KR20140071681A - Promoter from rice and use thereof - Google Patents

Abstract

The present invention relates to a promoter which comprises base sequences in sequence number 1 and specifically induces an expression of a leaf. More specifically, the present invention relates to a promoter which specifically induces the expression of the leaf, a recombinant expression vector including the same, and a plant transformed by the recombinant expression vector. The promoter specifically induces the expression of the leaf. Therefore, the promoter specifically expresses target protein and thus can improve traits of a crop.

Description

PROMOTER FROM RICE AND USE THEREOF < RTI ID = 0.0 >

The present invention relates to a rice-derived promoter that induces expression specifically in leaves. More particularly, the present invention relates to a promoter that specifically induces expression in truncated mesenchymal tissue, leaves, flowers, and pods, and a recombinant expression vector comprising the same, and a plant transformed with the recombinant expression vector.

Recently, as the genetic engineering technology has developed, many researches have been carried out to improve the characteristics of plants. In particular, there is much interest in techniques for obtaining a useful gene from a transgenic plant. A promoter involved in expression of the gene is required when the desired gene is expressed in a transgenic plant.

 In general, a promoter is a kind of regulatory region having a function of regulating the expression of a nucleotide sequence, that is, a gene, which determines when and where a gene is to be expressed. Over the years, numerous types of promoters have been identified through endless research. Conventionally reported promoters can be classified according to their features and functions such as a promoter that induces expression at all times and a promoter that induces expression in time or position specific manner.

More specifically, the first is a strong promoter capable of maximizing the expression level. This was initially developed as a promoter that is used to maximize the expression level of the target gene, and is representative of the 35S RNA gene promoter (P35S) of flower cabbage mosaic virus and the actin gene promoter of rice. They are mainly used for the purpose of production of antibiotic resistance genes used as selection markers in the transformation of plants, genes for inhibiting insect pests of plants, or plants.

Second, promoters that limit the time of expression can be mentioned. This has been reported as a promoter that restricts the expression of a gene of interest only to a specific stage of the developmental stage of the plant. For example, promoters of genes involved in flowering can express genes only during the flowering season, and promoters of genes expressed by various biotic or abiotic stimuli can be included in the timing-regulated promoters.

Third, tissue-specific promoters that limit expressed tissue are examples. This is the promoters that are used to achieve the transfection purpose by limiting the expression of the desired gene only to specific tissues of the plant. A number of examples of promoters inducing such tissue-specific expression have been reported for each tissue of a plant according to various purposes to be used.

In particular, the promoters inducing tissue-specific expression among the promoters classified according to functions and characteristics are classified as follows according to the tissues expressed in the plant. First, a systemic expression-inducible promoter can be mentioned. As a promoter that induces expression in plant whole body, a promoter of 35S RNA gene of cauliflower mosaic virus (CaMV), which is also a promoter used to maximize the expression level, is used as a representative promoter for a dicotyledonous plant. Promoters of rice actin and maize ubiquitin genes have been mainly used as promoters for systemic expression of the plant in the monocotyledonous plant. Recently, a promoter of rice cytochrome C gene (OsOc1) has been developed 0429335). These genes are used for the purpose of inducing the expression of antibiotics, herbicide resistance genes and reporter genes used as selection markers in the transformation as in the case of the promoters maximizing the expression level. From the viewpoint of research, These are the promoters that are considered to be the priority when attempting to reveal.

Second, seed-specific promoters can be mentioned. As a representative example, the rice glutelin promoter used for the development of golden rice as promoters of rice major storage protein gene is widely used to induce seed-specific expression of monocotyledonous plants. Promoters that are mainly used to induce seed-specific expression include soybean-derived lectin promoter, cabbage-derived napin promoter and γ-tocopherol methyl transferase (γ-TMT) in Arabidopsis seeds. There are carrot-derived DC-3 promoter and perilla derived oleosin promoter used in studies to promote vitamin E production by inducing gene expression.

