypes, 22F and 33F, are being developed.

In addition, a vaccine for the manufacture of pneumococcus which produces multi-serum-type polysaccharide polysaccharide has been developed. International Patent Publication No. WO 2008/138120 A1 discloses a serotype 6B transformed serotype 6D strain of pneumococcus by replacing serotypes 6B pneumococcal galactosidase (wciNa) with glucose transporter (wciNb) In a study by Carmen L. et al (Clin. Vaccine Immunol. 2010, 17 (2)), two polymorphic strains of serotype 6A and 6B were identified by polymorphism following the modification of the wciP gene sequence of serotype 6 11): 1820). However, there is no known pneumococcal which produces a hybrid polysaccharide polysaccharide by introducing a repetitive unit polymerase of the capsular polysaccharide into a pneumococcal strain in the form of a plasmid carrier or a parallel gene sequence.

Accordingly, the present inventors have made efforts to produce a pneumococcal strain producing a hybrid multi-serum type polysaccharide. As a result, it has been found that a vector containing the same repetitive unit polymerase wzy 19A gene of serotype 19A of S. pneumoniae capsular polysaccharide is S . Since S. pneumoniae transformed into serotype 19F pneumococci in New Mono produces effectively hybrid 19S and 19F polysaccharide polysaccharides, the S. pneumoniae and the hybrid multi-serotype polysaccharide produced therefrom are effective against pneumonia The present invention has been accomplished by confirming that the present invention can be effectively used as a vaccine against a bacterium.

It is an object of the present invention to provide a method for producing a hybrid polysaccharide capsular polysaccharide ( Streptococcus pneumoniae) pneumoniae ) and a hybrid multicellular polysaccharide produced from the strain.

In order to accomplish the above object, the present invention provides a method for producing S. pneumoniae, which comprises the step of transfecting S. fneumoniae with a serotype 19F pneumococcal bacterial strain containing the wzy 19A gene of the same repetitive unit polymerase of serotype 19A of S. pneumoniae capsular polysaccharide Gt; 19A < / RTI > and 19F hybrid multicellular polysaccharide polysaccharide strains.

The present invention also provides 19A and 19F hybrid multi-serotype polysaccharides produced by said pneumococci.

The present invention also provides a vaccine composition for the prevention and treatment of pneumococcal bacteria comprising the above 19A and 19F hybrid multi-serum type polysaccharide.

In addition,

1) preparing a vector containing the wzy 19A gene of the same repeat unit polymerase of serotype 19A of S. pneumoniae capsular polysaccharide; And

2) transforming the vector of step 1) with S. pneumoniae into a serotype 19F pneumococcal strain to produce a transformed strain. The 19A and 19F hybrid multinucleated polysaccharide polysaccharide- And a manufacturing method thereof.

In addition,

1) culturing the pneumococcal strain; And

2) obtaining a hybrid membrane polysaccharide of serotype 19A and 19F from the culture of step 1) above.

The serotype 19A Streptococcus pneumoniae of the present invention pneumoniae) repeat unit polymerase 19A wzy gene the vector is produced is transformed into a S. pneumoniae serotype 19F pneumoniae Streptococcus pneumoniae is the serotype 19A and hybrid film polysaccharide (polysaccharide capsule) of 19F containing the a As a result, the pneumococci and the hybrid polysaccharide polysaccharides produced therefrom can be effectively used as a vaccine against S. pneumoniae.

Brief Description of the Drawings Fig. 1 is a diagram showing the schematic diagram of the synthesis site of the coat of TREP19A ( Streptococcus pneumoniae TREP19A) in Streptococcus pneumoniae strain, a serotype 19A pneumococcal strain.
FIG. 2 is a schematic diagram showing the formation of a hydrate capsic polysaccharide synthesized by introducing the wzy 19A gene into a Streptococcus pneumoniae EF3030 ( Streptococcus pneumoniae EF3030) through a plasmid carrier in a serotype 19F pneumococcal strain. to be.
FIG. 3 is a diagram for predicting the results of the production of polysaccharide capsules according to the positive and negative reactions of the sandwich enzyme-linked immunosorbent assay (sandwich ELISA).
4 is a diagram showing the serotype analysis of the hybrid membrane polysaccharide by sandwich enzyme immunoassay.
FIG. 5 is a diagram showing the schematic diagram of the synthesis site of the coating of EF3030 in S. pneumoniae .
6 is a diagram showing the structure of a Janus cassette prepared to remove the wzy 19F gene.
7 is a diagram showing the structure of a parallel gene cassette produced by linking genes of wzy19F-wzy19A polymerase.
Fig. 8 is a schematic diagram showing the process of introducing the wzy 19F- wzy 19A parallel gene cassette into the synthetic polysaccharide synthesis site of serotype 19F pneumococci using Janus cassette.
9 is a schematic diagram showing the formation of a hybrid membrane polysaccharide synthesized by introducing the wzy 19F- wzy 19A gene through a Janus cassette.
FIG. 10 is a graph showing the serotype analysis of a hybrid membrane polysaccharide through flow cytometric serotyping assay (FCSA).

Hereinafter, the present invention will be described in detail.

The present invention is a 19A and 19F hybrid transformed into S. pneumoniae serotype 19F pneumococcal strain containing the wzy 19A gene of the same repeat unit polymerase of serotype 19A of the S. pneumoniae capsular polysaccharide A transformed pneumococcal strain for producing a serotype polysaccharide is provided.

The wzy 19A gene is preferably composed of the nucleotide sequence of SEQ ID NO: 1, but is not limited thereto.

In a particular embodiment of the present invention, the inventors of the repeating unit from the polymerase, Serotype 19A Pneumococcal TREP19A the strain of S. pneumoniae in order to produce pneumococcal polysaccharides that express the hybrid film using a plasmid transformants wzy obtained the 19A gene (see Fig. 1), pVPT-T7 was inserted into vector were prepared pIH12_02 plasmid, as a result of the culture transformed by the EF3030 pneumococci the plasmid to S. pneumoniae of serotypes 19F ( 2), it was confirmed that pneumococcal strains simultaneously expressing the serotype 19A and 19F coat polysaccharides were produced (see FIGS. 3 and 4).

In order to produce a pneumococcal strain expressing a hybrid membrane polysaccharide using DNA transformation of S. pneumoniae, the present inventors have developed a method of isolating S. pneumoniae from a gene of TIGR19F strain expressing serotype 19F membrane polysaccharide wzy 19F was prepared in the Janus cassette to remove the gene (Fig. 5 and 6, and Table 1), a method of preparing a DNA gene cassette is connected parallel to wzy 19F- wzy gene 19A in parallel with this, the next (Fig. 7 8, and Table 2), the cassette DNA was transformed into TIGH19X in S. pneumoniae that did not express the capsular polysaccharide and cultured (see FIG. 9). As a result , it was confirmed that the hybrid multistreated polysaccharide 19A and 19F (See Fig. 10).

Therefore, the pseudomonas aeruginosa strains transformed with the vector containing the wzy 19A gene of the present invention efficiently produce hybrid multisense- type polysaccharide 19A and 19F, And can be effectively used as a vaccine composition for prevention and treatment against a bacterium.

The present invention also provides 19A and 19F hybrid multi-serotype polysaccharides produced by said pneumococci.

