KR20140118291A - Novel Pleurotus eryngii var. ferulae Strain P49AB64 - Google Patents
Novel Pleurotus eryngii var. ferulae Strain P49AB64 Download PDFInfo
- Publication number
- KR20140118291A KR20140118291A KR1020130033915A KR20130033915A KR20140118291A KR 20140118291 A KR20140118291 A KR 20140118291A KR 1020130033915 A KR1020130033915 A KR 1020130033915A KR 20130033915 A KR20130033915 A KR 20130033915A KR 20140118291 A KR20140118291 A KR 20140118291A
- Authority
- KR
- South Korea
- Prior art keywords
- strain
- mushroom
- p49ab64
- ddl01
- new
- Prior art date
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N1/00—Microorganisms, e.g. protozoa; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
- C12N1/14—Fungi; Culture media therefor
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01G—HORTICULTURE; CULTIVATION OF VEGETABLES, FLOWERS, RICE, FRUIT, VINES, HOPS OR SEAWEED; FORESTRY; WATERING
- A01G18/00—Cultivation of mushrooms
- A01G18/40—Cultivation of spawn
Landscapes
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Engineering & Computer Science (AREA)
- Health & Medical Sciences (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Genetics & Genomics (AREA)
- Biotechnology (AREA)
- Organic Chemistry (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Mycology (AREA)
- Microbiology (AREA)
- Biomedical Technology (AREA)
- Botany (AREA)
- Virology (AREA)
- Tropical Medicine & Parasitology (AREA)
- Biochemistry (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Medicinal Chemistry (AREA)
- Environmental Sciences (AREA)
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
Description
본 발명은 아위느타리버섯에 대한 것으로, 보다 구체적으로는 종래 알려진 아위느타리버섯 균주들을 선발한 후 선발된 균주와 아위느타리버섯 균주 DDL01(기탁번호 : KACC93085P)를 교배 육종하여 얻어진 DDL01(KACC93085P)의 계통을 이은 아위느타리버섯 신균주 및 그 균주의 재배를 통해 얻어지는 자실체에 관한 것이다.
(KACC93085P) obtained by cross-breeding a selected strain of aviforme mushroom strain and a strain selected from the previously known strains and an avirulent mushroom strain DDL01 (accession number: KACC93085P), and more particularly, And a fruiting body obtained through cultivation of the strain.
아위느타리버섯은 큰느타리버섯의 변종(Pleurotus eryngii var. ferulae) 또는 담자균류의 느타리버섯과(pleurototaceae) 느타리버섯속(pleurotus)의 독립된 종(Pleurotus ferulae)으로 분류 체계상 논란이 되고 있는 종으로서, 건조지대인 중국 신강지방의 아위나무에서 야생되기 때문에 아위느타리라고 불리게 되었다. It is classified as Pleurotus eryngii var. Ferulae (Pleurotus eryngii var. Ferulae) or Pleurotus ferulae (Pleurotus ferulae) of pleurototaceae. Because it is wild in the arid tree of Xinjiang province of China, which is a dry area, it is called "
아위느타리버섯은 1958년부터 인도, 프랑스, 독일 등에서 인공재배에 대한 연구가 시작되었고, 1958년 Kalmer가 처음으로 인공재배에 성공하였으며, 1983년 중국에서 톱밥, 면실피, 밀기울을 섞어 인공재배에 성공하였으며 1990년에는 단포자 교잡으로 우수한 균주를 확보하여 복건성, 신강성, 등지에서 광범위하게 사용되고 있으며(이동희, 2005), 세계적으로 년간 1,000톤 정도로 소량 생산되고 있는 버섯이다(홍기형, 2004). Research on artificial cultivation began in 1958 in India, France and Germany. In 1958, Kalmer was the first to succeed in artificial cultivation. In 1983, artificially cultivated artificial cultivation of sawdust, cottonseed, and bran in China. (1990), which has been widely used in Fujian Province and Sinjangseong Province (Dong-hee, 2005) and secures excellent strains by crossing monocotyledonous mushroom (Hong Gi-hyung, 2004).
아위느타리버섯 자실체의 형태적 특성을 살펴보면, 갓은 크기가 15-100㎜, 최적은 20-50㎜이며 초기에는 반구형이고, 갓 끝은 안쪽으로 굽어 있으며, 성장하면 반반구형, 중고편평형 또는 편평하게 펴진다. 최적은 반구형이다. 표면은 평활하다. 어린 시기에는 갈회색(5D2, brownish grey, Methuen Handbook of Color)을 띠고, 성장하면 회황색(5B3, greyish orange)을 띤다. 습할 때 흡습성이나 건조하면 건변색현상이 일어난다. 조직은 부드럽고 탄력성이 있는 육질형이며, 유백색이다. 맛은 달며, 사탕수수의 향과 유사한 향이 있다. 특히 씹을 때 아삭거리는 감촉이 매우 좋다. 주름살은 대에 내린주름살이고, 15-35× 1-3㎜이며, 4-가지형이고, 다소 빽빽하다. 초기에는 유백색이나 성장하면 황백색(4A2, yellowish white)을 띤다. 주름살날은 평활하다. 대는 크기가 50-150 × 15-35㎜로 최적은 15-40 × 70-90㎜의 원통형이고, 기부쪽이 다소 굵거나 팽대해있다. 표면은 유백색을 띠며, 표면은 평활하다. 대 속은 차 있다. 대의 종방향으로는 매우 견고하고, 횡방향으로는 얇게 찢어진다. 포자의 색은 흰색이다. 포자는 크기가 5~6 X 7~9㎛로 원통형이다. 담자기는 크기가 24-39× 5-7㎛로 긴 곤봉형이며, 대부분 4-포자형이며, 기부에 클램프가 있다. 날시스티디아 크기가 25-35× 5-8㎛로 곤봉형, 방추형, 곤봉상방추형이며, 일반적으로 정단부에 1-3개의 뾰죽한 돌기가 있고, 세포벽은 얇으며, 무색이다. 측시스티디아는 없다. 자실층조직은 평행균사형-혼선형으로 제1균사조직형이며 균사의 격막에 클램프가 있다As for the morphological characteristics of the fruiting body of the eggplant mushroom, it is 15-100 mm in size and 20-50 mm in the optimum. It is hemispherical at the beginning, the end of the egg is curved inward, and when it grows, it becomes semi-spherical, used flat or flat It spreads. The optimum is hemispherical. The surface is smooth. In the younger period, it is gray (5D2, brownish gray, Methuen Handbook of Color) and grows to grayish orange (5B3, greyish orange). When it is wet, it becomes hygroscopic. The tissue is soft and resilient, meaty and milky. Taste is sweet and has an aroma similar to that of sugarcane. Especially when you chew chewy texture is very good. The wrinkles are wrinkles on the stool, 15-35 × 1-3 mm, 4-shape, and somewhat dense. It is milky white at the beginning and 4A2 (yellowish white) when it grows. The wrinkle blade is smooth. The size of the pedestal is 50-150 × 15-35㎜, the optimum is a cylindrical form of 15-40 × 70-90㎜, and the base side is somewhat thick or swollen. The surface is milky white and the surface is smooth. There is a car inside. It is very strong in the longitudinal direction and thinly torn in the lateral direction. The color of the spores is white. The spores are cylindrical with a size of 5 ~ 6 × 7 ~ 9㎛. The volcano is 24-39 × 5-7 μm long and has a long club style, mostly 4-spore type, with a clamp on the base. The size of the epidermidis is 25-35 × 5-8 μm, with club, fusiform, clublike fusiform shape. Generally, there are 1-3 rhyolitic projections at the top, and the cell wall is thin and colorless. There is no sidesteadia. The fascial layer structure is parallel mycelial-crossover type and is the first mycelial tissue type and there is a clamp on the diaphragm of mycelia
이러한 형태적 특성을 가진 아위느타리버섯은 다른 버섯에 비하여 형태가 우수하고 향미가 풍부하여 식용가치가 높으면서, 항종양, 혈당강하 작용을 하는 것으로 알려져 있다(홍 등 2004). 또한 위와 신장 장애 및 기침을 멎게 하고 염증을 제거하여 산부인과 종류의 병을 방제하는 의약적 효능이 알려져 있으며(김대식, 2002), 이외에도 식이섬유, 아미노산 및 기타 비타민 등을 다량함유하고 있어 건강식품 및 기능성 약용버섯으로서의 가치가 높다. 최근에 일본에서는 식용버섯으로 인기가 높아 생산이 급속히 증가되고 있으며, 우리나라에서는 2001년부터 꾸준히 연구되어 왔으나 상업화되지 못하다가 본 출원인에 의해 2009년 말에 개발된 아위느타리버섯 DDL01(기탁번호 : KACC93085P)이 현재 상업화 되어 판매되고 있는 상황이다. It is known that Ai outerium mushrooms having such morphological characteristics are superior in morphology and rich in flavor compared with other mushrooms, and have high anti-tumor and hypoglycemic effect while having high edible value (Hong et al., 2004). In addition, it has been known that the medicinal efficacy of controlling gynecologic diseases by stopping stomach and kidney disorders and coughs and eliminating inflammation is known (Kim Dae-sik, 2002), and also contains a large amount of dietary fiber, amino acid and other vitamins, Its value as medicinal mushroom is high. Recently, it has been studied in Korea since 2001 due to its high popularity as an edible mushroom in Korea. However, it has not been commercialized since 2001, and it has been confirmed by the Applicant that DDU01 (Accession No. KACC93085P) Is currently being commercialized and sold.
