KR20140112721A - Immunostimulantsfor foot-and-mouth disease prevention and feedstuff composition using the same - Google Patents

Abstract

The present invention provides an immune-enhancing material for foot-and-mouth disease prevention, which includes 0.1-0.3 wt% of composite germanium mineral, wherein the composite germanium mineral contains 36 ppm of germanium, biotite, muscovite, feldspar, tourmaline, zircon, garnet, apatite, and opaque mineral, and also contains iodine, cobalt, selenium, and vanadium as auxiliary minerals.

Description

FIELD OF THE INVENTION [0001] The present invention relates to an immune enhancer for preventing foot-and-mouth disease, and a feed composition using the same. BACKGROUND OF THE INVENTION 1. Field of the Invention [0002]

The present invention relates to an immune enhancer for preventing foot-and-mouth disease and a livestock feed composition using the same. More particularly, the present invention relates to an immune enhancer for preventing foot-and-mouth disease and a method for enhancing the resistance to foot- And to a livestock feed composition using the same.

Foot-and-mouth disease is a disease caused by infection of foot-and-mouth disease virus (FMDV), which belongs to the genus Picornaviridae and Aphthovirus.

The FMDV is characterized by a wide host range, high infectivity and very fast replication efficiency, and propagates through various routes such as direct and indirect contact propagation, air propagation, and the like. Especially in ruminants, asymptomatic, persistent infection can be a cause of disease is very difficult to eradicate.

Such foot-and-mouth disease has been a major obstacle to the international trade of livestock and livestock products due to the fact that it has sufficient elements to spread to other distant countries such as other countries. Despite the efforts worldwide for the eradication of foot-and-mouth disease And has caused many problems in many countries including Korea.

In addition, efforts to eradicate foot-and-mouth disease should be implemented in accordance with various factors such as endemic, semi-endemic, and disease-free animals and foot and mouth disease animals.

In other words, depending on the outbreak situation, the most appropriate method of preventive vaccination, urgent vaccination, and live disposal has been selected and applied. In Korea, too, During the foot-and-mouth disease period, about 3.4 million cows were vaccinated and about 8.3 million pigs were vaccinated twice. By 2012, vaccination is mandatory.

However, even if the vaccination is carried out, there are many problems as follows:

First, even the best vaccines developed so far will have antibodies to the vaccine 4-5 days after vaccination, usually two weeks after vaccination. However, the outbreak of foot-and-mouth disease is so rapid that the progression and spread of the disease is so rapid that diseases can spread and spread before the defensive antibodies against foot-and-mouth disease are formed,

Second, individuals infected with foot-and-mouth disease virus during the antibody-forming period after vaccination can become a source of infection that can spread viruses to other individuals in a carrier state.

Third, foot-and-mouth disease virus has 7 serotypes and 80 serotypes, and current vaccines can protect only a very small number of serotypes, and can not be defended if other serotypes invade after vaccination .

Fourth, considering that the highest efficacy of the developed and used foot-and-mouth disease vaccine is about 80% for cattle and 65-70% for pigs, the risk for foot-and-mouth disease development after vaccination is superior.

Therefore, it is difficult to achieve complete blockade of foot-and-mouth disease with the currently implemented foot-and-mouth disease vaccination policy alone.

1, the immune response of a host animal according to the foot-and-mouth disease vaccination or foot-and-mouth disease vaccination can be divided into innate immunity, humoral immunity, and cellular immunity .

Immune cells involved in innate immunity are known to be involved in macrophage, dendritic cell lymphocytes, especially natural killer (NK) cells, and lymphokine-activated killer (LAK) cells.

These immune cells induce the activation of T-lymphocytes and B-lymphocytes through the production of cytokines such as IFN-r and type I IFN, leading to a specific adaptive immune response. At this time. These immunities are induced by the production of proinflammatory cytokines and by the increase of migratory and chemotactic activity, and IFN-a and IFN-r are also known to play an important role in promoting innate immunity.

In addition, cytokine increases the activity of NK cells and macrophages as well as antiviral effects, thereby inhibiting the replication and spreading of foot-and-mouth disease virus in the host animal's body. Thus, it is very important to control foot-and- It plays a role.

Above all, foot-and-mouth disease is a very fast-spreading disease. Therefore, immunization, especially innate immunity, is required to defend during the period when defensive antibodies are formed even when an emergency vaccine is inoculated in the case of foot and mouth disease. Humoral immunity against foot-and-mouth disease is formed by the activation of monocytes, macrophages, and dendritic cells by antigenpresenting cells (APCs), in particular dendritic cells presenting antigen to B cells.

Humoral immunity against foot-and-mouth disease can lead to effective defense against reinfection in the host, and major defense by vaccination is through humoral immunity. One of the important roles of antibodies in such humoral immunity is to reduce the infectivity of foot-and-mouth disease virus by phagocytosis of antigen and antibody immune complexes.

Macrophages activate phagocytic cells within 4 days of infection or emergency vaccination and are important for early immune response and work without specific antibodies. When a specific antibody is formed, the phagocytosis is further activated by interaction.

IgM is produced 3-4 days after viral infection or vaccination, maximal at 1-14 days and then decreases. The major neutralizing antibody, IgG, is formed in the 4-7 days of immunity and is produced to a maximum after 2 weeks. In general, IgG1 has a higher titer than IgG2.

Activation of B cell immunity is mediated by the interaction of cytokine receptors (T cells) with Ig-like receptors on the cell surface and the physiological binding of B and Th cells to T helper (Th) cells, Interaction converts IgM to IgG. The cellular immunity of foot-and-mouth disease appears at the time of infection or vaccination.

In animals in which the host animal has the same antibody titer to the same antigen, the polymorphisms of the MHC molecule may differ in animal resistance and this plays a very important role in cellular immunity. Activation of B cells in cattle and pigs The production of antibodies is mainly associated with T cells (mostly CD4 +). Th cells mainly recognize the epithelial and nonstructural proteins and play an important role in defense immunity against viruses and antibody production. Th cells are antigen-stimulated B cells and effector cells for antibody production and are essential for the progression of cytotoxic T cell work. Effector cell immunity is involved in phagocytosis, antibody affinity and antibody concentrations to remove antibody / viral complexes.

Much attention has been paid to the use of natural minerals in off-shore livestock industry mainly through zeolite studies. Much research has been done since Mumpton and Fishman (1997) reported that zeolite as a feed supplementation promotes growth in pigs.

Zeolite is a material consisting of aluminosilicates such as SoltoB. It is reported by Airoldi et al. (1993) and Ma et al. (1979) that the widespread adsorption power due to the structure of the lattice pattern reduces the generation of ammonium in livestock manure And Castro et al. (1989) reported that adsorption of the toxin substances in the intestines could promote the efficiency of feed and promote the growth of livestock.

Coffey et al. (1989) reported on the effects of meat quality in pigs as well as growth promotion in the summer. These toxic adsorptions have been shown to increase not only growth but also fertility rates by Ramos et al. (1996) and Piva et al. (2000). Cole and Hutcheson (1990) The damage caused by transport heat can be reduced.

Effects on laying hens were reported by Elliot and Edwards (1991). In 2000, it was reported by Stanton (2000) that other nutrient minerals have been studied to increase the rate of growth in cattle feeds and to increase the number of sows in sows by Papaioannou (2002a, 2002b). In addition, after 1990, studies were continued to control the concentration of ammonium in the farm, and Ndegwa et al. (2008) reported the effect of lowering the ammonium concentration in the farm.

In addition to the studies by Holian et al. (1997) that zeolite-containing aluminosilicates are excreted in the macrophages and activated by macrophages, the zeolite- The effects of the changes and the resulting vaccination have not yet been studied.

The interest in the use of natural minerals in domestic livestock industry has been studied through the study of germanium complex mineral (SoltoB), which is a natural mineral composed mainly of aluminosilicate.

Kwon et al. (2003) reported an increase in growth rate in pigs when SoltoB was used as a feed additive. Chen et al. (2005) reported that SoltoB could be used as an antibiotic substitute for feed supplementation to increase the proliferative capacity of lymphocytes and monocytes in pigs. Then, the uptake rate of high protein nutrients in pigs was increased, butyric acid, acetic acid, propionic acid.

Lee et al. (2003) and Sarker et al. (2010) reported that the production of ammonium was reduced by the feeding of SoltoB in laying hens. Recently, Jung et al. (2010) reported that the administration of SoltoB enhances the immune response in experimental animals and increases the defense against viral diseases in pigs. Jung et al. (2012b) Increased defense against respiratory diseases has been studied and reported.

In addition, Jung et al. (2012a) reported that SoltoB inhibited the growth of Engerotoxin E. coli and Salmonella spp., Which are major causes of bacterial digestive diseases.

It is a main object of the present invention to provide a method for preventing the non-specific immune (natural immunity) of a host animal at the time of feeding by blending a predetermined amount of germanium complex mineral crushed into powder in an animal husbandry field, The present invention provides an immunomodulating material for preventing foot-and-mouth disease, which can increase the resistance to foot-and-mouth disease of foot-and-mouth disease and can increase the efficiency of foot-and-mouth disease vaccine, and a livestock feed composition using the same.

One aspect of the present invention is a germanium complex mineral containing 36 ppm of germanium and biotite, muscovite, feldspar, tourmaline, zircon, garnet, apatite and opaque minerals and containing iodine, cobalt, selenium and vanadium as auxiliary minerals The present invention provides an immune enhancer for preventing foot-and-mouth disease.

According to one aspect of the present invention, it is preferable that the germanium complex mineral useful for preventing foot-and-mouth disease is added at a rate of 0.1 to 3.0 wt% based on 100 wt% of the animal feed.