The present invention also provides a vaccine composition for the prevention and treatment of pneumococcal bacteria comprising the above 19A and 19F hybrid multi-serum type polysaccharide.

Since the hybrid multi-serum type polysaccharide of 19A and 19F of the present invention simultaneously exhibits 19A and 19F serotype polysaccharide, the hybrid polysaccharide type polysaccharide is useful as a vaccine composition for prevention and treatment of Streptococcus pneumoniae have.

The vaccine composition for preventing and treating pneumococcal disease comprising the hybrid multi-serum type polysaccharide of the present invention may further comprise suitable carriers, excipients and diluents conventionally used in the production of pharmaceutical compositions.

The pharmaceutical dosage form of the vaccine composition may be used in the form of a pharmaceutically acceptable salt thereof, and may be used alone or in combination with another pharmaceutically active compound, and may be used in a suitable combination.

The vaccine composition comprising the hybrid multi-serum-type polysaccharide of the present invention can be administered orally or parenterally in the form of powders, granules, tablets, capsules, suspensions, emulsions, syrups, aerosols or the like, oral preparations, And the like. Examples of carriers, excipients and diluents that can be included in the composition of the present invention include lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, acacia rubber, alginate, gelatin, calcium phosphate, calcium silicate, Cellulose, methylcellulose, microcrystalline cellulose, polyvinylpyrrolidone, water, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate and mineral oil. In case of formulation, it is prepared by using filler, weighting agent, binder, wetting agent, disintegrant, diluent of surfactant or excipient usually used.

Solid formulations for oral administration include tablets, pills, powders, granules, capsules and the like, which may contain at least one excipient such as starch, calcium carbonate, sucrose ), Lactose, gelatin and the like. In addition to simple excipients, lubricants such as magnesium stearate and talc are also used. Examples of liquid formulations for oral use include suspensions, solutions, emulsions, and syrups. Various excipients such as wetting agents, sweetening agents, flavoring agents, preservatives and the like may be included in addition to water and liquid paraffin, which are commonly used simple diluents. Formulations for parenteral administration include sterilized aqueous solutions, non-aqueous solutions, suspensions, emulsions, freeze-dried preparations, and suppositories. Examples of the suspending agent include propylene glycol, polyethylene glycol, vegetable oil such as olive oil, injectable ester such as ethyl oleate, and the like. Examples of the suppository base include witepsol, macrogol, tween 61, cacao butter, laurin, glycerogelatin and the like.

The preferred dosage of the vaccine composition comprising the hybrid multi-serum type polysaccharide of the present invention may vary depending on the condition and the weight of the patient, the degree of disease, the drug form, the administration route and the period, May be administered once to several times per week. In addition, the dose may be increased or decreased depending on the route of administration, degree of disease, sex, weight, age, and the like. Thus, the dosage amounts are not intended to limit the scope of the invention in any manner.

In addition,

1) S. pneumoniae Preparing a vector comprising the wzy 19A gene of the same repeat unit polymerase of serotype 19A of the capsular polysaccharide; And

2) transforming the vector of step 1) with S. pneumoniae into a serotype 19F pneumococcal strain to produce a transformed strain. The 19A and 19F hybrid multinucleated polysaccharide polysaccharide- And a manufacturing method thereof.

In addition,

1) culturing the pneumococcal strain of the present invention; And

2) obtaining hybrid 19S and 19F hybrid polysaccharide type polysaccharides from the culture of step 1).

Preferably, the wzy 19A gene comprises the nucleotide sequence of SEQ ID NO: 1 and the wzy 19F gene comprises the nucleotide sequence of SEQ ID NO: 2, but is not limited thereto.

The expression vector is preferably a shuttle vector derived from a plasmid vector, a cosmid vector, a bacteriophage vector and a viral vector. More specifically, a plasmid vector is preferably used, but is not limited thereto.

The transformation may be from the group consisting of Lipofectamine, Dojindo's Hilymax, Fugene, jetPEI, Effectene and DreamFect. A method using any one of the commercially available transfection reagents selected; A method using calcium-phosphate, a positively charged polymer, a liposome, a nanoparticle, a nucleofection, an electroporation, a heat shock, and magnetofection; A method of using retrovirus; And a method using a competence stimulatory peptide, and more preferably a method using an electroporation method or a receptor stimulating peptide, and more specifically, Is most preferably a method using a receptor stimulating peptide, but is not limited thereto.

Since the pneumococci produced by the production method of the present invention effectively produce the hybrid multi-serum-type polysaccharide of 19A and 19F, the pneumococci and the hybrid multi-sera-type polysaccharides produced therefrom can be used as a vaccine against pneumococci . ≪ / RTI >

The polynucleotide encoding the hybrid multisense polysaccharide polysaccharide of the present invention is a polysaccharide synthetase which is expressed from the coding region and which is expressed from the coding region in consideration of the codon degeneracy of the codon or the codon preference in the pneumococcal strain to express the above- Various modifications may be made to the coding region within a range that does not change the amino acid sequence of the coding region, and various modifications or modifications may be made within a range that does not affect the expression of the gene, Those skilled in the art will understand that the present invention is included in the scope of the present invention. That is, as long as the polynucleotide of the present invention encodes a protein having equivalent activity, one or more nucleotide bases may be mutated by substitution, deletion, insertion, or a combination thereof, and these are also included in the scope of the present invention. The sequence of such polynucleotides may be short or double-stranded, and may be a DNA molecule or RNA (mRNA) molecule.

Hereinafter, the present invention will be described in detail with reference to examples.

However, the following examples are illustrative of the present invention, and the contents of the present invention are not limited by the following examples.

< Example  1 > plasmid &lt; / RTI &gt; hybrid ( hybrid ) film  Polysaccharides ( capsule polysaccharide ) Expressing pneumococcal of  Produce

<1-1> Streptococcus Pneumoniae  TREP19A ( Streptococcus pneumoniae  TREP19A)

For serotype 19A pneumococci to the strain of S. pneumoniae to give 19A wzy genes of the same repeating units from TREP19A polymerase, the whole genome was isolated from the S. pneumoniae strain TREP19A.

Specifically, S. pneumoniae was treated with TREP19A (Burton et al ., 2006 ; The strain should be diluted with blood containing Tryptic soy broth (TSB), 1.5% agar and 5% sheep red blood cells (SRBC) The cells were inoculated into a blood agar medium (Hanil Commodore), cultured overnight at 37 ° C in a 5% carbon dioxide incubator, and then 2 to 3 colonies produced were screened to obtain Todd Hewitt ) Was suspended in THY medium containing liquid medium (purchased from BD Bioscience) and 0.5% yeast extract (purchased from BD Bioscience), and then absorbance at a wavelength of 600 nm was measured to be 0.6 &Lt; / RTI &gt; Then, the medium was centrifuged to remove the supernatant to obtain cells, and the cells were washed with 0.1% sodium deoxycholate, 0.01% sodium dodecyl sulfate and 0.15 M sodium acetate , 0.1 ml of cell-lysis buffer was added, and the mixture was incubated at 37 占 폚 for 10 minutes. After the reaction, 0.9 ml of a saline-sodium citrate buffer (SSC buffer) containing 0.15 M sodium chloride and 0.015 M sodium citrate was added and reacted at 65 ° C for 15 minutes.