아위느타리버섯 DDL01(기탁번호 : KACC93085P)은 재배기간이 짧고, 맛과 형태가 우수하여 상품성이 높으며 병재배가 가능하여 상품화된 후 국내뿐만 아니라 일본, 미국 등에 수출하고 있는 상황이다.The mushroom DDU01 (accession number: KACC93085P) is short in cultivation period, has good taste and shape, and has high commerciality.
그런데, 미국수요자들이 자실체의 갓 표면 색깔이 백색에 가까울수록 호감을 보이고 있어, 세계 최대의 소비지인 미국에서 아위느타리버섯 DDL01 보다 더 높은 부가가치를 창출하기 위해서는 갓의 색택이나 다른 형태적 특징 등에서 새롭게 개량된 균주가 개발될 필요가 있었다. 또한 도 1에 도시된 바와 같이 상업화된 아위느타리버섯(Pleurotus eryngii var. ferulae) DDL01(KACC93085P) 균주가 재배된 자실체 사진에서 알 수 있듯이 아위느타리버섯 DDL01은 형태적으로 대가 굵지 않아 적어도 4개 내지 5개 정도를 발이 시킬 수 있다. 이와 같이 아위느타리버섯 DDL01은 대가 굵지 않으므로 구이용으로 적합하지 않게 되어 버섯의 조리법 중 구워서 먹는데 사용되기 어려운 문제점이 있었다. However, in order to create higher added value in the United States, the world's largest consumer of edible mushroom DDL01, the US consumers are more likely to appreciate the closer the surface color of fresh fruit bodies is to white, Lt; / RTI > need to be developed. As shown in FIG. 1, as shown in the photograph of a fruiting body in which a commercially-available Pleurotus eryngii var. Ferulae DDL01 (KACC93085P) strain was grown, the avirulent mushroom DDL01 is at least 4 to 5 It is possible to walk about a degree. As described above, the mushroom DDL01 is not suitable for roasting because it is not large in size, and thus it is difficult to use it in baking during mushroom recipe.
따라서, 아위느타리버섯 DDL01 보다 더 높은 부가가치를 창출하기 위해서 자실체의 갓 표면 색깔이 백색에 가까울 뿐만 아니라 구이용으로 적합하도록 형태적 특징 등에서 새롭게 개량된 균주가 개발될 필요가 있었다.
Therefore, in order to create a higher added value than A. zucchini mushroom DDL01, it was necessary to develop a newly improved strain in morphological characteristics such that the fresh surface color of fruiting body is close to white as well as suitable for roasting.
본 발명자들은 이러한 문제점을 해결하기 위하여 연구 노력한 결과 자실체의 갓 표면 색깔이 백색에 가까울 뿐만 아니라 구이용으로 적합한 DDL01(KACC93085P) 균주의 계통을 이은 아위느타리버섯 균주의 육종에 성공함으로써 본 발명을 완성하였다.The inventors of the present invention have completed the present invention by succeeding in the study of the above-mentioned problems, and succeeded in breeding of the A. avirifolius mushroom strain which is not only white in color but also suitable for roasting, with the strain DDL01 (KACC93085P).
따라서, 본 발명의 목적은 버섯 자루 즉 대가 아위느타리버섯 DDL01 보다 2배 이상 굵어 구이용으로 적합하고 자실체 갓 표면 색택이 보다 미백색이며 갓에서 자루의 일정부분까지 물결모양의 유선형주름살이 형성되는 형태적 특성을 가진 DDL01(KACC93085P) 균주의 계통을 이은 아위느타리버섯 신균주 P49AB64(기탁번호 : KACC93173P) 및 그 균주의 재배를 통해 얻어지는 자실체를 제공하는 것이다.Therefore, the object of the present invention is to provide a mushroom syrup, which is suitable for roasting thicker than twice the DDL01 mushroom syrup, that is, the mushroom sack, that is, the mushroom sash such that the surface color of the mash body is more whitish and the wavy wrinkled wrinkles are formed (Accession No .: KACC93173P) and a strain obtained from the strain of DDU01 (KACC93085P) strain having the genus Pseudomonas sp.
본 발명의 또 다른 목적은 신균주 P49AB64의 자간 단포자 교배를 통해 얻어져 상기 신균주 P49AB64와 일정간격을 두고 배지 상에서 대치배양 하였을 때 대치선이 형성되지 않는 P49AB64 계열의 아위느타리버섯 균주 및 그 균주의 재배를 통해 얻어지는 자실체를 제공하는 것이다.Another object of the present invention is to provide a novel strain P49AB64, which is obtained by crossing the new strain P49AB64 with the new strain P49AB64 at a constant interval in the culture medium, To obtain a fruit body obtained through cultivation.
본 발명의 목적들은 이상에서 언급한 목적들로 제한되지 않으며, 언급되지 않은 또 다른 목적들은 아래의 기재로부터 당업자에게 명확하게 이해될 수 있을 것이다.
The objects of the present invention are not limited to the above-mentioned objects, and other objects not mentioned can be clearly understood by those skilled in the art from the following description.
상술된 본 발명의 목적을 달성하기 위해, 먼저, 본 발명은 신균주 아위느타리버섯 P49AB64(기탁번호 : KACC93173P)를 제공한다. 상기 균주는 2013년 3월 26일자로 한국미생물보존센터에기탁되었다(수탁번호 : KACC93173P).In order to achieve the above-mentioned object of the present invention, first, the present invention provides a novel strain, aviator mushroom P49AB64 (accession number: KACC93173P). The strain was deposited on March 26, 2013 at the Korean Society for Microbiological Protection (Accession No .: KACC93173P).
