KR20140118291A - Novel Pleurotus eryngii var. ferulae Strain P49AB64 - Google Patents

Abstract

The present invention relates to Pleurotus eryngii var. ferulae, and more specifically to a new Pleurotus eryngii var. ferulae strain descended from DDL01 (accession number: KACC93085P), which is gained by selecting previously-known Pleurotus eryngii var. ferulae strains, and cross-breeding the selected strains and Pleurotus eryngii var. ferulae DDL01 (accession number: KACC93085P); and to a fruit body gained through cultivating the new strain.

Description

Pseudomonas aeruginosa strain P49AB64 {Novel Pleurotus eryngii var. ferulae Strain P49AB64}

(KACC93085P) obtained by cross-breeding a selected strain of aviforme mushroom strain and a strain selected from the previously known strains and an avirulent mushroom strain DDL01 (accession number: KACC93085P), and more particularly, And a fruiting body obtained through cultivation of the strain.

It is classified as Pleurotus eryngii var. Ferulae (Pleurotus eryngii var. Ferulae) or Pleurotus ferulae (Pleurotus ferulae) of pleurototaceae. Because it is wild in the arid tree of Xinjiang province of China, which is a dry area, it is called "

Research on artificial cultivation began in 1958 in India, France and Germany. In 1958, Kalmer was the first to succeed in artificial cultivation. In 1983, artificially cultivated artificial cultivation of sawdust, cottonseed, and bran in China. (1990), which has been widely used in Fujian Province and Sinjangseong Province (Dong-hee, 2005) and secures excellent strains by crossing monocotyledonous mushroom (Hong Gi-hyung, 2004).

As for the morphological characteristics of the fruiting body of the eggplant mushroom, it is 15-100 mm in size and 20-50 mm in the optimum. It is hemispherical at the beginning, the end of the egg is curved inward, and when it grows, it becomes semi-spherical, used flat or flat It spreads. The optimum is hemispherical. The surface is smooth. In the younger period, it is gray (5D2, brownish gray, Methuen Handbook of Color) and grows to grayish orange (5B3, greyish orange). When it is wet, it becomes hygroscopic. The tissue is soft and resilient, meaty and milky. Taste is sweet and has an aroma similar to that of sugarcane. Especially when you chew chewy texture is very good. The wrinkles are wrinkles on the stool, 15-35 × 1-3 mm, 4-shape, and somewhat dense. It is milky white at the beginning and 4A2 (yellowish white) when it grows. The wrinkle blade is smooth. The size of the pedestal is 50-150 × 15-35㎜, the optimum is a cylindrical form of 15-40 × 70-90㎜, and the base side is somewhat thick or swollen. The surface is milky white and the surface is smooth. There is a car inside. It is very strong in the longitudinal direction and thinly torn in the lateral direction. The color of the spores is white. The spores are cylindrical with a size of 5 ~ 6 × 7 ~ 9㎛. The volcano is 24-39 × 5-7 μm long and has a long club style, mostly 4-spore type, with a clamp on the base. The size of the epidermidis is 25-35 × 5-8 μm, with club, fusiform, clublike fusiform shape. Generally, there are 1-3 rhyolitic projections at the top, and the cell wall is thin and colorless. There is no sidesteadia. The fascial layer structure is parallel mycelial-crossover type and is the first mycelial tissue type and there is a clamp on the diaphragm of mycelia

It is known that Ai outerium mushrooms having such morphological characteristics are superior in morphology and rich in flavor compared with other mushrooms, and have high anti-tumor and hypoglycemic effect while having high edible value (Hong et al., 2004). In addition, it has been known that the medicinal efficacy of controlling gynecologic diseases by stopping stomach and kidney disorders and coughs and eliminating inflammation is known (Kim Dae-sik, 2002), and also contains a large amount of dietary fiber, amino acid and other vitamins, Its value as medicinal mushroom is high. Recently, it has been studied in Korea since 2001 due to its high popularity as an edible mushroom in Korea. However, it has not been commercialized since 2001, and it has been confirmed by the Applicant that DDU01 (Accession No. KACC93085P) Is currently being commercialized and sold.