As a result, a strain lysate containing a whole genome of TREP19A strain was prepared in S. pneumoniae and stored at -20 ° C until use.

<1-2> wzy 19A  gene Cloning  Manufacture of vectors

To prepare a vector for cloning the wzy 19A gene, the pVPT-T7 vector (Zuou, M et al . , 2008. J Microbiol Methods 72 (3): 249-56).

Specifically, 10 ng of pVPT-T7 plasmid was added to E. coli TOP10 (Invitrogen), left on ice for 30 minutes, reacted for 1 minute in a constant temperature water bath at 42 DEG C, To induce insertion of the plysmid into E. coli. After the reaction, the E. coli was immediately transferred to ice, rapidly cooled, and 1 ml of Super Optimal Broth (SOB; Invitrogen) was added to the E. coli, followed by shaking for 40 minutes in a 200 rpm 37 ° C incubator Lt; / RTI &gt; Then, the cells were plated on an LB plate medium containing 300 μg / ml of erythromycin (Sigma-Aldrich) as an antibiotic, and cultured overnight at 37 ° C. Then, a clearly generated colony was selected, Lt; RTI ID = 0.0 &gt; ml &lt; / RTI &gt; LB liquid medium containing myc. To give a culture medium midi plasmid purification kit; a using (Midi plasmid purification Kit purchased from Qiagen) purification of the pVPT-T7 vector, followed by preparation of the linear DNA to process the Kpn I restriction enzyme.

<1-3> wzy 19A  Gene Cloning

In order to obtain the wzy 19A gene of the same repetitive unit polymerase from the coat synthesis locus consisting of the pneumococcal strain having the serotype 19A, the wzy 19A gene was cloned from the whole genome of TREP19A into S. pneumoniae, Was inserted into the pVPT-T7 plasmid prepared in Example < 1-2 &gt;.

Specifically, using the strain lysate obtained in Example <1-1> as a template and using a P5109 forward primer (SEQ ID NO: 5: AAAGGTACCATGACTTATTTATTTTTTACTCTG) and a P3109 reverse primer (SEQ ID NO: 6: AAGGATCCTTAAGCGTAATCTGGAACATCGTATGGGTAGTTTTCCGATTTAATACTTGTGTCAGAG) The wzy 19A gene consisting of the sequence was amplified by PCR using Taq DNA polymerase (TaKaRa Ex Taq, product number: TaKaRa Code RR001AM), and the base sequence of the amplified DNA was analyzed and confirmed. Kpn I restriction enzyme And a linear form of wzy 19A fragment DNA was prepared. Then, the wzy 19A DNA and the pVPT-T7 vector prepared in the above Example <1-2> were quantified and mixed in the same ratio. Then, the RBC rapid ligation kit (purchased from Real Biotech Co.) (SEQ ID NO: 7: ATGGCTAGTATGACAGGAGGTCAACAAATGGGATAG) and P3107 reverse primer (SEQ ID NO: 8: aAAggatccTTAAGCGTAATCTGGAACATCGTATGGG) with a T4 ligase and ligated to the plasmid and DNA using PCR To amplify the linear DNA product. The linear DNA products were further digested with Bam HI restriction enzymes and then cleaved at both ends. Then, the linear DNA products were purified using a Wizard SV gel and a PCR clean-up kit (Promega) A circular plasmid DNA was prepared from the T4 ligase. The prepared plasmid DNA was transformed into E. coli TOP10 host by the same method as in Example <1-2>, screened with erythromycin and then subjected to PCR using 5730 forward primer (SEQ ID NO: 7) and P3107 reverse primer (SEQ ID NO: 8) PCR was re-performed to confirm the introduction of the wzy 19A gene.

As a result, as shown in Fig. 2, a plasmid having a length of 8608 bp was prepared, which was prepared by inserting the wzy 19A gene having a length of 1362 bp comprising the sequence listing 1 into a 7287 bp pVPT-T7 vector. pIH12_02 &lt; / RTI &gt; (Fig. 2).

&Lt; 1-4 > Transformation cells ( competent cell ) Preparation

Example <1-3> a plasmid pIH12_02 the serotype 19F, S. pneumoniae EF3030 pneumophila California to switch (tranformation) transformed to Streptococcus strains, the cell for transformation of strain EF3030 in S. pneumoniae in the manufacture Prepared.

Specifically, S. pneumoniae EF3030 (Dr. David E. Briles) pneumococcus was inoculated into a blood agar medium and incubated overnight at 37 ° C in a 5% carbon dioxide incubator. The resulting two to three fungal colonies Were suspended in THY medium, and then the absorbance at 600 nm was measured at 37 ° C. until the absorbance reached 0.6. Then, 100 μL of the medium was obtained and added to 10 mL of competent media of pH 7.2, THY liquid medium containing 0.2% bovine serum albumin (BSA) and 0.02% calcium chloride (CaCl ₂ ) Diluted at a ratio of 1: 100, 200 쨉 l was dispensed into 1.5 ml microtube, and then 50 쨉 l of 80% glycerol was added.

As a result, transfection cells were prepared, and the cells were used for transfection in freezing or immediately fresh conditions at -80 ° C.

<1-5> S. Pneumoniae EF3030  As a pneumococcal strain pIH12 Transformation of _02 plasmid

In order to express the capsular polysaccharide synthesized by wzy19A in EF3030 in S. pneumoniae of serotype 19F, The embodiment pIH12_02 the plasmid prepared in Example <1-3> was transformed into S. pneumoniae EF3030 strain of S. pneumoniae.

Specifically, 100 μl of EF3030 transforming cells in S. pneumoniae prepared in Example <1-4> was inoculated into 100 μl of a solution of hydrogen-Glu-Met-Arg-Ile-Ser-Arg-Ile- 250 ng of Competence stimulatory peptide type 2 (CSP-2; Hanpei Co., Ltd., product number ANA63877) composed of Phe-Leu sequence was reacted at 37 캜 for 14 minutes, 1 μg of pIH12_02 plasmid prepared in <1-4> was added and reacted at 37 ° C for 2 hours. After the reaction, the cells were plated on a blood agar medium containing 0.5 ug / ml of gentamicin (Sigma-Aldrich) and 5 ug / ml of erythromycin and cultured overnight at 37 ° C. lysed colony was inoculated into 1 ml of THY liquid medium and the absorbance was measured at a wavelength of 600 nm and shake cultured until OD value reached 0.5. After the culture, the medium was obtained and diluted by adding the same amount of THY liquid medium. Then, 500 μl of 80% glycerol was added, and 500 μl of each was dispensed.

As a result, pneumococcal bacteria simultaneously expressing wzy 19A and 19F membrane polysaccharide were produced as shown in Fig. 2 (Fig. 2).

<1-6> wzy 19A  And 19F film  Identification of polysaccharide expression

A sandwich enzyme-linked immunosorbent assay (sandwich ELISA) was performed to confirm the expression of wzy 19A and 19F membrane polysaccharides on EF3030 in S. pneumoniae of serotype 19F.