바람직한 실시예에 있어서, 상기 신균주는 아위느타리버섯 균주 DDL01(기탁번호 : KACC93085P)의 자실체에서 분리한 단포자와 아위느타리버섯 균주 DDL01을 제외한 다른 아위느타리버섯 균주의 자실체에서 분리한 단포자를 교배하여 얻어진 다. In a preferred embodiment, the new strain is obtained by crossing a single sporozoite isolated from the fruiting body of a fungus strain other than the monocotyledonospora mushroom strain DDL01 isolated from the fruiting body of the aviforme mushroom strain DDL01 (accession number: KACC93085P) .
바람직한 실시예에 있어서, 상기 신균주를 일정 간격을 두고 배지 상에 각각 접종하여 대치배양하면 대치선이 형성되지 않는다.In a preferred embodiment, when the new strain is inoculated and inoculated on a culture medium at regular intervals, no replacement line is formed.
바람직한 실시예에 있어서, 상술된 신균주 아위느타리버섯 P49AB64의 균사 배양물 또는 이로부터 발육된 균주의 체세포 계대배양물의 단일-포자배양법 또는 다중-포자배양법에 의한 증식 또는 체세포 선별에 의해 생산된다. In a preferred embodiment, it is produced by single-spore culture of a mycelium culture of the above-mentioned new strain, avian oyster mushroom P49AB64, or a somatic cell subculture of a strain derived therefrom, or by multiplication or somatic cell sorting by multi-spore culture.
또한, 본 발명은 상술된 어느 하나의 균주로 형성된 아위느타리버섯 자실체를 제공한다.The present invention also provides an agar oyster fruiting body formed from any one of the strains described above.
바람직한 실시예에 있어서, 상기 자실체는 대의 굵기가 아위느타리버섯 DDL01의 자실체의 대보다 2배 내지 5배 굵고 갓으로부터 대의 일정부분까지 물결모양의 유선형주름살이 형성된다. In a preferred embodiment, the weight of the flesh body is 2 to 5 times thicker than the weight of the fruiting body of the agaricus mushroom DDL01, and a wavy streamlined wrinkle is formed from the gut to a certain portion of the body.
또한, 본 발명은 상술된 아위느타리버섯 자실체로부터 얻어지는 포자를 제공한다.In addition, the present invention provides a spore obtained from the above-described agar oyster fruiting body.
또한, 본 발명은 상술된 포자간에 이루어지는 단포자 교배 또는 상술된 포자와 상술된 어느 하나의 신균주 아위느타리버섯 P49AB64의 자모간 다이-모노 교배로 얻어진 것을 특징으로 하는 P49AB64 계열의 아위느타리버섯 균주를 제공한다.In addition, the present invention relates to a P49AB64 family of avian oyster mushroom strain, which is obtained by the above-mentioned spore-mating or the above-mentioned spore and the above-mentioned one of the novel strains of the avian oyster mushroom P49AB64, to provide.
바람직한 실시예에 있어서, 상기 신균주 아위느타리버섯 P49AB64와 일정 간격을 두고 배지 상에 각각 접종하여 대치배양 하였을 때 대치선이 형성되지 않는 다.In a preferred embodiment, a replacement line is not formed when the culture is inoculated by inoculating the new strain, Pyridoxylum pentosulphate P49AB64, at a predetermined interval, respectively.
또한, 본 발명은 상술된 P49AB64 계열의 아위느타리버섯 균주로 형성된 아위느타리버섯 자실체를 제공한다.In addition, the present invention provides an agar oyster fruiting body formed from the above-mentioned P49AB64 family of aviforce mushroom strains.
바람직한 실시예에 있어서, 상기 자실체는 갓으로부터 대의 일정부분까지 물결모양의 유선형주름살이 형성된다. In a preferred embodiment, the fulcrum body is formed from a wig to a certain portion of the base in the form of a wavy streamlined wrinkle.
본 발명은 다음과 같은 우수한 효과를 갖는다.The present invention has the following excellent effects.
즉, 본 발명에 의하면 상업화된 DDL01(KACC93085P) 균주보다 수요자들의 호감을 이끌어낼 수 있는 형태적 특성을 가진 DDL01(KACC93085P) 균주의 계통을 이은 아위느타리버섯 신균주 및 그 균주의 재배를 통해 얻어지는 자실체를 제공할 수 있다. That is, according to the present invention, it is possible to obtain a new strain of aviflora mushroom, which is a strain of DDL01 (KACC93085P) strain having a morphological characteristic that can induce a favorable feeling of consumers than a commercialized strain DDL01 (KACC93085P), and a fruiting body Can be provided.
또한, 본 발명의 아위느타리버섯 신균주 및 자실체는 버섯 자루 즉 대가 아위느타리버섯 DDL01 보다 2배 이상 굵어 구이용으로 적합하고 자실체 갓 표면 색택이 보다 미백색이며 갓에서 자루의 일정부분까지 물결모양의 유선형주름살이 형성되는 형태적 특성을 가지므로 품질 및 상품성이 우수하다.In addition, the new strains and fruiting bodies of the present invention are more suitable for roasting than the mushroom sack, i.e., Daewoi Aituteri mushroom DDL01, which is thicker in color, and the surface color of the fruiting bodies is more whitish in color, and the wavy wrinkled wrinkles And thus has excellent quality and merchantability.
또한, 본 발명은 신균주 P49AB64의 자간 단포자 교배를 통해 얻어져 상기 신균주 P49AB64와 일정간격을 두고 배지 상에서 대치배양 하였을 때 대치선이 형성되지 않는 P49AB64계열의 아위느타리버섯 균주 및 그 균주의 재배를 통해 얻어지는 자실체를 제공할 수 있다.
The present invention also relates to a method for producing a P49AB64 strain of avian oyster mushroom strain, which is obtained by crossing the new strain P49AB64 and crossing the fresh strain P49AB64 at a constant interval on the culture medium, Can be provided.
도 1은 상업화된 아위느타리버섯(Pleurotus eryngii var. ferulae) DDL01(KACC93085P) 균주가 재배된 자실체 사진이다.
도 2는 본 발명의 실시예에 따른 아위느타리버섯 신균주 P49AB64(수탁번호 : KACC93173P)가 재배된 자실체 사진이다.
도 3은 본 발명에 따른 아위느타리버섯 신균주 P49AB64(수탁번호 : KACC93173P)의 계통관계를 UPGMA 방법으로 나타낸 것이다.Fig. 1 is a photograph of a fruit body cultivated with a commercialized strain of Pleurotus eryngii var. Ferulae DDL01 (KACC93085P).
Fig. 2 is a photograph of a fruit body cultivated with a new strain of avifolium mushroom strain P49AB64 (accession number: KACC93173P) according to an embodiment of the present invention.
FIG. 3 shows the systematic relationship of the new strain of avian oyster mushroom P49AB64 (accession number: KACC93173P) according to the present invention by the UPGMA method.