According to one aspect of the present invention, the auxiliary mineral component added to the germanium complex mineral may be 0.05 ppm of iodine, 10.00 ppm of cobalt, 5.00 ppm of selenium, and 74.20 ppm of vanadium.

According to one aspect of the present invention, the germanium complex mineral and the auxiliary mineral component added thereto may have a particle size of 75 μm to 1.0 μm.

Another aspect of the present invention relates to a method of preparing a feed containing 36 ppm of germanium and biotite, muscovite, feldspar, tourmaline, zucon, garnet, apatite and opaque minerals in a basic feed comprising corn, soybean meal, limestone, salt, vitamin premix, And 0.1 to 3.0% by weight of a germanium complex mineral added with iodine, cobalt, selenium and vanadium as auxiliary minerals. The present invention also provides a livestock feed composition using the immune enhancer for preventing foot-and-mouth disease.

According to one aspect of the present invention, the basic diet comprises 76.95 wt% of corn, 19.20 wt% of soybean meal, 1.20 wt% of fish meal, 0.75 wt% of limestone, 0.65 wt% of calcium phosphate, 0.25 wt% of salt, 0.20 wt% 0.10% by weight of linseed and 0.10% by weight of biocin. The feed composition can be prepared by adding 0.1 to 1.0% by weight of germanium complex mineral to the feed.

According to another aspect of the present invention, there is provided a method of preparing a basic feed comprising the following ingredients: corn 76.95% by weight, soybean meal 19.20% by weight, fish meal 1.20% by weight, limestone 0.75% by weight, calcium phosphate 0.65% by weight, salt 0.25% by weight, %, 0.10% by weight of linseed and 0.10% by weight of bioinch. The feed composition can be prepared by adding 1.0 to 3.0% by weight of germanium complex mineral to the pig feed.

According to the embodiments of the present invention described above, it is possible to increase the resistance to foot-and-mouth disease and to increase the efficiency of foot-and-mouth disease vaccine by enhancing nonspecific immunity (natural immunity) of the feed animals by feeding the basic feed supplemented with a germanium complex mineral, The specific adaptive immunity specific to foot-and-mouth disease can be effectively induced, and the occurrence of foot-and-mouth disease can be suppressed as much as possible.

BRIEF DESCRIPTION OF THE DRAWINGS FIG. 1 is a schematic diagram showing the immune response of a host following foot-and-mouth disease or foot and mouth vaccination.
FIG. 2 is a graph showing PI changes in bovine serum using the PrioCHECK FMDV type O ELISA kit.
FIG. 3 is a graph showing changes in IgM and IgG in serum after the first vaccination.
Fig. 4 is a graph showing changes in feces and IgA in saliva after vaccination. Fig.
FIG. 5 is a graph showing subpopulation of CD3 + lymphocytes prior to SoltoB feeding and changes after 23 weeks of feeding. FIG.
FIG. 6 is a graph showing subpopulation of CD4 + lymphocytes before SoltoB feeding and changes after 23 weeks of feeding. FIG.
FIG. 7 is a graph showing subpopulation of CD8 + lymphocytes prior to SoltoB feeding and changes after 23 weeks of feeding.
Figure 8 is a graph showing subpopulation of CD79a + PBMC before SoltoB feeding and changes after 23 weeks of feeding.
FIG. 9 is a graph showing subpopulation of MHC I and II lymphocytes before SoltoB feeding and changes after 23 weeks of feeding. FIG.
10 is a graph showing changes in the ratio of peripheral blood immune cells in cattle according to SoltoB administration.
FIG. 11 is a graph showing changes in peripheral blood composition in cattle according to SoltoB administration. FIG.
Figure 12 is a graph showing relative cytokines changes in cows following SoltoB feeding.
FIG. 13 is a graph showing the evaluation of lymphocyte proliferative ability in cattle according to SoltoB feeding. FIG.
14 is a graph showing changes in lysozyme activity in sera according to SoltoB administration.
15 is a graph showing blood IgG antibody levels before and after inoculation with foot and mouth disease virus vaccination in a laboratory unit.
16 is a graph showing blood IgG antibody production rate after foot-and-mouth disease vaccination in a laboratory unit.
17 is a graph showing blood IgG antibody levels before and after inoculation with foot-and-mouth disease vaccination in an outdoor farm unit.
18 is a graph showing blood IgG antibody production rate after foot-and-mouth disease vaccination after SoltoB administration in an outdoor farm unit.
19 is a graph showing the serum IgM antibody titer before and after foot-and-mouth vaccination.
20 is a graph showing CD4 + T lymphocytes in pig blood after foot-and-mouth vaccination.
FIG. 21 is a graph showing CD8 + T lymphocytes in pig blood after foot-and-mouth vaccination.
FIG. 22 is a graph showing CD4 / CD8 + T lymphocyte levels in pig blood after foot-and-mouth vaccination.
FIG. 23 is a graph showing the ratio of CD4 + / CD8 + T lymphocytes in pig blood after vaccination with foot-and-mouth disease.
24 is a graph showing changes in blood composition one week after the foot-and-mouth vaccination.
25 is a graph showing changes in blood composition after 4 weeks from the foot-and-mouth vaccination.
26 is a graph showing changes in blood composition 5 weeks after foot-and-mouth vaccination.
FIG. 27 is a graph showing the relative expression level of IFN-τ cytokine after foot-and-mouth vaccination.
FIG. 28 is a graph showing the relative expression level of TNF-.alpha. Cytokine after foot-and-mouth vaccination.
29 is a graph showing the relative expression level of IL-1 beta cytokine after foot-and-mouth vaccination.
FIG. 30 is a graph comparing the lymphocyte proliferative potency after vaccination against foot-and-mouth disease (unstimulated).
31 is a graph comparing the lymphocyte proliferative capacity after foot-and-mouth vaccination (LPS-stimulated).
32 is a graph comparing the lymphocyte proliferative capacity after foot-and-mouth vaccination (conA-stimulated).
33 is a graph showing changes in the activity of lysozyme in porcine serum after foot-and-mouth vaccination.
FIG. 34 is a graph showing changes in body temperature of each experimental group after an attack inoculation. FIG.
35 is a photograph showing the serum, the non-liquid and the saliva plaque assay of the unvaccinated group.
FIG. 36 is a graph showing changes in mini-pig antibody against foot-and-mouth disease virus structural protein (SP) and non-structural protein (NSP) during experimental period after foot-and-mouth attack.
FIG. 37 is a graph showing cytokine production in mini-pig serum after foot-and-mouth attack.
FIG. 38 is a graph showing the amount of cytokines produced at 96 hours after the stimulation of PBMCs in the mini-pig peripheral blood after foot-and-mouth attack with foot-and-mouth antigens.
FIG. 39 is a graph showing the results of proliferation of the immune cell PBMC in the blood of mini-pig after foot-and-mouth attack in relation to the foot-and-mouth disease antigen.

Hereinafter, the present invention will be described in detail with reference to specific embodiments thereof. However, the embodiments of the present invention can be modified into various other forms, and the scope of the present invention is not limited to the following embodiments.

Further, the embodiments of the present invention are provided to more fully explain the present invention to those skilled in the art. In addition, to include an element throughout the specification does not exclude other elements unless specifically stated otherwise, but may include other elements.

The immune enhancer for preventing foot-and-mouth disease according to the present invention contains 36 ppm of germanium, biotite, muscovite, feldspar, tourmaline, zircon, garnet, apatite and opaque mineral, and addition of iodine, cobalt, selenium and vanadium as auxiliary minerals Germanium complex mineral, and it is preferably added in an amount of 0.1 to 3.0% by weight based on 100% by weight of the animal feed.

The livestock feed according to the present invention enhances the resistance to foot-and-mouth disease by improving the efficiency of foot-and-mouth disease prevention vaccine by mixing a germanium complex mineral containing 36 ppm of germanium at a predetermined ratio to the corresponding livestock feed according to the growth state of the livestock .

In general, feeds are mainly composed of corn and wheat (soybean meal), and include fish meal, limestone, calcium phosphate, salt, lysine, biochin, vitamin premix and mineral premix.

More specifically, in the present embodiment, the feed is mixed in a ratio of 76.95 wt% of corn, 19.20 wt% of soybean meal, 1.20 wt% of fish meal, 0.75 wt% of limestone, 0.65 wt% of calcium phosphate, 0.25 wt% of salt, 0.20 wt% of vitamin mineral preparation, 0.10% by weight of neo and 0.10% by weight of bioinch, but the present invention is not limited thereto.

One embodiment of the germanium complex minerals to be applied to the present invention, SiO ₂ 76.7 wt%, Al ₂ O ₃ 10.8 wt.%, Fe ₂ O ₃ 2.01% by weight, CaO 0.12% by weight, MgO 0.47% by weight, K ₂ O 1.69 , 0.79 wt.% Of Na ₂ O, 0.45 wt.% Of TiO ₂ , 0.11 wt.% Of P ₂ O ₅ , and 6.56 wt.% Of other substances, but the present invention is not limited thereto.

In addition, the other substances may be composed of 0.05 ppm of iodine (I), 10 ppm of cobalt (Co), 5 ppm of selenium (Se), and 74.2 ppm of vanadium (V), but the present invention is not limited thereto.

At this time, the germanium complex mineral and the auxiliary mineral component added thereto may have a particle size of 75 μm to 1.0 μm, but the present invention is not limited thereto.

It is a non-specific immune enhancer similar to superantigen that activates T cells that play a major role in cellular immunity and has a very high affinity for major histocompatibility complex class II molecules, oxygen production, activation of proinflammatory cytokines such as interleukin IL-1a, IL-6, and TNF-a, thereby activating the immune system of the host animal.