Specifically, after culturing in Example <1-5>, the culture broth was obtained, or S. pneumoniae stored at -80 ° C. was dissolved at room temperature, and then 7 × cell-lysis buffer was added thereto. For 15 minutes. Then, 50 쨉 l of 400 쨉 g / ml anti-mouse IgG antibody was added to the PBS as a capture antibody, and reacted overnight at 4 째 C and fixed on the ELISA plate. After the fixation, the PBS was removed with an aspirator and washed three times with a PBS solution (PBS-T solution) containing 0.05% Tween 20, followed by washing with PBS containing 1% BSA (PBS -BSA solution) was diluted at a ratio of 1: 100 with an IgG isotype Hyp19AG1 antibody (supplied by Dr. Moon H. Nahm, Alabama State University) specific to 19A-coated polysaccharide, and 50 μl was added to the ELISA plate, And reacted at 37 DEG C for 1 hour. After the reaction, the cells were washed five times with PBS-T solution. The prepared pneumococcal lysate was diluted at a ratio of 1:10, 1: 100, 1: 1000, and 1: 10000, and 50 μl was added to each well of the ELISA plate Reacted at 37 ° C for 1 hour, and washed 5 times with PBS-T solution. Then, an IgG isotype Hyp19FM1 antibody (provided by Dr. Moon H. Nahm, Alabama State University) specific to the 19F-coated polysaccharide was diluted with PBS-BSA solution at a ratio of 1: 100, and 50 μl was added to the ELISA plate , Reacted at 37 ° C for 1 hour, and washed five times with PBS-T solution. Anti-mouse IgM-horseradish peroxidase (HRP) antibody (Sigma-Aldrich) was diluted with PBS-BSA as a secondary conjugate antibody and added to each well of the ELISA plate by 50 μl, After reacting at 37 ° C for 1 hour, the reaction solution was removed by a sucker and washed five times with PBS-T solution. Next, 50 μl of 3,3 ', 5,5-tetramethylbenzidine (TMB) substrate reaction solution was added to the reaction solution for 30 minutes, and the absorbance at 450 nm was measured.

As a result, it was confirmed that 19A and 19F multisera-type membrane polysaccharides were expressed in the pneumococci produced as shown in FIGS. 3 and 4 (FIGS. 3 and 4).

< Example  2> Streptococcus pneumoniae DNA  Using Transformation hybrid  Membrane-expressing pneumococcal of  Produce

<2-1> Non-coating  In the polysaccharide-producing strain, 19F film  The homologous gene expressing the polysaccharide ( isogenic ) Production of strain

In order to prepare a homologous gene strain expressing 19F membrane polysaccharide from TIGR4-JS ( Streptococcus pneumoniae TIGR4-JS) in Streptococcus pneumoniae strain, a pneumococcal strain that does not produce a capsular polysaccharide, a strain of EF3030 strain of S. pneumoniae The genome was transformed into S. pneumoniae strain TIGR4-JS.

Specifically, the embodiment of EF3030 strain of S. pneumoniae using the same method as in Example <1-1> preparing the strain decomposition liquid containing the entire genome, and then the same procedure as in Example <1-4> Cells for transforming TIGR4-JS strain were prepared in S. pneumoniae and transformed in the same manner as in Example <1-5> to give 0.5 g / ml of gentamicin and 300 / ml of streptomycin streptomycin), and the expression of the 19F-coated polysaccharide was confirmed by performing sandwich-ELISA in the same manner as in Example <1-6>.

As a result, the S. pneumoniae expressing the 19F-coated polysaccharide had a TIGR4-JS homology gene And the homologous gene strain was named TIGR19F.

<2-2> wyz 19F  Janus cassette for removing genes ( Janus cassette )

In order to recombine the parallel gene cassette DNA expressing the wzy 19F- wzy 19A hybrid membrane polysaccharide, a Janus cassette for removing wzy 19F from the synthesis site of the TIGR19F strain of S. pneumoniae shown in Fig. 5 was prepared.

Specifically, in the, S. pneumoniae TIGR4 on-JS strain of Example <1-1> and by preparing strains decomposition solution containing the whole genome using the same method to do this as a template, Table 1 PCR was carried out in the same manner as in Example < 1-3 > using the primers shown, and the Janus cassette was amplified. In addition, the same procedure as in Example <2-1> and S. pneumoniae strain EF3030 to the decomposition solution as a template, prepared in the above using the primers shown in Table 1. Example <1-3> PCR was performed to amplify the wch Q19f and wzx 19F gene fragments from the coat synthesis site of serotype 19F pneumococci. Then, each PCR product was digested with restriction enzymes shown in the following Table 1, and then purified using a PCR clean-up kit. The three fragments were ligated to each other with T4 ligase. Then, the PCR was carried out using the P5007 forward primer (SEQ ID NO: 15: GTCTTAGAAGAAACTATTTC) and the P3005 reverse primer (SEQ ID NO: 16: TTTATTGCTTCTGGACGTGTA) to confirm completion of the Janus cassette.

As a result, a Janus cassette having a size of about 3.5 kb was prepared to remove wzy 19F from the coat-synthesis locus of EF3030 strain in S. pneumonia consisting of the nucleotide sequence of SEQ ID NO: 3 as shown in Fig. 6 ).

PCR conditions for producing Janus cassettes for removal of wzy 19F Template DNA
Strain PCR product
(Amplification length) primer Restriction enzyme name direction order

EF3030



wch Q19f
(About 1 kb) P5003
(SEQ ID NO: 9) F  CGAGGGTGTGTAAATGACTTA P3006
(SEQ ID NO: 10) R  CAAACTCTAGACTAGTTAAACATCCTCG Xba I
wzx 19f
(About 1 kb) P5006
(SEQ ID NO: 11) F  GGGGCCCCGGATCCGCGACAGAATGTATA Bam HI P3003
(SEQ ID NO: 12) R  TTTGACAAAGGCTGAAACACA
TIGR4-JS

Janus cassette
(About 1.3 kb) 5112
(SEQ ID NO: 13) F  CTAGTCTAGAGTTTGATTTTTAATGG Xba I 3112
(SEQ ID NO: 14) R  CGCGGATCCGGGCCCCTTTCCTTATGCTTTTGG Bam HI

EF3030 EF3030 * denotes the strain of S. pneumoniae, TIGR4-JS represents the TIGR4 strain JS-ah S. pneumoniae.

* F denotes a forward primer, and R denotes a reverse primer.

<2-3> Using the Janus cassette wzy 19F  Gene removal

wzy 19F- wzy 19A In order to recombine the parallel gene cassette DNA expressing the hybrid membrane polysaccharide, wzy 19F was removed from the synthesis site of the TIGR19F strain in S. pneumonia using a Janus cassette.

Specifically, the transforming cell of TIGR19F strain was prepared in S. pneumoniae using the same method as in Example <1-4>, and 1 μg of Janus cassette DNA prepared in Example <2-2> Were transformed and cultured in a blood agar medium containing 0.5 ug / ml of gentamicin and 100 ug / ml of kanamycin and cultured in the same manner as in Example <1-6>, the expression of 19F-coated polysaccharide was confirmed by performing a sandwich-ELISA.

As a result, it was confirmed that the 19F membrane polysaccharide was not expressed in the S. pneumoniae strain TIGR19F, and the strain was named TIGR19X.

<2-4> wzy 19F - wzy 19A  Parallel gene cassette DNA Manufacturing

wzy 19F- wzy 19A To express the hybrid coat polysaccharide, the wzy 19F- wzy 19A parallel gene cassette DNA was prepared.

