KR20150019300A - Method for producing functional stay-green transgenic plant with increased resistance to abiotic stresses using NAC016 gene and the plant thereof - Google Patents

Abstract

The present invention relates to: a method for producing a functional stay-green transgenic plant with increased resistance to abiotic stress using NAC016 gene; and a plant produced by the same. When a gene, which is derived from mouseear cress and codes NA016 protein, is inhibited, functional stay-green traits are expressed in a plant of which aging is delayed and salt and oxidation stress resistance is increased. Therefore, a transgenic plant having productivity and abiotic stress resistance increased by adjusting expression of the NAC016 protein coding gene in the plant can be developed.

Description

FIELD OF THE INVENTION [0001] The present invention relates to a method for producing a functional green persistent mutant plant having increased abiotic stress tolerance using the NAC016 gene, and a plant having the same,

The present invention relates to a method for producing a functional green continuous mutant plant having increased abiotic stress tolerance using the NAC016 gene, and more particularly, to a method for producing a functional green continuous mutant plant, A method for the production of a plant having a functional green-persistent trait or an increased abiotic stress tolerance, comprising the steps of: And a gene encoding the NAC016 protein derived from Arabidopsis thaliana and its increased seeds and plants, and to a composition for controlling aging and abiotic stress resistance of a plant.

In the fall, most plants remobilize leaf nutrients into storage or seeds to maximize plant survival in the spring of next year (Hortensteiner and Feller, J. Exp . Bot . 53: 927-937, 2002 ). This rearrangement is caused by the senescence of leaves, which is a sophisticated, genetically programmed cell death process considered to be the last stage of leaf development (Lim et al. al ., Ann . Rev. Plant Biol . 58: 115-136, 2007). Leaf aging is an inherited factor, including plant hormones, levels of several metabolites and the state of the photosystem complex (Sakuraba et al ., Plant Cell Physiol . 53: 505-517, 2012) or by external factors such as drought, high salt, low brightness and pathogen attack (Mecey et al ., Chem . Commun . 47: 5295-5297, 2011).

Unlike normal individuals, mutants that show aging phenomena other than normal aging phenomena have been found in various plants until now. However, unlike the normal individuals, the mutant that keeps the green without changing the leaves to yellow even after the stage where the grain is emulsified is referred to as' green continuous mutation Quot; stay-green mutant " or " non-yellowing mutant ". Individuals exhibiting this green persistence trait are classified into five types according to their nature (Thomas and Howarth, J. Exp . Bot . , 51: 329, 2000). Type A green persistence is an object to which aging begins much later, and once aging begins, aging progresses at the same rate as a normal body. B type green persistence is characterized by the fact that aging begins at the same time as normal individuals but slow progress of leaf sulphation and slow rate of photosynthesis efficiency decline with aging. Both of these forms have a 'functional stay-green' trait where the photosynthetic efficiency remains relatively high while the grain is full. On the other hand, C type green persistence is a mutation that maintains the green color of the leaves because the chlorophyll does not decompose due to the genetic damage of the mechanism of decomposing chlorophyll during the aging of the plant, and this type of mutant has a physiological function Nonfunctional stay-green 'or' cosmetic staygreen 'because they normally undergo aging. D-type green persistence occurs when leaves suddenly die due to sudden freezing or drying. E-type green persistence is a variant in which chlorophyll is accumulated in a relatively high content in the leaves and maintains dark green but does not increase photosynthetic efficiency. Therefore, leaves with functional green persistence maintain high chlorophyll content and photosynthetic efficiency while the grain is free, while leaves with non-functional green persistence have green color of leaves, but photosynthesis ability is normal .

Genetic, developmental, and physiological factors that induce senescence are transcription factors (TFs) that dynamically regulate senescence-associated gene (SAG), a nuclear gene that acts in signaling pathways and in various signaling pathways. (Buchanan-Wollaston et al ., Plant J. 42: 567-585, 2005). The Arabidopsis thaliana genome encodes about 2000 TFs (Riechman et al ., Science 290: 2105-2110, 2000), 40 aging-related TFs (senTFs) progressively increase expression as the leaves age (Balazadeh et al ., Plant Biol. 10: 63-75, 2008). In particular, aging-induced NAM, ATAF1, 2 and CUC2 (senNAC) TF are abundant, suggesting that they play an important role in the regulation of leaf senescence.

Several senNAC regulatory mechanisms and physiological functions have been determined (Balazadeh et al ., Plant Biol . 10: 63-75, 2008). For example, NAC092 / AtNAC2 / ORESARA1 ( ORE1 ) serves as an aging promoter; ore1 mutants delay leaf senescence (Kim et al ., Science 323: 1053-1057, 2009). ORE1 is regulated post-transcription by miRNA 164. As plants aging, ETHYLENE INSENSITIVE 2 ( EIN2 ) inhibits miRNA164, leading to a gradual increase in ORE1 expression to promote leaf senescence (Kim et al ., Science 323: 1053-1057, 2009). In addition, the downstream (downstream) of a gene is ORE1 estradiol-inducible ORE1-overexpressing (ORE1 -OX) it was irradiated by a microarray analysis of a plant (Balazadeh et al, Plant J. 62 : 250-264, 2010.) ; It identified 170 genes that were significantly up-regulated, including 78 SAGs. Of these genes, BFN1 ( BIFUNCTIONAL NUCLEASE1 ), SINA1 and SAG29 / SWEET15 , which are direct target genes of ORE1 , have been recently discovered (Matallana-Ramirez et al ., Plant doi: 10.1093 / mp / sst012, 2013). In addition, Breeze et al. Identified many senNAC genes up-regulated by ORE1 using high-resolution time-series microarray data ( Plant Cell 23: 873-894, 2011). These results indicate that ORE1 plays an important role in direct or indirect regulation of SAG expression in combination with other senNACs to promote leaf senescence.

In addition to ORE1 , NAP and ORS1 have also been found to promote senescence. NAC029 / NAP is the Arabidopsis senNAC (Guo and Gan, Plant J. 46: 601-612, 2006); The nap mutants exhibit delayed leaf senescence, and NAP- OX plants show premature sulphation of leaves during both natural and cancer inducible senescence, indicating that NAP also promotes senescence. Furthermore, rice ( Oryza sativa ) and kidney beans ( Phaseolus that is evolutionarily conserved from 601-612, 2006), which network is vegetation control NAP: vulgaris) over-expression of NAP homologue is delayed to compensate for aging phenotypes (Guo and Gan, Plant J. 46 of the Arabidopsis thaliana mutant nap . NAC059 / ORESARA1 SISTER1 ( ORS1 ) was identified as a paralog of ORE1 (Ooka et al ., DNA Res. 10: 239-247, 2003). ORS1 expression is predominantly age and H ₂ O ₂ dependent; Also, the ors1 mutant exhibited delayed leaf senescence and ORS1- OX was prematurely senescent (Balazadeh et al ., Mol . Plant 4: 346-360, 2011).