The mushroom DDU01 (accession number: KACC93085P) is short in cultivation period, has good taste and shape, and has high commerciality.

However, in order to create higher added value in the United States, the world's largest consumer of edible mushroom DDL01, the US consumers are more likely to appreciate the closer the surface color of fresh fruit bodies is to white, Lt; / RTI > need to be developed. As shown in FIG. 1, as shown in the photograph of a fruiting body in which a commercially-available Pleurotus eryngii var. Ferulae DDL01 (KACC93085P) strain was grown, the avirulent mushroom DDL01 is at least 4 to 5 It is possible to walk about a degree. As described above, the mushroom DDL01 is not suitable for roasting because it is not large in size, and thus it is difficult to use it in baking during mushroom recipe.

Therefore, in order to create a higher added value than A. zucchini mushroom DDL01, it was necessary to develop a newly improved strain in morphological characteristics such that the fresh surface color of fruiting body is close to white as well as suitable for roasting.

The inventors of the present invention have completed the present invention by succeeding in the study of the above-mentioned problems, and succeeded in breeding of the A. avirifolius mushroom strain which is not only white in color but also suitable for roasting, with the strain DDL01 (KACC93085P).

Therefore, the object of the present invention is to provide a mushroom syrup, which is suitable for roasting thicker than twice the DDL01 mushroom syrup, that is, the mushroom sack, that is, the mushroom sash such that the surface color of the mash body is more whitish and the wavy wrinkled wrinkles are formed (Accession No .: KACC93173P) and a strain obtained from the strain of DDU01 (KACC93085P) strain having the genus Pseudomonas sp.

Another object of the present invention is to provide a novel strain P49AB64, which is obtained by crossing the new strain P49AB64 with the new strain P49AB64 at a constant interval in the culture medium, To obtain a fruit body obtained through cultivation.

The objects of the present invention are not limited to the above-mentioned objects, and other objects not mentioned can be clearly understood by those skilled in the art from the following description.

In order to achieve the above-mentioned object of the present invention, first, the present invention provides a novel strain, aviator mushroom P49AB64 (accession number: KACC93173P). The strain was deposited on March 26, 2013 at the Korean Society for Microbiological Protection (Accession No .: KACC93173P).

In a preferred embodiment, the new strain is obtained by crossing a single sporozoite isolated from the fruiting body of a fungus strain other than the monocotyledonospora mushroom strain DDL01 isolated from the fruiting body of the aviforme mushroom strain DDL01 (accession number: KACC93085P) .

In a preferred embodiment, when the new strain is inoculated and inoculated on a culture medium at regular intervals, no replacement line is formed.

In a preferred embodiment, it is produced by single-spore culture of a mycelium culture of the above-mentioned new strain, avian oyster mushroom P49AB64, or a somatic cell subculture of a strain derived therefrom, or by multiplication or somatic cell sorting by multi-spore culture.

The present invention also provides an agar oyster fruiting body formed from any one of the strains described above.

In a preferred embodiment, the weight of the flesh body is 2 to 5 times thicker than the weight of the fruiting body of the agaricus mushroom DDL01, and a wavy streamlined wrinkle is formed from the gut to a certain portion of the body.

In addition, the present invention provides a spore obtained from the above-described agar oyster fruiting body.

In addition, the present invention relates to a P49AB64 family of avian oyster mushroom strain, which is obtained by the above-mentioned spore-mating or the above-mentioned spore and the above-mentioned one of the novel strains of the avian oyster mushroom P49AB64, to provide.

In a preferred embodiment, a replacement line is not formed when the culture is inoculated by inoculating the new strain, Pyridoxylum pentosulphate P49AB64, at a predetermined interval, respectively.

In addition, the present invention provides an agar oyster fruiting body formed from the above-mentioned P49AB64 family of aviforce mushroom strains.

In a preferred embodiment, the fulcrum body is formed from a wig to a certain portion of the base in the form of a wavy streamlined wrinkle.

The present invention has the following excellent effects.

That is, according to the present invention, it is possible to obtain a new strain of aviflora mushroom, which is a strain of DDL01 (KACC93085P) strain having a morphological characteristic that can induce a favorable feeling of consumers than a commercialized strain DDL01 (KACC93085P), and a fruiting body Can be provided.