Specifically, the Example <1-1> and <2-1> and S. pneumoniae in TREP19A or S. pneumoniae strain EF3030, and to the decomposition solution as a template to manufacture in shown in Table 2: PCR was carried out in the same manner as in Example <1-3> above using the primers to amplify the wch Q19f- wzy 19F and wzx 19F gene fragments of serotype 19A pneumococcal strains or serotype 19F pneumococcal strains of serotype 19A pneumococci . Then, the three fragments were ligated to each other by performing overlap PCR using the three gene fragments as a template and using P5007 forward primer (SEQ ID NO: 15) and P3003 reverse primer (SEQ ID NO: 12). Then, PCR was re-executed using the primer used in the overlap PCR, and the nucleotide sequence was analyzed to confirm the completion of the parallel gene cassette DNA.

As a result, a wzy 19F- wzy 19A parallel gene cassette of about 4.5 kb in size was prepared to express the wzy 19F- wzy 19A hybrid coat polysaccharide composed of the nucleotide sequence of SEQ ID NO: 4 as shown in Figs. 7 and 8 7 and 8).

PCR conditions for producing wzy 19F- wzy 19A parallel gene cassette template
DNA strain PCR product
(Amplification length) primer name direction order
TREP19A

wzy 19A
(About 1.37 kb)
P5002
(SEQ ID NO: 17) F  ATGTATAGGAGAGGGTAGATGACTTATTTATTTTT P3004
(SEQ ID NO: 18) R  TTAGTATTCATCAACTATCCTCTCTA

EF3030
wch Q19f- wzy 19F
(About 2.2 kb) P5007
(SEQ ID NO: 15) F  GTCTTAGAAGAAACTATTTC P3002
(SEQ ID NO: 19) R  AAAAATAAATAAGTCATCTACCCTCTCCTATACAT
wzx 19f
(About 1.0 kb) P5004
(SEQ ID NO: 20) F  TAGAGAGGATAGTTGATGAATACTAA P3003
(SEQ ID NO: 12) R  TTTGACAAAGGCTGAAACACA

* Denotes a TREP19A TREP19A strains on S. pneumoniae, EF3030 EF3030 represents a strain of S. pneumoniae.

* F denotes a forward primer, and R denotes a reverse primer.

<2-5> wzy 19F - wzy 19A hybrid film  Production of polysaccharide pneumococcus

19F-19A In order to produce pneumococcal bacteria expressing the hybrid membrane polysaccharide, the wzy 19F- wzy 19A parallel gene cassette was transformed into pneumococcal strain and flow cytometric serotyping assay (FCSA) Respectively.

Specifically, the transforming cell of TIGR19X strain was prepared using the same method as in Example <1-4>, and 1 μg of the wzy 19F- wzy 19A parallel gene cassette DNA prepared in Example <2-4> Were transformed in the same manner as in Example <1-5>, and cultured in a blood agar medium containing 0.5 ug / ml of gentamicin and 300 ug / ml of streptomycin. The medium was then cultured at 13,000 rpm For 2 minutes and the supernatant was removed to obtain cells. The cells were washed with phosphate buffered saline (PBS), 5% fetal bovine serum (FBS) and 0.1% sodium azide ), 10 ml of FACS buffer was added thereto, diluted at a ratio of 1:10, and 50 μl of the diluted FACS buffer was added to a V-bottom plate . Then, the Dobl monoclonal antibody specific for the 19A-coated polysaccharide as the primary antibody (Park et al., Infect Immun. 77 (8): 3374-9, 2009; provided by Dr. Moon H. Nahm of Alabama State University) and 19F Hyp19FMl monoclonal antibody (provided by Dr. Moon H. Nahm, Alabama State University), which is specific for the capsular polysaccharide, was diluted at a ratio of 1: 4,000 and 1: 100, respectively, and 50 μl was added to the V-shaped plate. After 30 minutes of reaction, 100 F of FACS buffer was added, centrifuged at 2,500 rpm for 5 minutes, and the plate was turned upside down to quickly remove the supernatant. A diluted solution of anti-human-IgG-PE antibody (Southern Biotech) and an anti-mouse-Ig-PE antibody (BD Bioscience) as a secondary antibody was added to suspend the precipitated pneumococci. After 30 minutes of reaction, 100 F of FACS buffer was added, centrifuged at 2,500 rpm for 5 minutes, and the plate was turned upside down to quickly remove the supernatant. Then, 200 to 300 μl of FACS buffer was added to suspend the precipitated pneumococci and transferred to a fluorescence activated cell sorter (FACS) tube to which 700 μl of FACS buffer was added. FACS caliber (FACS caliber; BD) to analyze the signal of the bound antibody.

As a result, it was confirmed that 19A and 19F hybrid multi-serum type polysaccharide was expressed in S. pneumoniae as shown in Fig. 10 (Fig. 10).