Therefore, it enhances the defense ability against various pathogens penetrating from the outside by activating the innate / natural immunity of the host animal, enhances the humoral and cellular immunity of the host animal, and induces an active immune response when the host animal is exposed to the antigen Thereby increasing the resistance to foot-and-mouth disease and improving the efficiency of administering a foot-and-mouth disease vaccine.

One. Example  One

Example 1 was conducted to examine the efficacy of the germanium complex mineral (product name: 'SoltoB') for preventing foot-and-mouth disease in cattle.

1) Selection of test system

First, in an experimental farm, the presence of foot-and-mouth disease antibodies was checked in order to exclude the interference by the anti-idiotype antibody in the newborn calves. Then, individuals without foot-and-mouth disease antibodies were selected and treated with the SoltoB group (n = 45; 0.5% w / w) and non-receiving group (n = 44). To confirm the presence of FMDV before vaccination, the PrioCHECK FMDV type O ELISA kit (Prionics) was used.

Next, FMDV vaccination and sampling were performed. Decivac FMD DOE trivalent vaccine (Intervet), a nationally approved vaccine, was injected intramuscularly with 2 ㎖ of the dose, and boosting was inoculated at 4 weeks after the first vaccination.

Blood, feces, and saliva were sampled periodically from the day before the vaccination to the 6th month after the second vaccination. The collected blood was centrifuged at 1500 × g, 15 minutes, and 4 ° C. to separate the serum, which was immobilized at 56 ° C. for 30 minutes and stored at -20 ° C. At this time, the feces and saliva sampled with the swab were immersed in 1 ml of PBS for 1 hour at 4 ° C, and centrifuged at 1500 × g for 15 minutes at 4 ° C to collect the supernatant.

The current foot-and-mouth disease vaccine should be boosted at least once every 6 months after first vaccination in cattle, followed by boosting vaccination at 3-4 weeks after the first vaccination.

This is because permanent immunization is not formed by FMD vaccination. The ideal vaccine can be defined as rapid immune formation after vaccination, permanent translation by a single inoculation, maintenance of long-term immune formation, and distinction between outdoor infection and vaccination (Cox, 2009) How much maintenance is done can be an indicator of how much vaccine efficiency has increased.

In this study, the duration of antibody maintenance was compared by sampling until 6 months after the second inoculation, which is an additional need for inoculation, to determine how high the antibody level is maintained in the vaccinated herds. At this time, the inhibition percent (PI) of the serum collected by sampling with the PrioCHECK FMDV type O ELISA kit (Prionics) was used as an indicator of the antibody value, and the high PI value was reversely calculated for the antibody. Here, if the PI value is 50 or more, it is positive. If it is less than 50, it is judged as negative.

PI = 100 - (OD-negative control serum OD / Positive control serum OD) × 100

Referring to FIG. 2, after the first vaccination, both the SoltoB and non-Solvay groups showed the same level of PI elevation. Thereafter, PI increased steadily until 4 weeks after boost vaccination at 2 weeks after the first vaccination. PI increased again after 4 weeks of boosting vaccination, and PI increased at 10 weeks Respectively.

Thereafter, the PI value showed a gentle curve and its value decreased. At the time when the reinforcement vaccination was required, the PI value started to decrease again. There was no significant difference between the SoltoB and non - SoloB groups until the 27th week after vaccination, but the SoltoB group showed higher PI than the non - SoloB group (p <0.05).

2) Initial reaction of antibody production

Referring to FIG. 3, the comparison of the initial reaction of antibody production can be judged as to how fast the antibody with higher activity appears and the time of class switching of IgM and IgG. IgM, which is used as an indicator of early humoral immune response, rapidly appears in the serum within 3-4 days after vaccination. However, IgG has a strong binding force with antigen and neutralization power since it has weak binding ability with antigen and low antigen neutralization ability. . In this experiment, we compared the initial reaction of IgG by the comparison of the time of onset of IgM and the class switching time of IgG.

Serum samples were collected before and after the first vaccination on the 1st, 2nd, 3rd, and 7th days after the 1st vaccination and the 2nd, 3rd and 4th weeks after the first vaccination. Respectively. To determine specific IgM and IgG for foot-and-mouth disease, we used PrioCHECK FMDV type O ELISA kit (Prionics), horseradish peroxidase conjugated rabbit anti-IgM (Bethyl) and horseradish peroxidase conjugated sheep anti-bovine IgG. Each antibody titer was measured.

As a result, IgM appeared in the SoltoB group on the first day after the vaccination, but in the non - treated group, the IgM appeared on the third day after 7 days (p <0.05) IgM levels were higher than those of non - treated group.

At this time, the titer of IgG tended to increase after the first vaccination, and titer decreased after 3 weeks. This tendency is generally seen after vaccination, A boosting vaccine (secondary vaccination) should be administered on the week.

There was no significant difference between the SoltoB group and the non-treated group until two weeks after the vaccination, but the SoltoB group showed significantly higher antibody titers than the non-treated group at the 4th week after the first vaccination (p &Lt; 0.05).

Class switching periods were between 1 week and 2 weeks after the first vaccination in both SoltoB and non - Solvay groups. SoltoB group showed higher IgM and IgG activity than non - Solvay group.

3) Comparison of mucosal immune responses

4, mucous membrane is a place where host first contacts FMDV. Formation of mucosal immunity is very important for blocking infection of early FMD, but mucosal immune response is not effectively induced by injection vaccine. (Cox, 2009).

This mucosal immunity is mainly due to immunoglobulin of IgA. To determine the difference of mucosal immunity between SoltoB and non-saline group after FMD vaccination, horseradish peroxidase-conjugated sheep anti-bovine IgA (Bethyl ) And the fecal samples and the saliva of the undiluted solution were used to perform the same ELISA as the experiment method in which the activity of IgM and IgG was confirmed.

As a result, it was difficult to confirm the expression of IgA in the feces, but in saliva, IgA titer was higher in the SoltoB group than in the non - treated group at 2 weeks after the first vaccination (p <0.05).

At this time, the failure to confirm the expression of IgA in the feces was due to the fact that the injection vaccine did not induce strong mucosal immunity, but the sampling was done through the swab, so the variation was increased and the amount of feces through the swap was enough to measure IgA Of the total population.

In the case of saliva, there was a high variation and a deviation from the overall IgA tendency at 10 weeks and 28 weeks after the first vaccination, and it was also judged that the variation was measured largely because the sampling had to be done through swab.

In the IgA results of these saliva, the highest IgA was measured between 3 and 6 weeks after the boosting vaccination, ie between 7 and 10 weeks after the first vaccination, and thereafter the IgA decreased until the time when additional boosting vaccination was needed . In the SoltoB group, the increase of IgA was observed earlier than that of the non - treated group, and the activity was also higher.

4) Analysis of Peripheral Blood Lymphocyte Ratio by SoltoB Feeding

According to the results of the above experiment, the hematological and immune cell effects of SoltoB administration on cows were analyzed as follows.

As shown in Fig. 1, the change of immune ability is caused by a change of immune cells involved in immunity. When the immune system changes due to infection or vaccination, the first thing that happens is the change in the proportion of immune cells involved or the increase or decrease in absolute value. At this time, the CD4 + receptor expressed in the immune cells such as monocytes, T helper cells, marcophages, and dendritic cells is an important glycoprotein showing the activity of lymphocytes.

CD4 + receptors interact with T cell receptors of antigen presenting cells (APCs), which are very important for the initiation of immune responses, and induce a strong immune response. They bind to major histocompatibility complex class II (MHC class II) Is an important factor. The CD8 + receptor is also a glycoprotein that acts on the T cell receptor, like the CD4 + receptor, to induce immunity and induce specific immunity. In particular, CD8 + binds to MHC class I to induce immunity, and acts on cytotoxic T cells and plays an important role in the treatment of infected cells.

The CD4 + and CD8 + receptors, which play an important role in immunity and are used as an indicator of immunity, are also good indicators of immune function in combination with MHC molecules. MHC molecules distributed on the cell surface of all vertebrates play a role in presenting antigen to immune cells. Antigens infiltrating the host are phagocytosed by antigen presenting cells and then degraded into epitopes capable of inducing immunity, which are then presented to immunocompetent cells by MHC molecules, resulting in an immune response.

MHC I binds to CD8 + and shows immunity against intracellular infection or viral infection. MHC II can be expressed on the surface of all cells, but it is mainly distributed in antigen presenting cells (APCs) which are mainly immune cells. Immunocytochemicals such as MHC II, which is most abundant in dendritic cells, It is an important molecule for.

In addition, MHC II plays an important role in inducing the production of antibodies by activating B cells together with native T cells. In addition to MHC II, important B cells have an indicator of CD79a, an intracellular molecule, which plays an important role in the production of antibodies, as mentioned above.

CD3 is also known to be an indicator for the distribution of T cells that are important for immunity. In order to confirm the effect of SoltoB on cytotoxicity of bovine immune cells, immunocytes were isolated from peripheral blood of bovine animals and the distribution of each immune cell was confirmed as follows.

In order to isolate immune cells from the peripheral blood of bovine animals, the SoltoB group (n = 5) and the non-treated group (n = 5) were set up to collect blood of 50 cc or more in the jugular vein. Lt; / RTI &gt; 30 ml of diluted blood was carefully loaded into 20 ml of Histopaque-1077 (Sigma) and centrifuged at 400 xg for 30 minutes at 20 ° C (centrifugal condition accel 0, brake 0) to remove peripheral blood mononuclear cells, PBMC).