본 발명에서 사용되는 용어는 가능한 현재 널리 사용되는 일반적인 용어를 선택하였으나, 특정한 경우는 출원인이 임의로 선정한 용어도 있는데 이 경우에는 단순한 용어의 명칭이 아닌 발명의 상세한 설명 부분에 기재되거나 사용된 의미를 고려하여 그 의미가 파악되어야 할 것이다.Although the terms used in the present invention have been selected as general terms that are widely used at present, there are some terms selected arbitrarily by the applicant in a specific case. In this case, the meaning described or used in the detailed description part of the invention The meaning must be grasped.
이하, 첨부한 도면 및 바람직한 실시예들을 참조하여 본 발명의 기술적 구성을 상세하게 설명한다.Hereinafter, the technical structure of the present invention will be described in detail with reference to the accompanying drawings and preferred embodiments.
그러나, 본 발명은 여기서 설명되는 실시예에 한정되지 않고 다른 형태로 구체화 될 수도 있다. 명세서 전체에 걸쳐 본 발명을 설명하기 위해 사용되는 동일한 참조번호는 동일한 구성요소를 나타낸다.However, the present invention is not limited to the embodiments described herein but may be embodied in other forms. Like reference numerals used to describe the present invention throughout the specification denote like elements.
본 발명의 기술적 특징은 상업화된 아위느타리버섯 DDL01과 비교하여 자실체의 갓 표면 색깔이 백색에 가까울 뿐만 아니라 대의 굵기 또한 아위느타리버섯DDL01보다 두껍게 형성되도록 하여 구이용으로 적합한 형태적 특성을 갖도록 교배 육종된 DDL01 (KACC93085P) 균주의 계통을 이은 아위느타리버섯 신균주 및 그 균주의 재배를 통해 얻어지는 자실체에 있다.The technical feature of the present invention is that DDL01, which is commercialized, is not only white in color, but also has a thickness larger than that of A. manganese DDL01, so that DDL01 (KACC93085P) strain, and a fruiting body obtained through cultivation of the strain.
그 결과, 본 발명에 의한 아위느타리버섯 신균주로부터 형성된 자실체는 상업화된 아위느타리버섯 DDL01과 비교하여 2배 이상 많게는 5배까지 대의 굵기가 굵고 버섯 갓의 색택이 보다 미백색이며 특히 갓으로부터 대의 일정부분까지 물결모양의 유선형주름살이 형성되는 형태적 특성을 가지게 된다. As a result, the fruiting body formed from the new strain of Aeweiteri mushroom according to the present invention was thicker than 2 times and more than 5 times larger than the commercialized aviatorium mushroom DDL01, and the color of the mushroom shade was more whitish than that of commercialized A. The wrinkled wrinkles are formed in a wavy shape.
본 발명에 따른 아위느타리버섯 신균주는 종래 알려진 아위느타리버섯 균주들 중에서도 농업회사법인주식회사 뜰아채 부설연구소의 보존균주 중 DDL01 (KACC93085P)의 단포자 P7330W과 시험재배를 통해 DAC7421를 선발하였고, 이하의 실험에서 교배육종의 모본 균주로 사용하였다.
Among the known strains of A. niger mushroom strain according to the present invention, among the known strains of A. niger mushroom strain, P7330W, a single spore strain of DDL01 (KACC93085P) and DAC7421, In the experiment, it was used as a representative strain of crossbred breeding.
실시예 1. 아위느타리버섯 신균주 P49AB64의 육종Example 1. Breeding of a novel strain of avian oyster mushroom P49AB64
본 발명을 위해 농업회사법인주식회사 뜰아채 부설연구소의 보존균주 중 DDL01(KACC93085P)의 단포자 P7330W와 DAC7421를 모균주로 사용했다. For the present invention, the spore strains P7330W and DAC7421 of DDL01 (KACC93085P) were used as the parent strains among the strain strains of the Institute of Agricultural Biotechnology,
(1) 단포자의 분리(1) Isolation of monospore
낙하법에 의해 아위느타리버섯 균주 DDL01, DAC7421의 버섯 자루 부위가 제거된 갓 부위를 버섯의 주름살이 밑으로 향하게 하여 페트리접시에 올려놓고 24시간 경과된 후에 갓을 제거하고 페트리접시 위에 떨어진 버섯의 포자들을 멸균수를 통해 적당한 농도로 희석하여 감자 한천배지에 도말하여 25℃에서 배양하였다. 배양 7일 이후부터 발아하는 1차 균사를 이쑤시개를 통해 순수분리하고 각각의 1차 균사는 다시 감자 한천배지에 접종하였다. 접종된 감자 한천배지는 25℃에서 14일간 배양한 뒤 각각의 균사를 일부 떼어내어 현미경을 통해 클램프의 유무를 확인하고 클램프가 보이지 않는 균사만을 10% 글리세롤 용액에 넣고 냉장보관하며 시험에 사용하였다.
After dropping the mushroom on the Petri dish with the wrinkles of the mushroom pointing downward, the mushroom spores of the mushroom strain DDL01 and DAC7421 were removed by dropping method. After 24 hours, the mushroom spores Were diluted to an appropriate concentration through sterilized water and plated on a potato agar medium and cultured at 25 ° C. The first germination germinated from 7 days after cultivation was separated by toothpick, and each primary mycelium was inoculated again on potato agar medium. The inoculated potato agar broth was incubated at 25 ℃ for 14 days. The mycelium was partially removed, and the presence or absence of the clamp was confirmed by a microscope. Only the mycelium with no clamp was put in a 10% glycerol solution and used for the test.
(2) 교배(2) Crossing
순수 분리되어 냉장보관중인 서로 다른 각각의 아위느타리버섯 균주의 단포자(일핵)균사와 단포자(일핵)균사의 교배와 단포자(일핵)균사와 모균의 균사(이핵)의 교배방법을 수행하였다. 각각 감자한천배지에 접종하고 25℃에서 14일간 배양한 뒤 생육이 좋고 균사체량이 많은 것만을 선발하여 교배 육종에 사용하였다. 감자한천 배지에 자란 균사체를 1cm 원형의 크기로 잘라 떼어낸 균사체 블럭을 각각 1개씩 새로운 감자한천배지 페트리접시에 3cm 간격을 두고 대치하여 교배 육종를 수행하였다. 접종된 감자한천배지 페트리접시를 25℃ 항온기에서 21~28일간 배양한 뒤 균사를 떼어내어 현미경으로 관찰해 단핵의 균사체 블럭쪽에서 클램프가 형성된 균주만을 선발하였다.
Mating of monocotyledonous (monocotyledonous) mycelia and monocotyledonous (mycorrhizal) hyphae of hybrids of each of the different Aeweuteri mushroom strains isolated from each other and hyphae of monocotyledonous hyphae and hyphal mycelium . Each of them was inoculated on a potato agar medium and cultured at 25 ° C for 14 days. Only those with good growth and high mycelium were selected for crossing breeding. Mycelium grown on a potato agar medium was cut into 1 cm round size, and each mycelium block was replaced with a new potato agar medium petri dish at intervals of 3 cm to perform crossing breeding. The inoculated potato agar medium petri dish was incubated at 25 ℃ for 21 ~ 28 days. Mycelia were removed and examined with a microscope to isolate strains which were clamped on the mycelial block side of mononuclear cells.
(3) 교배주의 재배시험(3) Crossbreeding Cultivation Test
콘콥 : 밀기울을 8:2의 비율로 혼합해 수분을 65%로 조정하여 850cc 버섯재배용 병에 580g씩 입병한 후 2cm의 봉으로 가운데 위에 밑부분까지 타공하여 121℃에서 60분간 멸균하였다. 멸균한 후 20℃ 까지 냉각한 후 상기 선발된 균주를 접종하고 24℃에서 30일간 암흑상태에서 배양하였다. 배양 완료 후 균긁기 작업을 행한 후 14~18℃, 습도 80~95%, 조도 100~200룩스에서 발이 및 생육 등의 재배시험을 실시하였다.