Third, root-specific expression promoter has not yet been commercialized. However, root-specific expression of pyruvate peroxidase (prxEa) has been isolated and confirmed recently. In recent years, the expression of maz genes (ibMADS) It has been reported that the ADP-glucose pyrophosphatase (AGPase) gene is isolated and the corresponding promoter induces a specific expression in the root and induces root-specific transient expression in carrot and radish .

Fourthly, there are other tissue specific promoters such as leaves. The related promoters include ribosyl bisphosphate carboxylase / oxygenase small subunit (rbcS), which induces expression of strong genes only in photosynthetic tissues of leaves and the like. ) Promoter, tomato-derived fruit maturation-specific expression-inducing phytoene synthase (PDS) promoter, and pollen-specific plant-derived cabbage-derived oleosin promoter.

Such seed, root or leaf-specific expression promoters are expected to be used for the purpose of improving agricultural traits, accumulating useful proteins, and producing useful substances in major crops used for food, food, or food.

However, conventional promoters known to induce tissue-specific expression in the known promoters, particularly plants, have the advantage of being capable of expressing a target gene in a tissue-specific manner, but have a disadvantage in that the expression amount thereof is insignificant. Therefore, it is urgent to find useful new promoters capable of expressing a gene of interest in a plant in a tissue-specific and large-scale expression.

Accordingly, the present inventors have continued research on new promoters capable of expressing a target gene in a tissue-specific manner in a plant, and have found that a promoter isolated from rice has an activity of inducing the expression of a target gene in a specific tissue at the time of plant growth and development And completed the present invention.

Korean Patent No. 10-1054891

An object of the present invention is to provide a promoter which induces expression specifically in a leaf, which comprises the nucleotide sequence of SEQ ID NO: 1.

It is another object of the present invention to provide a recombinant expression vector comprising a foreign gene encoding a protein of interest operably linked to said promoter.

It is still another object of the present invention to provide a microorganism transformed with the recombinant expression vector and a plant transformed with the transformed microorganism.

It is still another object of the present invention to provide a method for producing a transgenic plant in which a target protein is specifically expressed in a leaf using the promoter.

The present invention provides a promoter which induces expression specifically in a leaf, comprising the nucleotide sequence of SEQ ID NO: 1.

The invention also provides a recombinant expression vector comprising a foreign gene encoding a protein of interest operably linked to a promoter.

According to one embodiment of the present invention, the recombinant expression vector may be pBGWFS7-pOsKAT3.

The present invention also provides a microorganism transformed with said recombinant expression vector.

According to an embodiment of the present invention, the microorganism may be Agrobacterium tumefaciens .

The present invention also provides a transgenic plant transformed with the above-mentioned transforming microorganism.

According to one embodiment of the present invention, the plant may be a dicotyledonous plant or a monocotyledonous plant.

Further, according to the present invention,

Preparing a recombinant vector comprising a promoter consisting of the nucleotide sequence of SEQ ID NO: 1 and a foreign gene encoding a target protein operably linked thereto;

Transforming the microorganism with the recombinant expression vector to prepare a transformed microorganism; And

Infecting the plant with the transformed microorganism;

A method for producing a transgenic plant in which a target protein is specifically expressed in a leaf.

In order to discover a novel promoter that specifically expresses a target gene in plants, the present inventors have identified a nucleotide sequence by isolating a gene that is not expressed in roots among the expression patterns of OsKAT3 gene, one of rice potassium channel genes 1).

The present inventors confirmed the expression pattern of the GUS gene in the Arabidopsis thaliana by fusing the GUS gene to the OsKAT3 promoter of the present invention in order to confirm whether the OsKAT3 promoter of the present invention expresses the target gene in a tissue-specific manner See Examples 3-4). As a result, it was confirmed that the GUS gene was expressed in the leaves of Arabidopsis thaliana (see Fig. 2-3).

From the above results, it can be seen that the OsKAT3 promoter of the present invention is a promoter that induces the expression of the target gene in the leaves of plants.