In contrast, the two senNACs, NAC042 / JUNGBRUNNEN1 ( JUB1 ) and NAC083 / VND-INTERACTING2 ( VNI2 ) are aging inhibitor modulators; Knockout mutants of these genes are prematurely senescent, and their overexpression delays leaf senescence (Wu et al ., Plant Cell 24: 482-506, 2012). In addition, the JUB1- OX and VNI2- OX plants have improved salt tolerance in Arabidopsis plants by regulating the expression of the salt stress response gene, which can be regulated simultaneously through senNAC's regulatory network of salt stress signaling and leaf senescence pathways Lt; / RTI > JUB1 is also directly coupled to DREB2A promoter H ₂ O ₂ - serves as a reactive NAC TF - active oxygen species (reactive oxygen species) to improve resistance to oxidative stress parameters. JUB1- OX plants exhibit enhanced H ₂ O ₂ stress tolerance and jub1 mutants exhibit increased sensitivity (Wu et al ., Plant Cell 24: 482-506, 2012). The molecular function of some senNACs is well characterized, but many other senNAC functions remain unidentified. Therefore, the present invention aims to reveal the function of NAC016 , a transcription factor of Arabidopsis thaliana NAC, which has not been previously characterized, in controlling aging and stress tolerance.

Korean Patent No. 0647767 discloses a method for producing a novel green persistent gene and a green persistence mutant plant, and Korean Patent No. 1028113 discloses a method for producing a CaHB1 gene of pepper, which is involved in growth promotion, salt tolerance and aging control, And its use '. However, as described in the present invention, there has been no description of a method for producing a functional green persistent mutant plant having an increased abiotic stress tolerance using the NAC016 gene, and plants therefrom.

DISCLOSURE OF THE INVENTION The present invention has been made in view of the above-mentioned needs, and it is an object of the present invention to provide a functional stay-green in which the aging of the leaves is delayed in Arabidopsis plants inhibiting the expression of a gene encoding NAC016 protein derived from Arabidopsis, The present inventors have completed the present invention by confirming that the resistance to salt and oxidative stress is enhanced as compared with the wild type.

In order to solve the above-mentioned problems, the present invention relates to a method for the treatment of NACO16 protein in a plant, which comprises the step of suppressing the expression of a gene encoding NAC016 protein derived from Arabidopsis thaliana, Thereby providing an increased plant production method.

The present invention also provides plants and their seeds having a functional green-tolerance trait or an abiotic stress tolerance produced by the method.

In addition, the present invention provides a composition for controlling aging and abiotic stress resistance of a plant, comprising a gene encoding Arabidopsis NAC016 protein.

Inhibition of the expression of the gene encoding the NAC016 protein derived from Arabidopsis of the present invention results in a functional green-persistent trait in the delayed senescence plant and an increase in the abiotic stress tolerance. Therefore, the NAC016 protein coding gene Can be used to increase productivity and contribute to the development of transgenic plants with increased abiotic stress resistance.

Figure 1 shows the expression pattern of NAC016 in the developmental stage of plants and the aging induction conditions of cancer treatment. (A) The expression of NAC016 began to increase in green rosette leaves of 4-week-old wild-type Arabidopsis (Col-0) plants. (B) The expression of NAC016 increases after 2 days of cancer treatment and decreases after 5 days. The relative expression levels of NAC016 were measured using reverse transcription-quantitative real-time PCR (RT-qPCR), relative to the transcript level of GAPDH (glyceraldehyde phosphate dehydrogenase, At1g16300) Standardized. The mean and standard deviation are values obtained from three or more biological repeat experiments. The experiment showed similar results with at least two repetitions.
Figure 2 shows the results of analyzing the characteristics of the nac016-1 mutant. (A) T-DNA and gene structure inserted in the fourth exon of NAC016 . Exons are marked by boxes connected to lines representing introns. (B) The absence of NAC016 mRNA in the nac016-1 mutant was confirmed by RT-PCR. GAPDH was used as a loading control. (C) A stay-green phenotype of the nac016-1 mutant during natural aging. The color of the leaves is changed in 5-6 weeks old plants. (D) In the case of continuous white light (90 μmol m ^-2 s ^-1 ), leaves isolated from 3 week-old nac016 -1 mutants were treated for 4 days (D), whole plants were treated for 7 days (E ), The age-dependent phenotype of (F) treated leaves from 3-week-old plants for 2 days in aging induction hormone (20 μM ABA or 100 μM MeJA). The nyc1 nol double mutant was used as a control group for the gustatory persistence. ABA, abscisic acid; DDI, cancer treatment days; DT, treatment days; MeJA, methyl jasmonate.
Figure 3 shows photosynthetic-related factor changes in the nac016-1 mutant during cancer-induced senescence induction. (A) Changes in the contents of total chloroplasts after four days of dark brown leaves, nac016-1 and nyc1 nol plants isolated from 4 weeks of dark brown leaves. (B) Changes in chloroplast a / b ratio after four days dark treatment of leaves isolated from 3 major wild type, nac016-1 and nyc1 nol plants. The black and white bars represent the pre-cancer treatment and the post-cancer treatment for 4 days, respectively. The mean and standard deviation are the results obtained from more than 8 iterations. (C) 3 main wild type, nac016 -1 and nyc1 nol Cell membrane ionic leaching after 5 days of cancer treatment of leaves isolated from plants. The ion leakage is expressed as a ratio of initial conductivity to total conductivity. The black and white bars indicate before cancer treatment and after cancer treatment for 5 days, respectively. (D) Photosynthetic protein immunoblot analysis of leaves isolated from 3 major wild type, nac016-1 and nyc1 nol plants. For photosynthetic protein detection, antibodies against PSII antennas (Lhcb1, Lhcb2 and Lhcb4), PSI core (PsaA), PSI antennas (Lhca1 and Lhca2) and PAO (pheophorbide a oxygenase) were used. RbcL (Rubisco large subunit) protein was identified by CBB (Coomassie Brilliant Blue) staining. Studen's t- test was used to calculate statistical significance (*, P <0.05; **, P <0.01). The experiment showed similar results in at least two repeated experiments. DDI, cancer treatment days.
Fig. 4 shows the result of observing chlorophyll of nac016-1 mutant leaves using a scanning electron microscope under the aging inducing conditions by cancer treatment. (A) cancer before treatment and four days Cancer changes in chlorophyll appearance of wild-type and mutant nac016 -1 leaves after processing. Scale bar = 1 μm. DDI, cancer treatment days. (B) Granatilacoid structure in the chlorophyll of the wild type and nac016-1 mutant leaves before and 4 days after cancer treatment. G, Glanum; PG, plastoglobule. Scale bar = 0.2 μm.
FIG. 5 shows the phenotypic results of NAC016 overexpressing transformants under normal conditions and cancer-induced senescence inducing conditions. (A) RT-PCR analysis of the amount of NAC016 expression in four independent NAC016 overexpressing transformants. The GAPDH gene was used as a loading control. (B) phenotype of wild-type, nac016-1 mutant and NAC016 overexpressing transformants during natural aging. It is a photograph of the plant which is raised about seven weeks. (C) Leaf phenotype observed after 4 weeks of dark treatment of wild type, nac016-1 mutant and NAC016 overexpressing transformant grown for 4 weeks. (D) Total chlorophyll content of wild-type, nac016-1 mutant and NAC016 overexpressing transformants of (C) above. Black and white bars mean 0 day cancer treatment and 4 day cancer treatment, respectively. Values and standard deviations are values obtained from more than 8 biological replicates. This experiment showed similar results in at least two replicate experiments. Studen's t- test was used to calculate statistical significance (*, P <0.05; **, P <0.01).
FIG. 6 shows the results of examining aging-related gene expression after cancer treatment in nac016-1 mutant and NAC016 overexpressed transgenic plants. (AI) for 4 weeks, followed by RNA extraction for 4 days before and after the cancer treatment. The first strand cDNA was obtained from the leaves of the wild type, nac016-1 mutant and NAC016 overexpressed transgenic plant leaves. And using the RT-qPCR analysis, NAC029 / NAP (A), NAC042 / JUB1 (B), NAC059 / ORS1 (C), NAC083 / VNI2 (D), NAC092 / ORE1 (E), SGR1 (F), PPH (G), NYC1 (H) and WRKY22 (I). GAPDH transcript levels were standardized and used to measure the relative expression levels of each gene. The mean and standard deviation are values obtained from three or more biological repeat experiments. This experiment showed similar results in at least two replicate experiments. Studen's t- test was used to calculate statistical significance (*, P <0.05; **, P <0.01).
Figure 7 shows the result of examining the phenotype of the nac017-1 mutant. (A) The gene structure of NAC017 (SALK_117000C) and the T-DNA insertion form in the second exon region. RT-PCR analysis confirmed that NAC017 was not expressed in (B) nac017-1 mutants. The GAPDH gene was used as a loading control. (C) and whole plants (D) of the plants grown for 4 weeks under aging inducing conditions by CE treatment were used for phenotyping. Total chlorophyll content (E) was measured in the leaves of wild type, nac016-1 and nac017-1 plants before induction of cancer treatment (black bars) and 6 days of cancer treatment (white bars). The mean and standard deviation are values obtained from more than four biological replicates. This experiment showed similar results in at least two replicate experiments. Studen's t- test was used to calculate statistical significance (*, P <0.05).
Figure 8 shows the phenotype of nac016-1 and NAC016- OX plants under salt and oxidative stress conditions. (AD) for 3 days were treated for 5 days in MES buffer (pH 5.8) containing 150 mM NaCl, or in leaves treated with 20 mM H ₂ O ₂ for 2 days. The leaves of wild type, nac016-1 and NAC016- Phenotype (A, C) and total chlorophyll content (B, D). The mean and standard deviation are values obtained from more than 8 biological replicates. Studen's t- test was used to calculate statistical significance (*, P <0.05). DT, processing days.
FIG. 9 shows the result of measuring the binding activity of the NAC016 protein to the promoter region of NAP and ORS1 through Yeast one-hybrid analysis.
(A) Yeast hybridization revealed that NAC016 (N16) binds to the promoter region of senNAC ( NAP , JUB1 , ORS1 , VNI2 and ORE1 ). β-Galactosidase (β-Gal) activity was confirmed by the chlorophenol red-β-D-galactopyranoside (CPRG) method. Empty baits and prey plasmids (-) were used as negative controls. Each result was obtained from six independent transformed yeasts, and the mean and standard deviation were analyzed using the results. The results were obtained from at least two replicates and Studen's t- test was used to calculate statistical significance (*, P <0.05; **, P <0.01). NS, no significant difference. (B, C) phenotype of nap mutants in salt and oxidative stress conditions. The leaves of wild type, nap and nac016-1 plants grown for 4 weeks were treated with MES buffer (pH 5.8) containing 150 mM NaCl (B) and 20 mM H ₂ O ₂ (C) and their phenotype was analyzed. This result was obtained through at least 2 repeated experiments. DT, processing days.