In addition, the new strains and fruiting bodies of the present invention are more suitable for roasting than the mushroom sack, i.e., Daewoi Aituteri mushroom DDL01, which is thicker in color, and the surface color of the fruiting bodies is more whitish in color, and the wavy wrinkled wrinkles And thus has excellent quality and merchantability.

The present invention also relates to a method for producing a P49AB64 strain of avian oyster mushroom strain, which is obtained by crossing the new strain P49AB64 and crossing the fresh strain P49AB64 at a constant interval on the culture medium, Can be provided.

Fig. 1 is a photograph of a fruit body cultivated with a commercialized strain of Pleurotus eryngii var. Ferulae DDL01 (KACC93085P).
Fig. 2 is a photograph of a fruit body cultivated with a new strain of avifolium mushroom strain P49AB64 (accession number: KACC93173P) according to an embodiment of the present invention.
FIG. 3 shows the systematic relationship of the new strain of avian oyster mushroom P49AB64 (accession number: KACC93173P) according to the present invention by the UPGMA method.

Although the terms used in the present invention have been selected as general terms that are widely used at present, there are some terms selected arbitrarily by the applicant in a specific case. In this case, the meaning described or used in the detailed description part of the invention The meaning must be grasped.

Hereinafter, the technical structure of the present invention will be described in detail with reference to the accompanying drawings and preferred embodiments.

However, the present invention is not limited to the embodiments described herein but may be embodied in other forms. Like reference numerals used to describe the present invention throughout the specification denote like elements.

The technical feature of the present invention is that DDL01, which is commercialized, is not only white in color, but also has a thickness larger than that of A. manganese DDL01, so that DDL01 (KACC93085P) strain, and a fruiting body obtained through cultivation of the strain.

As a result, the fruiting body formed from the new strain of Aeweiteri mushroom according to the present invention was thicker than 2 times and more than 5 times larger than the commercialized aviatorium mushroom DDL01, and the color of the mushroom shade was more whitish than that of commercialized A. The wrinkled wrinkles are formed in a wavy shape.

Among the known strains of A. niger mushroom strain according to the present invention, among the known strains of A. niger mushroom strain, P7330W, a single spore strain of DDL01 (KACC93085P) and DAC7421, In the experiment, it was used as a representative strain of crossbred breeding.

Example 1. Breeding of a novel strain of avian oyster mushroom P49AB64

For the present invention, the spore strains P7330W and DAC7421 of DDL01 (KACC93085P) were used as the parent strains among the strain strains of the Institute of Agricultural Biotechnology,

(1) Isolation of monospore

After dropping the mushroom on the Petri dish with the wrinkles of the mushroom pointing downward, the mushroom spores of the mushroom strain DDL01 and DAC7421 were removed by dropping method. After 24 hours, the mushroom spores Were diluted to an appropriate concentration through sterilized water and plated on a potato agar medium and cultured at 25 ° C. The first germination germinated from 7 days after cultivation was separated by toothpick, and each primary mycelium was inoculated again on potato agar medium. The inoculated potato agar broth was incubated at 25 ℃ for 14 days. The mycelium was partially removed, and the presence or absence of the clamp was confirmed by a microscope. Only the mycelium with no clamp was put in a 10% glycerol solution and used for the test.

(2) Crossing

Mating of monocotyledonous (monocotyledonous) mycelia and monocotyledonous (mycorrhizal) hyphae of hybrids of each of the different Aeweuteri mushroom strains isolated from each other and hyphae of monocotyledonous hyphae and hyphal mycelium . Each of them was inoculated on a potato agar medium and cultured at 25 ° C for 14 days. Only those with good growth and high mycelium were selected for crossing breeding. Mycelium grown on a potato agar medium was cut into 1 cm round size, and each mycelium block was replaced with a new potato agar medium petri dish at intervals of 3 cm to perform crossing breeding. The inoculated potato agar medium petri dish was incubated at 25 ℃ for 21 ~ 28 days. Mycelia were removed and examined with a microscope to isolate strains which were clamped on the mycelial block side of mononuclear cells.