Concon: Bran was mixed at a ratio of 8: 2 to adjust the water content to 65%. 580g of the mixture was put into a 850cc mushroom cultivation bottle, and the mixture was pierced to the bottom with a 2 cm rod and sterilized at 121 ° C for 60 minutes. After cooling to 20 캜 after sterilization, the selected strain was inoculated and cultured in the dark state at 24 캜 for 30 days. After completion of the cultivation, bacterial scratching was carried out, and cultivation tests such as foot and growth were carried out at 14 to 18 ° C, 80 to 95% in humidity and 100 to 200 lux at the illuminance.
(4) 신규 교배주인 아위느타리버섯 신균주 P49AB64의 선발(4) Screening of new strain P4A6464
단포자 교배를 통해 얻어진 교배주들을 시험재배하고, 스크리닝하여 자실체 갓의 색택을 미백색으로 유도하는 특징을 지닌 DDL01(KACC93085P)의 단포자 P7330W를 DAC7421균주의 단포자들과 교배하여 균사 생장 및 재배에서 우수한 교배주를 선발하여 P49AB64로 명명하여, 2013년 3월 26일자로 한국미생물보존센터에 기탁하였다.(수탁번호 : KACC93173P).
The crossbreds of DDL01 (KACC93085P), which has the characteristics of inducing the coloration of the fruit body gland to the whitish color, were cross-tested with the sporophytes of the DAC7421 strain and tested for mycelial growth and cultivation A good breeder was selected and named as P49AB64, and deposited on March 26, 2013 with the Korean Society for Microbiological Protection (Accession No .: KACC93173P).
실험예 1. 신규 교배주 P49AB64의 균학적 특성Experimental Example 1. Mycological characteristics of novel crossbred strain P49AB64
실시예에서 얻어진 신규 교배 균 P49AB64주의 균학적 특성을 다음과 같이 조사하였다.The mycological characteristics of the novel crossbred strain P49AB64 obtained in the examples were investigated as follows.
1) 포테이토 덱스트로스 한천(PDA)배지에서의 생육 상태 (25℃):7일째의 콜로니 직경은 42.0mm. 균사는 흰색으로 빽빽하며, 기중 균사의 양은 보통, 직선적으로 자란다.1) Growth condition (25 占 폚) on potato dextrose agar (PDA) medium: the diameter of the colonies on the 7th day is 42.0 mm. Mycelium is dense with white, and the amount of air hypha grows normally and linearly.
2) 머쉬룸 컴플레트 한천(MCM)배지에서의 생육 상태 (25℃):7일째의 콜로니 직경은 45.2mm. 균사는 흰색으로 빽빽하며, 기중 균사의 양은 보통, 직선적으로 자란다.2) Growth condition (25 캜) on mushroom complex agar (MCM) medium: Colony diameter at the 7th day is 45.2 mm. Mycelium is dense with white, and the amount of air hypha grows normally and linearly.
3) 마이코로지컬한천(MA)배지에서의 생육 상태 (25℃):7일째의 콜로니 직경은43.0mm 균사는 흰색으로 빽빽하며, 기중 균사의 양은 보통, 직선적으로 자란다.3) Growth condition (25 ° C) on mycological agar (MA) medium: The colony diameter on the 7th day is dense with 43.0 mm hypha, and the amount of air hyphae grows normally linearly.
4) 콘밀한천(CMA)배지에서의 생육 상태 (25℃):7일째의 콜로니 직경은 37.5mm균사는 흰색으로 매우 희박하고, 기중 균사의 양은 매우 적음, 직선적으로 자란다.4) Growth condition (25 ° C) on the agar medium (CMA): The colony diameter on the 7th day is 37.5 mm. Mycelium is very thin in white, and the amount of air hypha is very small and grows linearly.
5) 사브로우드 덱스트로스 한천(SDA)배지에서의 생육 상태 (25℃):7일째의 콜로니 직경은 35.5mm. 균사는 흰색으로 빽빽하며, 후기에 균사체의 색택이 부분적으로 붉은노랑을 띄며, 기중 균사의 양은 보통, 직선적으로 자란다.5) Growth condition (25 占 폚) on a medium of SDA broth: The diameter of colonies on the 7th day is 35.5 mm. Mycelium is dense with white, and the color of mycelium is partially reddish yellow in the latter period. The amount of mycelium in the air is usually linear.
6) 균사생육최적온도:PDA 배지상에 직경 5mm의 종균을 접종해, 각 온도대에서 각각 배양 짓고, 7일 뒤에 각 콜로니 경을 측정했더니, 균사신장의 최적온도는 26℃ 부근이었다.6) Optimum temperature of mycelial growth: 5 mm diameter seedlings were inoculated on the PDA medium, cultured at each temperature zone, and 7 days later, the optimum temperature for mycelial growth was around 26 ° C.
7) 균사생육최적 pH:글루코스-펩톤-이스트 익스트렉트 액체 배지 25ml씩을 멸균 후, 각 pH에 조정해, 종균을 접종 후, 25℃으로12일간(에) 정치배양 한 뒤, 건조균체중량을 측정했더니, 균사생육최적 pH은 6.0 ~ 6.5 부근이었다.
7) Optimum pH of mycelial growth: 25 ml of glucose-peptone-yeast extract liquid medium was sterilized, adjusted to each pH, inoculated with seed bacterium, allowed to stand at 25 ° C for 12 days, The optimum pH for mycelial growth was around 6.0 to 6.5.
실험예 2. 신규 교배주 P49AB64의 유전적 특성Experimental Example 2. Genetic characteristics of novel crossbred strain P49AB64
실시예에서 얻어진 균주의 유전적 특성을 조사하기 위해 양 균사가 갖고 있는 성인자가 다르면, 그 균사는 서로 다른 균사다라고 하는 균류 분류학적 사실에 입각해, 양친주 및 근연품종과의 한천배지상에서의 대치배양에 의해 성인자의 동이판정을 수행하였다. 포테이토 덱스트로스 한천배지상에 3센치의 간격을 두고 서로 대치하여 각각 균주를 접종해 25℃로 14~21일간 배양한 뒤 양 콜로니 경계부에 대선이 생길지 아닐지를 판정했고(대선형성은 +, 형성하지 않는 것은 로 표시), 그 결과를 표 1에 나타내었다.In order to investigate the genetic characteristics of the strains obtained in the Examples, it is known that when the strains of the hyphae are different, hyphae are different hyphae, Adult maturation was performed by confluent culture. The seeds were inoculated with each other at intervals of 3 centimeters on a potato dextrose agar medium and incubated at 25 ° C for 14 to 21 days, and it was judged whether or not an election would occur at the boundary between the two colonies The results are shown in Table 1.