In order to accomplish the object of the present invention, the present invention provides a method of producing a plant having a functionally green-persistent trait comprising the step of inhibiting the expression of a gene encoding NAC016 protein derived from Arabidopsis, A method for producing a plant having increased tolerance is provided.

In the present invention, the green persistent NAC016 mutation gene has a function of losing the function of the normal NAC016 gene and keeping the plant green without aging. These NAC016 mutant genes are the NAC016 A part of the base of the gene may be deleted or a part of the base of the gene may be replaced with a single or a plurality of different bases or a single or plural different bases may be added to the gene.

In particular, in the following examples of the present invention, mutant plants inhibiting the expression of the green persistent NAC016 gene in which the function of the gene coding for the NAC016 protein is inhibited are described. However, the recombinant vector containing the NAC016 gene, the transformant It is obvious to those skilled in the art to prepare microorganisms and plants transformed using the above gene information.

In addition, although it has been exemplified in the present invention that a green persistence mutant plant can be produced by using a Arabidopsis thaliana, it is obvious to those skilled in the art that a green persistence mutant plant can be produced in all plants containing the NAC016 gene and having sulfidation . It will also be apparent to those skilled in the art that inactivating the protein encoded by the NAC016 gene in a plant in which sulphurization takes place produces a green persistent mutant plant. It will also be apparent to those skilled in the art that, even if the mutant plant is an ovine breeding plant, it can be reproductively reproductively produced by tissue culture or the like.

The scope of the NAC016 protein according to the present invention includes proteins having the amino acid sequence shown in SEQ ID NO: 2 isolated from Arabidopsis thaliana and functional equivalents of the proteins. Refers to an amino acid sequence having at least 70%, preferably at least 80%, more preferably at least 90% amino acid sequence identity with the amino acid sequence represented by SEQ ID NO: 2 as a result of addition, substitution or deletion of an amino acid, Refers to a protein exhibiting substantially the same physiological activity as the protein represented by SEQ ID NO: 2 and having a sequence homology of 95% or more. "Substantially homogenous bioactivity" means a resistance to abiotic stress, such as a functional green persistence phenotype or salt and oxidative stress, which occurs when protein expression is inhibited.

The present invention also provides a gene encoding the NAC016 protein. The gene of the present invention includes all the genomic DNAs or cDNAs encoding the NAC016 protein. Preferably, the gene of the present invention may include the nucleotide sequence shown in SEQ ID NO: 1. In addition, homologues of the nucleotide sequences are included within the scope of the present invention. Specifically, the gene has a nucleotide sequence having a sequence homology of 70% or more, more preferably 80% or more, still more preferably 90% or more, and most preferably 95% or more, with the nucleotide sequence of SEQ ID NO: 1 . "% Of sequence homology to polynucleotides" is ascertained by comparing the comparison region with two optimally aligned sequences, and a portion of the polynucleotide sequence in the comparison region is the reference sequence for the optimal alignment of the two sequences (I. E., A gap) relative to the &lt; / RTI &gt;

In one embodiment of the invention, the functional green persistent trait can increase the yield by simultaneously maintaining the plant's green and photosynthesis capacity during seed ripening, but is not limited thereto.

In one embodiment of the present invention, the expression of the NAC016 protein-encoding gene is inhibited by inserting T-DNA into the NAC016 protein coding gene, inducing mutation through endogenous transposon, X-ray or gamma-ray irradiation, Or antisense RNA, and may preferably inhibit the expression of the NAC016 protein coding gene by inserting T-DNA into the NAC016 protein coding gene. However, the present invention is not limited thereto .

In one embodiment of the invention, the abiotic stress may be salt or oxidative stress, but is not limited thereto.

The present invention also provides plants and their seeds having a functional green-tolerance trait or an abiotic stress tolerance produced by the method.