<110> EWHA UNIVERSITY - INDUSTRY COLLABORATION FOUNDATION <120> Streptococcus pneumoniae producing hybrid polyserotype capsular          polysaccharide and hybrid polyserotype capsular polysaccharide          produced therefrom <130> 13P-08-009 <160> 20 <170> Kopatentin 2.0 <210> 1 <211> 1362 <212> DNA <213> Streptococcus pneumoniae <400> 1 atgacttatt tatttttact ctgcctgacc ttattcttat taactttctt ctattttttt 60 gctttcaatc aagatttgat agctccgcca gttgtcatgt ctgttatgtt tctcattagt 120 tctgtatttg cccttattaa tgtgcaaaac tggaatattg agtatagtgg tttagcttat 180 cttttgatta ttagtggcat tattgttttt tcaatgcctc tcttggctct taattcgcct 240 agtctaaata ccaagattaa agtgacggat cggctcattg atatccaatt ctggaaaata 300 gctcttacta ttatagttga cctcattatt ctatatcttt ataggagaga gattcataat 360 cttgcactta gccatggtta tacgggttca aattttcagt ggttctttag aaatgctacc 420 agttatgaag gtgagctaac agtgcgaact tcgattcggg tcctcattcg tatcattgac 480 gtatctgctt atatttttgg atatactttt attaataatt tcttcattta tagtcataaa 540 cgctctaaag atttactgct cttagttcca ttcttgattt ttatttctaa aaccttatta 600 tctgggggta gattggatat tataaaaatt ttaattgcgt atgttgtaat ggcctatatt 660 cagcaaaaac gaaaagttgg ctgggataag gtcatctccc ataaatatat gagacttggt 720 tttgtaggct tgatagctgg gattcctacc ttttactatt ctttattctt atctggacgt 780 tctacgacta gaactgtatt tgaaagtatt tcaacctatt taggaggttc gattcagcat 840 tttaatcagt atattcaaaa tcctattgga gtagctgagg tttttggcga tgagtcattt 900 gtagctatta tgaatatttt gggtaatctt ggctttgtca attacaatag taccgttcac 960 ttagaatttc ggcagttagg gattactatg ggtaacgttt atactttctt tagaagaccc 1020 tggcatgact ttgggttagt cggtatgtat atcttttcct ttgttgtcgg tgtgtttttt 1080 gctatttttt atttgaaatt aagaaagagc cgtgctggtt ttaaattgga tattcataca 1140 attatttact cttatttctt ttattggatt tttttatcgt ccattgagca atactcgttt 1200 acaacaatca gtttgtttac acttgtattt atagtcttgg tttacctaat ggctttcttc 1260 tattggaatt tggatttcca cagaggaaaa ctagtaatta aactctctga cacaagtatt 1320 aaatcggaaa actacccata cgatgttcca gattacgctt aa 1362 <210> 2 <211> 1366 <212> DNA <213> Streptococcus pneumoniae <400> 2 atgagttatt tatttttact ttgccttaca ttattcttat tgactatatt ctatttcttt 60 gcttttattc aagatttaat tgctcctcca gtagttatgt ctgtaatgtt tctaattagt 120 tcagtatttg cactggttaa ttcaaaaaac tggaatattg aatatagtgg aatagcctat 180 attctcataa ttagtggtat tattatattt tcgattcctt taatggcatt aaaatcacct 240 aattttaata ctgaggttaa gattgctgat cgattaattg atatccaatt ttggaaaatt 300 gctctaacta ttataattga tctctttatt ttgtatcttt acaggaagga aatatacaac 360 cttgttctta gtaatggata tacggggtca aatattcagt ggttttttag aaatgcaacg 420 agttatgaag gtgaattgac agtgcgaact tttattcgag ttctcattcg tgttattgac 480 gtatctgctt atatttttgg atatactttt attaataatt ttcttatcta tcgccataaa 540 cgccctaaag acatattact tttagtacct ttattaatat ttatttcaaa aactttaata 600 tcaggaggcc ggcaagatat tattaaaatt ctgattgcct atgtaatcat gatgatatat 660 caacaaaaac ggaaagttgg atggaataga gtcatatctc ataaatatat tcaccttgga 720 tttgttggtt taatagcagg tattccagca ttttactact ctttgttttt agccggtcgt 780 tcaacgacta ggacgctatt tgagagtgtt tcgacctatc taggaggctc aattcagcat 840 tttaatcagt atattgaaaa tccattagat cctggtgaag tttttggcag tgaaacattg 900 gtgcctatat taaatatatt aggggaaatg ggcctagtta attatcgtag tacaattcat 960 ttagaatttc ggacactagg agttactgta ggaaatgttt atactttttt tagaagaccc 1020 ttgcatgatt ttggtctagt tggtatgtat gtatttgtct ttgctgtagg tgcttttttt 1080 gctatttatt atttagttct gagaaagaaa caggttggtt ttaatttgga tattcatacc 1140 attatttatt cttatgtctt ttattggatt tttttatcat caatcgagca atactcgttc 1200 acaatgatta gtctatatac acttgtattt attgtgttgg tttactttat ggctatcttt 1260 tactggtgta cagattttaa aagaggaaaa ctgattttta aaatttctga ctcaagtatc 1320 aaattaaaag aagaataaca gaatgtatag gagagggtag gggtag 1366 <210> 3 <211> 3770 <212> DNA <213> Artificial Sequence <220> <223> Janus cassette for removing wzy19f <400> 3 gtcttagaag aaactatttc ttgtgttaaa tctataaaag aaggcaatta taatgcaaag 60 caaatcgtta ttattgataa tttctctaat aatggtactg gtgaaaaact acaagagctt 120 tatgaatcag atttagaaat tgatgttttg attaaccatg aaaatgctgg ttttgctcgt 180 ggaaataatg tggcttatca atttgctaag gaaaagtata accccgattt catggttatc 240 atgaataacg atattgagat agaaacagaa aattttgaaa aaattgtgac agatatctat 300 cgtgaggaaa aattccattt gctcgggcca gatatcttct cgactactta ccaacttcac 360 caaaacccaa aacggttgac acattatact tatggagaag ttaaagctct aaatgaaaaa 420 tttaaaaaag ggagccaagt tagtctagct ttaaaaatca aatgttggtt gaaagctagt 480 aaagttcttc gaacagcaat ctatcaaaat agacgtaaaa aaggatcagt agactataga 540 aaaccgtag aaaacccaat tcttcatggt tcttttattg tatattcgag agattttatc 600 gaaaaagagg agtatgcttt taaccctaac accttctttt actatgaaac agagatatta 660 gattatgaag ctgaattaaa aggatacaag agaatttata cacctaaaat tagagttttg 720 caccatcaaa atgttgcaac taatcaagtt tacacgaact tgttagaaaa aaccttgttt 780 tcaaataaat gcaactttaa atccaccagt tattttttga agttgatgaa agaaaacgag 840 gatgtttaac tagtctagag tttgattttt aatggataat gtgatataat ctttaaatac 900 tgtagaaaag aggaaggaaa taataaatgg ctaaaatgag aatatcaccg gaattgaaaa 960 aactgatcga aaaataccgc tgcgtaaaag atacggaagg aatgtctcct gctaaggtat 1020 ataagctggt gggagaaaat gaaaacctat atttaaaaat gacggacagc cggtataaag 1080 ggaccaccta tgatgtggaa cgggaaaagg acatgatgct atggctggaa ggaaagctgc 1140 ctgttccaaa ggtcctgcac tttgaacggc atgatggctg gagcaatctg ctcatgagtg 1200 aggccgatgg cgtcctttgc tcggaagagt atgaagatga acaaagccct gaaaagatta 1260 tcgagctgta tgcggagtgc atcaggctct ttcactccat cgacatatcg gattgtccct 1320 atacgaatag cttagacagc cgcttagccg aattggatta cttactgaat aacgatctgg 1380 ccgatgtgga ttgcgaaaac tgggaagaag acactccatt taaagatccg cgcgagctgt 1440 atgatttttt aaagacggaa aagcccgaag aggaacttgt cttttcccac ggcgacctgg 1500 gagacagcaa catctttgtg aaagatggca aagtaagtgg ctttattgat cttgggagaa 1560 gcggcagggc ggacaagtgg tatgacattg ccttctgcgt ccggtcgatc agggaggata 1620 tcggggaaga acagtatgtc gagctatttt ttgacttact ggggatcaag cctgattggg 1680 agaaaataaa atattatatt ttactggatg aattgtttta gtacctagaa ttcaccaaaa 1740 ataaaaaaac acaggagaat gtagatgcct acaattaacc aattggttcg caaaccgcgt 1800 aaatcaaaag tagaaaaatc taaatcacca gctttgaacg ttggttacaa tagtcataaa 1860 aaagttcaaa caaacgtttc ttcaccacaa aaacgtggtg ttgcaactcg tgttggaaca 1920 atgacaccta aaaaacctaa ctcagccctt cgtaaattcg ctcgtgtacg tttgagcaac 1980 cttatcgaag ttactgccta catcccaggt atcggacaca acttgcaaga gcacagcgtg 2040 gtgcttcttc gcggtggacg tgtaaaagac cttccagggg tacgttacca tatcgtccgt 2100 ggtgcacttg atactgcagg tgttaacgat cgtaaacaag gccgttctaa atacggtact 2160 aaacgtccaa aagcataagg aaaggggccc ggatccgcga attaaaagaa gaataacaga 2220 atgtatagga gagggtagat gaatactaaa attaaaaata taataactag tttttcttat 2280 gttatttctt caaatctgct catagtttta acctcatcac tagttgtttt gatttttcct 2340 aaaataatgg gggtaactga gtacagttac tggcaacttt atatttttta tctgacctat 2400 atcggttttt tccacttggg ttggattgat gggatttatc tcaaatatgg tggcttagaa 2460 tatacaaatt tagatagaaa acagttttat tctcagatga ttctattttc tagtttctta 2520 atgctaatct cgctggtatt atttactttg aacctaataa ctgtaaggga tgaaaacgca 2580 agatatattt ataatatggc tatcattagc atgatagtca caaacttaag aacactctat 2640 gtttatatct tgcagatgac aaatcgcttg aaggatagtt cagtcattct aattagtgat 2700 cgcgttttat atgtactcct tttattcatg tttattgtat ttggatggca tgagtacaag 2760 gtcatgattt gggctgatat tctaggtcga acattttctc tcatgctttc cttctggatt 2820 tgtaaagata ttgtgtttca gcctttgtca aaatttatct tagatttcaa ggagtccctt 2880 gataatatcc gtgttggaat caatttaatg ctatctaaca ttgcgagtag catgattata 2940 ggcattgttc gtatgggaat tcaatggaat tggaatattg aaacattcgg gaaagtgtca 3000 ttaactttga gtatatctaa tttattaatg acttttatta atgccattgg attagttatc 3060 tttcctttga taaagcgaac aaagactgag aatttaccta aaatttattc taatttaaga 3120 aatgctttga tgttggttat gttcgcaatc ttgctcttct actatccttt aaaatttatt 3180 cttgatattt ggcttcctgc ttataaggat gccttagttt tcatggccct aatttttcct 3240 atgtcagttt atgaagggaa