The term "promoter" is a gene site located upstream of an encoding site, which generally includes a point at which transcription is initiated. The promoter is a TATA box that controls gene expression, a CAAT box site, And an enhancer that promotes the expression of almost all genes regardless of the site, position, and direction. In addition, among these promoters, there are promoters that induce expression constantly in all tissues and promoters that induce expression in a time or position specific manner. In particular, the promoter according to the present invention induces expression specifically in specific parts of plants do.

The "expression vector" refers to plasmids, viruses or other vectors known in the art in which the promoter of the present invention and the gene sequence encoding the target protein operably linked to the promoter can be inserted or introduced . The nucleotide sequence encoding the plant-specific expression promoter of the plant according to the invention and the target protein operably linked to the promoter may be operably linked to an expression control sequence, wherein the operably linked gene sequence and the expression control sequence May be included in an expression vector that also contains a selection marker and a replication origin.

Said "operably linked" may be a gene and expression control sequence linked in such a way as to enable gene expression when a suitable molecule is coupled to an expression control sequence. "Expression control sequence" means a DNA sequence that regulates the expression of a polynucleotide sequence operably linked to a particular host cell. Such regulatory sequences include promoters for conducting transcription, any operator sequences for regulating transcription, sequences encoding suitable mRNA ribosome binding sites, and sequences controlling the termination of transcription and translation.

The expression vector according to the present invention may be prepared by inserting a promoter of the present invention using a conventional vector used for protein expression as a basic framework and inserting a nucleotide sequence encoding a target protein downstream of the promoter have. Therefore, plasmids derived from Escherichia coli (pBR322, pBR325, pUC118 and pUC119), Bacillus subtilis -derived plasmids (pUB110 and pTP5), yeast-derived plasmids (YEp13, YEp24 and YCp50 ) And Ti plasmids, plant virus vectors, and binary vectors such as pCHF3, pPZP, pGA, and pCAMBIA sequences can be used. However, any person skilled in the art can use any vector as long as it can introduce the promoter of the present invention and the base sequence encoding the target protein operably linked to the promoter into the host cell.

The target protein that can be used in the present invention may be any target protein derived from the outside, that is, an exogenous protein or an endogenous protein and a reporter protein, which is desired to be expressed specifically by a plant tissue by the promoter of the present invention. The exogenous protein refers to a protein that does not naturally exist in a specific tissue or cell, and the endogenous protein refers to a protein expressed by a gene naturally present in a specific tissue or cell. In addition, the reporter protein is a protein expressed by a reporter gene, and refers to a marker protein that shows its activity in a cell by its presence.

Therefore, when the promoter of the present invention is used, in the case of a crop which consumes a specific part of a plant, for example, a leaf or a stem, a target protein can be taken together with a leaf or a stem by expressing a useful protein of interest in a specific tissue of the plant You can develop a crop.

In one embodiment of the present invention, the OsKAT3 promoter of the present invention having the nucleotide sequence of SEQ ID NO: 1 is operably linked to a known vector having a reporter system in which a blue coloring gene, Gus, One recombinant expression vector, pBGWFS7-pOsKAT3, was prepared (see Examples).

A recombinant expression vector comprising a promoter of the present invention and a gene sequence encoding the target protein operably linked to the promoter may be introduced into a host cell using methods known in the art. Methods for introducing the recombinant expression vector according to the present invention into host cells include, but are not limited to, calcium chloride (CaCl 2) and heat shock method, particle gun bombardment, silicon carbide whisker (Silicon carbide whiskers), sonication, electroporation, and PEG (polyethylenglycol) precipitation.

Accordingly, the present invention provides a host cell transformed with a recombinant expression vector comprising a promoter of the present invention and a nucleotide sequence encoding a target protein operably linked to the promoter. The host cell is preferably a microorganism. In one embodiment of the present invention, Agrobacterium tumefaciens LBA4404 was used.