In one embodiment of the present invention, the plants used in the present invention are selected from the group consisting of Arabidopsis, potato, eggplant, cigarette, pepper, tomato, burdock, ciliaceae, lettuce, bellflower, spinach, modern sweet potato, celery, carrot, Such as rice, barley, wheat, rye, corn, sugar cane, oats, onions, etc., such as Chinese cabbage, cabbage, gangbu, watermelon, melon, cucumber, amber, pak, strawberry, soybean, mung bean, It may be a monocot plant, preferably a dicotyledon, more preferably a Arabidopsis, but is not limited thereto.

In addition, the present invention provides a composition for controlling the aging and abiotic stress resistance of a plant, which comprises a gene encoding a NAC016 protein derived from Arabidopsis thaliana comprising the amino acid sequence of SEQ ID NO: 2. The composition contains, as an active ingredient, a gene encoding a NAC016 protein derived from Arabidopsis thaliana comprising the amino acid sequence of SEQ ID NO: 2. Using the gene, expression is suppressed in a plant to delay aging of the plant, It is possible to increase the resistance of the plant to stress stress and, on the contrary, increase the expression in the plant by using the gene, thereby accelerating the aging of the plant and reducing the abiotic stress resistance of the plant. It is possible to control the abiotic stress resistance.

In one embodiment of the invention, the abiotic stress may be salt or oxidative stress, but is not limited thereto.

Hereinafter, the present invention will be described in detail by way of examples. However, the following examples are for illustrative purposes only and are not intended to limit the scope of the present invention.

Materials and methods

1. Target plants and growth conditions

The Arabidopsis plants used in the present invention were cultivated at a temperature of 22 ° C and a humidity of 22 ° C using a soil mixture of vermiculite (Shinsung, Korea) at a ratio of 3: 1 to a 'Sunshine Mix' (Sun-Gro Horticulture, Bellevue, (White fluorescent lamp, luminous intensity 90 μmol m ^-2 s ^-1 ) at a plant growth of 60% under long-day cultivation conditions (14 h day / 10 h night). Various mutants used in the experiments were obtained from ABRC (Arabidopsis Biological Resource Center, Ohio State University, USA). Each mutant nac016-1 (SALK_001597C), nac016-2 (SALK_074316 ), nac017-1 (SALK_117000C), nap (SALK_005010C), ore1 (CS23887), pph (SALK_024673C), nyc1 (SALK_091664C) and nol (SALK_151467) to be. The nyc1 nol double mutant was produced by crossing each single mutant. For the dark-induced senescence of isolated leaves, 3-4 rosette leaves of 3-4 week old plants were used, and 3 mM MES (2- (N-morpholino) ethane sulfonic acid buffer (pH 5.8) and subjected to the treatment of cancer treatment at a plant growth of 22 ° C.

2. Analysis of total chlorophyll content

To analyze total chlorophyll content, photosynthetic pigments were extracted from each leaf using 80% acetone. The concentration of chlorophyll was measured using a UV / VIS spectrophotometer (Lichtenthaler, Methods Enzymol. 148: 350-382, 1987) using the method used in previous reports.

3. SDS-PAGE and immunoblot analysis

10 mg of each leaf of the plant was disrupted with liquid nitrogen, and 100 μl of extraction buffer (50 mM Tris-HCl pH 6.8, 2 mM EDTA, 10% (w / v) glycerol, 2% And 6% (v / v) 2-mercaptoethanol). The homogenized sample was heated at 90 DEG C for 5 minutes and centrifuged to obtain a supernatant. 10 μl of the supernatant was separated by 12.5% (w / v) SDS-PAGE, and the separated proteins were stained with CBB (Coomassie Brilliant Blue). For immunoblot analysis, 4 μl of the supernatant was separated by 12.5% (w / v) SDS-PAGE and transferred to Hybond-P nylon membrane (GE Healthcare) through the protein transfer device. Thereafter, the content of each protein was measured and compared with various antibodies. The antibodies used for the immunoblot analysis were LHCI subunits (Lhca1, Lhca2), LHCII subunits (Lhcb1, Lhcb2, Lhcb4), CP43, D1, PsaA and PAO (Agrisera, Sweden). Binding of these antibody antigens was confirmed using an enhanced chemiluminescence detection system, ECL Plus (GE Healthcare).

4. Transmission electron microscopy

Transmission electron microscopy analysis was performed with reference to the previous paper (Inada et al ., Planta 206: 585-597, 1998). The sections of each leaf tissue were fixed using a modified Karnovsky fixative (2% paraformaldehyde, 2% glutaraldehyde, 50 mM sodium chocodilate buffer, pH 7.2) and pH 7.2 Of 50 mM sodium chocodilate buffer at 4 &lt; 0 &gt; C for 10 minutes. The cells were then fixed with 50 mM sodium chocoditrite buffer (pH 7.2) containing 1% osmium tetroxide for 2 hours at 4 ° C and washed twice with distilled water at room temperature. Each immobilized sample was stained with 0.5% uranyl acetate solution at 4 ° C for at least 30 minutes, and the water was removed with various concentrations of ethanol and propylene oxide. Respectively. Thereafter, the resultant was polymerized at 70 ° C for 24 hours, and then an ultrathin section was prepared using a diamond knife of an Ultramicrotome (MT-X) and mounted on a formvar-coated copper grid. Each mounted portion was stained with 2% uranyl acetate for 5 minutes, Reynolds' lead citrate for 2 minutes at room temperature, and observed with a JEM-1010 EX electron microscope (JEOL, Japan).

5. RT-PCR and RT-qPCR analysis

For RT-PCR analysis, total RNA was isolated from each plant leaf using TRIzol reagent. Finally, 25 μl of first-strand cDNA was prepared by using M-MLV reverse transcriptase and oligo (dT) ₁₅ primer (Promega). Each of the extracted 5 μg of RNA was diluted with 1/4 Respectively. RT-qPCR analysis was performed using 1 μl of cDNA, 10 μl of 2 × SYBR Green PCR Master Mix (Qiagen), and 0.25 mM primer. Each primer sequence is set forth in Table 1. Analysis of RT-qPCR was performed using Light Cycler 480 (Roche Diagnostics). Expression of each gene was investigated relative to the expression level of GAPDH (glyceraldehyde phosphate dehydrogenase) relative to the expression level of GAPDH (Sakuraba et al ., Plant Cell Physiol. 51: 1055-1065, 2010).

6. Construction of vectors and transformation of plants

NAC016 cDNA was synthesized by RT-PCR using M-MLV reverse transcriptase (Promega) and PrimeSTAR polymerase (TaKaRa, Japan). The synthesized cDNA was inserted into the pCR8 / GW / TOPO gateway vector (Invitrogen) to confirm the sequence information. Then, pMDC32 (Curtis and Grossniklaus, Plant Physiol . 133: 462-469, 2003). The cloned recombinant plasmid was transformed into Agrobacterium tumefaciens strain GV3101. Wild-type (Col-0) or nac016-1 plants were transformed with the floral dip method using transformed Agrobacterium (Clough and Bent, Plant J. 16: 735-743, 1998). Transformant T ₀ seedling was selected on 0.5 × MS medium containing 15 mg / L hygromycin, and T ₂ homozygous lines were selected through generation progression.