Separated PBMCs were washed three times with RPMI 1640 medium (centrifugation condition 300 × g, 10 min, 8 ° C) and finally cultured at a cell number of 5 × 10 ⁶ cells / ml. The cultured cells were stimulated with 5 μg / ml of DPBS, concanavlin A (ConA, Sigma), 5 μg / ml of lipopolysaccharide (LPS, Sigma) and 5 μg / ml of lipopolysaccharide (LPS, Sigma) Lt; / RTI &gt;

Cells cultured for 96 hours were collected, washed twice with DPBS (Difco) supplemented with 2% FBS (Difco), suspended in 200 μl of 3% formaldehyde solution and fixed at 22 ± 3 ° C for 20 minutes to fix the cells .

The immobilized cells were washed twice with DPBS supplemented with 2% FBS and then suspended in 200 μl of a DPBS (permeabilization solution, PS) containing 0.2% Tween-20 (Sigma) and incubated at 37 ° C for 15 minutes. The membrane was dissolved.

The immobilized cells were washed twice with DPBS supplemented with 2% FBS and suspended in DPBS supplemented with 100 μl of 2% FBS. To prevent non-specific reactions, Of normal IgG.

The Fc receptor was reacted with an antibody against each indicator conjugated with the fluorescent substance in the blocking state.

Cells bound with antibodies to each indicator were examined for subpopulation of isolated PBMCs by measuring fluorescence substances bound by flow cytometry (FACS, BD). The results are shown in Table 1 below.

Target function Antibody Fluorescent material company CD3 Antigen presentation and immune induction as T cell receptor Hamster anti-bovine CD3 FITC abcam CD4 Immune induction with Th 1 activity Mouse anti-novine CD4 PE US Biological CD8 Virus clearance and related cellular immune activity Mouse anti-novine CD8 PE LS Bioscience CD79a Activity of B cells producing antibodies Mouse anti-novine CD79a PE abcam MJC 1 CD8 Receptor Binding Immunogenesis Mouse anti-novine MHC I FITC Novus Biological MHC II CD4 Receptor Binding and Immunogenesis Mouse anti-novine MHC II PE abcam

CD3 + lymphocytes

Referring to FIG. 5, the blood of all calves before SoltoB feeding was sampled and non-subpopulation of CD3 + lymphocytes was examined. As a result, the average CD3 positive lymphocytes were 65.4% and there was no difference between the two experimental groups. After 23 weeks of feeding SoltoB, the proportion of SoltoB group was 93.8% and 94.3% of non - treated group, respectively. The increase in the proportion of CD3 + lymphocytes in both groups, compared to before SoltoB feeding, was probably due to the growth of the calf, the experimental animal during the SoltoB feeding trial.

CD4 + lymphocytes

Referring to FIG. 6, there was no significant difference between the SaltoB pre-pay group and the non-pay group. After the SoltoB test, the subpopulation of the SoltoB group was 13.9%, which was lower than that of the nonproliferation group (19.2%). However, statistical significance was not confirmed due to the high variation.

CD8 + lymphocytes

Referring to FIG. 7, there was no significant difference between the pre-pay group and the non-pay group. After the SoltoB test, the subpopulation of the SoltoB group showed 12.0% lower CD8 + subpopulation compared with 14.9% of the nonproliferation group.

CD79a + PBMC

Referring to FIG. 8, there was no genetic difference between the SoltoB pre-pay group and the non-pay group. 23 weeks after starting the SoltoB trial, the SoltoB group showed a decrease in CD79a + PBMC subpopulation compared to the non-treated group. The CD79a + PBMC subpopulation in the SoltoB group was 4.7% and the CD79a + PBMC subpopulation in the SoltoB non - treated group was 6.7%.

MHC  I and MHC II lymphocytes

Referring to FIG. 9, it can be seen that there is a difference in the subpopulations between the pre-pay group and the non-pay group. This seems to be the individual car of the calf used in the experiment. There was no difference in MHC I expression between the SoltoB non-treated group and the SoltoB treated group after 23 weeks of SoltoB treatment. In contrast, the subpopulation of MHC II was significantly increased in the SoltoB group compared to the SoltoB non-treated group (p <0.05).

As shown in FIG. 10, in the SoltoB group, the subpopulation of CD 79a, CD4, and CD8 decreased compared to the non-treated group, and the subpopulation of the lymphocytes and the MHC I There was no difference in expression and MHC II expression was significantly increased.

CD79a and CD4 were not statistically significant due to differences in variation. On the other hand, in MHC II, the expression subpopulation was significantly increased, because the aluminosilicate, which is the main component of SoltoB, was stimulated by macrophage and increased immunity with IFN-r secretion. Holian et al. (1997) and Mollick (1989), which is consistent with previous studies. Based on the results of the previous studies and the results of this study, it is expected that the administration of SoltoB may increase the expression of MHC II and thus the immune enhancement effect.

5) Changes in peripheral blood composition of cattle according to SotoB feeding

To determine the changes in peripheral blood composition in the cow following SoltoB treatment, peripheral blood was collected from the bovine jugular vein at 0, 1, 3, 8, 11, and 23 weeks after vaccination and treated with EDTA. The composition of WBC, lymphocytes, monocytes, neutrophils, eosinophils, and basophils related to immunity and defense was confirmed using Compteur Analyzer d'Hematologie Ms 9-5, MELET SCHLOESING Laboratoires, France.

11, significant differences in WBC, lymphocytes, neutrophils, and basophils were found between the two groups before the SoltoB feeding trial, which was conducted to transport the calf to start the experiment, It is judged to be the result of the external factor caused by the individual difference caused by the stress caused by the change. There was no significant difference between the two groups after the start of the SoltoB feeding trial.

6) Changes in relative cytokines expression following SoltoB treatment

Cytokines are substances that induce immune cell signaling and immune response in the immune system and play a very important role in immune formation. IFN-r is a cytokine that is predominantly identified in immunological responses to viral diseases and intracellular bacterial infections, and plays an important role in cellular immunity and acquired immunity. IL-1 is a cytokine secreted mainly by macrophages, monocytes, dendritic cells, and other immune cells. IL-4 is a cytokine known to induce the differentiation of non-differentiated native T cells and to induce the proliferation of B cells and T cells. Differentiated and proliferated B cells differentiate into plasma cells and play an important role in antibody production.

IL-6 is a cytokine that is mainly produced by macrophages stimulated by pathogen associated molecular pattern (PAMP) and is mainly involved in fever and acute immunity.

To determine the effect of SoltoB on cytokines expression in cows, PBMCs were isolated from the sampled blood and RNA was extracted using RNeasy mini kit (Qiagen, Valencia, CA, USA).

The extracted RNA was synthesized by reverse transcription kit (Qiagen), and the relative cytokines expression levels of IFN-r, IL-1b, IL-4, and IL- -Gene SYBR Green PCR kit (Qiagen) and Rotor-Gene Q (Qiagen), and the results are shown in Table 2 below.

Gene Forward reverse anealing
Temperature (℃) accession No IFN-τ ATAACCAGGTCATTCAAAGG ATTCTGACTTCTCTTCCGCT 52 M29867 IL-1? GATGCCTGAGACACCCAA GAAAGTCAGTGATCGAGGG 53 M37210 IL-1? CAAGGAGAGGAAAGAGACA TGAGAAGTGCTGATGTACCA 53 M37211 IL-4 CAAAGAACACAACTGAGAAG AGGTCTTTCAGCGTACTTGT 54 M77120 IL-6 TCCAGAAGGAGTATGAGG CATCCGAATAGCTCTCAG 52 X57317

The real-time PCR was performed at initialization step 95 ° C / 1 min, denaturation step 94 ° C / 1s, annealing step 5 °, optimal extension annealing temperature 5 sec, extension step 72 ° C./10s and denaturation extension 50 cycles .

12, the expression of IFN-r was significantly higher in the SoltoB group than in the non-treated group (p <0.05) at the 3rd and 8th weeks after the feeding, and in the SoltoB group (P <0.05) compared with non - treated group.

These results are in agreement with the results of Albina et al. (1991) and Jung et al. (2010) that alumino-silicate is stimulated by macrophage to induce immune response and promote IFN-r production.

SoltoB, fed as a feed additive, stimulates macrophages in macrophages in bovine animals, thereby increasing the expression of IL-1 family cytokines and promoting the production of IFN-r, which may play an important role in viral diseases and acquired immunity Seems to be. In addition, IL-4 and IL-6 showed a higher expression level than the non-treated group in the SoltoB group.

7) Evaluation of lymphocyte proliferation by SotoB

In the immunocompetent lymphocytes, rapid proliferation is induced by stimulation of certain mitogens. In order to evaluate the lymphocyte proliferation by SoltoB administration, PBMCs isolated from the peripheral blood of bovine animals are stimulated with respective mitogens or DPBS Respectively.

The cells were cultured in a 96-well plate at a concentration of 5 × 10 ⁶ cells / ml in a concentration of 5 × 10 ⁶ cells / ml in the SoltoB-treated group and the non-treated group. ConA and B-lymphocytes mitogen LPS At a concentration of 5 μg / ml for 96 hours at 37 ° C and 5% CO ₂ , respectively. 10 μl of 10 × Prestoblue (Life technologies), a cell viability reagent, was added and incubated for 2 hours. The absorbance at 560 nm was measured to evaluate the proliferative activity.

As a result, as shown in FIG. 13, it was confirmed that the peripheral blood lymphocytes isolated from the group treated with SoltoB showed higher proliferative capacity than the peripheral blood lymphocytes isolated from the non-treated group (p <0.05).

