KR101855134B1 - ATPG4 Protein Delaying Senescence and Providing Yield Increase and Stress Tolerance in Plants, the Gene Encoding the Protein and Those Uses - Google Patents

Abstract

The present invention discloses an ATPG4 protein having genes for plant productivity, delayed aging and stress tolerance, genes thereof, and uses thereof. The transgenic and transgenic plants exhibit not only increased productivity but also aging delay characteristics and stress tolerance characteristics.

Description

ATPG4 protein having a plant productivity increasing function, a delayed aging function, and a stress tolerance function, a gene thereof, and a use thereof ATPG4 Protein Delaying Senescence and Providing Yield Increase and Stress Tolerance in Plants, Gene Encoding the Protein and Those Uses

The present invention relates to an ATPG4 protein having a plant productivity increasing function, an aging delaying function and a stress tolerance function, a gene thereof, and a use thereof.

Plant aging is the last stage of plant development, an age-dependent decay process at the cell, tissue, organ, or organism level, leading to the death phase through growth and development. Plants gradually lose their ability to synthesize as the aging process progresses, resulting in sequential degradation of intracellular structures and macromolecules, resulting in loss of cell homeostasis and ultimately death (Thomas et al., 1993). The aging of these plants is genetically planned as a series of sequential biochemical and physiological phenomena, which is very sophisticated and active at the level of cells, tissues and organs.

The initial phenomenon of senescence in cell structure is the degradation of chloroplasts, which are organelles containing more than 70% of leaf proteins. From a metabolic point of view, it means that the carbon assimilation in plant body is converted into the catabolism of macromolecules such as chlorophyll, protein, membrane lipid, and RNA. The increased catabolism activity through aging induces the conversion of cellular components accumulated in leaves, which are myelinated tissues during growth, into exocrine cell components supplied for seed or other storage organ development. Thus, plant senescence is thought to be a genetic trait that is actively acquired to adapt to environmental conditions during cell degeneration and evolution (Buchanan-Wollaston et al., 2003; Lim and Nam, 2005; Nam, 1997)

Such aging of plants is affected by internal environmental factors such as plant hormones and external environmental factors such as drought, nutrient limitation, and pathogen infiltration. Among the plant hormones, cytokinin is a physiologically delayed aging hormone, and many aging control techniques have been reported. The Amasino group has developed a method to regulate the aging-specific cytokinin synthesis by recombining the IPT gene into the senescence-specific promoter of the SAG12 gene. In this way, 50% . When introduced into lettuce in the same manner, it was found that the postharvest storage was greatly increased (McCabe et al., 2001). It has also been reported that the level of cytokinin is increased in the tobacco expressing the maize homeobox gene (knotted1) in the SAG12 promoter and the senescence of the leaves is delayed. In the case of tomato, a case of controlling the aging of fruit by controlling ethylene has been reported. In addition, the expression of polygalacturonase gene associated with cell wall degradation is inhibited to increase the transportability and shelf life of tomato The case of Flav-O-Savor can be a commercialized example. In the case of apples, it has been reported that one of the domestic breeds breeding for delayed senescence is accompanied by a mutation of aminocyclopropanecarboxylate oxidase (ACC oxidase) gene, which is an ethylene synthesis gene.

Recently, a number of studies have been carried out on the isolation of genes that induce expression at the aging stage and the analysis of their expression patterns in order to elucidate the regulation of senescence. Analysis of the genes whose expression is increased during senescence has been studied in Arabidopsis thaliana, radish, tomato and the like, and it has been suggested that the pathway of aging is a very complicated network through analysis of expression patterns, The genes involved in senescence are largely isolated using subtractive hybridization and microarray. Among them, transcription factor, which is presumed to be an aging-regulated gene, or receptor-like Receptor-like kinase, and the like as the main targets. Many of the transcription factors that increase expression during the aging process are proteins with NAC, WRKY, C2H2-type zinc finger, Ap2 / EREBP, and MYB domains (Lim et al., 2007). Inhibition of the expression of WRKY53 gene among WRKY transcription factors caused delayed senescence in the plant, whereas increased expression caused premature aging of the plant. Thus, the WRKY53 gene appears to be a positive regulator of plant senescence (Miao et al., 2004). In addition, the AtNAP gene among NAC transcription factors has been reported to be a positive regulator of plant senescence (Guo and Gan, 2006).

On the other hand, the expression of GmSARK, which is one of the receptor-like kinases, is up-regulated not only by spontaneous aging but also by artificial aging by cancer treatment, (Li et al., 2006).

Recently, reactive oxygen species (ROS) have been known to play an important role in plant senescence. In particular, the peroxisome the car ㅌ Tallahassee azepin homozygous protein derived from (peroxysome) (catalase isoform) are proposed in Zentgraf group to the Arabidopsis thaliana that control the aging of the plant with APX1 from a material (Zimmermann et al., 2006) .

On the other hand, in agriculture, aging of plants may limit the productivity of crops due to limitations on the growth stage of plants, and may cause loss of quality such as leaf sulphation and nutrient loss in vegetable crops. Therefore, research on plant aging basically not only increases the understanding of the growth process of plants, but also provides the control of plant aging, which can lead to improvement of agricultural traits such as crop productivity and shelf life. Gan et al. (1995) could increase productivity by up to 50% through regulation of aging in tobacco, and beans (Guiamett et al ., 1990), it was possible to obtain an increase of productivity of 30% or more through aging control. However, research on productivity enhancement through controlling plant aging is still very limited.

For this reason, plant biotechers are trying to find genes or proteins that contribute to life extension in plants.

It is an object of the present invention to provide an ATPG4 protein having an aging-delaying function and a stress-tolerance function with a plant productivity increasing function.

Another object of the present invention is to provide a gene encoding the protein.

It is another object of the present invention to provide a method for producing a plant having aging delay characteristics.

It is still another object of the present invention to provide a method for producing a plant having an increase in production amount.

It is still another object of the present invention to provide a method for producing a plant having stress tolerance.

Other objects of the present invention will be described below.

In one aspect, the present invention relates to ATPG4 protein having a plant productivity increasing function, a delayed aging function, and a stress tolerance function.

The present inventors have succeeded in isolating the gene of the protein based on the nucleotide sequence of AT-HOOK MOTIF NUCLEAR-LOCALIZED PROTEIN (GeneBank accession number NP_566232.1) in Arabidopsis, When transgenic plants were overexpressed, productivity increase characteristics such as an increase in biomass and / or seed productivity of the individual were apparent, and the delayed senescence of the plant was conspicuous, and the resistance characteristic against drought stress or oxidative stress was also apparent Respectively.

These results indicate that the gene and protein are involved in delaying the senescence of the plant and increasing the productivity of the plant.

The present inventors have named the gene to gene and protein ATPG4 ATPG4 (AT -hook p rotein of G enomine 4), these nucleotide sequences and amino acid sequences are disclosed in SEQ ID NOS: 1 and 2, respectively.

The ATPG4 protein of the present invention is one of the following polypeptides (a), (b) and (c).

(a) a polypeptide comprising the entire amino acid sequence of SEQ ID NO: 2;

(b) a polypeptide comprising a substantial portion of the amino acid sequence set forth in SEQ ID NO: 2; And

(c) a polypeptide substantially similar to the polypeptide of (a) or (b) above.

In this specification, the term " protein " is used interchangeably with the same meaning as the polypeptide, and the term " gene " is used interchangeably with the polynucleotide.

As used herein, the term " a polypeptide comprising a substantial portion of the amino acid sequence of SEQ ID NO: 2 " means that the polypeptide still contains a sufficient amount of a plant aging-delaying function and a productivity-enhancing function when compared with the polypeptide consisting of the amino acid sequence of SEQ ID NO: Of the amino acid sequence of SEQ ID NO: 2. The length of the polypeptide and the degree of activity of such a polypeptide do not matter, since it still suffices to retain the senescence retarding function and the productivity increasing function of the plant. That is, a polypeptide still having a lower activity than that of the polypeptide comprising the amino acid sequence of SEQ ID NO: 2, but still has a function of aging-retarding function and productivity-enhancing function, Quot; polypeptide ". Those skilled in the art, that is, those who are familiar with the relevant prior arts known on the basis of the present application, will recognize that even if a portion of a polypeptide comprising the amino acid sequence of SEQ ID NO: 2 is deleted, such polypeptide still has a delayed aging function and a productivity- I would expect to have it. As such a polypeptide, there can be mentioned a polypeptide in which an N-terminal portion or a C-terminal portion is deleted in a polypeptide comprising the amino acid sequence of SEQ ID NO: 2. Since it is generally known in the art that such polypeptides have the function of the native polypeptide even if the N-terminal or C-terminal part is deleted. In some cases, it may be the case that the N-terminal portion or the C-terminal portion is essential for maintaining the function of the protein, and the polypeptide in which the N-terminal portion or the C-terminal portion is deleted does not exhibit the above function. It is within the ordinary skill of those skilled in the art to distinguish and detect an inactive polypeptide from an active polypeptide. Furthermore, even if the N-terminal portion or the C-terminal portion as well as other portions are deleted, the function of the native polypeptide can still be possessed. Again, one of ordinary skill in the art will be able to fully ascertain whether these deleted polypeptides still have the function of the native polypeptide within their normal capabilities. In particular, the present disclosure discloses the nucleotide sequence of SEQ ID NO: 1, the amino acid sequence of SEQ ID NO: 2, further encoded by the nucleotide sequence of SEQ ID NO: 1, and the amino acid sequence of SEQ ID NO: 2, 2, it is understood by those skilled in the art that the polypeptide lacking some sequences in the amino acid sequence of SEQ ID NO: 2 still retains the function of the polypeptide comprising the amino acid sequence of SEQ ID NO: 2 It becomes very clear that it can be sufficiently confirmed within the normal capability range. Therefore, in the present invention, the above-mentioned " polypeptide comprising a substantial part of the amino acid sequence of SEQ ID NO: 2 " means that the polypeptide of the present invention can be produced by a person skilled in the art on the basis of the disclosure herein, Should be understood as including all polypeptides of deletion form having function and productivity-enhancing function.