7. Ion leakage analysis

Membrane leakage analysis was performed with reference to the previous report (Fan et al ., Plant Cell 9: 2183-2196, 1997). Membrane leaks were analyzed by measuring the electrolyte (or ion) of the leaves isolated from the plant. Ten stressed leaves were placed in 6 ml of 0.4 M mannitol solution at room temperature and reacted with mild stirring for 3 hours. Each solution was reacted with a conductivity meter (CON6 METER, LaMotte, USA) Respectively. The overall conductivity was measured after each sample was treated at 85 占 폚 for 20 minutes. The ratio of ion leakage was analyzed by comparing the total conductivity and the post-treatment conductivity as a percentage in each sample.

8. Hormone Treatment

For hormone treatment, the leaves of the plants grown for 4 weeks were tested in 3 mM MES buffer with or without 20 μM ABA (Sigma) or 100 μM MeJA (Sigma). Each hormone treatment was analyzed after treatment for 2 days at 22 ° C and continuous light (90 μmol m ^-2 s ^-1 ) (Woo et al., Plant Cell 13: 1779-1790, 2001) .

9. Salts and H ₂ O ₂  process

Analysis of salt stress was performed by analyzing the reaction with NaCl, and analysis of oxidative stress was performed by analyzing the reaction with hydrogen peroxide (H ₂ O ₂ ) (Wu et al ., Plant Cell 24: 482-506 , 2012). The salt and hydrogen peroxide treatment was carried out by placing the leaves isolated from the plants grown for 3-4 weeks in a 3 mM MES buffer (pH 5.8) containing 150 mM NaCl or 20 mM H ₂ O ₂ with the leaves facing upwards . Reactions to salt and oxidative stress were analyzed at 22 ° C and continuous light (90 μmol m ^-2 s ^-1 ).

10. Yeast one-hybrid analysis

The Arabidopsis gene, NAC016, was cloned into the pGAD424 vector (Clontech). The promoter portion of the five senNAC genes (NAP, JUB1, ORS1, VNI2 and ORE1) was cloned into pLacZi (Clontech). The DNA region of -1000 bp to +500 bp was selected for the cloned promoter region. Information on each primer used for cloning is shown in Table 1. Each vector was transformed into yeast strain YM4271, and the transformed yeast was assayed for the activity of? -Galactosidase to determine whether the NAC016 transcription factor was responsive to the promoter region of each gene. β-D-galactopyranoside (CPRG) method was used to measure the activity of β-galactosidase, and the method of measurement was referred to Yeast Protocol Handbook (Clontech).

Usage gene The forward primer (5 '- &gt; 3') SEQ ID NO: The reverse primer (5 '- &gt; 3') SEQ ID NO: Cloning NAC016 ATGGTTGATTCTTCTCGTGATTCGTG 3 TCACGACAAGAGAGGTCTTCCCATAAC 4 RT-qPCR NAC016 CAGACACCTGAGAACCAGCTT 5 CACCATTTTGTCCTTCCTTGT 6 NAC029 TCCATCATCCCAGAAGTTGA 7 GGTTTGGTCTGACTCCGTTT 8 NAC042 TGGAAAGCCACTGGTATTGA 9 ATCGGTTTTGGTGCCTTTAC 10 NAC059 GTTTACCTCCGCTGATGGATT 11 TCTTGTCATCGGTTGTTTGGT 12 NAC083 CTACAAAGGCAAACCACCTCA 13 CGTTCTTGTTACCGGCTCTTT 14 NAC092 AATGAAGCTGTTGCTTGACG 15 AGAAATTCCAAACGCAATCC 16 SGR1 TGGGCAAATAGGCTATACCG 17 CCACCGCTTATGTGACAATG 18 PPH TCTCACGTATTGTGGAGGTCA 19 CCACCGCTTATGTGACAATG 20 NYC1 GTTAACAGACGCGATGGAGA 21 GCCTGGAAAAGAGCTAGGTG 22 WRKY22 TACGGACAGAAACCCATCAA 23 CATCTTCGGGTCGGATCTAT 24 leaven
single
Hybridization NAC016 GAATTCATGGTTGATTCTTCTC 25 GGATCCTCACGACAAGAGA 26 NAC029 GAATTCAGACAAAGATAGGAG 27 GTCGACGGAGACGATAC 28 NAC042 GTCGACTTGGAATGCAGTTGAAG 29 CTCGAGTGATGATAAAGGCGCA 30 NAC059 GAATTCCTACTACGTTACAAC 31 GTCGACTTGTTTTTACTCCTTTA 32 NAC083 GAATTCCCTTATCAAAACAAGA 33 GTCGACATTCGTGCATGA 34 NAC092 CTTAAGTTATATGTAACCATGTGAAC 35 CAGCTGAGCTCTTCCTTTATAG 36

Example 1: Synthesis of senescence-associated NAC (senescence-associated NAC; senNAC) transcription factor Arabidopsis NAC016

The NAC016 (At1g34180) protein is one of the 105 NAC transcription factors present in the Arabidopsis genome. The NAC016 protein consists of 576 amino acids and has a highly conserved DNA-binding NAM domain at the N-terminal region. To reaffirm that the NAC016 gene is the senNAC gene, we investigated the amount of NAC016 gene expression during the development of the plant and during the aging process of the leaves induced by artificially treating dark conditions. The NAC016 gene expression was very low in the green leaves of the wild type plants grown for 2-3 weeks in the long day condition and the expression of the NAC016 gene started to increase in the green leaves of the 4 weeks old plant just before the normal aging started under the long day conditions ). When senescence was induced by cancer treatment of green leaf removed from 3 weeks old plant before aging, the expression of NAC016 gene started to increase after 2 days from the treatment of cancer, and the leaf color began to increase on the 5th day The expression on the day was greatly reduced. Indicating that NAC016 gene expression is deeply related to leaf senescence (FIG. 1B).

Example 2. Arabidopsis thaliana nac016  The stay green phenotype of the mutant

To elucidate the regulatory function of the NAC016 gene in the senescence of the leaves, nac016-1 (Fig. 2A) and nac016-1 (Fig. 2A) in which the T-DNA fragment was inserted into the fourth exon and intron of the NAC016 gene (At1g34180) 2 knockout mutants were investigated. RT-PCR confirmed the absence of NAC016 mRNA in the two nac016 mutants (Fig. 2B). The phenotype of the nac016-1 mutant was then investigated during plant development under long day conditions. The mutants did not show any significant difference compared to the wild type plants at the stage of nutrition growth up to 4 weeks after germination. However, when we entered the natural aging stage 4 weeks after germination, the nac016-1 mutant exhibited a characteristic that leaves greens were maintained in contrast to wild-type plants that normally changed to yellow (Fig. 2C). During the induction of cancer treatment aging, wild-type plants showed normal yellowing of green leaves, while nac016-1 mutants maintained green in both the incised leaves and the leaves attached to the plants (FIGS. 2D and 2E). When cancer treatment induced aging showed similar phenotype and mutation chedo nac016 nac016 -2 -1 mutant (the data shown). In addition, when the 35S: NAC016 gene was introduced into the nac016-1 mutant through transformation, the NAC016 gene function was restored in the nac016-1 mutant and the leaf sulphation proceeded (data not shown).