8) Evaluation of lysozyme activity in serum by SoltoB administration

Lysozyme is mainly secreted mainly in macrophage-like phagocytic cells, and is a method mainly used to evaluate the activity of phagocytic cells. To evaluate the activity of lysozyme in serum according to SoltoB supplementation , the resolution of sampled serum against M. lysodeikticus (Sigma) was investigated. Standard curves and serum samples were prepared and evaluated by Kreukniet (1994) to assess the resolution of M. lysodeikticus . Crystalline lysozyme was dissolved in the concentrations of 0, 0.125, 0.25, 0.5, 1.0, 2.0, 4.0 and 8.0 ㎍ / ㎖ and prepared as a standard.

To each well of a 96-well plate, 200 ㎕ of M. lysodeikticus dyddor at a concentration of 0.6 ㎍ / ㎖ was added and 20 l of standard lysozyme or serum prepared beforehand was added. The incubation was carried out at 41 ° C for 1 hour and the absorbance was measured at intervals of 15 minutes (540 nm). The lysozyme activity of the sample was determined by substituting the standard curve for the change of absorbance with time of the sample.

As a result, as shown in Fig. 14, higher lysozyme resolution was observed at 8 weeks and 20 weeks in serum of the SoltoB-fed group than in the non-treated group (p <0.05).

These results are consistent with the findings that the SoltoB-fed group showed higher IL-1 family cytokine expression and IFN-r expression than the non-treated group, and that IFN-r induces macrophage activity 1991), which is consistent with the previous paper.

Therefore, when the germanium biotite of the present invention is fed to cattle, the specific immune response (innate immunity) of the host animal is enhanced to increase the resistance to the foot-and-mouth disease and the specific adaptive immunity ), It is possible to suppress the occurrence of foot and mouth disease as much as possible.

9) Sintering

The current foot-and-mouth disease vaccine requires boosting vaccination after first vaccination in cattle, which is known to be about 3-4 weeks after the first vaccination. In addition, since it is not permanently immunized by the vaccination, reinforcement vaccination is necessary at 6 months after the second vaccination, and reinforcement vaccination should be continuously performed every 6 months thereafter. In the analysis of the effect of SoltoB on antibody maintenance period after vaccination, the SoltoB group showed higher antibody titers at 6 months after the vaccination than the non-treated group (p <0.05).

The increased efficacy of the vaccine is a faster and higher rise in antibody titers. To analyze the effect of SoltoB on the initial effects of foot-and-mouth disease vaccines, an important role for IgM and subsequent neutralizing antibodies used as indicators of early humoral immune responses And the time at which these two types of humoral immunoglobulin were converted was confirmed. As a result, the production of IgM was rapidly observed and the activity of SoltoB group was higher than that of non - treated group (p <0.05).

The appearance of early IgG did not show any difference between the two groups, but in the 4th week when boosting vaccination was required, the SoltoB group showed a higher IgG titer than the non - treated group (p <0.05). There was no difference in class switching between IgM and IgG. Injection vaccine was not known to induce mucosal immunity strongly, but mucosal immunity is very important in defense against disease because the first contact of foot-and-mouth disease virus with host is mucous membrane.

To investigate the effect of SoltoB on vaccine efficacy, we compared the activity of globulin IgA, a globulin of spot immunity, in saliva and feces. In the case of IgA in the feces, it was difficult to measure the IgA due to the characteristics of the fecal samples. As a result, the tendency was not confirmed either. In the salivary IgA, SoltoB group showed faster IgA than non - treated group (p <0.05). In addition, SoltoB group showed higher IgA titer than non - treated group (p <0.05). These results confirm that the SoltoB benefit can make the effect of the existing vaccine more rapid and last longer than the high reverse.

In order to scientifically demonstrate the immune enhancement effect that SoltoB is likely to be a factor in enhancing the effect of vaccine, changes in hematologic and immune cell morphology and macrophage activity were tested after SoltoB treatment. For this, SoltoB and non-salvage groups were established and blood samples were collected to analyze peripheral blood immune cells. SoltoB treatment group induced MHC II activity at 23 weeks after SoltoB treatment (Holian et al., 1997 ) And Mollick et al. (1989).

In addition, the subpopulation of CD79a, CD4, and CD8 was decreased in the SoltoB group compared to the non-treated group, and there was no difference in the expression of MHC I and subpopulation of the whole lymphocytes. CD79a and CD4 were not statistically significant due to differences in variation. However, the fact that MHC II, which plays an important role in the initiation of the immune response, was increased by the SoltoB diet, confirming that SoltoB treatment can induce rapid action of the immune system.

In addition to the subpopulation of immune cells in the supernatant, the immunoreactivity and immunoreactivity of cytokines were significantly increased in the SoltoB group compared to the non - treated group (p <0.05).

In addition, the expression level of cytokines mRNA of peripheral blood immune cells was analyzed and it was confirmed that expression of IFN-r and IL-1 family was significantly increased in SoltoB-fed group (p <0.05).

In addition, the expression level of cytokines mRNA of peripheral blood immune cells was analyzed and it was confirmed that expression of IFN-r and IL-1 family was significantly increased in SoltoB-fed group (p <0.05). These results are consistent with the results of Albina et al. (1991) and Jung et al. (2010) that aluminosilicates stimulate the production of IFN-r as a result of immune response to macrophage stimulation. The results of the increased Sol-B treatment of IFN-r and IL-1, which play a role, indicate that SoltoB supplementation can increase the cellular immune response.

In addition, a subset of CD4 + / MCH II / IFN-r / T cells was obtained by performing this task based on a previous study (Parida 2009) that further activates the antigen-presenting ability of APCs, Experimental results confirmed that the efficacy of the vaccine increased due to SoltoB treatment.

In addition to IFN-r and IL-1, IL-4 and IL-6 mRNA levels were increased in the peripheral blood mononuclear cells of the SoltoB group, but statistical significance was not observed. In addition to analyzing immune cells, we analyzed the differences in the composition of peripheral blood. Significant results between the two groups were difficult to identify. This seems to be due to the fact that the composition of the simple blood is largely changed by the body's reaction by the direct antigen such as infection of the disease, vaccination and trauma rather than change by the immunity enhancement.

The activity of macrophages was assessed by measuring the activity of lysozyme, which was confirmed at the serum level that the SoltoB group had higher activity than the non-treated group. This is also due to the fact that the SoltoB benefits from promoting the activity of macrophages in accordance with the preceding article. Based on the above results, it can be concluded that the effect of immune enhancement of SoltoB is mainly due to the increase of macrophages activity and dendritic cell antigen presentation ability with respect to cellular immunity, can do.

In other words, the effect of SoltoB on the foot-and-mouth disease vaccine and the analysis of the immune enhancement result showed that SoltoB treatment increased the cellular immunity and increased the defense effect against foot-and-mouth disease by increasing the effect of FMD vaccine The risk was reduced.

2. Example  2

Example 2 was conducted to examine the efficacy of the germanium complex mineral (product name: 'SoltoB') for preventing foot-and-mouth disease in pigs.

1) Selection of test system

First, the slaughterhouse was completely fumigated with formalin one week before entering the house and then completely ventilated using the hood. From the farms where no foot-and-mouth disease has ever occurred, 8-week-old weaned pigs (average 22 kg) were stocked as breeding stocks.

Fifteen piglets were randomly divided into three groups. Control (control) was fed normal pig feed, and 1% soltoB group was fed a mixture of 3% (W / W) soltoB in common pig feed.

The temperature and humidity in the kennel were maintained at 19-22 ℃ and 45-55%, respectively, and experiments were conducted in a specific pathogen-free (SPF) facility. Feeds were fed unlimitedly, and negative water was fed autonomous water. The diets were fed in advance for 2 weeks before the vaccination.

- Group separation: 5 for each group

- Control (control): General feed and vaccination

- 1% soltoB feed group: Feed 1% (w / w) soltoB in feed and vaccination

- 3% soltoB group: Feeding with 3% (w / w) soltoB in feed and vaccination

2) FMDV vaccination

Two weeks after entering the pig, Aftopor® (Merial), an inactivated refill and remedy vaccine currently available in Korea, was inoculated intramuscularly by 2 ml into the neck of pigs. To test the effect of SoltoB on the effects of foot and mouth disease virus vaccination, weekly hemostasis was performed in the jugular vein of piglets from 2 weeks before vaccination to 5 weeks after vaccination.

3) Confirmation of antibody production ability

IgG is a major neutralizing antibody that is formed after vaccination. As the level of IgG in the body increases, it can be considered that immunity against disease is further improved. Therefore, by measuring the IgG antibody level after vaccination, it can be confirmed whether the immune response to a specific disease is increased.

In order to confirm the IgG antibody production ability in this experiment, blood was collected from piglets two weeks prior to vaccination and five weeks after vaccination. Serum IgH antibody levels were measured using the PrioCHECK® FMDV type O ELISA kit from Prionics. In the final step of the experiment, the absorbance was measured (450 ㎚) and the percentage inhibition (PI) was calculated by following the instructions of the kit. The PI value was 50% Among the individuals with FMDV antibody, the antibodies were judged to be higher when the PI value was higher.

Referring to FIG. 15, the PI value of each group before FMDV vaccination was 29.17 in the control group, 22.44 in the 1% soltoB group, and 25.86% in the 3% soltoB group. However, after 1 week of FMDV vaccination, the control group was increased to 45.15 in the control group, 45.15 in the control group, 45.15 in the soltoB group and 55.73 in the 3% soltoB treatment group, and 54.40 in the control group, 57.67 in the control group, 57.67 in the control group, Showed an antibody titer of 76.06, indicating that antibody titer was significantly increased compared to the control group (p <0.05).