aatggctttg gtgataaata catatttaaa agcaatgaga 3300 atggaaaaag acattctcaa aattaatgct ttggttatgt taactagtat agtagtgaca 3360 ttagtgacta ctatactact aaataatttg gggctgacag ttgtatctat agttatttta 3420 cttgctttaa gaagtataat agctgaatta attttatcca aaaaactgaa gatatcagtc 3480 aagcaagaca ttgctttaga gttacttatg acgattatat ttatttcttc aagttggtat 3540 ctctctattt ggattgcagt aataatttat ttattggcgt atactttata tttgtattta 3600 aagcacaaag atatcagaat gtatatagaa tactttaaaa atcataaaaa aatatcataa 3660 aaattatata tcaatgaaat ggtagattac atttctacct ttttatccat ttaggaggaa 3720 acgatgaaaa agataatgct agttttcggt acacgtccag aagcaataaa 3770 <210> 4 <211> 4191 <212> DNA <213> Artificial Sequence <220> <223> serial cassette of wzy19F-wzy19A <400> 4 gtcttagaag aaactatttc ttgtgttaaa tctataaaag aaggcaatta taatgcaaag 60 caaatcgtta ttattgataa tttctctaat aatggtactg gtgaaaaact acaagagctt 120 tatgaatcag atttagaaat tgatgttttg attaaccatg aaaatgctgg ttttgctcgt 180 ggaaataatg tggcttatca atttgctaag gaaaagtata accccgattt catggttatc 240 atgaataacg atattgagat agaaacagaa aattttgaaa aaattgtgac agatatctat 300 cgtgaggaaa aattccattt gctcgggcca gatatcttct cgactactta ccaacttcac 360 caaaacccaa aacggttgac acattatact tatggagaag ttaaagctct aaatgaaaaa 420 tttaaaaaag ggagccaagt tagtctagct ttaaaaatca aatgttggtt gaaagctagt 480 aaagttcttc gaacagcaat ctatcaaaat agacgtaaaa aaggatcagt agactataga 540 aaaccgtag aaaacccaat tcttcatggt tcttttattg tatattcgag agattttatc 600 gaaaaagagg agtatgcttt taaccctaac accttctttt actatgaaac agagatatta 660 gattatgaag ctgaattaaa aggatacaag agaatttata cacctaaaat tagagttttg 720 caccatcaaa atgttgcaac taatcaagtt tacacgaact tgttagaaaa aaccttgttt 780 tcaaataaat gcaactttaa atccaccagt tattttttga agttgatgaa agaaaacgag 840 gatgtttaaa tgagttattt atttttactt tgccttacat tattcttatt gactatattc 900 ttttctttg cttttattca agatttaatt gctcctccag tagttatgtc tgtaatgttt 960 ctaattagtt cagtatttgc actggttaat tcaaaaaact ggaatattga atatagtgga 1020 atagcctata ttctcataat tagtggtatt attatatttt cgattccttt aatggcatta 1080 aaatcaccta attttaatac tgaggttaag attgctgatc gattaattga tatccaattt 1140 tggaaaattg ctctaactat tataattgat ctctttattt tgtatcttta caggaaggaa 1200 atatacaacc ttgttcttag taatggatat acggggtcaa atattcagtg gttttttaga 1260 aatgcaacga gttatgaagg tgaattgaca gtgcgaactt ttattcgagt tctcattcgt 1320 gttattgacg tatctgctta tatttttgga tatactttta ttaataattt tcttatctat 1380 cgccataaac gccctaaaga catattactt ttagtacctt tattaatatt tatttcaaaa 1440 actttaatat caggaggccg gcaagatatt attaaaattc tgattgccta tgtaatcatg 1500 atgtatatcc aacaaaaacg gaaagttgga tggaatagag tcatatctca taaatatatt 1560 caccttggat ttgttggttt aatagcaggt attccagcat tttactactc tttgttttta 1620 gccggtcgtt caacgactag gacgctattt gagagtgttt cgacctatct aggaggctca 1680 attcagcatt ttaatcagta tattgaaaat ccattagatc ctggtgaagt ttttggcagt 1740 gaaacattgg tgcctatatt aaatatatta ggggaaatgg gcctagttaa ttatcgtagt 1800 acaattcatt tagaatttcg gacactagga gttactgtag gaaatgttta tacttttttt 1860 agaagaccct tgcatgattt tggtctagtt ggtatgtatg tatttgtctt tgctgtaggt 1920 gctttttttg ctatttatta tttagttctg agaaagaaac aggttggttt taatttggat 1980 attcatacca ttatttattc ttatgtcttt tattggattt ttttatcatc aatcgagcaa 2040 tactcgttca caatgattag tctatataca cttgtattta ttgtgttggt ttactttatg 2100 gctatctttt actggtgtac agattttaaa agaggaaaac tgatttttaa aatttctgac 2160 tcaagtatca aattaaaaga agaataacag aatgtatagg agagggtagg ggtagatgac 2220 ttatttattt ttactctgcc tgaccttatt cttattaact ttcttctatt tttttgcttt 2280 caatcaagat ttgatagctc cgccagttgt catgtctgtt atgtttctca ttagttctgt 2340 atttgccctt attaatgtgc aaaactggaa tattgagtat agtggtttag cttatctttt 2400 gattattagt ggcattattg ttttttcaat gcctctcttg gctcttaatt cgcctagtct 2460 aaataccaag attaaagtga cggatcggct cattgatatc caattctgga aaatagctct 2520 tactattata gttgacctca ttattctata tctttatagg agagagattc ataatcttgc 2580 acttagccat ggttatacgg gttcaaattt tcagtggttc tttagaaatg ctaccagtta 2640 tgaaggtgag ctaacagtgc gaacttcgat tcgggtcctc attcgtatca ttgacgtatc 2700 tgcttatatt tttggatata cttttattaa taatttcttc atttatagtc ataaacgctc 2760 taaagattta ctgctcttag ttccattctt gatttttatt tctaaaacct tattatctgg 2820 gggtagattg gatattataa aaattttaat tgcgtatgtt gtaatggcct atattcagca 2880 aaaacgaaaa gttggctggg ataaggtcat ctcccataaa tatatgagac ttggttttgt 2940 aggcttgata gctgggattc ctacctttta ctattcttta ttcttatctg gacgttctac 3000 gactagaact gtatttgaaa gtatttcaac ctatttagga ggttcgattc agcattttaa 3060 tcagtatatt caaaatccta ttggagtagc tgaggttttt ggcgatgagt catttgtagc 3120 tattatgaat attttgggta atcttggctt tgtcaattac aatagtaccg ttcacttaga 3180 atttcggcag ttagggatta ctatgggtaa cgtttatact ttctttagaa gaccctggca 3240 tgactttggg ttagtcggta tgtatatctt ttcctttgtt gtcggtgtgt tttttgctat 3300 tttttatttg aaattaagaa agagccgtgc tggttttaaa ttggatattc atacaattat 3360 ttactcttat ttcttttatt ggattttttt atcgtccatt gagcaatact cgtttacaac 3420 aatcagtttg tttacacttg tatttatagt cttggtttac ctaatggctt tcttctattg 3480 gaatttggat ttccacagag gaaaactagt aattaaactc tctgacacaa gtattaaatc 3540 ggaaaactga aaacaataaa aatagagagg atagttgatg aatactaaaa ttaaaaatat 3600 aataactagt ttttcttatg ttatttcttc aaatctgctc atagttttaa cctcatcact 3660 agttgttttg atttttccta aaataatggg ggtaactgag tacagttact ggcaacttta 3720 tattttttat ctgacctata tcggtttttt ccacttgggt tggattgatg ggatttatct 3780 caaatatggt ggcttagaat atacaaattt agatagaaaa cagttttatt ctcagatgat 3840 tctattttct agtttcttaa tgctaatctc gctggtatta tttactttga acctaataac 3900 tgtaagggat gaaaacgcaa gatatattta taatatggct atcattagca tgatagtcac 3960 aaacttaaga acactctatg tttatatctt gcagatgaca aatcgcttga aggatagttc 4020 agtcattcta attagtgatc gcgttttata tgtactcctt ttattcatgt ttattgtatt 4080 tggatggcat gagtacaagg tcatgatttg ggctgatatt ctaggtcgaa cattttctct 4140 catgctttcc ttctggattt gtaaagatat tgtgtttcag cctttgtcaa a 4191 <210> 5 <211> 32 <212> DNA <213> Artificial Sequence <220> <223> P5109_F <400> 5 aaaggtacca tgacttattt atttttactc tg 32 <210> 6 <211> 66 <212> DNA <213> Artificial Sequence <220> <223> P3109_R <400> 6 aaggatcctt aagcgtaatc tggaacatcg tatgggtagt tttccgattt aatacttgtg 60 tcagag 66 <210> 7 <211> 36 <212> DNA <213> Artificial Sequence <220> <223> 5730_F <400> 7 atggctagta tgacaggagg tcaacaaatg ggatag 36 <210> 8 <211> 37 <212> DNA <213> Artificial Sequence <220> <223> P3107_R <400> 8 aaaggatcct taagcgtaat ctggaacatc gtatggg 37 <210> 9 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> P5003_F <400> 9 cgagggtgtg taaatgactt a 21 <210> 10 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> P3006_R <400> 10 caaactctag actagttaaa catcctcg 28 <210> 11 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> P5006_F <400> 11 ggggcccgga tccgcgacag aatgtata 28 <210> 12 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> P3003_R <400> 12 tttgacaaag gctgaaacac a 21 <210> 13 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> 5112_F <400> 13 ctagtctaga gtttgatttt taatgg 26 <210> 14 <211> 33 <212> DNA <213> Artificial Sequence <220> <223> 3112_R <400> 14 cgcggatccg ggcccctttc cttatgcttt tgg 33 <210> 15 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> P5007_F <400> 15 gtcttagaag aaactatttc 20 <210> 16 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> P3005_R <400> 16 tttattgctt ctggacgtgt a 21 <210> 17 <211> 35 <212> DNA <213> Artificial Sequence <220> <223> P5002_F <400> 17 atgtatagga gagggtagat gacttattta ttttt 35 <210> 18 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> P3004_R <400> 18 ttagtattca tcaactatcc tctcta 26 <210> 19 <211> 35 <212> DNA <213> Artificial Sequence <220> <223> P3002_R <400> 19 aaaaataaat aagtcatcta ccctctccta tacat 35 <210> 20 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> P5004_F <400> 20 tagagaggat agttgatgaa tactaa 26