여기서, P49AB64를 모균으로 하는 자균1 및 자균2(자균1 및 자균2)는 신균주 아위느타리버섯 P49AB64의 자실체로부터 얻어진 포자간에 이루어지는 단포자 교배로 얻어진 균주들이고, P49AB64를 모균으로 하는 자균3(자균3)은 신균주 아위느타리버섯 P49AB64의 자실체로부터 얻어진 포자와 신균주 아위느타리버섯 P49AB64의 자모간 다이-모노 교배로 얻어진 균주이다. Herein, the strains 1 and 2 (strains 1 and 2), which are P49AB64 as the mother strain, are strains obtained by a single-spore hybridization between spores obtained from the fruiting body of the novel strain Pyralidae P49AB64, and the strains 3 3) is a strain obtained by crossing of the spore obtained from the fruiting body of the new strain Pseudomonas aeruginosa P49AB64 and the new parent strain Pseudomonas aeruginosa P49AB64.
실험예 3. 신규 교배주인 P49AB64 의 분자생물학적 동정Experimental Example 3. Molecular Biological Identification of New Crossbred P49AB64
(1) ITS지역(region)의 염기서열 결정 (1) Determination of the nucleotide sequence of the ITS region
배양체로부터 비드 비팅(bead beating) 방법을 이용하여 DNA를 추출하였고 내부 전사되는 ITS(Internal transcribed spacer)를 PCR(polymerase chain reaction)증폭하기 위하여 ITS1 (TCCGTAGGTGAACCTGCGG; 서열번호 1) / ITS4 (TCCTCCGCTTATTGATATGC; 서열번호 2)의 프라이머 세트를 각각 이용하여 증폭한 후 정제를 통해 (주)Macrogen에 시퀀싱을 의뢰하여 염기서열을 결정하였다(서열번호 3).ITS1 (TCCGTAGGTGAACCTGCGG; SEQ ID NO: 1) / ITS4 (TCCTCCGCTTATTGATATGC; SEQ ID NO: 1) was used to amplify an internal transcribed ITS (Internal Transcribed Spacer) by PCR using a bead beating method from a culture medium. 2) were amplified using the primer sets, respectively, and then subjected to sequencing by the Macrogen Co. (SEQ ID NO: 3) through purification.
>49AB64> 49AB64
TGGGAAGGATCATTAATGAATTCACTATGGAGTTGTTGCTGGCCTCTAGGGGCATGTGCACGCTTCACTAGTCTTTCAACCACTTGTGAACTTTTGATAGATCTGTGAAGTCGTCTCTCAAGTCGTTAGACTTGGTTTGCTGGGATGTAAACGTCTCGGTGTGACTACGCAGTCTATTTACTTATAACACCCCAAATGTATGTCTACGAATGTCATTTAAAGGGCCTTGTGCCTATAAACCATAATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTTGAGTGTCATTAAATTCTCAAACTCACTCTGGTTTTTCCAATTGTGATGTTTGGATTGTTGGGGGCTGCTGGCCTTGACAGGTCGGCTCCTCTTAAATGCATTAGCAGGACTTCTCATTGCCTCTGCGCATGATGTGATAATTATCACTCATCAATAGCACGCATGAATAGAGTCTGGCTCTCTAACCGTCCGCAAGGACAATTTGACAATTTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGTGGGAAGGATCATTAATGAATTCACTATGGAGTTGTTGCTGGCCTCTAGGGGCATGTGCACGCTTCACTAGTCTTTCAACCACTTGTGAACTTTTGATAGATCTGTGAAGTCGTCTCTCAAGTCGTTAGACTTGGTTTGCTGGGATGTAAACGTCTCGGTGTGACTACGCAGTCTATTTACTTATAACACCCCAAATGTATGTCTACGAATGTCATTTAAAGGGCCTTGTGCCTATAAACCATAATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTTGAGTGTCATTAAATTCTCAAACTCACTCTGGTTTTTCCAATTGTGATGTTTGGATTGTTGGGGGCTGCTGGCCTTGACAGGTCGGCTCCTCTTAAATGCATTAGCAGGACTTCTCATTGCCTCTGCGCATGATGTGATAATTATCACTCATCAATAGCACGCATGAATAGAGTCTGGCTCTCTAACCGTCCGCAAGGACAATTTGACAATTTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAG
(2) 유전적 특성 분석(2) Analysis of genetic characteristics
염기서열이 결정된 두 유전자 부분을 수정을 거쳐 유전자은행의 BLAST 서치를 통해 가장 유사한 균주의 염기서열들을 얻은 후, 좀 더 정확한 유전적 분석을 시도하였다. After genomic analysis of the two gene sequences, BLAST searches for the most similar genomic sequences and genetic analysis.
ClustalW2(Multiple Sequence Alignment)를 이용하여 모든 염기서열을 정렬하였고, 이를 토대로 MrBayes version 3.1 program을 이용하여 Bayesian MCMC run으로 진화학적 거리를 계산하고, maximum likelihood 방법으로 분자진화학적 관계를 도 3에 나타내었다. 이때 boot-strapping 값은 1000으로 사용하였다. 이를 토대로 이들의 유사성 및 최종 동정을 하였다. 그 결과 느타리버섯속의 프레오로투스 에링기 버라이어티 페룰라에(Pleurotus eryngii var. ferulae) 버섯으로 동정되었다.
All sequences were sequenced using ClustalW2 (Multiple Sequence Alignment). Based on this, the evolutionary distance was calculated by Bayesian MCMC run using MrBayes version 3.1 program, and the molecular chemical relationship by the maximum likelihood method is shown in Fig. 3 . The boot-strapping value is 1000. Based on this, similarities and final identifications were made. As a result, Pleurotus eryngii var. Ferulae ( Pleurotus eryngii var. Ferulae ) It was identified as mushroom.
실험예 4. 신규 교배주인 P49AB64의 재배 Experimental Example 4: Cultivation of new cross breeder P49AB64
1. 배지조제1. Preparation of badge
배지재료는, 콘콥 : 밀기울 = 8 : 2(용적비, 40-50g/850cc 병이 표준)으로 혼합해 사용하였다. 교반 혼합하여 최종 배지 함수율이 68~70%가 되도록 조정하였다.The medium was mixed with Concon: Bran = 8: 2 (volume ratio, 40-50 g / 850 cc standard). Followed by stirring and mixing to adjust the final medium water content to 68-70%.
2. 충진2. Filling
배지의 충진양은 850cc 빈병에 480-520g(내용양)이 되도록 충진하였다.The filling amount of the medium was filled to 850 cc bottles to 480-520 g (content amount).
3. 살균3. Sterilization
고압살균은 배지내 온도가 120℃에 달하고 나서 60분간(유효살균시간) 실시하며, 살균솥 온도를 표준으로 할 경우에는, 90분간 (850cc 병) 실시한다.The high-pressure sterilization is carried out for 60 minutes (effective sterilization time) after the temperature reaches 120 ° C in the medium, and 90 minutes (850cc bottle) when the sterilization pot temperature is standard.
4. 방냉4. Cooling
청결한 환경 하에서 배지온도가 20℃ 이하가 될 때까지 냉각하였다.Under a clean environment, the culture medium was cooled until the culture medium temperature became 20 DEG C or lower.
5. 접종5. Inoculation
종균의 접종양은 1병당 15cc 정도를 표준으로 접종하였다.The inoculum amount of seed bacterium was inoculated as standard of about 15cc per one bottle.
6. 배양관리6. Culture management
온도는 18℃으로 25일간 관리하고, 이에 계속하여 23℃으로 8~10일간의 배양숙성 관리하였다. 습도는 전기배양은 60~70%, 후기배양은 70~80%으로 관리하였으며, 이산화탄소 농도는 3,000ppm 이하로 관리하였다. 조도는 암흑배양으로 관리하고, 기간은 30일간 배양한다.The temperature was maintained at 18 占 폚 for 25 days, followed by aging at 23 占 폚 for 8 to 10 days. Humidity was maintained at 60 ~ 70% for the electric culture and 70 ~ 80% for the later culture, and the carbon dioxide concentration was controlled at 3,000 ppm or less. Light intensity is controlled by dark culture, and period is 30 days.