At 3 and 4 weeks after vaccination, antibody titers in the 3% SoltoB group remained high in the control group. In the 3rd week, antibody titers in the control group were 60.00, whereas antibody titers in the 3% SoltoB group (P <0.05). The antibody titers in the control group were significantly higher than those in the control group (65.05 versus 81%, respectively) in the 3% SoltoB group (p <0.05) .

The results showed that the group fed with 3% SoltoB had higher IgG antibody against FMDV than the control group. These results suggest that FMDV-specific IgG antibodies are increased by Cliptox and Song et al. (2009) report that IgG antibodies against FMDV were increased when ginseng stem-leaf saponin and mineral oil were applied. ). Also, this may be related to the report of Jung et al. (2010) that SoltoB increases the antibody titer of PCV2 virus in pigs.

4) Identification of antibody production rate

In the case of foot-and-mouth disease vaccines, even if the best-developed vaccines are developed, the highest efficacy of vaccines in pigs is generally only 65-70%. Thus, vaccine efficiency may be enhanced if the antibody titer can be promoted following vaccination.

Therefore, in this experiment, antibody production rates were compared to determine whether antibody production was promoted after SoltoB administration. The detection of antibody production was carried out in the same manner as in the experiment for confirming antibody production ability. However, the antibody production rate was calculated using the method of dividing the number of males that showed positive antibody per whole marrow and multiplying by 100.

As a result, as shown in Fig. 22, antibody production was observed at 20% in the control group, 40% in the 1% SoltoB group and 60% in the 3% SoltoB group in the first week of inoculation. In the second week, the antibody production rate reached 100% in the 3% SoltoB group, but only 60% in the control group. In the 4th week, the antibody production rate was 100% in both the 1% SoltoB and 3% SoltoB groups, but the control group remained at 80%. It was not until 5th week that the antibody production rate of the control group reached 100% there was.

Therefore, the SoltoB group was more rapidly produced after the vaccination than the control group, indicating that the SoltoB group was more rapidly produced after the vaccination than the control group. It was confirmed that the antibody production by the vaccine is promoted.

On the other hand, in order to confirm the effect of SoltoB on the antibody production of FMDV vaccine in actual laboratory farms as well as laboratory units, a pig farm was selected, and SoltoB was fed on the farm. Blood was collected from 30 birds one month before and one month after each vaccination. Pre-treatment of the collected blood was carried out in the same manner as in the previous method and stored at -20 ° C until the measurement.

The following is a comparison of antibody production and antibody production in field farms.

5) Determination of antibody production ability and confirmation of antibody production rate

In order to confirm the IgG antibody production ability against serum FMDV, the same method as that used for confirming the antibody production ability was used in the above experiment for measuring the antibody activity.

As a result, as shown in Fig. 17, the antibody level of the control group before FMDV vaccination was 21.68 and that of SoltoB group was 17.23, indicating that FMDV antibody was negative. However, after 1 month of FMDV vaccination, antibody titers increased in both groups, indicating that the antibodies were positive.

In particular, antibody titers in the SoltoB group were significantly higher than those in the control group (p <0.01), indicating that antibody titers in the SoltoB group were significantly higher than those in the control group ).

These results are similar to those obtained in the previous laboratory experiments. Therefore, SoltoB can be used to increase antibody titers against foot-and-mouth disease viruses in general outdoor farms as well as experimental units.

6) Comparison of antibody production rate in farm units

Referring to Figure 18, antibody production rates were expressed using the same method as in the previous laboratory unit experiments. As a result, antibody production was 86.67% in the control group and 90% in the SoltoB treatment group at 4th week of the vaccination.

Therefore, the antibody production rate of SoltoB group was higher than that of control group. These results are similar to those of the laboratory-based experiments, and SoltoB can increase vaccine efficiency by increasing antibody production to foot-and-mouth disease vaccines in field farms.

7) Initial reaction of antibody production

IgM is the first antibody formed within 3-4 days of vaccination and is used as an indicator of the initial response of antibody production. IgM is later transformed into a major neutralizing antibody, IgG, by the interaction of T-B cells, and plays an important role in immune formation by the vaccine expressing the immune response.

In this experiment, we tried to compare the initial reaction of IgM antibody by measuring the IgM antibody. For this purpose, 3 ml of peripheral blood was collected from the jugular vein of each group before vaccination and at 1 and 2 weeks after vaccination. Serum was separated from the collected blood and used in this experiment.

To determine the IgM in the serum, a PrioCHECK® FMDV type O ELISA kit and a horseradish peroxidase conjugated goat anti-pig IgM secondary antibody (AbD serotec) were used. The absorbance was measured at the final stage of the experiment (405 nm) Was confirmed. The comparison of IgM antibody titers was considered as the higher the absorbance and the higher the antibody titer.

As shown in FIG. 19, the control group was 1.11, the control group was 1.11, the 1% SoltoB group was 1.25, and the 3% SoltoB group was 0.69 before the FMDV vaccination. And increased to 1.33 in the SoltoB group.

3% SoltoB group showed significant increase in IgM antibody compared to control (p <0.05). This result is similar to that of Mayr et al. (2001) in which IgM antibody and IgM antibody were increased when the capsid and proteinase coding regions of FMDV were applied to adenovirus 5 lacking replication when applying FMDV vaccine. Therefore, when the IgM antibody titer is increased, the IgG antibody titer is also increased, which is considered to increase the protection against FMDV.

8) Analysis of Hematological and Immune Cell Effects on SoltoB Feeding in Pigs

The ratio of CD4 + T cells to CD8 + T cells is an indicator commonly used to measure immune function and response when analyzing the ratio of peripheral blood lymphocytes to SoltoB. A low CD4 +: CD8 + ratio is more common in immunosuppressive or acute viral diseases, while a high CD4 +: CD8 + ratio is more common when chicken immunity is enhanced.

In this example, 3 ml of peripheral blood was harvested from the jugular vein of a pig at 1-5 weeks after vaccination and compared with the same amount of PBS to compare the ratio of lymphocytes in the peripheral blood according to SoltoB administration. Diluted peripheral blood was carefully raised on 3 ml of Lymphoprep (Axis-shield), centrifuged at 800 × g for 20 minutes, and lymphocytes were isolated. Lymphoprep TM (Axis-shield, Oslo, Norway) was used to separate lymphocytes from the blood. The separated lymphocytes are subjected to measurement by washing three times with, cold PBS was antibody and 30 minutes of reaction, which is shown below was diluted with the number of lymphocytes in the 5.0 × x 10 ⁶ cell / ㎖ concentration.

FITC anti-pig CD4a (help T cell) and PE anti-pig CD8 (cytotoxic T cell) antibody for 30 min in the dark room. After the reaction, the cells were centrifuged twice, and the cells were mixed with 1 ml of PBS. The ratio of lymphocytes in peripheral blood was measured using a flow cytometer (FACSCalibur FACS, BD Biosciences, USA).

20 and 21, the ratio of CD4 + T cell and CD8 + T cell was not significantly changed in each group. Referring to FIGS. 22 and 23, the CD4 + / CD8 + ratio was also significantly No changes were observed.

9) Changes in blood composition of pigs according to SoltoB feeding

24 to 26, peripheral blood was collected from the jugular vein of pigs at the 1st, 4th and 5th weeks after the vaccination in order to confirm the change in the blood composition of the pig according to the SoltoB administration, Forcyte ™, Oxford Science Inc., UK) were used to examine changes in absolute levels of white blood cells including Neutrophils, Lymphocytes, Monocytes, Eosinophils, and Basophils. As a result, there was no significant difference in the peripheral blood leukocyte counts.

10) Survey of relative cytokines expression by SoltoB administration

After solubilization with SoltoB, blood was drawn from the jugular vein of the pigs, and the lymphocytes were separated from the blood and RNA was extracted from the RNeasy mini kit (Qiagen, Valencia, CA, USA). RT-PCR was performed using the reverse transcription kit (Qiagen). The relative expression levels of TNF-α and IFN-τ were measured using the MyiQ ™ real-time PCR detection system (Bio-Rad, Hercules, Calif., USA), and the results are shown in Table 3 below.

Gene Forward Reverse accession No Beta-actin CAGGTCATCACCATCGGCAACG GACAGCACCGTGTTGGCGTAGAGGT U07786 TNF-a CCTCTTCTCCTTCCTCCTG CCTCGGCTTTGACATTGG NM_214022 IL-1? GGCCGCCAAGATATAACTGA GGACCTCTGGGTATGGCTTTC NM_214055 IFN-τ CAAAGCCATCAGTGAACTCATGA TCTCTGGCCTTGGAACATAGTCT X53085

The real-time PCR conditions were Initialization step 95% C / 5min, Denaturation step 94 ° C / 30s, Annealing step 57 ° C / 30s, Extension step 72 ° C / 45s and Denaturation-Extension 35 cycles.

27 to 29, it was confirmed that the IFN-r level of the SoltoB-fed group was significantly increased after one week of the vaccination. In contrast, TNF-α IL-β levels were not significantly different in each group. This result is similar to that reported by Jung et al. (2010) that SoltoB increases the expression of IFN-τ cytokines in mice. Increased expression of cytokines with representative immunopotentiating effects such as IFN-τ may facilitate the process of acquired immune formation after foot-and-mouth disease vaccination.

11) Evaluation of lymphocyte proliferative ability by SoltoB administration

In order to comparatively analyze the lymphocyte proliferative capacity according to the SoltoB treatment, peripheral blood was collected from the jugular vein of pigs at 1-5 weeks after vaccination and the lymphocytes were isolated to perform this experiment. Separated lymphocytes were stained with trypan blue and counted and counted under a microscope.