(3) Crossbreeding Cultivation Test

Concon: Bran was mixed at a ratio of 8: 2 to adjust the water content to 65%. 580g of the mixture was put into a 850cc mushroom cultivation bottle, and the mixture was pierced to the bottom with a 2 cm rod and sterilized at 121 ° C for 60 minutes. After cooling to 20 캜 after sterilization, the selected strain was inoculated and cultured in the dark state at 24 캜 for 30 days. After completion of the cultivation, bacterial scratching was carried out, and cultivation tests such as foot and growth were carried out at 14 to 18 ° C, 80 to 95% in humidity and 100 to 200 lux at the illuminance.

(4) Screening of new strain P4A6464

The crossbreds of DDL01 (KACC93085P), which has the characteristics of inducing the coloration of the fruit body gland to the whitish color, were cross-tested with the sporophytes of the DAC7421 strain and tested for mycelial growth and cultivation A good breeder was selected and named as P49AB64, and deposited on March 26, 2013 with the Korean Society for Microbiological Protection (Accession No .: KACC93173P).

Experimental Example 1. Mycological characteristics of novel crossbred strain P49AB64

The mycological characteristics of the novel crossbred strain P49AB64 obtained in the examples were investigated as follows.

1) Growth condition (25 占 폚) on potato dextrose agar (PDA) medium: the diameter of the colonies on the 7th day is 42.0 mm. Mycelium is dense with white, and the amount of air hypha grows normally and linearly.

2) Growth condition (25 캜) on mushroom complex agar (MCM) medium: Colony diameter at the 7th day is 45.2 mm. Mycelium is dense with white, and the amount of air hypha grows normally and linearly.

3) Growth condition (25 ° C) on mycological agar (MA) medium: The colony diameter on the 7th day is dense with 43.0 mm hypha, and the amount of air hyphae grows normally linearly.

4) Growth condition (25 ° C) on the agar medium (CMA): The colony diameter on the 7th day is 37.5 mm. Mycelium is very thin in white, and the amount of air hypha is very small and grows linearly.

5) Growth condition (25 占 폚) on a medium of SDA broth: The diameter of colonies on the 7th day is 35.5 mm. Mycelium is dense with white, and the color of mycelium is partially reddish yellow in the latter period. The amount of mycelium in the air is usually linear.

6) Optimum temperature of mycelial growth: 5 mm diameter seedlings were inoculated on the PDA medium, cultured at each temperature zone, and 7 days later, the optimum temperature for mycelial growth was around 26 ° C.

7) Optimum pH of mycelial growth: 25 ml of glucose-peptone-yeast extract liquid medium was sterilized, adjusted to each pH, inoculated with seed bacterium, allowed to stand at 25 ° C for 12 days, The optimum pH for mycelial growth was around 6.0 to 6.5.

Experimental Example 2. Genetic characteristics of novel crossbred strain P49AB64

In order to investigate the genetic characteristics of the strains obtained in the Examples, it is known that when the strains of the hyphae are different, hyphae are different hyphae, Adult maturation was performed by confluent culture. The seeds were inoculated with each other at intervals of 3 centimeters on a potato dextrose agar medium and incubated at 25 ° C for 14 to 21 days, and it was judged whether or not an election would occur at the boundary between the two colonies The results are shown in Table 1.

Herein, the strains 1 and 2 (strains 1 and 2), which are P49AB64 as the mother strain, are strains obtained by a single-spore hybridization between spores obtained from the fruiting body of the novel strain Pyralidae P49AB64, and the strains 3 3) is a strain obtained by crossing of the spore obtained from the fruiting body of the new strain Pseudomonas aeruginosa P49AB64 and the new parent strain Pseudomonas aeruginosa P49AB64.