Additional experiments were conducted using the nac016-1 mutant to characterize the regulatory function of NAC016 on the leaf senescence mechanism. In addition, since the aging of plant leaves is induced by the plant hormones ABA (abscisic acid) and MeJA (methyl jasmonate), the present inventors have found that in the case of constant light conditions, the intercalated green of the nac016-1 mutant Leaves were treated with 20 μM ABA or 100 μM MeJA to induce leaf senescence, and the results were observed. In the wild-type plants, rapid aging was observed in the treatment of the hormone treatment in two days, while green was persistent in the nac016-1 mutant (Fig. 2F). This suggests that the function of the NAC016 gene plays an important role in controlling plant age, cancer treatment, and plant hormone-induced senescence.

Example 3. nac016  Functional green-persistent delay of aging in the mutant

Mutants that exhibit the green persistence phenotype can generally be divided into two types, functional and non-functional. Functional green persistence mutants are characterized by the ability to maintain high green and photosynthetic abilities at the same time during the ripening period to increase yields. On the other hand, non-functional green persistence mutants have the property that the degradation of chlorophyll is inhibited regardless of the photosynthesis ability and seed productivity of the plant and thus the greenness of the leaves is maintained (Hortensteiner, Trends Plant Sci. 14: 155-162, 2009) .

To determine whether the nac016 mutant had functional green persistence or nonfunctional green persistence, the photosynthetic index of the nac016-1 mutant was examined during aging. The total chloroplast content of nac016-1 mutants prior to cancer treatment was similar to that of wild-type plants. However, after 4 days of cancer treatment, it was confirmed that the chloroplast content of the nac016-1 mutant was maintained at a level as high as that of the other green persistent phenotype nyc1 nol mutant (Fig. 3A). On the other hand, in the nyc1 nol mutant, the chlorophyll a / b ratio decreased sharply due to the specific stability of subunits of LHCII (light-harvesting complex II), but the chlorophyll a / b ratio of nac016-1 mutant decreased But remained almost unchanged after 4 days (Fig. 3B). The nac016-1 mutant showed an ion leakage rate, an important measure of cell membrane degradation, lower than wild-type plants (Fig. 3C). In addition, the nac016-1 mutant maintained relatively high levels of photosynthetic-related proteins relative to wild-type plants (FIG. 3D). This is consistent with the difference in total chloroplast amount (Figure 3A).

Functional Green Persistence Plants have a relatively long period of normal shape grana thylakoids at the aging stage, while abnormally thick grana structures in non-functional green persistent plants (Schelbert et al ., Plant Cell 21: 767 -785, 2009). Therefore, the present inventors observed the chloroplast structure of wild-type plant leaves and nac016-1 mutant leaves. The chloroplast structure and granular thylakoid membrane morphology of nac016-1 mutant leaves before cancer treatment were similar to those of wild-type plants (top panel of FIG. 4A). After the cancer treatment for 4 days, nac016 -1 in the chloroplast of the mutant leaves were observed to be maintained Grana thylakoid membrane, in the wild type plant chloroplast could hardly find the Grana thylakoid membrane form (lower panel in Fig. 4A and 4B). In addition, plastoglobules appearing under stress and aging conditions were observed to accumulate in the chloroplasts of wild-type plant leaves, but not in leaves of the nac016-1 mutant. The present inventors have found that the nac016 mutant properly maintains the photosynthetic protein balance, total chlorophyll content and granatilacoid membrane structure under the aging inducing conditions, and this result suggests that the nac016 mutant has a functional green persistent trait.

Example 4. In the aging inducing condition NAC016  Overexpressed ( NAC016 -OX) promoting plant yellowing

To confirm that NAC016 regulates leaf senescence at the transcriptional level, NAC016 overexpressed transgenic plant NAC016- OX ( NAC016 overexpressor) was constructed. High levels of NAC016 were expressed in four independently obtained NAC016 overexpressing transgenic plant leaves (Fig. 5A). No phenotypic difference was observed between NAC016 -OX and wild-type plants during the period of nutrition growth up to 4 weeks after germination. However, during the natural aging period, aging of the leaves was promoted in NAC016- OX plants grown for 7 weeks (Fig. 5B). In another experiment, leaves of NAC016 -OX plants grown for 3 weeks were incised to induce cancer-induced senescence. After 4 days of cancer treatment, the degree of senescence of the plant was investigated. As a result, it was confirmed that the leaf of NAC016 -OX plant aged more rapidly than the wild type (FIG. 5C), indicating that chlorophyll content was lower in NAC016 -OX plant leaf (Fig. 5D). These results suggest that chlorophyll degradation during leaf senescence is highly correlated with expression of NAC016 gene.

Example 5. Regulation of SenNAC and SAG Expression Levels of NAC016 Transcription Factor

In order to elucidate the aging delay of nac016 mutant leaves and the mechanism of aging promotion of NAC016 -OX plant leaves at the molecular level, the expression level of aging-related gene (SAG) was examined using RT-qPCR assay. ( NAC029 / NAP , NAC042 / JUB1 , NAC059 / ORS1 , NAC083 / VNI2 and NAC092 / ORE1 ) among the genes known as senNAC in the wild type, nac016-1 mutant and NAC016- Were selected to investigate their expression levels (Fig. 6A-E). These five genes are known to increase expression in cancer treatment for 4 days in the wild type. Compared to the wild type, the nac016-1 mutant showed markedly decreased expression of these genes and increased expression in NAC016- OX plants (Fig. 6B). Next, we examined the expression levels of aging-related genes (SAG) such as chlorophyllase genes SGR1, PPH and NYC1 and senWRKY gene WRKY22 (FIG. 6F-I). Similar to the expression pattern of the five senNAC genes examined above, the expression of four senescence-related genes (SGR1, PPH, NYC1 and WRKY22) was markedly decreased in the nac016-1 mutant, while in the NAC016- OX plant, Respectively.

We also examined the expression of the NAC016 gene in the senescence-related genes nyc1 , pph , wrky22 , nap and ore1 mutants after cancer treatment to determine whether aging-related genes affect NAC016 gene expression. When the expression level of NAC016 gene was measured after 4 days of cancer treatment, the expression of NAC016 gene was decreased by about 50% in the orel mutants, but the expression level was not different in the other senescence mutants (data not shown) . These results suggest that NAC016 acts at the upstream of major genes related to senescence and promotes leaf senescence by increasing their expression level.

Example  6. nac016 Mutant salt stress and H ₂ O ₂ Oxidative stress resistance

To determine whether NAC016 gene expression was also responsive to salt stress, leaves were cut and treated with salt stress in 4-week-old wild-type (Col-0) plants. As a result, it was confirmed that the amount of NAC016 gene expression was significantly increased after 1 day of salting treatment (data not shown). Therefore, we anticipate that the expression mechanism of NAC016 gene may be related to oxidative and salt stress signaling pathways, and the leaf color changes of nac016-1 and NAC016- OX under salt and oxidative stress conditions were examined. 8C and D ) in 150 mM NaCl (Figs. 8A and 8B) or 20 mM H ₂ O ₂ for 2 days (Figs. 8C and 8B) in the leaves cut from the wild type control nac016-1 and NAC016- ). As a result, the nac016-1 mutant retained the total chlorophyll content and maintained the greenness of the leaves, while the NAC016 -OX leaves showed lower chlorophyll content than the wild type control (control) in both stress treatment conditions The leaves were aged early. This shows that NAC016 is involved in the oxidative and salt stress signaling pathways.