7. 균긁기7. Scraping bacteria
발아 수를 억제하는 목적으로 15~20mm 균긁기를 실시하였다.Scraping of 15 ~ 20mm was performed for the purpose of suppressing the number of germination.
8. 발이관리8. Foot Care
온도는 14-15℃으로 관리하고, 전기발이의 습도는 90-95%으로 3-5일간, 후기발이는 70~80%으로 3-5일간 관리하였다. 이산화탄소 농도는 1,000ppm 이하로 관리하며, 조도는 낮에만 전등관리로 하였다. 5-8일 간, 물구나무서기상태로 관리하였다. 후기발이에서 15mm 정도의 어린버섯의 원기가 형성되면 바로 물구나무서기상태에서 정립상태로 뒤집어 생육관리를 하였다.The temperature was controlled at 14-15 ° C, and the humidity of the electric foot was controlled for 3-5 days at 90-95% and 70-80% for the latter 3-5 days. The carbon dioxide concentration was controlled to be less than 1,000 ppm, and the light intensity was managed only at the daytime. For 5 to 8 days. When young mushroom was grown about 15mm from the late feet, it was turned upside down and maintained its growth condition.
9. 생육관리9. Growth management
재배병 입구 표면에 형성된 어린버섯들의 크기를 동조화하기 위해서 온도는 13-14℃으로 관리해 16℃ 이상으로는 올라가지 않도록 하였다. 최초의 3일간을 15℃으로 관리하였다. 습도는 70-95%으로 관리해 건 /습의 습도교차를 크게 벌여 관리하였다. 발아 확인 후에 정립상태로 되돌려 5-8일간 관리하였다. 정립에 되돌린 직후는 생육 초기에 저온관리로 제습에 의한 습도조건에 주의하여 관리한다.In order to synchronize the size of the young mushrooms formed on the entrance surface of the cultivation bottle, the temperature was controlled at 13-14 ° C so as not to rise above 16 ° C. The first 3 days were managed at 15 ° C. Humidity was controlled by 70-95%, and the humidity / humidity crossing was managed to a large extent. After germination confirmation, it was returned to the established state and maintained for 5-8 days. Immediately after being returned to the formulation, care should be taken in the early stage of growth to take into account the humidity conditions caused by dehumidification with low temperature control.
10. 수확10. Harvest
버섯 갓이 둥그스름한 모양이 남아있는 상품의 상태에서 수확하였다.
Mushroom gods were harvested in the state of a product with a roundish shape.
실시예에서 얻어진 아위느타리버섯 신균주 P49AB64를 상술된 바와 같이 재배하여 수확한 결과, 도 2에 도시된 사진과 같이 아위느타리버섯 DDL01(KACC93085P)의 계통을 유지하지만 아위느타리버섯 DDL01과 비교하여 2배 이상 대의 굵기가 굵고 버섯 갓의 색택이 보다 미백색이며 특히 갓으로부터 대의 일정부분까지 물결모양의 유선형주름살이 형성되는 형태적 특성을 갖는 것을 알 수 있다.
As a result of cultivating and harvesting the new avian oyster mushroom strain P49AB64 obtained in the example as described above, the strain of the agaricus mushroom DDL01 (KACC93085P) was maintained as shown in the photograph shown in Fig. 2, And the color of the mushroom shrub is more whitish than that of the mushroom shrub. In particular, it has a morphological characteristic that wavy wrinkled wrinkles are formed from the shrub to a certain part of the shrub.
또한, 체세포 및 조직 배양 선별, 담자 포자 선별 및 Pleurotus eryngii var. eryngii, Pleurotus eryngii var. ferulae, Pleurotus eryngii var. nebrodensis 와의 혼성화를 포함하는 다양한 수단에 의해, P49AB64로부터 다양한 균주들이 개발될 수 있으며, 제조된 하이브리드 균주들은 시장에서 요구되는 상업적인 특성에 대해 스크리닝될 수 있다. In addition, somatic and tissue culture selection, cell spore selection and Pleurotus eryngii var. eryngii, Pleurotus eryngii var. ferulae, Pleurotus eryngii var. By various means including hybridization with nebrodensis, a variety of strains can be developed from P49AB64 and the hybrid strains produced can be screened for the commercial characteristics required in the market.
예를 들어, 다양한 P49AB64 계열의 아위느타리버섯 균주가 신균주 아위느타리버섯 P49AB64의 균사 배양물 또는 이로부터 발육된 균주의 체세포 계대배양물의 단일-포자배양법 또는 다중-포자배양법에 의한 증식 또는 체세포 선별에 의해 생산될 수 있다. For example, a variety of P49AB64 strains of A. aviforme mushroom strain have been used for the proliferation or somatic cell sorting by the single-spore culture method or the multi-spore culture method of the mycelial culture of the new strain Pseudomonas aeruginosa P49AB64 or the somatic cell subculture of the strain developed therefrom Lt; / RTI >
특히, 신균주 아위느타리버섯 P49AB64의 자실체로부터 얻어진 포자간에 이루어지는 단포자 교배 또는 상기 포자와 신균주 아위느타리버섯 P49AB64의 자모간 다이-모노 교배로 얻어진 P49AB64 계열의 아위느타리버섯 균주는 실험예 2에서 알 수 있듯이 신균주 아위느타리버섯 P49AB64과 유전적 특성이 유사하며, 자실체의 형태적 특성 또한 갓으로부터 대의 일정부분까지 물결모양의 유선형주름살이 많거나 적은 차이 및/또는 길거나 짧은 차이는 있으나 물결모양의 유선형주름살이 형성되는 점에서 유사하다. In particular, the P49AB64 strain of the avian oyster mushroom strain obtained by the spore-mating crosses between the spores obtained from the fruiting body of the new strain Aiu oyster mushroom P49AB64 or the rhizomes of the spores and the new strain pseudo-oyster mushroom P49AB64, As can be seen, genetic characteristics are similar to that of the new strain Pseudomonas aeruginosa P49AB64, and the morphological characteristics of fruiting bodies are also found in many wavy wrinkles, small differences, and / or long or short differences, It is similar in that wrinkles are formed.
본 발명은 이상에서 살펴본 바와 같이 바람직한 실시 예를 들어 도시하고 설명하였으나, 상기한 실시 예에 한정되지 아니하며 본 발명의 정신을 벗어나지 않는 범위 내에서 당해 발명이 속하는 기술분야에서 통상의 지식을 가진 자에 의해 다양한 변경과 수정이 가능할 것이다.While the present invention has been particularly shown and described with reference to exemplary embodiments thereof, it is clearly understood that the same is by way of illustration and example only and is not to be taken by way of limitation, Various changes and modifications will be possible.
Claims (10)
The new strain Pseudomonas mushroom P49AB64 (Accession No .: KACC93173P).
상기 신균주는 아위느타리버섯 균주 DDL01(기탁번호 : KACC93085P)의 자실체에서 분리한 단포자와 아위느타리버섯 균주 DDL01을 제외한 다른 아위느타리버섯 균주의 자실체에서 분리한 단포자를 교배하여 얻어진 것을 특징으로 하는 신균주 아위느타리버섯 P49AB64.