 Strains P49AB64 Mycobacteria 1 Mycobacteria 2 Mycobacteria 3 P.nebrodensis (China) + + + + P.nebrodensis (Empress mushroom) + + + + P. ferulae var. Fuscus (KCTC 26065) + + + + P. eryngii (cultivated) + + + + P.ferulae (China) + + + + P. eryngii var. Ferulae (DAC 7322) + + + + P. eryngii var. Ferulae (DAC 7421) + + + + P. eryngii var. Ferulae (DDL01) + + + + P48-24s + + + + P49AB64 - - - - P49AB64 as a mother strain 1 - - - - P49AB64 as a mother strain 2 - - - - P49AB64 as a mother strain 3 - - - -

Experimental Example 3. Molecular Biological Identification of New Crossbred P49AB64

(1) Determination of the nucleotide sequence of the ITS region

ITS1 (TCCGTAGGTGAACCTGCGG; SEQ ID NO: 1) / ITS4 (TCCTCCGCTTATTGATATGC; SEQ ID NO: 1) was used to amplify an internal transcribed ITS (Internal Transcribed Spacer) by PCR using a bead beating method from a culture medium. 2) were amplified using the primer sets, respectively, and then subjected to sequencing by the Macrogen Co. (SEQ ID NO: 3) through purification.

> 49AB64

TGGGAAGGATCATTAATGAATTCACTATGGAGTTGTTGCTGGCCTCTAGGGGCATGTGCACGCTTCACTAGTCTTTCAACCACTTGTGAACTTTTGATAGATCTGTGAAGTCGTCTCTCAAGTCGTTAGACTTGGTTTGCTGGGATGTAAACGTCTCGGTGTGACTACGCAGTCTATTTACTTATAACACCCCAAATGTATGTCTACGAATGTCATTTAAAGGGCCTTGTGCCTATAAACCATAATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTTGAGTGTCATTAAATTCTCAAACTCACTCTGGTTTTTCCAATTGTGATGTTTGGATTGTTGGGGGCTGCTGGCCTTGACAGGTCGGCTCCTCTTAAATGCATTAGCAGGACTTCTCATTGCCTCTGCGCATGATGTGATAATTATCACTCATCAATAGCACGCATGAATAGAGTCTGGCTCTCTAACCGTCCGCAAGGACAATTTGACAATTTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAG

(2) Analysis of genetic characteristics

After genomic analysis of the two gene sequences, BLAST searches for the most similar genomic sequences and genetic analysis.

All sequences were sequenced using ClustalW2 (Multiple Sequence Alignment). Based on this, the evolutionary distance was calculated by Bayesian MCMC run using MrBayes version 3.1 program, and the molecular chemical relationship by the maximum likelihood method is shown in Fig. 3 . The boot-strapping value is 1000. Based on this, similarities and final identifications were made. As a result, Pleurotus eryngii var. Ferulae ( Pleurotus eryngii var. Ferulae ) It was identified as mushroom.

Experimental Example 4: Cultivation of new cross breeder P49AB64

1. Preparation of badge

The medium was mixed with Concon: Bran = 8: 2 (volume ratio, 40-50 g / 850 cc standard). Followed by stirring and mixing to adjust the final medium water content to 68-70%.

2. Filling

The filling amount of the medium was filled to 850 cc bottles to 480-520 g (content amount).

3. Sterilization

The high-pressure sterilization is carried out for 60 minutes (effective sterilization time) after the temperature reaches 120 ° C in the medium, and 90 minutes (850cc bottle) when the sterilization pot temperature is standard.

4. Cooling

Under a clean environment, the culture medium was cooled until the culture medium temperature became 20 DEG C or lower.

5. Inoculation

The inoculum amount of seed bacterium was inoculated as standard of about 15cc per one bottle.

6. Culture management

The temperature was maintained at 18 占 폚 for 25 days, followed by aging at 23 占 폚 for 8 to 10 days. Humidity was maintained at 60 ~ 70% for the electric culture and 70 ~ 80% for the later culture, and the carbon dioxide concentration was controlled at 3,000 ppm or less. Light intensity is controlled by dark culture, and period is 30 days.

7. Scraping bacteria

Scraping of 15 ~ 20mm was performed for the purpose of suppressing the number of germination.

8. Foot Care

The temperature was controlled at 14-15 ° C, and the humidity of the electric foot was controlled for 3-5 days at 90-95% and 70-80% for the latter 3-5 days. The carbon dioxide concentration was controlled to be less than 1,000 ppm, and the light intensity was managed only at the daytime. For 5 to 8 days. When young mushroom was grown about 15mm from the late feet, it was turned upside down and maintained its growth condition.