Example 7. Analysis of binding activity of NAC016 protein by yeast one-hybrid analysis

In order to better understand the regulation function of the NAC016 protein as an aging-promoting transcription factor, it is essential to identify which target gene NAC016 regulates the senescence of the leaf. ORE1 is known to bind to several SAG promoters including SINA1 , BFN1, and SAG29 to increase the expression level (Matallana-Ramirez et al ., Plant Signal. Behav. 5: 733-735, 2013). In addition, DNA microarray analysis revealed VNI1 as a candidate target gene regulated by ORE1 (Rauf et al ., EMBO Rep. 14: 382-388, 2013). This suggests that there is a regulatory cascade between senNAC-senNAC in the genetic program of leaf senescence. In RT-qPCR experiments, the expression levels of five senNAC genes ( NAP , JUB1 , ORS1 , VNI2 and ORE1 ) were decreased in the nac016-1 mutant leaves and increased in the NAC016 -OX leaves in the cancer-induced senescence inducing conditions (Figs. 6A-E). Therefore, NAC016 transcription factors bind to the promoters of these genes to increase gene expression and promote leaf senescence. To confirm this, we investigated whether NAC016 binds to the promoters of the 5 sene NAC genes through yeast single hybridization analysis. As a result, it was confirmed that NAC016 binds to promoters of NAP and ORS1 (FIG. 9A). This suggests that the expression of senNAC transcription factors, NAP and ORS1 , which promote senescence, is the target gene directly regulated by NAC016 in the senescence regulating mechanism of the leaves. Additional experiments were performed using nap mutants that showed green-stay-green in natural and cancer-treated aging conditions to further reinforce their regulatory mechanisms. This leaves the incision in the nap mutants in the senescence-induced conditions by salt for 5 days (150 mm NaCl) stress (Fig. 9B) and oxidation of 2 days (20 mM H ₂ O ₂₎ stress (Fig. 9C) processing nac016 mutant Like green leaf phenotype. As a result, the leaves of the nap mutant also exhibited a very similar green persistence and leaves of nap016 -1 mutant (FIG. 8 and FIG. 9B and 9C). This means that the NAP016-NAP regulatory cascade is present in the salt and oxidative stress response circuits at the same time as the senescence progression of the leaves.