In the present specification, the term " polypeptide substantially similar to the polypeptides of (a) and (b) " includes one or more substituted amino acids, but the function of the polypeptide comprising the amino acid sequence of SEQ ID NO: 2, Delayed function and productivity-enhancing function. Here, as long as the polypeptide containing one or more substituted amino acids retains the aging-delay function and the productivity-enhancing function of the plant, the degree of activity of the polypeptide or the degree to which the amino acid is substituted does not matter. In other words, even if a polypeptide comprising one or more substituted amino acids contains a small number of substituted amino acids and a large number of substituted amino acids compared to a polypeptide comprising the amino acid sequence of SEQ ID NO: 2, A delay function and a productivity increasing function are included in the present invention. Even if one or more amino acids are substituted, the polypeptide comprising such a substituted amino acid will still retain the function of the original polypeptide if the amino acid prior to substitution is chemically equivalent to the substituted amino acid. For example, even if alanine, which is a hydrophobic amino acid, is substituted with another hydrophobic amino acid, such as glycine, or a more hydrophobic amino acid such as valine, leucine or isoleucine, the polypeptide with such substituted amino acid (s) Will still retain the function of the native polypeptide. Likewise, even if a negatively charged amino acid such as glutamic acid is replaced with another negatively charged amino acid such as aspartic acid, the polypeptide having such substituted amino acid (s) still retains the function of the original polypeptide even if its activity is low And even if a positively charged amino acid, such as arginine, is replaced with another positively charged amino acid, such as lysine, a polypeptide having such a substituted amino acid (s) will still retain the function of the original polypeptide even if the activity is low will be. Also, polypeptides comprising amino acid (s) substituted at the N-terminal or C-terminal portion of the polypeptide will still retain the function of the native polypeptide. Those skilled in the art can prepare a polypeptide that still retains the aging-delaying function and productivity-enhancing function of the plant having the polypeptide comprising the amino acid sequence of SEQ ID NO: 2, while containing the above-mentioned one or more substituted amino acids. Those skilled in the art will also recognize that polypeptides comprising one or more substituted amino acids still have the above functions. In addition, the present specification discloses an embodiment that discloses the base sequence of SEQ ID NO: 1 and the amino acid sequence of SEQ ID NO: 2, and the polypeptide including the amino acid sequence of SEQ ID NO: 2 has a function of delaying the senescence and increasing the productivity of the plant. It is clear that the "polypeptide substantially similar to the polypeptides of (a) and (b)" of the present invention can be easily practiced by those skilled in the art. Therefore, a " polypeptide substantially similar to the polypeptide of (a) or (b) above " should be understood to include all polypeptides that contain one or more substituted amino acids but still have a function of aging delay and productivity of the plant. As such, " polypeptide substantially similar to the polypeptide of (a) or (b) above " is meant to include all polypeptides that contain one or more substituted amino acids but still have a function of delaying the aging and productivity of plants, From the viewpoint of degree, the polypeptide preferably has higher sequence homology with the amino acid sequence of SEQ ID NO: 2. The polypeptide preferably has a sequence homology of at least 60% in the lower limit of the sequence homology, but desirably has 100% sequence homology in the upper limit of the sequence homology. More specifically, the top sequence homology is 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72% 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89% , 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% and 99%. &Quot; Polypeptides substantially similar to the polypeptides of (a) and (b) " of the present invention refer to "polypeptides substantially similar to polypeptides comprising the entire amino acid sequence of SEQ ID NO: 2" Substantially all of the polypeptides comprising a substantial portion ", so that all the explanations given hereinabove are applicable to " polypeptides substantially similar to polypeptides comprising the entire amino acid sequence of SEQ ID NO: 2 " as well as " A polypeptide substantially similar to a polypeptide comprising a substantial portion of the sequence ".

In another aspect, the invention is directed to an isolated polynucleotide encoding a polypeptide as described above. As used herein, the term " polypeptide " as used herein refers to a polypeptide comprising the entire amino acid sequence of SEQ ID NO: 2, a polypeptide comprising a substantial portion of the amino acid sequence of SEQ ID NO: 2, Is meant to encompass not only polypeptides substantially similar to the above polypeptides but also all of the polypeptides of the preferred embodiments described above. Therefore, the polynucleotide of the present invention is an isolated polynucleotide encoding a polypeptide comprising the entire amino acid sequence shown in SEQ ID NO: 2, or a substantial portion thereof, having a senescence retarding function and a productivity increasing function of the plant, Encoding similar polypeptides comprises isolated polynucleotides and further comprises a polynucleotide encoding a polypeptide encoding a polypeptide having all of its sequence homology in the order of sequence homology as described above, Gt; polynucleotides < / RTI > When an amino acid sequence is revealed, a polynucleotide encoding such an amino acid sequence based on such amino acid sequence can be easily prepared by those skilled in the art.

As used herein, the term " isolated polynucleotide " refers to a chemically synthesized polynucleotide, an organism, in particular Arabidopsis thaliana , and polynucleotides containing modified nucleotides, and is defined to include both single-stranded or double-stranded RNA or polymers of DNA.

In another aspect, the present invention relates to a method for producing a plant with delayed senescence.

(A) overexpressing a gene having a nucleotide sequence of SEQ ID NO: 1 or a gene having a sequence similar to the nucleotide sequence of SEQ ID NO: 1 in a plant, and (b) And a step of selecting the plant having the plant.

As used herein, the term " delayed senescence " refers to a property that the plant life is prolonged compared to that of a wild-type plant. Specifically, the symptom of yellowing and / or necrosis of leaves and / or stalks is delayed compared to that of wild- It is said that the photosynthetic efficiency of plants is higher than that of wild type plants.

In the present specification, the term " plant " includes mature plants, immature plants (seedlings), plant seeds, plant cells, plant tissues and the like. When plant cells or plant tissues are used for transformation, the transformed plant cells or plant tissues can be obtained by the methods described in European Patent EP0116718, European Patent EP0270822, WO 84/02913, Gould et al. 1991, Plant Physiol 95, 426-434) and the like, can be used to grow and grow into mature plants.

Also, in the present specification, the term " plant " includes all plants in which delayed aging can give useful results to humans. Since the aging delay is directly related to the increase in the yield, that is, the seed productivity and / or the increase in the biomass of the individual, the meaning of the plant is primarily that the crops such as rice, wheat, barley, corn, soybean, potato, , Oats, sorghum, cruciferous vegetables (Chinese cabbage, kale, cauliflower, broccoli, young radish, radish, freshcorn, etc.), pepper, strawberry, tomato, watermelon, cucumber, cabbage, melon, , Carrots, ginseng, tobacco, cotton, sesame, sugarcane, beet, perilla, peanut, rapeseed, apple tree, pear, jujube tree, peach, sheep grape, grape, citrus, persimmon, apricot, banana And will include guitar ragras, red clover, orchardgrass, alpha alpha, tall fescue, perennialla grass, rose, gladiolus, gerbera, carnation, chrysanthemum, lilies and tulips.

In the present specification, the term " a gene having a sequence similar to the nucleotide sequence of SEQ ID NO: 1 " means a gene having a nucleotide sequence that is different from that of SEQ ID NO: 1 due to codon degeneracy of the codon while encoding the amino acid sequence of SEQ ID NO: And a homologue of a gene consisting of the nucleotide sequence of SEQ ID NO: 1, which has a function of delaying the aging of the plant, It is meant to include genes. Here, the gene having the sequence similar to the nucleotide sequence of SEQ ID NO: 1 is preferably as high as the sequence homology with the nucleotide sequence of SEQ ID NO: 1, and most preferably has the sequence homology of 100%. On the other hand, in the lower limit of the sequence homology, it is preferable that the gene has 60% or more sequence homology with the nucleotide sequence of SEQ ID NO: 1. More specifically, the above sequence homology is 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72% %, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87% , The higher the order of 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% and 99%.

As used herein, " overexpressing " means expression above a level expressed in a wild-type plant. Such "overexpression" may be determined by directly determining the gene of SEQ ID NO: 1 or a gene (for example, cDNA) comprising a sequence similar to the nucleotide sequence of SEQ ID NO: 1, or indirectly quantifying the protein encoded by the gene have. It can also be confirmed through phenotypes depending on the characteristics of the gene.