Claims (11)

In the same repeating unit polymerase wzy transformed 19A and 19F are hybrid serotype polysaccharide film 19A is a vector comprising a gene for serotype 19F Streptococcus pneumoniae in S. pneumoniae serotype 19A of the polysaccharide coating to the S. pneumoniae Transgenic Streptococcus pneumoniae strains for production.
The transformed pneumococcal strain according to claim 1, wherein the wzy 19A gene comprises the nucleotide sequence of SEQ ID NO: 1.
2. The transformed S. pneumoniae strain of claim 1, wherein the wzy 19F gene comprises the nucleotide sequence of SEQ ID NO: 2.
19. A 19S and 19F hybrid multicellular polysaccharide produced by S. pneumoniae of claim 1.
A vaccine composition for the prevention and treatment of Streptococcus pneumoniae comprising the 19A and 19F hybrid multi-serum type polysaccharide of claim 4.
1) preparing a vector containing the same repetitive unit polymerase wzy 19A gene of the serotype 19A of the S. pneumoniae capsular polysaccharide; And
2) transforming the vector of step 1) into S. pneumoniae into a serotype 19F pneumococcal strain to produce a transformed strain. 19A and 19F hybrid transformed pneumococcal strains for the production of a multi- &Lt; / RTI &gt;
7. The method according to claim 6, wherein the wzy 19A gene comprises the nucleotide sequence of SEQ ID NO: 1.
7. The method according to claim 6, wherein the wzy 19F gene comprises the nucleotide sequence of SEQ ID NO: 2.
7. The method of claim 6, wherein the vector of step 1) is any one selected from the group consisting of a plasmid vector, a cosmid vector, a bacteriophage vector, and a viral vector. A method for producing transformed pneumococci.
7. The method according to claim 6, wherein the transformation in step 2) is carried out using Lipofectamine, Hilymax, Fugene, jetPEI, Effectene from Dojindo, And DreamFect; a method of using one of the commercially available transfection reagents selected from the group consisting of &lt; RTI ID = 0.0 &gt; A method using calcium-phosphate, a positively charged polymer, a liposome, a nanoparticle, a nucleofection, an electroporation, a heat shock, and magnetofection; A method of using retrovirus; And a method using a competence stimulatory peptide. The method for producing a 19S and 19F hybrid multisense polysaccharide polysaccharide according to any one of claims 1 to 3,
1) culturing the pneumococcal strain of claim 1; And
2) obtaining hybrid 19S and 19F hybrid polysaccharide type polysaccharides from the culture of step 1) above.

Images