Separated lymphocytes were stained with trypan blue and counted and counted under a microscope. And finally diluted in RPMI-1640 medium at a concentration of 1 x 10 &lt; ⁶ &gt; cells / ml. 100 μl of diluted cells were dispensed into each well of a 96-well cell culture plate, and then 100 μl of RPMI-1640 medium supplemented with ConA (5 μg / ml) or LPS (50 μg / ml) Or mitogen-free medium was added to each well, followed by incubation at 41 ° C and 5% CO ₂ for 48 hours.

Twenty microliters of MTT (5 μg / ml) solution was added to each well of the cultured cells for 48 hours, and further cultured for 4 hours at 41 ° C. and 5% CO ₂ . After completion of the incubation, the supernatant was removed, and 200 μl of DMSO was added per well to allow sufficient time for all cells to dissolve (at least 10 minutes).

After all the cells were melted, the absorbance at 540 nm was measured to compare the proliferative capacity of the lymphocytes.

FIG. 32 shows that there was no significant difference in mitogen-induced visibility in each group, and even when stimulated with LPS (B cell mitogen) and ConA (T cell mitogen) .

12) Evaluation of lysozyme activity in sera by SoltoB administration

Lysosyme is an antimicrobial substance that is mainly secreted in the turbinates such as large color cells and polymorphonuclear leukocytes and melts the walls of bacteria. To determine the effect of SoltoB on the activity of lysozyme when inoculated with foot-and-mouth disease virus in pigs, the activity of lysozyme was measured in porcine molds of inoculation 1-5 weeks. Lysozyme was measured by the standard curve of the degree of degradation of the crystal lysozyme Using the method of Kreukniet et al. (1994).

Crystalline lysozyme was dissolved in the concentrations of 0.5, 1, 2, 3, 4, and 5 μg / ml and prepared as a standard. 200 μl of M. lysodeikticus-solution was added to each well of a 96-well plate and 20 μl of a standard lysozyme or serum prepared beforehand was added.

The incubation was carried out at 41 ° C for 1 hour and the absorbance was measured at intervals of 15 minutes (540 nm). The lysozyme activity of the sample was determined by substituting the standard curve for the change of absorbance with time of the sample.

Referring to FIG. 33, it was confirmed that no significant difference was shown in each group.

13) Sintering

In the case of antibody production in the laboratory, IgE antibody titer of SoltoB group was higher than that of control group after FMDV vaccination. Especially, 3% SoltoB group showed significant tendency of antibody production.

In particular, IgG antibodies in the 3% SoltoB group showed a statistically significant increase at 2-4 weeks after vaccination. This seems to be related to the ability of SoltoB to stimulate the production of antibodies against FMDV at the time of FMDV vaccination in pigs.

In the case of antibody production, antibody production was 60% from the 1st week of vaccination in the 3% SoltoB supplementation group, and antibody production was formed in all individuals at the 2nd week, and the antibody production rate was maintained at 100% until the 5th week. On the other hand, the antibody production rate in the control group was only 20% at the first visit, and the antibody production rate at the second visit did not reach 100% at 60%. Therefore, SoltoB treatment seems to accelerate the production of antibody by FMDV vaccine to pigs more rapidly.

Similarly, when SoltoB was fed to pigs in farms, IgG antibody production and antibody production rate of FMDV were compared, and it was found that IgG antibody titer was significantly increased in the SoltoB fed group compared to the control group after FMDV vaccination The antibody production was also higher in the SoltoB group than in the control group.

These results suggest that FMDV-specific IgG antibodies are increased by Cliptox and Song et al. (2009) report that IgG antibodies against FMDV were increased when ginseng stem-leaf saponin and mineral oil were applied. ). Also, this may be related to the report of Jung et al. (2010) that SoltoB increases the antibody titer of pig PCV2 virus.

In addition, the serum IgM antibody level was found to be high in order to confirm that the early reaction of antibody production was promoted in FMDV vaccination after SoltoB administration in pigs. Especially, IgM antibody was significantly increased in 3% SoltoB group .

These results are similar to those of Mayr et al. (2001) in which IgM antibody and IgG antibody were increased when the FMDV capsid and 3C proteinase coding regions were applied to adenovirus 5 lacking replication when applied with FMDV vaccine. Therefore, when the IgM antibody titer is increased, the IgG antibody titer is also increased, which is considered to increase the protection against FMDV.

In addition, the relative cytokines expression level was confirmed using real time PCR to confirm the effect of FMDV vaccination on the immune response in addition to changes in antibody function after SoltoB feeding in pigs. As a result, it was confirmed that IFN-r level of 1% and 3% SoltoB supplementation group was significantly increased after 1 week of vaccination. This is similar to that reported by Song et al. (2009) that IFN-r levels were increased during inoculation with FMDV after application of ginseng stem-leaf saponin and mineral oil. Therefore, it is considered that immunity enhancement by IFN-r increase as well as the antibody increase can be expected when FMDV vaccine is administered after SoltoB is fed to pigs.

These results indicate that the production of IgM in the initial reaction of antibody production after the administration of SoltoB to pigs after FMDV vaccination is promoted, followed by the generation of IgG antibody. In addition, IFN-r is a cytokine that induces the switching of IgG2a and IgG3 from B cells (Roitt et al., 2001). In addition to enhancing antibody production by SoltoB, IFN- -r in the presence of the antioxidant.

3. Example 3

Example 3 was carried out to analyze the effect of the anti-foot-and-mouth disease vaccine on SoltoB administration through FMD virus attack inoculation.

1) Selection of test system

- Disclosed animal: 5-week-old mini pig without foot-and-mouth disease antibody (OptiPop solution)

- Control group: Solto B vaccination group (5, Solto B + vaccination), Solto B non-vaccination group (5, Vaccination), Solto B non-vaccination vaccination group

- Attack strain: 2010 Andong isolate (Provided by the Agriculture, Forestry and Fisheries Quarantine Inspection Headquarters)

- feed and water provided: free meals

2) Mini pig vaccination and SoltoB salary

The mini pigs used for the inoculation were produced in the aseptic breeding facility of Optipop Solution (Osong), and after 7 days of SoltoB (0.5% w / w in feed) after induction (5 wk), Aftopor Merial vaccine . The SoltoB group then continued to feed SoltoB until the end of the experiment.

3) Attack inoculation

On the 5th day after the vaccination, OptiParm Solution's mini pig was transferred to the shield room. One day after mating, one of the mice was selected as a donor in the control group. The donor was anesthetized and the foot-and-mouth disease virus was injected directly into the hoof. The infected donor was transferred to an isolator cage in a shielded room to prevent infection in other experimental groups. After 48 hours, donor's foot-and-mouth disease was confirmed and the donor was inoculated with SoltoB + vaccination group, vaccination group and control group for 16 hours. And attacked. SoltoB was fed again to the SoltoB group for 16 hours to allow contact between Donor and the experimental piglets.

4) Breeding management and sampling after attack inoculation

Since the pigs infected with foot-and-mouth disease have been exposed to the foot-and-mouth disease, a large number of foot-and-mouth disease viruses have been released. After the attack by Donor, Identified species were transferred to an isolator cage. It was also disinfected with Bacon S (Bayer) once a day to prevent persistent infection caused by viruses that were released and kept in the breeding facility. Sampling was performed once a day, and serum, saliva and runny nose were collected. The clinical symptoms were confirmed once a day and body temperature was measured.

5) Comparative analysis of clinical symptoms after inoculation

In the control group (unvaccinated group) after the inoculation, the symptoms of depression (no movement even when the person approached, and depression or refusal of movement of the cage, depression) began to appear on the 2nd day, Blister formation, a typical clinical symptom of foot and mouth disease, was identified in the lobes and mouth.

In addition to these clinical symptoms, we confirmed the viremia of the blood by confirming the results of positive real-time PCR (AccuPower FMD real time PCR kit, Bioneer) in the blood samples collected at the same time, It was confirmed that the pig was properly processed. In the control group, body temperature was increased on the 4th day, and almost normal body temperature was recovered on the 8th day.

Both SoltoB and non-salaried subjects also started to show symptoms of drowsiness in attack inoculation D + 2. In the SoltoB group, 4 out of 5 birds showed symptoms of depression, whereas in the non - treated group, 5 birds showed symptoms of depression.

Referring to FIG. 34, body temperature was increased 4 days after the inoculation, and the normal body temperature was recovered at the D + 6 day, but no significant difference was found between the SoltoB and non-solvent groups.

35, the amount of virus secreted from blood (D + 3, D + 4), non-liquid (D + 4) and saliva (D + 4) The plaque assay was performed using bovine kidney cells. For the SoltoB and non-Solv vaccine groups, live virus was not detected in the above samples. On the other hand, live virus was detected in 3 out of 4 mice in the control group at the time of D + 3 and D + 4 in the control group that did not receive the vaccine, and live virus was detected in 1 saliva and 3 saliva at D + Respectively.

Antibody changes to foot-and-mouth disease virus after attack inoculation

In order to distinguish antibody formation from foot-and-mouth disease outbreaks and antibody formation by foot-and-mouth disease vaccination, antibodies against foot-and-mouth disease vaccines form antibodies against the structure protein (SP) of foot and mouth disease virus and antibodies against non-structure protein Are not formed (Cox, 2008). In addition, when the antibody is sufficiently generated by the foot-and-mouth disease vaccine and the defense is adequately prepared, the antibody against NSP is formed lower than that of the non-vaccinated individual even if infected with actual foot-and-mouth disease virus, Because the virus is sufficiently neutralized by the antibody against the virus.