In the method for producing a plant with delayed aging according to the present invention, the step (a) may be carried out by a genetic engineering method.

The genetic engineering method comprises the steps of: (i) inserting the gene of SEQ ID NO: 1 or a gene having a sequence similar to the nucleotide sequence of SEQ ID NO: 1 into an expression vector operably linked to a regulatory sequence capable of overexpressing the gene; ii) transforming the expression vector into a plant.

As used herein, " operably " means that the transcription and / or translation of a gene is linked to be influenced. For example, if a promoter affects the transcription of a gene linked thereto, the promoter and the gene are operably linked.

As used herein, the term " regulatory sequence " is intended to include any sequence whose presence can affect the transcription and / or translation of a gene linked thereto. Such regulatory sequences include promoter sequences, polyadenylation signal ), And a replication start point.

As used herein, the term " promoter " refers to the conventional meaning as known in the art. Specifically, the term " promoter "Quot; refers to a nucleic acid sequence having a function of controlling transcription of one or more genes, including a site, a transcription start point, a transcription factor binding site, and the like. Such a promoter may be a TATA box (usually located at a transcription start point (+1) -20 to -30 position) upstream of the transcription start point, a CAAT box (usually at about -75 position , 5 'enhancer, transcription repressor, and the like.

The promoter that can be used is a promoter capable of overexpressing the gene of SEQ ID NO: 1 linked thereto, a constitutive promoter (a promoter that induces expression constantly in all plant tissues), an inducible promoter (expression of a desired gene in response to a specific external stimulus Or a promoter which induces a specific expression timing in a specific developmental stage or a specific tissue) can be used. A typical example of a usable constitutive promoter is a promoter of 35S RNA gene of cauliflower mosaic virus (CaMV), and a promoter of ubiquitin family (Christensen et al., 1992, Plant Mol Biol. 18, 675-689; EP0342926; Cornejo et al., 1993, Plant Mol. Biol. 23, 567-581), rice actin promoter (Zhang et al., 1991, The Plant Cell 3, 1155-1165) . Examples of available inducible promoters include yeast metallothionein promoters activated by copper ions (Mett et al., Proc. Natl. Acad. Sci., USA, 90: 4567,1993), activated by substituted benzenesulfonamides In2-1 and In2-2 promoters (Hershey et al., Plant Mol. Biol., 17: 679, 1991), GRE regulatory sequences (Schena et al., Proc. Natl. Acad. : 10421, 1991), photoregulatory promoters derived from small subunits of ethanol-regulated promoters (Caddick et al., Nature Biotech., 16: 177, 1998), ribulose bis- phosphate carboxylase (ssRUBISCO) , Mannofine Synthase Promoter (Velten et al., EMBO J., 3: 2723, 1984), Nopaline Synthase (NOS), EMBO J., 3: 1671, 1984; Broglie et al., Science, 224: (OcS) promoter, heat shock promoter (Gurley et al., Mol. Cell. Biol., 6: 559, 1986; Severin et al., Plant Mol. Biol., 15: A glutelin promoter, a soybean-derived lectin promoter, and a cabbage-derived napin promoter.

The transcription termination sequence is a sequence that acts as a poly (A) addition signal (polyadenylation signal) to increase the completeness and efficiency of transcription. Examples of the transcription termination sequence that can be used include a transcription termination sequence of the nopaline synthase (NOS) gene, a transcription termination sequence of the rice α-amylase RAmy1 A gene, a transcription termination sequence of the Octopine gene of Agrobacterium tumefaciens A transcription termination sequence of wheat ubiquitin gene, a transcription termination sequence of rice glutelin gene, and a transcription termination sequence of rice lactate dehydrogenase gene.

The expression vector may comprise a selectable marker gene. As used herein, the term " marker gene " refers to a gene encoding a trait that enables selection of a plant containing such a marker gene. The marker gene may be an antibiotic resistance gene or a herbicide resistance gene. Examples of suitable selectable marker genes include genes for adenosine deaminase, genes for dihydrofolate reductase, genes for hygromycin-B-phosphotransferase, genes for thymidine kinase, xanthine-guanine phosphoribosyl transferase A gene of Lase, and a phosphinotriosin acetyltransferase gene.

Herein, the term " transformation " means a modification of a genotype of a host plant by introduction of a causal gene, and regardless of the method used for transformation, the causative gene is expressed in a host plant, more precisely, ≪ / RTI > and incorporated into the genome of the cell. Herein, the homologous gene and the heterologous gene are included in the homologous gene, and the term " homologous gene " means the endogenous gene of the host organism or the same species. The " heterologous gene " . For example, the Arabidopsis gene is a homologous gene for Arabidopsis plants but a heterologous gene for tomato plants.

Meanwhile, a method of transforming a plant with an exogenous gene can be performed by a method known in the art, for example, a direct gene transfer method using a gene gun, a method of transforming a plant in planta using a floral dip Method, a pollen-mediated transformation method, a protoplast transformation method, a virus-mediated transformation method, a liposome-mediated transformation method, and the like. Methods for transforming corn, for example, can be found in U.S. Patent No. 6,140,553, Fromm et al, 1990, Bio / Technology 8, 833-839, Gordon- (Shimamoto et al, 1989, Nature 338, 274-276), the method described in Datta < RTI ID = 0.0 > et al 1990, Bio / Technology 8, 736-740), WO 92/09696, WO 94/00977, WO 95/06722, and the like. In addition, for the transformation of tomatoes and tobacco, it is also possible to use a transgenic plant as described in An G. et al., 1986, Plant Physiol. 81: 301-305, Horsch RB et al, 1988, In: Plant Molecular Biology Manual A5, Dordrecht, Kluwer Academic Publishers, pp 1-9), Koornneef M. et al, 1986, In: Nevins DJ. And RA Jones, eds. Tomato Biotechnology, New York, NY, USA, Alan R. Liss, -178) can be used.

Generally, a method that is widely used for transforming plants is a method of infecting a plant, a plant seed or the like with transformed Agrobacterium.

Such Agrobacterium-mediated transformation methods are well known in the art (Chilton et al., 1977, Cell 11: 263: 271; European Patent EP 0116718; US Patent 4,940,838) Lt; / RTI > See, for example, U.S. Patent No. 5,159,135 for cotton, U.S. Patent No. 5,824,877 for soybeans, U.S. Pat. No. 5,591,616 for corn, and the like. The Agrobacterium-mediated transformation method utilizes a Ti-plasmid, which will include a border sequence that can integrate T-DNA into the genome of a plant cell.

Meanwhile, the step (b) may be carried out by visualizing the transformed plant through development of the degree of sulphation of the leaf or progress of the necrosis of the leaf, or by selecting the marker gene When transformed together, selection can be made using a selectable marker gene, further, a method of quantifying chlorophyll content, photosynthetic efficiency, etc., and a method of mixing the above methods can be selected.

In another aspect, the present invention relates to a method for producing a plant having productivity-enhancing characteristics of the present invention.

(A) overexpressing a gene having the nucleotide sequence of SEQ ID NO: 1 or a gene having a sequence similar to the nucleotide sequence of SEQ ID NO: 1 in the plant, and (b) increasing the productivity of the plant having the productivity- And selecting the plant having the characteristic.

As used herein, the term " productivity-enhancing property " refers to a property that the biomass (size and / or mass) of whole, stem, root and / or leaf of a plant is increased compared to a wild-type plant and / The number and / or mass of seeds per individual) is increased relative to the wild-type plant.

The step (a) may be carried out in a genetic engineering manner. Such a genetic engineering method is as described in connection with the method of manufacturing the delayed plant of the present invention.

The step (b) may be selected by comparing the biomass and / or the seed productivity of the plant, or, when the selective marker gene is transformed at the time of transformation, using the selective marker gene, It can be mixed and screened.

In yet another aspect, the present invention relates to a method of making a stress tolerant plant.

The method for producing a stress tolerant plant of the present invention comprises the steps of (a) overexpressing a gene having a nucleotide sequence of SEQ ID NO: 1 in a plant or a gene having a sequence similar to a nucleotide sequence of SEQ ID NO: 1, and (b) And selecting the plant.

As used herein, "stress" means drought stress and / or oxidative stress.

The step (a) may be carried out in a genetic engineering manner. Such a genetic engineering method is as described in connection with the method of manufacturing the delayed plant of the present invention.

The step (b) may be carried out by comparing the stress tolerance of a plant (for example, the progress of leaf sulphation, progress of leaf necrosis, leaf biomass, chlorophyll content, photosynthetic efficiency, etc.) When the selectable marker gene is transformed together, it can be screened using a selectable marker gene, or a combination of these methods can be selected.

In another aspect, the invention relates to a method of delaying plant senescence.

(A) a gene having the nucleotide sequence of SEQ ID NO: 1 or a gene having a sequence similar to the nucleotide sequence of SEQ ID NO: 1, so as to be operably linked to a regulatory sequence capable of overexpressing the gene; Into an expression vector, and (b) transforming the expression vector into a plant.

In another aspect, the present invention relates to a method for increasing plant productivity.