9. Growth management

In order to synchronize the size of the young mushrooms formed on the entrance surface of the cultivation bottle, the temperature was controlled at 13-14 ° C so as not to rise above 16 ° C. The first 3 days were managed at 15 ° C. Humidity was controlled by 70-95%, and the humidity / humidity crossing was managed to a large extent. After germination confirmation, it was returned to the established state and maintained for 5-8 days. Immediately after being returned to the formulation, care should be taken in the early stage of growth to take into account the humidity conditions caused by dehumidification with low temperature control.

10. Harvest

Mushroom gods were harvested in the state of a product with a roundish shape.

As a result of cultivating and harvesting the new avian oyster mushroom strain P49AB64 obtained in the example as described above, the strain of the agaricus mushroom DDL01 (KACC93085P) was maintained as shown in the photograph shown in Fig. 2, And the color of the mushroom shrub is more whitish than that of the mushroom shrub. In particular, it has a morphological characteristic that wavy wrinkled wrinkles are formed from the shrub to a certain part of the shrub.

In addition, somatic and tissue culture selection, cell spore selection and Pleurotus eryngii var. eryngii, Pleurotus eryngii var. ferulae, Pleurotus eryngii var. By various means including hybridization with nebrodensis, a variety of strains can be developed from P49AB64 and the hybrid strains produced can be screened for the commercial characteristics required in the market.

For example, a variety of P49AB64 strains of A. aviforme mushroom strain have been used for the proliferation or somatic cell sorting by the single-spore culture method or the multi-spore culture method of the mycelial culture of the new strain Pseudomonas aeruginosa P49AB64 or the somatic cell subculture of the strain developed therefrom Lt; / RTI >

In particular, the P49AB64 strain of the avian oyster mushroom strain obtained by the spore-mating crosses between the spores obtained from the fruiting body of the new strain Aiu oyster mushroom P49AB64 or the rhizomes of the spores and the new strain pseudo-oyster mushroom P49AB64, As can be seen, genetic characteristics are similar to that of the new strain Pseudomonas aeruginosa P49AB64, and the morphological characteristics of fruiting bodies are also found in many wavy wrinkles, small differences, and / or long or short differences, It is similar in that wrinkles are formed.

While the present invention has been particularly shown and described with reference to exemplary embodiments thereof, it is clearly understood that the same is by way of illustration and example only and is not to be taken by way of limitation, Various changes and modifications will be possible.

Agricultural Biotechnology Research Institute KACC93173 20130326

Claims (10)

The new strain Pseudomonas mushroom P49AB64 (Accession No .: KACC93173P).
The method according to claim 1,
Wherein the new strain is obtained by crossing monocotyledonous fungi isolated from the fruiting bodies of the fungus of the genus Acanthopanax senticosus except for the monocotyledonous fungus isolated from the fruiting body of the aviforme mushroom strain DDL01 (Accession No .: KACC93085P) and DDL01 of the avirulent mushroom strain New strain.
The method according to claim 1,
Wherein the new strain is inoculated on the culture medium at a predetermined interval to replace the new strain, and no replacement line is formed.
An agate oyster fruiting body formed from the strain of any one of claims 1 to 3.
5. The method of claim 4,
Wherein the flesh body has a thickness of 2 to 5 times thicker than that of the fruiting body of the agaricus mushroom DDL01, and a wavy streamlike wrinkle is formed from the gut to a certain part of the body.
4. The spore obtained from the fruiting body of an agar mushroom of claim 4.
Wherein the spore of the spore of step 6 or the spore of claim 7 and the novel strain of avian oyster mushroom P49AB64 of any one of claims 1 to 3, Mushroom strain.
8. The method of claim 7,
The P49AB64 strain of the oyster mushroom strain is characterized in that no replacement line is formed when the new strain is inoculated to the culture medium at a constant interval from the new strain Aiuteritari mushroom P49AB64.
A fried eggplant mushroom body formed from the strain of claim 7.
10. The method of claim 9,
Wherein the fruiting body is formed from a wig to a certain part of the base to form a wavy streamlike wrinkle.

Images