In this experiment, we analyzed the antibody titers of SP and NSP in the SoltoB and non - Soluble groups to investigate the effect of SoltoB on the translation formation by foot and mouth disease vaccine.

1) Antibody changes to foot-and-mouth SP antigen

Referring to FIG. 36, PI was measured using PrioCHECK FMDV type O ELISA kit in order to confirm the activity of antibody against SP present in sera sampled immediately before foot-and-mouth virus attack. The higher the value of PI, the higher the antibody titer.

As a result, there was no difference between the SoltoB and non - Solvay groups, and there was no significant difference between the two groups after attack. In the control group that did not receive the vaccine, the PI value was very low before the attack and the PI value did not rise to 50 from the fourth day after the attack. On the other hand, the SoltoB + vaccination group and the vaccination group that received the vaccine maintained a PI value of 70-80 over the entire period of the attack vaccination.

2) Antibody changes to foot-and-mouth disease NSP antigen

In order to confirm the level of antibody production against NSP after vaccination with foot-and-mouth disease, the activity of antibody to NSP in serum was measured by PI using BioNote FMD NSP Anibody ELISA (BioNote) kit. FMD vaccine does not form antibodies against NSP after vaccination to distinguish antibodies from vaccines against outdoor infections. However, as shown in Figure 47b, the pre-inoculation of the foot-and-mouth vaccination showed a titer of PI above 50, which is a positive criterion for NSP, which is attributed to the nonspecific response of the kit.

Even though nonspecific responses were considered, the SoltoB group showed lower PI scores than the non-treated group, and the PI value of the SoltoB group was significantly higher than that of the non-treated group on the 2nd and 3rd day of the inoculation (P < 0.05). These results suggest that SoltoB is more neutralizing antibody than SP in non - treated group.

3) Changes in serum cytokines

Cytokines are very important in forming and defending immunity. Both IFN-r and IL-8 are critical for viral and intracellular bacterial infections, both of which play an important role in the development of congenital immunity and acquired immunity. In the case of IL-8, it is secreted mainly by the macrophage, which is an antigen. In the case of CCL-2, cytokines mainly mediate the inflammatory response, and mainly induce T cells or monocytes in wound or inflammation sites. (R & D system, USA), IL-8 (R & D system, USA) and CCL-2 (MyBioSource, USA) were used to determine the effect of SoltoB on vaccine- Were measured. The changes in the serum cytokines of the mini-pigs after the inoculation were as shown in Fig.

37, the production of IFN-r and IL-8 was higher in the SoltoB-fed group than in the non-treated group, and lower in the CCL-2 group than in the non-treated group. This is in agreement with previous studies that SoltoB supplementation promotes macrophage activity and increases production of IFN-r. In contrast, low expression of CCL-2 is thought to be due to the fact that CCL-2 is a cytokine involved in inflammation, and that the inoculation of foot-and-mouth attack is more effective in the SoltoB group than in the non-treated group.

Comparison of Immune Response of Peripheral Blood Immunocytes after Inoculation

We analyzed the effects of SoltoB supplementation on vaccine - induced defense capacity through analysis of response to FMF stimulation of peripheral blood immune cells following challenge inoculation. PBMC were isolated from blood of mini-pigs on day 8 after challenge and cultured at a cell number of 5 × 10 ⁶ cells / ml, and then stimulated with FMD Ag 2.5 μg / ml for 96 hours. The stimulated cells were centrifuged at 300 × g, 4 ° C. for 10 minutes, and the cell supernatant was collected to measure the amount of cytokines produced.

The cells were cultured in a 96-well plate at a density of 5 × 10 6 cells / ml, and then stimulated with FMD Ag 2.5 μg / ml for 96 hours. 10 μl of cell viability reagent 10 × Prestoblue (Life technologies) And incubated for another 2 hours. Cell proliferation was confirmed by absorbance at 560 nm.

1) Comparative analysis of cytokines production ability of peripheral blood immune cells against FMD

IFN-r (Kingfisher biotech Inc, USA), IL-8 (Kingfisher biotech Inc, USA), which is the same item analyzed in the serum of a mini-pig subjected to foot-and-mouth attack in response to the FM antigen of peripheral blood immune cells, CCL-2 (Kingfisher biotech Inc, USA) were analyzed.

Referring to FIG. 38, when PBMCs were stimulated with FMD Ag, the production of IFN-r and IL-8 was higher in the SoltoB-fed group than in the non-treated group, and CCL-2 was found to be lower than that in the non-treated group. This result is similar to that of cytokines produced directly from the serum of the mini-pigs inoculated with the vaccine. As a result, the innate immune system mainly involving IFN-r and IL-8 and the immunological enhancement by the SoltoB- This is probably due to the increased resistance to foot and mouth disease.

2) Comparative analysis of proliferation of peripheral blood immune cells against FMD

The effect of SoltoB on the protective effect against vaccine - induced inoculation was evaluated by comparing the proliferation of peripheral blood immunity cells against FMD.

Referring to FIG. 39, it was confirmed that the proliferation of FMF was significantly increased when the SoltoB group was compared with the non-treated group (p <0.05). This suggests that SoltoB supplementation increases the ability of the vaccine to protect against FMD at the cellular level by increasing the ability of the vaccine to protect the immune cells.

In addition, the result of elevation in the SoltoB group of IL-8 is consistent with the result of high proliferation of the SoltoB group in peripheral blood antigens of peripheral blood immune cells. The fact that IL-8 promotes the proliferation of cells suggests that Li (2003). On the other hand, IL-8 promotes higher proliferation than the SoltoB-treated group and the non-treated group in the unvaccinated experimental group, as previously reported by Li et al. (2003). On the other hand, in the experimental group not vaccinated, the level of proliferation was higher than that of the SoltoB group and the non-treated group. This indicates that the control group with the direct infection of foot-and-mouth disease and the viremia- This seems to be due to the consistency of the whole blood.

Sintering

Clinical symptoms and viremia were confirmed in the whole head after the challenge in the control vaccination group to confirm whether the attack was in progress properly. After the inoculation, both SoltoB and non-solitary group showed symptoms of D + 2 in the depressed group. (P <0.05) and CCL-2 expression in the SoltoB group compared to the non-treated group, and higher IFN-r and IL-8 production than the non-treated group (p <0.05). In the peripheral blood immunocytes, the peripheral blood immune cells of the SoltoB-treated group showed higher IFN-r and IL-8 production and proliferative capacity (p <0.05) and the lower CCL-2 production was lower in the SoltoB-treated group It is considered that the reason for this is that the additional inflammatory response caused by the increase in infectious resistance to foot - and - mouth disease in the SoltoB group was reduced compared to the non - treated group.

In the present study, we found that SoltoB induces cellular immunity (IFN-r, IL-1, IL-8, and IL-8) , subset of MHC II, macrophage, and lymphocyte proliferation), confirming that the effects of FMD vaccine can be sustained faster and with longer duration.

The present invention is not limited to the above-described embodiments and the accompanying drawings, but is intended to be limited by the appended claims.

It will be apparent to those skilled in the art that various changes in form and details may be made therein without departing from the spirit and scope of the invention as defined by the appended claims. something to do.

Claims (8)

0.1 to 3.0% by weight of a germanium complex mineral containing 36 ppm of germanium and biotite, muscovite, feldspar, tourmaline, zircon, garnet, apatite and opaque minerals as auxiliary minerals and iodine, cobalt, selenium and vanadium added thereto Immune enhancer for preventing foot-and-mouth disease.
The method according to claim 1,
Wherein the auxiliary mineral component added to the germanium complex mineral is 0.05 ppm iodine, 10.00 ppm cobalt, 5.00 ppm selenium, and 74.20 ppm vanadium.
3. The method according to claim 1 or 2,
Wherein the germanium complex mineral and the auxiliary mineral component added thereto have a particle size of 75 mu m to 1.0 mu m.
Corn, soybean meal, limestone, salt, vitamin premix and mineral premix,
0.1 to 3.0% by weight of a germanium complex mineral containing 36 ppm of germanium and biotite, muscovite, feldspar, tourmaline, zircon, garnet, apatite and opaque minerals as auxiliary minerals and iodine, cobalt, selenium and vanadium added thereto A composition for livestock feed using immunopotentiating substances for preventing foot-and-mouth disease.
5. The method of claim 4,
The basic diet contained 76.95 wt% of corn, 19.20 wt% of soybean meal, 1.20 wt% of fish meal, 0.75 wt% of limestone, 0.65 wt% of calcium phosphate, 0.25 wt% of salt, 0.20 wt% of vitamin mineral preparation, 0.10 wt% And 0.10% by weight of prothrombin,
And 0.1 to 1.0% by weight of a germanium complex mineral is added to the cow feed.
5. The method of claim 4,
The basic diet contained 76.95 wt% of corn, 19.20 wt% of soybean meal, 1.20 wt% of fish meal, 0.75 wt% of limestone, 0.65 wt% of calcium phosphate, 0.25 wt% of salt, 0.20 wt% of vitamin mineral preparation, 0.10 wt% And 0.10% by weight of proline.
Wherein the germanium complex mineral is added to the pig feed in an amount of 1.0 to 3.0% by weight.
7. The method according to any one of claims 4 to 6,
Wherein the auxiliary mineral component added to the germanium complex mineral is 0.05 ppm of iodine, 10.00 ppm of cobalt, 5.00 ppm of selenium, and 74.20 ppm of vanadium.
7. The method according to any one of claims 4 to 6,
Wherein the germanium complex mineral and the auxiliary mineral component added thereto have particle sizes of 75 mu m to 1.0 mu m.

Images