(A) a gene having the nucleotide sequence of SEQ. ID. NO. 1 or a gene having a sequence similar to the nucleotide sequence of SEQ. ID. NO. 1 is operably linked to a regulatory sequence capable of overexpressing the gene. (B) transforming the expression vector into a plant.

In another aspect, the present invention relates to a method for increasing stress tolerance of a plant.

(A) a gene having the nucleotide sequence of SEQ ID NO: 1 or a gene having a sequence similar to the nucleotide sequence of SEQ ID NO: 1 is operably linked to a regulatory sequence capable of overexpressing the gene And (b) transforming the expression vector into a plant.

In the above methods, steps (a) and (b) are as described in connection with the method for producing the delayed aged plant of the present invention.

In another aspect, the present invention relates to a method for producing an aging delayed plant, which comprises obtaining a gene having the nucleotide sequence of SEQ ID NO: 1 or a gene having a sequence similar to the nucleotide sequence of SEQ ID NO: 1, Lt; RTI ID = 0.0 > transgenic < / RTI >

In a preferred aspect, the plant is a transgenic plant having an ATPG4 protein encoding the amino acid sequence of SEQ ID NO: 2, particularly a gene having the nucleotide sequence of SEQ ID NO: 1, and overexpressing the same to thereby have an aging-delay characteristic.

In another aspect, the present invention relates to a gene having the nucleotide sequence of SEQ ID NO: 1 or a gene having a sequence similar to the nucleotide sequence of SEQ ID NO: 1 obtained by the method for producing a plant having the productivity- The present invention relates to a transgenic plant having increased productivity.

In a preferred aspect, the plant is a transgenic plant having productivity-enhancing characteristics by overexpression of a gene encoding the ATPG4 protein consisting of the amino acid sequence of SEQ ID NO: 2, in particular the gene ATPG4 having the nucleotide sequence of SEQ ID NO: 1.

In another aspect, the present invention relates to a method for producing a stress tolerant plant, which comprises obtaining a gene having the nucleotide sequence of SEQ ID NO: 1 or a gene having a sequence similar to the nucleotide sequence of SEQ ID NO: 1, Lt; RTI ID = 0.0 > transgenic < / RTI >

In a preferred aspect, the plant is a transgenic plant having stress resistance by overexpression of a gene encoding the ATPG4 protein consisting of the amino acid sequence of SEQ ID NO: 2, in particular the gene ATPG4 having the nucleotide sequence of SEQ ID NO: 1.

In the present specification, the term " transgenic plant " is used not only when the gene is transfected into plant cells, plant tissues, or plant seeds capable of developing and growing into mature plants but also by crossing with transgenic plants The resulting genome includes modified plants, plant seeds, and plant cells.

As described above, according to the present invention, it is possible to provide the ATPG4 protein and its gene having a function of delaying the aging of plants, a productivity increasing function, and a stress tolerance function. Since the gene provides a delayed aging function, a productivity increasing function and a stress tolerance function of a plant, when the plant is transformed with this gene, it is possible to delay the aging of the plant, increase the productivity, or produce a plant resistant to stress have.

Fig. 1 shows the structure (schematic diagram) of a pCSEN-ATPG4 recombinant vector into which the ATPG4 gene having the senescence delay function, the productivity increasing function and the stress tolerance function of the plant is introduced in the sense direction.
FIG. 2 is a photograph of a Arabidopsis thaliana grown on the T ₂ line of Arabidopsis thaliana transformed with the recombinant vector pCSEN-ATPG4 of FIG. 1 for 50 days and 70 days after germination.
Con: Arabidopsis wild type or control
ATPG4 ox-2 : Arabidopsis T- ₂ line transformed with pCSEN-ATPG4 recombinant vector
ATPG4 ox-5 : Arabidopsis T- ₂ line transformed with pCSEN-ATPG4 recombinant vector
ATPG4 ox-7 : Arabidopsis T- ₂ line transformed with pCSEN-ATPG4 recombinant vector
FIG. 3 shows the results of qRT-PCR analysis of the expression pattern of ATPG4 gene in Arabidopsis thaliana grown in the T ₂ line of Arabidopsis thaliana transformed with the recombinant vector pCSEN-ATPG4 of FIG. 1 for 20 days after cotyledonization will be.
Wt: Arabidopsis wild type
ATPG4 ox-2: Arabidopsis T- ₂ line transformed with pCSEN-ATPG4 recombinant vector
ATPG4 ox-5: Arabidopsis T- ₂ line transformed with pCSEN-ATPG4 recombinant vector
ATPG4 ox-7: Arabidopsis T- ₂ line transformed with pCSEN-ATPG4 recombinant vector
FIG. 4 shows the results of qRT-PCR analysis of the expression pattern of ATPG4 gene in various plant tissues of Arabidopsis wild type.
S: seedling, R: root, Ar: arial region, GL: green leaf, YL: yellow leaf, St: stem, F: inflorescence organ
FIG. 5 is a diagram illustrating an increase in productivity of the Arabic long line of FIG. 3.
Con: Arabidopsis wild type or control
ATPG4 ox-2 : Arabidopsis T- ₂ line transformed with pCSEN-ATPG4 recombinant vector
ATPG4 ox-5 : Arabidopsis T- ₂ line transformed with pCSEN-ATPG4 recombinant vector
ATPG4 ox-7 : Arabidopsis T- ₂ line transformed with pCSEN-ATPG4 recombinant vector
Height: Key, NTS: Drying weight, Dry-W: Dry weight, TSW: Total seed weight, TNS: Total seed count, 1,000SW: 1,000 seed weight
Fig. 6 shows that the rosette leaf of the Arabidopsis wild type (Con), the mutants ATPG4 ox-2, ATPG4 ox-5 , and ATPG4 ox-7 induced delayed senescence from day 12 after cotyledon It is a picture of leaf phenotype observed up to 40 days per day.
FIG. 7 shows that the rosette leaf of the Arabidopsis wild type (Con), the mutants ATPG4 ox-2, ATPG4 ox-5 , and ATPG4 ox-7 induced delayed senescence from day 12 after cotyledon The chlorophyll content of the leaves was examined for up to 40 days per day.
Fig. 8 shows that the rosette leaves of the Arabidopsis wild type (Con), the mutants ATPG4 ox-2, ATPG4 ox-5 , and ATPG4 ox-7 induced delayed senescence from day 12 after cotyledon The photosynthetic efficiency of the leaves was measured by Fv / Fm for up to 40 days per day.
FIG. 9 shows that the rosette leaves of the Arabidopsis wild type (Con), the mutants ATPG4 ox-2, ATPG4 ox-5 , and ATPG4 ox-7 induced delayed senescence from day 12 after cotyledon The expression pattern of the senescence marker gene of the leaves was analyzed by qRT-PCR until day 40, and ACT2 was used as PCR positive control. CAB2 is a chlorophyll a / b binding protein gene, and SEN4 and SAG12 are aging genes and aging marker genes.
FIG. 10 shows the results of deterioration of the cancerous state by detachment of the left -handed wild type (Con), delayed aging-induced mutants ATPG4 ox-2, ATPG4 ox-5 , and ATPG4 ox-7 3-4 And the leaf phenotype was observed every 2 days for 12 days.
Fig. 11 shows the results of deterioration of the cancerous state by detaching 3-4 times of the Arabidopsis wild type (Con), the delayed aging-induced mutants ATPG4 ox-2, ATPG4 ox-5 , and ATPG4 ox-7 at day 21 after germination And the chlorophyll content of the leaves was examined every 12 days for 2 days.
Fig. 12 shows the results of deterioration of the cancerous state by detachment of the left -handed wild type (Con), delayed aging-induced mutants ATPG4 ox-2, ATPG4 ox-5 , and ATPG4 ox- The photosynthetic efficiency of the leaves was measured by Fv / Fm every 2 days for 12 days.
FIG. 13 shows the results of detachment of the left and right lobes (Con), delayed aging-induced mutants ATPG4 ox-2, ATPG4 ox-5 , and ATPG4 ox- The expression of aging marker gene of leaves was analyzed by qRT-PCR for 12 days every 2 days. ACT2 was used as PCR positive control. CAB2, SEN4, and SAG12 are aging marker genes.
FIG. 14 is a photograph of a Arabidopsis thaliana grown on the T ₂ line of Arabidopsis thaliana transformed with the recombinant vector pCSEN-ATPG4 of FIG. 1 for 55 days after germination.
Col-0: Arabidopsis wild type
Con: Arabidopsis control
ATPG4 ox-1 : Arabidopsis T ₂ line transformed with pCSEN-ATPG4 recombinant vector
ATPG4 ox-2 : Arabidopsis T- ₂ line transformed with pCSEN-ATPG4 recombinant vector
ATPG4 ox-3 : Arabidopsis T ₂ line transformed with pCSEN-ATPG4 recombinant vector
ATPG4 ox-4 : Arabidopsis T ₂ line transformed with pCSEN-ATPG4 recombinant vector
ATPG4 ox-5 : Arabidopsis T- ₂ line transformed with pCSEN-ATPG4 recombinant vector
ATPG4 ox-6 : Arabidopsis T ₂ line transformed with pCSEN-ATPG4 recombinant vector
ATPG4 ox-7 : Arabidopsis T- ₂ line transformed with pCSEN-ATPG4 recombinant vector
ATPG4 ox-8 : Arabidopsis T ₂ line transformed with pCSEN-ATPG4 recombinant vector
FIG. 15 shows the results of qRT-PCR analysis of the expression pattern of the ATPG4 gene in plants at 24 days after the cotyledon of the T ₂ lines of the transgenic Arabidopsis thaliana of the above-mentioned 13.
FIG. 16 is a graph showing total seed yield as an index of productivity increase for the T ₂ lines of the transgenic Arabidopsis thaliana of FIG.
FIG. 17 shows the results of a drought treatment for 16 days in the Arabidopsis wild type or control (Con) and delayed senescence-induced mutants ATPG4 ox-2, ATPG4 ox-5 and ATPG4 ox-7 at 30 days after germination , And the phenotypic changes of
FIG. 18 shows the results of a drought treatment for 16 days in the Arabidopsis wild type or control (Con) and delayed senescence-induced mutants ATPG4 ox-2, ATPG4 ox-5 and ATPG4 ox-7 at 30 days after germination , Of the leaf weight.
FIG. 19 shows the results of detachment of 3-4 left leaves of ATPG4 ox-2, ATPG4 ox-5 , and ATPG4 ox-7 in the Arabidopsis wild type or control (Con) Figure _{2 shows} the phenotypic changes of leaves treated with H ₂ O ₂ for days.
FIG. 20 shows the results of detachment of 3-4 left leaves of ATPG4 ox-2, ATPG4 ox-5 , and ATPG4 ox-7 in the Arabidopsis wild type or the control (Con) This figure shows the chlorophyll content of leaves treated with daily H ₂ O ₂ .
FIG. 21 shows the results of detachment of 3-4 left leaves of ATPG4 ox-2, ATPG4 ox-5 , and ATPG4 ox-7 in the Arabidopsis wild type or control (Con) Fv / Fm shows the change in photosynthetic efficiency of leaves treated with daily H ₂ O ₂ .