<110> SNU R & DB FOUNDATION <120> Method for producing functional stay-green transgenic plant with          increased resistance to abiotic stresses using NAC016 gene and          the plant thereof <130> PN13266 <160> 36 <170> Kopatentin 2.0 <210> 1 <211> 1898 <212> DNA <213> Arabidopsis thaliana <400> 1 atggttgatt cttctcgtga ttcgtgtttc aaagctggta agtttagtgc tccaggtttt 60 cgatttcacc ctactgatga agagcttgtg gtttattatc ttaagaggaa gatctgttgt 120 aaaaaacttc gagtcaatgc cattggtgtc gttgatgttt acaaagtcga tccttctgaa 180 ttgcctggta attttcaaca ccttcttatc gattttgatt catgtctatc gatgttgaag 240 acgggagata gacagtggtt ctttttcact ccaaggaata ggaagtatcc taacgcagct 300 aggtcaagta gaggtactgc aactggttat tggaaggcga caggaaagga tcgagtcatt 360 gagtacaatt caagatctgt tggactcaag aagactcttg ttttctatag aggtcgtgct 420 cctaatggtg agagaactga ctgggtgatg catgagtaca ctatggatga agaagagcta 480 gggagatgta agaacgctaa ggagtattat gctctttata agctttataa gaagagtggg 540 gctggtccta agaatggtga acagtatggt gctccgttcc aagaagaaga atgggttgat 600 agtgatagtg aagatgcaga tagtgtcgct gtaccggatt atcccgtggt ccgttatgag 660 aatggtcctt gtgtggatga tactaaattt tgcaatcctg tcaaacttca gttagaggat 720 attgagaagc ttctcaatga aatcccagat gcacccgggg ttaaccaaag acagtttgat 780 gagtttgttg gtgttccaca gggtaatagt gcagaagtga tacagagcac attgctgaat 840 aattcttctg gagagtatat tgaccctcgg acgaatggaa tgttcttgcc aaatggccag 900 ctatacaaca gggactcgag ttttcagtcc catttgaatt catttgaggc tacctctggt 960 atggcacctc ttctagataa tgagaaggag gagtacattg aaatgaatga tcttctgatc 1020 cctgagctcg gtgcttcttc aacagagaaa tccacagagt tcttgaacca tggtgaattt 1080 ggtgatgtta atgaatacga ccaattgttc aatgacatat ctgtttttca gggaacttct 1140 acagatctgt cttgtctgag taattttact aataacacat caggccaaag acagcaatta 1200 ctttatgaac agttccagta ccagacacct gagaaccagc ttaataacta catgcatcct 1260 agtaccactc ttaatcagtt cactgacaat atgtggttta aagatgatca ggctgctctc 1320 tatgttcaac caccacaatc ttcttctgga gcattcactt cacagtcaac aggtgtgatg 1380 cctgagtcta tgaatcccac tatgagtgta aatccccaat acaaggaagg acaaaatggt 1440 ggtggaacaa ggagccagtt ctcatcagct ctgtgggaat tattggaatc aataccatca 1500 acaccagcct ctgcctgtga gggtcctctt aaccagacct ttgtgcgtat gtctagcttc 1560 agccgcatca ggttcaatgg aacgtcagtg actagtagaa aagtcactgt agcaaagaag 1620 cgtatcagta acagaggttt tcttctgtta tcaattatgg gtgctttgtg tgctatcttc 1680 tgggtgttca aagccaccgt tggagttatg ggaagacctc tcttgtcgtg acctagactc 1740 ttgaatcttg attcagcata agttagcctg atccacatct ttgattatgt atagagtttg 1800 aaagagttta attcttaaca aaagatttct tttttcctgg attctctgat ggctttgaaa 1860 ttttgcttgc acttatcata ttaagcagaa tttttgaa 1898 <210> 2 <211> 576 <212> PRT <213> Arabidopsis thaliana <400> 2 Met Val Asp Ser Ser Arg Asp Ser Cys Phe Lys Ala Gly Lys Phe Ser   1 5 10 15 Ala Pro Gly Phe Arg Phe His Pro Thr Asp Glu Glu Leu Val Val Tyr              20 25 30 Tyr Leu Lys Arg Lys Ile Cys Cys Lys Lys Leu Arg Val Asn Ala Ile          35 40 45 Gly Val Val Asp Val Tyr Lys Val Asp Pro Ser Glu Leu Pro Gly Asn      50 55 60 Phe Gln His Leu Leu Ile Asp Phe Asp Ser Cys Leu Ser Met Leu Lys  65 70 75 80 Thr Gly Asp Arg Gln Trp Phe Phe Phe Thr Pro Arg Asn Arg Lys Tyr                  85 90 95 Pro Asn Ala Ala Arg Ser Ser Arg Gly Thr Ala Thr Gly Tyr Trp Lys             100 105 110 Ala Thr Gly Lys Asp Arg Val Ile Glu Tyr Asn Ser Arg Ser Val Gly         115 120 125 Leu Lys Lys Thr Leu Val Phe Tyr Arg Gly Arg Ala Pro Asn Gly Glu     130 135 140 Arg Thr Asp Trp Val Met His Glu Tyr Thr Met Asp Glu Glu Glu Leu 145 150 155 160 Gly Arg Cys Lys Asn Ala Lys Glu Tyr Tyr Ala Leu Tyr Lys Leu Tyr                 165 170 175 Lys Lys Ser Gly Ala Gly Pro Lys Asn Gly Glu Gln Tyr Gly Ala Pro             180 185 190 Phe Gln Glu Glu Glu Trp Val Asp Ser Asp Ser Glu Asp Ala Asp Ser         195 200 205 Val Ala Val Pro Asp Tyr Pro Val Val Arg Tyr Glu Asn Gly Pro Cys     210 215 220 Val Asp Asp Thr Lys Phe Cys Asn Pro Val Lys Leu Gln Leu Glu Asp 225 230 235 240 Ile Glu Lys Leu Leu Asn Glu Ile Pro Asp Ala Pro Gly Val Asn Gln                 245 250 255 Arg Gln Phe Asp Glu Phe Val Gly Val Pro Gln Gly Asn Ser Ala Glu             260 265 270 Val Ile Gln Ser Thr Leu Leu Asn Asn Ser Ser Gly Glu Tyr Ile Asp         275 280 285 Pro Arg Thr Asn Gly Met Phe Leu Pro Asn Gly Gln Leu Tyr Asn Arg     290 295 300 Asp Ser Ser Phe Gln Ser His Leu Asn Ser Phe Glu Ala Thr Ser Gly 305 310 315 320 Met Ala Pro Leu Leu Asp Asn Glu Lys Glu Glu Tyr Ile Glu Met Asn                 325 330 335 Asp Leu Leu Ile Pro Glu Leu Gly Ala Ser Ser Thr Glu Lys Ser Thr             340 345 350 Glu Phe Leu Asn His Gly Glu Phe Gly Asp Val Asn Glu Tyr Asp Gln         355 360 365 Leu Phe Asn Asp Ile Ser Val Phe Gln Gly Thr Ser Thr Asp Leu Ser     370 375 380 Cys Leu Ser Asn Phe Thr Asn Asn Thr Ser Gly Gln Arg Gln Gln Leu 385 390 395 400 Leu Tyr Glu Gln Phe Gln Tyr Gln Thr Pro Glu Asn Gln Leu Asn Asn                 405 410 415 Tyr Met His Pro Ser Thr Thr Leu Asn Gln Phe Thr Asp Asn Met Trp             420 425 430 Phe Lys Asp Asp Gln Ala Leu Tyr Val Gln Pro Pro Gln Ser Ser         435 440 445 Ser Gly Ala Phe Thr Ser Gln Ser Thr Gly Val Met Pro Glu Ser Met     450 455 460 Asn Pro Thr Met Ser Val Asn Pro Gln Tyr Lys Glu Gly Gln Asn Gly 465 470 475 480 Gly Gly Thr Arg Ser Gln Phe Ser Ser Ala Leu Trp Glu Leu Leu Glu                 485 490 495 Ser Ile Pro Ser Thr Pro Ala Ser Ala Cys Glu Gly Pro Leu Asn Gln             500 505 510 Thr Phe Val Arg Met Ser Ser Phe Ser Arg Ile Arg Phe Asn Gly Thr         515 520 525 Ser Val Thr Ser Arg Lys Val Thr Val Ala Lys Lys Arg Ile Ser Asn     530 535 540 Arg Gly Phe Leu Leu Leu Ser Ile Met Gly Ala Leu Cys Ala Ile Phe 545 550 555 560 Trp Val Phe Lys Ala Thr Val Gly Val Met Gly Arg Pro Leu Leu Ser                 565 570 575 <210> 3 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 3 atggttgatt cttctcgtga ttcgtg 26 <210> 4 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 4 tcacgacaag agaggtcttc ccataac 27 <210> 5 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 5 cagacacctg agaaccagct t 21 <210> 6 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 6 caccattttg tccttccttg t 21 <210> 7 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 7 tccatcatcc cagaagttga 20 <210> 8 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 8 ggtttggtct gactccgttt 20 <210> 9 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 9 tggaaagcca ctggtattga 20 <210> 10 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 10 atcggttttg gtgcctttac 20 <210> 11 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 11 gtttacctcc gctgatggat t 21 <210> 12 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 12 tcttgtcatc ggttgtttgg t 21 <210> 13 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 13 ctacaaaggc aaaccacctc a 21 <210> 14 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 14 cgttcttgtt accggctctt t 21 <210> 15 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 15 aatgaagctg ttgcttgacg 20 <210> 16 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 16 agaaattcca aacgcaatcc 20 <210> 17 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 17 tgggcaaata ggctataccg 20 <210> 18 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 18 ccaccgctta tgtgacaatg 20 <210> 19 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 19 tctcacgtat tgtggaggtc a 21 <210> 20 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 20 ccaccgctta tgtgacaatg 20 <210> 21 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 21 gttaacagac gcgatggaga 20 <210> 22 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 22 gcctggaaaa gagctaggtg 20 <210> 23 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 23 tacggacaga aacccatcaa 20 <210> 24 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 24 catcttcggg tcggatctat 20 <210> 25 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 25 gaattcatgg ttgattcttc tc 22 <210> 26 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 26 ggatcctcac gacaagaga 19 <210> 27 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 27 gaattcagac aaagatagga g 21 <210> 28 <211> 17 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 28 gtcgacggag acgatac 17 <210> 29 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 29 gtcgacttgg aatgcagttg aag 23 <210> 30 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 30 ctcgagtgat gataaaggcg ca 22 <210> 31 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 31 gaattcctac tacgttacaa c 21 <210> 32 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 32 gtcgacttgt ttttactcct tta 23 <210> 33 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 33 gaattccctt atcaaaacaa ga 22 <210> 34 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 34 gtcgacattc gtgcatga 18 <210> 35 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 35 cttaagttat atgtaaccat gtgaac 26 <210> 36 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 36 cagctgagct cttcctttat ag 22

Claims (10)

A method for the production of a plant having a functional stay-green trait or increased abiotic stress tolerance, comprising the step of inhibiting the expression of a gene encoding a NAC016 protein from Arabidopsis in a plant. 2. The method of claim 1, wherein the functional green persistent trait maintains green and photosynthetic ability simultaneously during seed ripening to increase yield. 2. The method according to claim 1, wherein the NAC016 protein comprises the amino acid sequence of SEQ ID NO: 2. 2. The method according to claim 1, wherein the expression of the gene encoding the NAC016 protein is inhibited by inserting T-DNA into the gene encoding the NAC016 protein to inhibit the expression of the gene encoding the NAC016 protein. The method according to claim 1, wherein the abiotic stress is salt or oxidative stress. 6. A plant having a functional green-persistent trait or increased abiotic stress tolerance produced by the method of any one of claims 1 to 5. 7. The plant according to claim 6, wherein the plant is a dicotyledonous plant. A seed of a plant according to claim 6. A composition for regulating senescence and abiotic stress resistance of a plant, comprising a gene encoding a NAC016 protein derived from Arabidopsis thaliana comprising the amino acid sequence of SEQ ID NO: 2. 10. The composition of claim 9, wherein the abiotic stress is salt or oxidative stress.

Images