The method according to claim 1,
Wherein the new strain is obtained by crossing monocotyledonous fungi isolated from the fruiting bodies of the fungus of the genus Acanthopanax senticosus except for the monocotyledonous fungus isolated from the fruiting body of the aviforme mushroom strain DDL01 (Accession No .: KACC93085P) and DDL01 of the avirulent mushroom strain New strain.
상기 신균주를 일정 간격을 두고 배지 상에 각각 접종하여 대치배양하면 대치선이 형성되지 않는 것을 특징으로 하는 신균주 아위느타리버섯 P49AB64.
The method according to claim 1,
Wherein the new strain is inoculated on the culture medium at a predetermined interval to replace the new strain, and no replacement line is formed.
An agate oyster fruiting body formed from the strain of any one of claims 1 to 3.
상기 자실체는 대의 굵기가 아위느타리버섯 DDL01의 자실체의 대보다 2배 내지 5배 굵고 갓으로부터 대의 일정부분까지 물결모양의 유선형주름살이 형성되는 것을 특징으로 하는 아위느타리버섯 자실체.
5. The method of claim 4,
Wherein the flesh body has a thickness of 2 to 5 times thicker than that of the fruiting body of the agaricus mushroom DDL01, and a wavy streamlike wrinkle is formed from the gut to a certain part of the body.
4. The spore obtained from the fruiting body of an agar mushroom of claim 4.
Wherein the spore of the spore of step 6 or the spore of claim 7 and the novel strain of avian oyster mushroom P49AB64 of any one of claims 1 to 3, Mushroom strain.
상기 신균주 아위느타리버섯 P49AB64와 일정 간격을 두고 배지 상에 각각 접종하여 대치배양 하였을 때 대치선이 형성되지 않는 것을 특징으로 하는 P49AB64 계열의 아위느타리버섯 균주.
8. The method of claim 7,
The P49AB64 strain of the oyster mushroom strain is characterized in that no replacement line is formed when the new strain is inoculated to the culture medium at a constant interval from the new strain Aiuteritari mushroom P49AB64.
A fried eggplant mushroom body formed from the strain of claim 7.
상기 자실체는 갓으로부터 대의 일정부분까지 물결모양의 유선형주름살이 형성되는 것을 특징으로 하는 아위느타리버섯 자실체.
10. The method of claim 9,
Wherein the fruiting body is formed from a wig to a certain part of the base to form a wavy streamlike wrinkle.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
KR1020130033915A KR101455702B1 (en) | 2013-03-28 | 2013-03-28 | Novel Pleurotus eryngii var. ferulae Strain P49AB64 |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
KR1020130033915A KR101455702B1 (en) | 2013-03-28 | 2013-03-28 | Novel Pleurotus eryngii var. ferulae Strain P49AB64 |
Publications (2)
Publication Number | Publication Date |
---|---|
KR20140118291A true KR20140118291A (en) | 2014-10-08 |
KR101455702B1 KR101455702B1 (en) | 2014-11-03 |
Family
ID=51991163
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
KR1020130033915A KR101455702B1 (en) | 2013-03-28 | 2013-03-28 | Novel Pleurotus eryngii var. ferulae Strain P49AB64 |
Country Status (1)
Country | Link |
---|---|
KR (1) | KR101455702B1 (en) |
Families Citing this family (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
KR102323518B1 (en) | 2019-09-25 | 2021-11-05 | 권경열 | Novel Pleurotus eryngii var. ferulae Strains 151 and fruit body of the same |
Family Cites Families (4)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
KR100403411B1 (en) | 2001-04-10 | 2003-10-30 | 권득수 | The novel pleurotus ferulae-k9 and the culture method for thereof |
KR100954964B1 (en) | 2009-11-24 | 2010-04-23 | 농업회사법인주식회사 뜰아채 | A novel pleurotus eryngii var. ferulae strain ddl01 and method of producing it |
KR101485491B1 (en) * | 2010-04-12 | 2015-01-22 | 농업회사법인주식회사 뜰아채 | A novel Pleurotus eryngii var. ferulae strain DDL01 and method of producing it |
KR101325214B1 (en) * | 2011-05-24 | 2013-11-04 | 농업회사법인주식회사 뜰아채 | Noble elastease inhibitor isolated from Pleurotus eryngii var. ferulae and composition of the prevention or treatment for anti aging containing the same as an active ingredient |
-
2013
- 2013-03-28 KR KR1020130033915A patent/KR101455702B1/en active IP Right Grant
Also Published As
Publication number | Publication date |
---|---|
KR101455702B1 (en) | 2014-11-03 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
KR101035898B1 (en) | Novel lentinula edodes (berk.) pegler gna01 | |
CN107227263B (en) | White flammulina velutipes JK01 strain and application thereof | |
JP5464588B2 (en) | New strain Agittake and its cultivation method (Anovel Pleurotuserenigivar. Ferulaestrain and methodofproductionit) | |
KR101433040B1 (en) | Novel Pleurotus eryngii var. ferulae Strain | |
JP2007053928A (en) | New fungal strain and method for culturing new fruit body | |
KR101485491B1 (en) | A novel Pleurotus eryngii var. ferulae strain DDL01 and method of producing it | |
JP5124670B2 (en) | Mushroom artificial cultivation method | |
EA035884B1 (en) | New hybrid agaricus bisporus mushroom strains | |
KR101485485B1 (en) | Novel Pleurotus eryngii var. ferulae Strains and fruit body of the same | |
KR101544927B1 (en) | Novel Pleurotus eryngii var. ferulae Strain P48-24s and its descendants | |
KR101455702B1 (en) | Novel Pleurotus eryngii var. ferulae Strain P49AB64 | |
KR20090081226A (en) | Method for making of nutrient broth for cultivating Oyster mushrooms and nutrient broth for cultivating Oyster mushrooms made thereby | |
KR101485487B1 (en) | Novel Pleurotus eryngii var. ferulae MMW7622 and fruit body of the same | |
KR101439973B1 (en) | Novel Pleurotus eryngii var. ferulae Strains and fruit body having white pileus of the same | |
KR102323518B1 (en) | Novel Pleurotus eryngii var. ferulae Strains 151 and fruit body of the same | |
KR101110487B1 (en) | New mycoleptodonoides aitchisonii strains and artificial method for cultivating same | |
CN115093976B (en) | White beech mushroom ZHSjg-byg and cultivation method thereof | |
KR20240109915A (en) | Novel strain pleurotus sp. P21287 obtained by interspecies hybridization and its cultivation method | |
CN114365658B (en) | Lentinus edodes fruiting body model cultivation method | |
JP2006067929A (en) | Method for culturing eryngii | |
JP4063707B2 (en) | Mushroom artificial cultivation method | |
JP4842235B2 (en) | Mushroom artificial cultivation method | |
KR20180057342A (en) | Novel Pleurotus eryngii var. ferulae Strains D4 and fruit body of the same | |
JPH0750927A (en) | Method for cultivating new strain | |
JP2003092927A (en) | Method for cultivating new strain |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
A201 | Request for examination | ||
E902 | Notification of reason for refusal | ||
E902 | Notification of reason for refusal | ||
E701 | Decision to grant or registration of patent right | ||
GRNT | Written decision to grant | ||
FPAY | Annual fee payment |
Payment date: 20171023 Year of fee payment: 4 |
|
FPAY | Annual fee payment |
Payment date: 20191022 Year of fee payment: 6 |