Hereinafter, embodiments of the present invention will be described. However, the scope of the present invention is not limited to these embodiments.

< Example  1> From Arabidopsis to control the increase of plant productivity and delayed aging, and also provide stress tolerance ATPG4  Isolation of genes

The following procedure was performed to isolate the ATPG4 gene from the Arabidopsis thaliana, which has the function of delaying the senescence of the plant, the productivity increasing function and the stress tolerance function.

<Example 1-1> Cultivation and culture of Arabidopsis thaliana

The Arabidopsis thaliana was cultivated in pots containing soil or cultivated in Petri dishes containing MS medium (Murashige and Skoog salts, Sigma, USA) containing 2% sucrose (pH 5.7) and 0.8% agar . When cultivated in pots, they were cultivated in a growth chamber controlled at a light cycle of 16/8 hours at a temperature of 22 ° C.

<Example 1-2> RNA extraction and preparation of cDNA library

To construct Arabidopsis cDNA library, RNA was extracted from whole organ of Arabidopsis of different differentiation stage using RNasey Plant Mini Kit (QIAGEN, Germany) and extracted from the extracted total RNA using Superscript III Reverse Tanscriptase (INVITROGEN, USA) cDNA was synthesized.

<Example 1-3> ATPG4 gene isolation which regulates plant productivity and delayed senescence and provides stress tolerance of plants

Arabidopsis AT-HOOK-LOCALIZED PROTEIN MOTIF NUCLEAR the forward primer shown in SEQ ID NO: 3 on the basis of a base sequence containing the sequence of the restriction enzyme PacI in (GeneBank accession number NP_566232.1) (PacI / AT3G04570 SOE-F, 5'-TTA ATT AAA TGG CGA ATC CAT GGT GGA CAG -3 ') and the reverse primer shown in SEQ ID NO: 4 containing the sequence of the restriction enzyme XbaI (XbaI / AT3G04570 SOE-R , 5'-TCT AGA TTA AAA TCC TGA CCT AGC TTG AGC-3 ') was synthesized. Using the two primers, full length cDNA was amplified and separated from the Arabidopsis cDNA prepared in <Example 1-2> using polymerase chain reaction (PCR).

As a result of the analysis of the separated cDNA, it was confirmed that it has a 948 bp transcriptional translation frame (ORF) encoding 315 amino acids having a molecular weight of about 32 kDa and consists of one exon, and AT- It has a hook domain I was named them as ATPG4 (AT -hook p rotein of G enomine 4). The isoelectric point of the ATPG4 protein encoded by the gene was 6.3 (hereinafter, the gene is referred to as " ATPG4 " or " ATPG4 Gene &quot;, and the protein is called " ATPG4 " or " ATPG4 protein &quot;).

< Example  2> ATPG4  Sense constructs for genes ( construct Characterization of the Transgenic Arabidopsis thaliana in Korea

& Lt; Example 2-1 > ATPG4 Production of transgenic Arabidopsis thaliana into which a sense construct was introduced into a gene

To confirm whether the gene regulates plant productivity and delayed senescence and provides stress tolerance of plants, ATPG4 A transgenic Arabidopsis thaliana in which the gene was introduced in the sense direction was prepared ATPG4 transcripts.

ATPG4 cDNA was amplified by PCR from Arabidopsis cDNA using a forward primer represented by SEQ ID NO: 3 and containing a sequence of restriction enzyme PacI and a reverse primer represented by SEQ ID NO: 4 and containing a sequence of restriction enzyme XbaI . Cutting the DNA with restriction enzymes PacI and XbaI, and an inducible promoter (inducible promoters (promoter)) of the a pCSEN vector construction to receive the control of SEN1 promoter cloned in the sense orientation sense configuration chain to ATPG4 gene pCSEN-ATPG4 recombinant Vector. The SEN1 promoter has specificity with respect to a gene expressed by a plant growth stage.

Meanwhile, FIG. 1 is a diagram showing a recombinant vector pCSEN-ATPG4 in which the ATPG4 gene is introduced into the pCSEN vector in the sense direction. In Figure 1 BAR refers to the BAR gene (phosphinothricin acetyltransferase gene) which confers resistance to the Basta Herbicide, RB is the right border (Right Border), LB is the left boundary (Left Border), P35S the CaMV 35S promoter, 35S-A CaMV 35S RNA polyA, PSEN is SEN1 The promoter, Nos-A, refers to the polyA of the nopaline synthase gene.

The pCSEN-ATPG4 recombinant vector was introduced into Agrobacterium tumefaciens using an electroporation method. The transformed Agrobacterium culture was incubated at 28 ℃ until the OD ₆₀₀ value is 1.0, the cells were harvested by centrifugation at 5,000rpm for 10 minutes to 25 ℃. The harvested cells until the final OD ₆₀₀ value of 2.0 Infiltration Medium; was suspended in (IM 1X MS SALTS, 1X B5 vitamin, 5% sucrose, 0.005% Silwet L-77, Lehle Seed, USA) medium. 4 weeks old Arabidopsis thaliana was immersed in an Agrobacterium suspension in a vacuum chamber and placed under a vacuum of 10 ⁴ Pa for 10 minutes. After soaking, Arabidopsis was placed in a polyethylene bag (polyethylene bag) for 24 hours. Thereafter, the transformed Arabidopsis was continuously grown to harvest the seed (T ₁ ). As a control group, Arabidopsis transformed with wild type Arabidopsis thaliana or ATPG4 gene free vector (pCSEN vector) was used.

<Example 2-2> Characterization of T ₂ Transgenic Arabidopsis thaliana

Seed harvested from Arabidopsis thaliana transformed as in <Example 2-1> was selected by immersing in 0.1% Basta herbicide (KyungNin, Korea) for 30 minutes and culturing. The plants were treated with Basta herbicide 5 times during the growth of transformed Arabidopsis thaliana, and the transformed Arabidopsis thaliana was selected from each pot. T ₁ Arabidopsis thaliana transformed with pCSEN-ATPG4 vector control (ATPG4 Surprisingly, the mutants exhibited marked aging delayed characteristics when compared to their phenotype with the wild-type Arabidopsis (the Arabidopsis or wild type Arabidopsis transformed with only the gene-free vector (pCSEN vector)).

To more precisely identify the phenotypic changes of these transgenic Arabidopsis thaliana, we took T ₂ transgenic seeds from T ₁ transgenic Arabidopsis thaliana and examined the phenotype of these lines. First, T ₂ via the Basta Herbicide then grown in pots to a low temperature treatment (4 ℃) a T ₂ transformant seed for 3 days Transgenic Arabidopsis thaliana was selected.

Phenotype identification of selected Arabidopsis T ₂ transfection lines was performed on days 50 and 70 after germination (FIG. 2).

with the pCSEN-ATPG4 construct ATPG4 ox- 2, ATPG4 ox -5 and ATPG4 The ox- 7 mutant line showed a significant delay in aging of the plant when compared to the control (Con) of the Arabidopsis thaliana. In addition, these mutants showed not only a delayed senescence phenotype but also a marked increase in individual size and seed production . These delayed aging and productivity gains were slightly different in each line. This is due to the fact that the overexpression of genes slightly differs from one line to another as shown in Fig.

In order to analyze the expression patterns of the ATPG4 gene in selected mutants with the delayed phenotype of senescence, the wild type and the ATPG4 ox- 2, ATPG4 ox -5 and ATPG4 The total RNA was extracted from the leaves of the ox- 7 mutant using the RNasey Plant Mini Kit (QIAGEN, Germany). Using 1 μg of each of the RNA as a template, using Superscript III Reverse Tanscriptase (INVITROGEN, USA) at 65 ° C for 5 minutes; 60 minutes at 50 占 폚; And 70 &lt; 0 &gt; C for 15 minutes. PCR was carried out using the synthesized cDNA as a template and the specific primers shown in the following Table 1 for the ATPG4 gene and the ACT gene used as a PCR positive control. The PCR was performed by heating at 94 DEG C for 2 minutes to denature the template DNA, followed by washing at 94 DEG C for 1 minute; 55 &lt; 0 &gt; C for 1 minute 30 seconds; And 72 ° C for 1 minute, and then the reaction was carried out at 72 ° C for 15 minutes. Thereafter, PCR products were confirmed by 1% agarose gel electrophoresis, and the results are shown in FIG. Compared to Arabidopsis wild type, ATPG4 ox- 2, ATPG4 ox- 5 and ATPG4 ox -7 mutants ATPG4 gene expression was markedly increased, and this fact proves that the mutants are overexpressed ATPG4 gene.

The relative expression level of the gene ATPG4 high ATPG4 ox-2, ATPG4 ox -5 and ATPG4 ox- 7 mutants showed higher productivity, such as individual size and seed yield, than the control. Interestingly, the relative expression of ATPG4 The ox- 5 variant is ATPG4 ox- 2 ATPG4 ox- 7 mutants, the effect on productivity increase was relatively weak. Therefore, it can be concluded that the regulation of the expression level of this gene can arbitrarily produce plants having phenotypic characteristics for increasing productivity and delaying senescence

A primer sequence for expression of ATPG4 gene and ACT gene and SEQ ID NO: No. Gene name Forward / reverse primer (SEQ ID NO) One ATPG4 CTCGCGATTCTCCAAATGCT (SEQ ID NO: 5) / GCTAGGGTTTCGATGACGTCAGT (SEQ ID NO: 6) 2 ACT ATGGCCGATGGTGAGGATATTC (SEQ ID NO: 7) / CACCAGCAAAACCAGCCTTC (SEQ ID NO: 8)

In order to analyze the expression pattern of ATPG4 gene in Arabidopsis thaliana wild type plants, we extracted cDNAs by extracting organ RNA from various developmental stages of Arabidopsis wild type and used the ATPG4 gene as a template and the ACT gene used as PCR positive control PCR was carried out using specific primers shown in [Table 1] below. As shown in FIG. 4, it was confirmed that expression of ATPG4 gene was mainly in the leaves, and expression was also observed in stem and Inflorescence organs . On the other hand, the expression of genes in seedling and root of early development was remarkably low. These results suggest that this gene is mainly involved in the regulation of plant senescence by functioning mainly in leaves, stems and inflorescence organs of plants. However, .

< Example  3> ATPG4  Overexpression Mutant  Characterization of productivity increase

ATPG4 ox- 2, ATPG4 , and ATPG4 genes were used to confirm that the delayed plant senescence through overexpression of the ATPG4 gene could lead to an increase in crop productivity. ox -5 and ATPG4 ox- 7 line by the productivity increase index such as seed yield.

The applied productivity increase indicators are the plant height, silique number (NTS), dry weight (W), total seed weight (TSW), total seed number (TNS) SW), and the result is an average value of 20 individuals per line.

ATPG4 ox- 2, ATPG4 ox -5 and ATPG4 ox -7 mutant lines were increased by more than 1.5 times in seed weight compared with control in Arabidopsis thaliana. The weight of 1,000 seeds was ATPG4 ox - 2 mutant increased 1.4 times more than the control. Based on these facts, the expression of this gene seems to provide an increase in the individual size and total weight of seeds. And overexpression mutant had a significant increase in biomass and dry weight compared to the control. This fact suggests that the ATPG4 gene induces an increase in crop productivity such as individual size, seed size, and seed yield, as well as delayed senescence (FIG. 5). Therefore, the application of this gene to other crops would be highly valuable in terms of productivity increase.

< Example  4> ATPG4  Overexpression Mutant  Characterization of Aging Control

In order to confirm the delayed trait of ATPG4 overexpression, phenotypic observation, leaf chlorophyll content, and photosynthetic activity of rosette leaf 3-4 times every 4 days from 12 days after cotyledon production in T ₂ generation were measured And compared with Arabidopsis control.

& Lt; Example 4-1 > ATPG4 Phenotypic changes of leaves with age-dependent aging of overexpressing mutants

From the 12th day after cotyledon production, 3-4 times left leaf was observed every 4 days for 40 days. As a result, in the case of Arabidopsis wild type, the leaf sulphation appeared rapidly after 28 days and the leaf became necrosis on the 32nd day. On the other hand, ATPG4 ox- 2, ATPG4 ox- 5 and ATPG4 In the case of ox- 7, the sulphation of the leaves proceeded after 36 days, and the necrosis of the leaves occurred after 40 days (Fig. 6). Based on these facts, it is concluded that the ATPG4 gene plays an important role in delaying plant senescence.

& Lt; Example 4-2 > ATPG4 Changes in chlorophyll content by age-dependent aging of overexpressing mutants

For the determination of chlorophyll content, chlorophyll was extracted from 80% (V / V) acetone of each sample leaf. The chlorophyll content was determined by the method of Lichtenthaler and Wellburn ( Biochemical) using the extinction coefficient of 663.2 nm and 664.8 nm Society Transduction 603: 591-592, 1983). As a result, as shown in FIG. 7, the chlorophyll content of the wild type rapidly decreased from 24 days after cotyledon production, and the chlorophyll content was almost 0% at 36 days. However, the content of chlorophyll in ATPG4 ox- 2, ATPG4 ox -5 and ATPG4 ox- 7 showed chlorophyll content of more than 60% at the beginning of the measurement even after 28 days of cotyledon production.

Example 4-3 ATPG4 Changes in photosynthetic efficiency by age-dependent aging of overexpressing mutants

How to Plant Mol . Biol . 30: 939, 1996). First, the leaves of each DAE (day after emersion) were treated with cancer for 15 minutes, and fluorescence of chlorophyll was measured using Plant Efficiency Analyzer (Hansatech). Photosynthetic efficiency was expressed by the photochemical efficiency of PS II (photosystem II) using the fluorescence properties of chlorophyll. Maximum fluorescence (Fv) versus maximum value of fluorescence (Fm) (Fv / Fm). The higher the value, the better the photosynthetic efficiency.

As a result, as shown in Fig. 8, the wild type rapidly decreased from 32 days after the cotyledon production, and most of the activity disappeared after 36 days. However, ATPG4 ox- 2, ATPG4 ox -5 and ATPG4 In the case of ox- 7 , there was almost no activity change until the 36th day after cotyledon production, but after 40 days, the activity was lost. From these results, it was shown that ATPG4 overexpression mutants have a phenotype that is much longer than that of wild type, and the effect of this lifetime extension is due to the decrease of chlorophyll content by ATPG4 gene and the biochemical It is thought to be caused by delayed change.

<Example 4-4> ATPG4 Expression of aging-related genes by age-dependent aging of overexpressing mutants

Wild species and ATPG4 ox- 2, ATPG4 ox -5 and ATPG4 In order to compare the expression of senescence associated genes (SAGs) in ox- 7 variants, the expression pattern of ATPG4 gene and each aging-related gene over time during leaf development was confirmed by qRT-PCR analysis.

Total RNA was isolated using WelPrep ^™ Total RNA Isolation Reagent (JBI). DNase I (Ambion) was treated and 0.75 ug was quantitatively analyzed using ImProm-II ^™ Reverse Transcription System (Promega) Respectively.

Quantitative analysis of the ATPG4 gene and marker genes for senescence was confirmed by quantitative real-time PCR (qRT-PCR) using the Applied Bio-systems 7300 Real Time PCR System. Aging marker gene was used as a SAG12, SEN4 and CAB2 genes, as qRT-PCR was used as a positive control ACT2 gene. The primers used are shown in Table 2 below.

Primer SEQ ID NO: &lt; RTI ID = 0.0 &gt; No. Gene name Forward / reverse primer (SEQ ID NO) One CAB2 CCGAGGACTTGCTTTACCCC SEQ ID NO: 9) / AACTCAGCGAAGGCCTCTGG (SEQ ID NO: 10) 2 SEN4 CGTCGATGACACACCCATTAGAG (SEQ ID NO: 11) / CATCGGCTTGTTCTTTGGAAAC (SEQ ID NO: 12) 3 SAG12 ACGATTTTGGCTGCGAAGG (SEQ ID NO: 13) / TCAGTTGTCAAGCCGCCAG (SEQ ID NO: 14) 4 ACT2 ATGGCCGATGGTGAGGATATTC (SEQ ID NO: 7) / CACCAGCAAAACCAGCCTTC (SEQ ID NO: 8) 5 ATPG4 CTCGCGATTCTCCAAATGCT (SEQ ID NO: 5) / GCTAGGGTTTCGATGACGTCAGT (SEQ ID NO: 6)

In the case of wild type, the expression of genes related to photosynthesis such as CAB2 (chlorophyll a / b binding protein) showed a similar decrease pattern with wild type and ATPG4 overexpressing mutants as time passed. However, in the case of SAG12 expression used as a signal of aging, the wild type showed the maximum expression at 32 days, while the ATPG4 overexpressing mutants showed little increase until day 36, and the weakest singal at 40 days. The expression of SEN4 , which is known to gradually increase during the senescence of plants, increased rapidly after 20 days in wild type, while the ATPG4 overexpression mutant did not show a significant increase in expression of SEN4 during the aging process. On the other hand, the expression pattern of ATPG4 gene was found to be higher than that of wild-type ATPG4 gene, and the expression level of ATPG4 gene overexpression was significantly higher than that of wild type. However, despite these decreasing phenomena, it still maintained a higher expression sequence than the wild type (Fig. 9). Taken together, these results suggest that the ATPG4 gene delays the onset of senescence at the molecular level and then regulates physiological phenomena such as chlorophyll content and photosynthetic efficiency, resulting in phenotypic extension of leaf life.

Example 4-5 ATPG4 Analysis of aging characteristics of overexpressing mutants by cancer treatment

In order to analyze the characteristics of delayed traits of ATPG4 overexpressing mutants against cancer treatment, a factor known to promote senescence, rosette leaves were detached 3-4 times on day 21 after germination in T ₂ generation, After suspending in MES buffer (2- [N-morpholino] -ethanesulfonic acid, pH 5.8), phenotype observation, leaf chlorophyll content, photosynthesis efficiency and aging-related gene expression were observed every 2 days Were measured in the same manner as in Examples 4-1 to 4-4 &gt; and compared with wild-type Arabidopsis thaliana.

As a result, in the case of Arabidopsis wild type, the leaf sulphation progressed from 4 days after cancer treatment, and the leaf became necrosis state on the 6th day. On the other hand, ATPG4 ox- 2, ATPG4 ox- 5 and ATPG4 ox- 7 was observed to be more delayed than that of the wild-type in the case of ATPG4 ox- 5 (Fig. 10). The changes in chlorophyll content and photosynthetic efficiency during aging by cancer treatment were also significantly higher than those of wild-type ATPG4 The mutants were found to be delayed in content and activity reduction, although there was a difference in degree (Figs. 11 and 12).

In addition, the expression of aging index genes, SEN4 and SAG12 , and the light dependent gene CAB2 was examined in the same manner as in Example 4-4. As a result, as shown in Fig. 13, ATPG4 It was found that the mutants delayed the expression of SAG12 and suppressed the expression rate of SEN4 . These results suggest that the ATPG4 gene may delay the expression of the aging index gene or inhibit the expression rate and delay the aging process.

< Example  5> ATPG4  Analysis of correlation between delayed plant aging and productivity increase due to overexpression

To elucidate the correlation between delayed senescence of ATPG4 overexpression and increase in productivity, 10 lines of T ₂ generation were selected and their phenotypic characteristics of delayed senescence and productivity increase, ATPG4 overexpression level of mutant lines, The productivity of the lines was investigated and compared with the Arabidopsis control.

& Lt; Example 5-1 > ATPG4 Analysis of phenotypic characteristics of delayed senescence and productivity increase in overexpressing mutants

ATPG4 To analyze the phenotypic characteristics of delayed senescence and productivity increase of the overexpression mutants, 5 lines were selected in addition to the T ₂ transgenic Arabidopsis thaliana lines analyzed in Example 2-2, and a total of 8 lines of T ₂ traits We compared the phenotypic changes of the Arabidopsis lines and the Arabidopsis wild type (col-0) and the control (Con). Phenotype identification of selected Arabidopsis T ₂ transfection lines was performed 55 days after germination (FIG. 14).

Overall, ATPG4 ox- 1 and ATPG4 Except for the ox- 8 mutant line, all of the 6 mutant lines have phenotypic characteristics of delayed senescence compared with the Arabidopsis control, and especially ATPG4 ox- 3, ATPG4 The ox- 4 and ATPG4 ox- 6 mutant lines were found to have strong phenotypic characteristics of delayed senescence. On the other hand, ATPG4 ox- 2, ATPG4 ox -5 and ATPG4 The ox- 7 variant line had distinct phenotypic characteristics in terms of productivity, such as individual size and silique yield, as compared to the plant senescence retardation, as compared to the Arabidopsis thaliana control (Con). These phenotypic characteristics of the mutant lines are judged to be due to the difference in the relative expression levels of the genes in the mutant lines as mentioned above. To prove this, the gene expression levels in each line were analyzed.

&Lt; Example 5-2 > Phenotype for delaying aging and increasing productivity Characteristic ATPG4 Overexpressing mutant ATPG4 Gene overexpression Degree analysis

As in Example 5-1, the phenotypic characteristics of delayed aging and productivity increase and ATPG4 In order to analyze the correlation with the relative overexpression of the gene, the expression pattern of the ATPG4 gene in the mutant 24 days after the cotyledon was examined. The results of using the specific primers of [Table 1] for the ATPG4 gene and the ACT gene used as a PCR positive control were shown in FIG.

It was confirmed that the expression of ATPG4 gene was increased in all 8 mutants compared with Arabidopsis wild type, and this fact proves that these mutants are overexpressed ATPG4 gene.

Interestingly, the aging delayed phenotype is a potent ATPG4 ox- 3, ATPG4 ox- 4 and ATPG4 The ox- 6 variants While the relative expression level of the gene ATPG4 high, ATPG4 having the phenotypic characteristics of productivity, such as the increased size of the object and silique production ox- 2, ATPG4 ox -5 and ATPG4 ox -7 mutants showed low relative expression of ATPG4 gene. Therefore, it is considered that the regulation of the expression level of this gene can arbitrarily develop crops having phenotypic characteristics of increase in productivity or aging delay of the plant.

Example 5-3 Synthesis of ATPG4 Overexpressing mutant ATPG4 Gene overexpression Analysis of Characteristics and Increase in Productivity

ATPG4 Overexpression mutant ATPG4 Gene overexpression The total seed weights of mutant lines were compared and analyzed with Arabidopsis wild type in order to more accurately analyze the characteristics of the degree and productivity increase.

ATPG4 ox- 3, ATPG4 ox- 4 and ATPG4 ox- 6 &lt; / RTI &gt; mutants, ATPG4 &lt; RTI ID = 0.0 &gt; ox- 2, ATPG4 ox- 5 and ATPG4 ox -7 mutants increased 1.7 times more in seed yield than Arabidopsis control, whereas ATPG4 ox- 3, ATPG4 ox- 4 and ATPG4 ox- 6 variants had an increase rate of less than 1.3-fold compared to the Arabidopsis control, and even ATPG4 ox- 6 mutants have a rather reduced rate (Fig. 16). Interesting fact is that the harvesting times of mutant lines with specific traits are not significantly different from the Arabidopsis control. This suggests that the productivity increase due to the overexpression of this gene can minimize the problems of harvesting time of crops due to the similar harvesting time of the control.

The result of Example 5 shows that the higher the degree of expression of APTG4 gene is, the stronger the aging delay characteristic of the plant is. Accordingly, the application of this gene shows that the application of the gene to plants or crops I think it will provide many advantages. In addition, the optimal range of APTG4 gene expression was strongly associated with plant productivity enhancement characteristics similar to those of the control. Therefore, applying a promoter capable of regulating expression of the gene (a relatively low expression promoter, an inducible promoter, an organ or a compound specific promoter, etc.) would provide a great advantage in the development of crops with increased productivity.

< Example  6> ATPG4  Overexpression Mutant  Characterization of stress

& Lt; Example 6-1 > ATPG4 Characterization of Overexpression Mutants on Drought Stress

Drought tolerance analysis of the overexpression mutant of ATPG4 gene showed that the drought was treated for 16 days after 30 days of germination and the change of total plant phenotypic change and the weight change of leaf per plant were compared to the drought tolerance And the degree of resistance to The results are shown in FIGS. 17 and 18. FIG. In the wild type Arabidopsis leaf, the yellowing phenomenon of leaf was rapidly progressed due to drought, and also the leaf weight was remarkably decreased by drought. On the other hand , overexpression mutant of ATPG4 gene showed that the greening of leaves was still proceeding in drought treatment, and the weight of leaves was much higher than that of wild type. This fact suggests that ATPG4 maximizes the water retention of plants even under drought stress and provides resistance to drought stresses of plants.

& Lt; Example 6-1 > ATPG4 Overexpressing mutant Characterization of H ₂ O ₂ stress

To investigate the resistance of ATPG4 overexpressing mutants to oxidative stress, 50 mM H ₂ O ₂ was added to 3 mM MES solution, and the leaves 3 and 4 25 days after germination were detached and placed in a floating state The chlorophyll content and photosynthetic efficiency were measured at 2 - day intervals to investigate the resistance to H ₂ O ₂ stress. It was confirmed that the ATPG4 overexpression mutant was delayed in the sulphation of the leaves and the reduction of the chlorophyll content and the photosynthetic efficiency compared with the Arabidopsis wild type (Figs. 19, 20 and 21). This fact implies that ATPG4 provides resistance to oxidative stress of plants.

Therefore, ATPG4 The genes are expected to provide many advantages in the development of stress tolerant crops by providing tolerance to drought and oxidative stress in plants.

<110> Genomince, Inc. <120> ATPG4 Protein Delaying Senescence and Providing Yield Increase          and Stress Tolerance in Plants, the Gene Encoding the Protein and          Those Uses <130> PP11-147-Genomine-APTG4 <160> 14 <170> Kopatentin 2.0 <210> 1 <211> 948 <212> DNA <213> Arabidopsis thaliana <400> 1 atggcgaatc catggtggac aggacaagtg aacctatccg gcctcgaaac gacgccgcct 60 ggttcctctc agttaaagaa accagatctc cacatctcca tgaacatggc catggactca 120 ggtcacaata atcatcacca tcaccaagaa gtcgataaca acaacaacga cgacgataga 180 gacaacttga gtggagacga ccacgagcca cgtgaaggag ccgtagaagc ccccacgcgc 240 cgtccacgtg gacgtcctgc tggttccaag aacaaaccaa agccaccgat cttcgtcact 300 cgcgattctc caaatgctct caagagccat gtcatggaga tcgctagtgg gactgacgtc 360 atcgaaaccc tagctacttt tgctaggcgg cgtcaacgtg gcatctgcat cttgagcgga 420 aatggcacag tggctaacgt caccctccgt caaccctcga ccgctgccgt tgcggcggct 480 cctggtggtg cggctgtttt ggctttacaa gggaggtttg agattctttc tttaaccggt 540 tctttcttgc caggaccggc tccacctggt tccaccggtt taacgattta cttagccggt 600 ggtcaaggtc aggttgttgg aggaagcgtg gtgggcccat tgatggcagc aggtccggtg 660 atgctgatcg ccgccacgtt ctctaacgcg acttacgaga gattgccatt ggaggaggaa 720 gaggcagcag agagaggcgg tggtggaggc agcggaggag tggttccggg gcagctcgga 780 ggcggaggtt cgccactaag cagcggtgct ggtggaggcg acggtaacca aggacttccg 840 gtgtataata tgccgggaaa tcttgtttct aatggtggca gtggtggagg aggacagatg 900 agcggccaag aagcttatgg ttgggctcaa gctaggtcag gattttaa 948 <210> 2 <211> 315 <212> PRT <213> Arabidopsis thaliana <400> 2 Met Ala Asn Pro Trp Trp Thr Gly Gln Val Asn Leu Ser Gly Leu Glu   1 5 10 15 Thr Pro Pro Gly Ser Ser Gln Leu Lys Lys Pro Asp Leu His Ile              20 25 30 Ser Met Asn Met Ala Met Asp Ser Gly His Asn Asn His His His          35 40 45 Gln Glu Val Asp Asn Asn Asn Asn Asp Asp Asp Arg Asp Asn Leu Ser      50 55 60 Gly Asp Asp His Glu Pro Arg Glu Gly Ala Val Glu Ala Pro Thr Arg  65 70 75 80 Arg Pro Arg Gly Arg Pro Ala Gly Ser Lys Asn Lys Pro Lys Pro Pro                  85 90 95 Ile Phe Val Thr Arg Asp Ser Pro Asn Ala Leu Lys Ser His Val Met             100 105 110 Glu Ile Ala Ser Gly Thr Asp Val Ile Glu Thr Leu Ala Thr Phe Ala         115 120 125 Arg Arg Arg Gln Arg Gly Ile Cys Ile Leu Ser Gly Asn Gly Thr Val     130 135 140 Ala Asn Val Thr Leu Arg Gln Pro Ser Thr Ala Ala Val Ala Ala Ala 145 150 155 160 Pro Gly Gly Ala Ala Val Leu Ala Leu Gln Gly Arg Phe Glu Ile Leu                 165 170 175 Ser Leu Thr Gly Ser Phe Leu Pro Gly Pro Ala Pro Pro Gly Ser Thr             180 185 190 Gly Leu Thr Ile Tyr Leu Ala Gly Gly Gln Gly Gln Val Val Gly Gly         195 200 205 Ser Val Val Gly Pro Leu Met Ala Ala Gly Pro Val Met Leu Ile Ala     210 215 220 Ala Thr Phe Ser Asn Ala Thr Tyr Glu Arg Leu Pro Leu Glu Glu Glu 225 230 235 240 Glu Ala Ala Glu Arg Gly Gly Gly Gly Gly Gly Ser Gly Gly Val Val Pro                 245 250 255 Gly Gln Leu Gly Gly Gly Gly Ser Pro Leu Ser Ser Gly Ala Gly Gly             260 265 270 Gly Asp Gly Asn Gln Gly Leu Pro Val Tyr Asn Met Pro Gly Asn Leu         275 280 285 Val Ser Asn Gly Gly Ser Gly Gly Gly Gly Gln Met Ser Gly Gln Glu     290 295 300 Ala Tyr Gly Trp Ala Gln Ala Arg Ser Gly Phe 305 310 315 <210> 3 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 3 ttaattaaat ggcgaatcca tggtggacag 30 <210> 4 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 4 tctagattaa aatcctgacc tagcttgagc 30 <210> 5 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 5 ctcgcgattc tccaaatgct 20 <210> 6 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 6 gctagggttt cgatgacgtc agt 23 <210> 7 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 7 atggccgatg gtgaggatat tc 22 <210> 8 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 8 caccagcaaa accagccttc 20 <210> 9 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 9 ccgaggactt gctttacccc 20 <210> 10 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 10 aactcagcga aggcctctgg 20 <210> 11 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 11 cgtcgatgac acacccatta gag 23 <210> 12 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 12 catcggcttg ttctttggaa ac 22 <210> 13 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 13 acgattttgg ctgcgaagg 19 <210> 14 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 14 tcagttgtca agccgccag 19

Claims (17)

delete delete (a) inserting a gene encoding the amino acid sequence set forth in SEQ ID NO: 2 into an expression vector operably linked to a regulatory sequence capable of overexpressing it;
(b) transforming the expression vector into a plant, and
(c) selecting a plant having a phenotype with delayed senescence.
The method of claim 3,
Wherein the gene is a gene having the nucleotide sequence of SEQ ID NO: 1.
(a) inserting a gene encoding the amino acid sequence set forth in SEQ ID NO: 2 into an expression vector operably linked to a regulatory sequence capable of overexpressing it;
(b) transforming the expression vector into a plant, and
(c) selecting a plant having a phenotype phenotype with increased productivity.
6. The method of claim 5,
Wherein the gene is a gene having a nucleotide sequence as set forth in SEQ ID NO: 1.
(a) inserting a gene encoding the amino acid sequence set forth in SEQ ID NO: 2 into an expression vector operably linked to a regulatory sequence capable of overexpressing it;
(b) transforming the expression vector into a plant, and
(c) selecting a plant resistant to oxidative stress or drought stress, wherein the plant is resistant to oxidative stress or drought stress.
8. The method of claim 7,
Wherein the gene is a gene comprising the nucleotide sequence of SEQ ID NO: 1, wherein the gene is resistant to oxidative stress or drought stress.
(a) inserting a gene encoding the amino acid sequence of SEQ ID NO: 2 into an expression vector operatively linked to a regulatory sequence capable of overexpressing it; and
(b) transforming the expression vector into a plant.
A method for delaying plant senescence.
10. The method of claim 9,
Wherein said gene is a gene comprising the nucleotide sequence of SEQ ID NO: 1.
(a) inserting a gene encoding the amino acid sequence of SEQ ID NO: 2 into an expression vector operatively linked to a regulatory sequence capable of overexpressing it; and
(b) transforming the expression vector into a plant.
A method for increasing plant productivity.
12. The method of claim 11,
Wherein the gene is a gene comprising the nucleotide sequence of SEQ ID NO: 1.
(a) inserting a gene encoding the amino acid sequence of SEQ ID NO: 2 into an expression vector operatively linked to a regulatory sequence capable of overexpressing it; and
(b) transforming the expression vector into a plant.
A method of increasing tolerance to oxidative or drought stress in plants.
14. The method of claim 13,
Wherein the gene is a gene comprising the nucleotide sequence of SEQ. ID. NO. 1, wherein the resistance to oxidative stress or drought stress of the plant is increased.
A transgenic plant having an aging-delay characteristic by introducing and overexpressing a gene encoding the amino acid sequence of SEQ ID NO: 2.
A transgenic plant having productivity-enhancing characteristics by introducing and overexpressing a gene encoding the amino acid sequence of SEQ ID NO: 2.
Wherein the gene encoding the amino acid sequence of SEQ ID NO: 2 is introduced and overexpressed, thereby being resistant to oxidative stress or drought stress.

Images