In addition, the recombinant expression vector of the present invention can be introduced into plants using methods known in the art. For example, Agrobacterium sp. Mediated method may be used although not limited thereto.

Accordingly, the present invention provides a transformed plant by introducing into the plant a recombinant expression vector comprising a promoter of the present invention and a nucleotide sequence encoding a target protein operably linked to the promoter.

The transformed plant according to the present invention can be obtained by a conventional method in the art, such as an ovine reproduction method or an aseptic reproduction method. More specifically, the plant of the present invention can be obtained through reproductive process, which is a process of producing seeds through the moisture process of flowers and propagating from the seeds. Also, the plant can be transformed with the recombinant expression vector according to the present invention, and then obtained by the conventional method for inducing callus, rooting, and soil purification, through a silent propagation method. That is, a fragment of a plant transformed with the recombinant expression vector of the present invention is pelleted in a suitable medium known in the art, and cultured under appropriate conditions to induce callus formation. When shoots are formed, the plant is transferred to a hormone-free medium Lt; / RTI > After about two weeks, the shoots are transferred to rooting medium to induce roots. The transformed plants according to the invention can be obtained by roots being induced and then transplanted into the soil for purification. Transgenic plants in the present invention may include whole plants as well as tissues, cells or seeds obtainable therefrom.

The present invention also provides a recombinant vector comprising a promoter of the invention and a foreign gene encoding a target protein operably linked thereto; Transforming the microorganism with the recombinant expression vector to prepare a transformed microorganism; And infecting the plant with the transformed microorganism; Wherein the target protein is expressed specifically in stem apical meristems, leaves, flowers and pods.

In the present invention, the plant may be a dicotyledonous plant or a monocotyledonous plant. The dicotyledonous plants include, but are not limited to, Arabidopsis, soybean, tobacco, eggplant, pepper, potato, tomato, cabbage, radish, cabbage, lettuce, peach Rice straw, watermelon, melon, cucumber, carrot, celery and rape. The terminal plants may be rice, barley, wheat, rye, corn, sugarcane, oats and sheep.

Since the promoter of the present invention induces expression specifically in the leaf, the target protein can be specifically expressed using the promoter, thereby improving the trait of the crop. Specifically, the target gene can be mainly expressed in the leaf of the ground part in both the terminal leaf and the dicotyledonous plant, so that it is useful for controlling the expression of the gene in order to improve the growth and development of the plant or to enhance various environmental stress resistance .

BRIEF DESCRIPTION OF THE DRAWINGS FIG. 1 is a diagram of a vector for transformation of a plant according to an embodiment of the present invention (LB: left T-DNA border, RB: right T-DNA border, Bar: bialaphos resistance gene, GUSA: beta-glucuronidase A, T35S: CaMV 35S terminator, 35S: CaMV 35S promoter).
FIG. 2 shows the results of GUS staining of transgenic rice plants for assaying the expression of tissues of the OsKAT3 promoter according to an embodiment of the present invention (Fig. 2: Adult sheath, ma: root, bar: flower, yarn: seed).
FIG. 3 shows the results of GUS staining of transgenic Arabidopsis thaliana for the tissue expression assay of OsKAT3 promoter in a dicotyledonous plant according to an embodiment of the present invention (A: 3rd leaf plant, II: stem truncation, Da: young leaf) .

The present invention will be described in more detail by way of examples. It should be noted, however, that the present invention is not limited by the following examples.

Example  One: Genome Of DNA PCR On by OsKAT3  Of the promoter region Cloning  And base sequence analysis

1-1: motif search and promoter region PCR  Amplification

The motif of the promoter region of the gene was searched using a database of Plant Cis-acting Regulatory DNA Elements (PLACE) program and a PCR product of about 1.5 Kb was amplified to amplify a sufficient region including main motifs such as TATA box , And then the promoter region of the gene was isolated by PCR.

Genomic DNA was extracted from rice leaves (Qiagen, DNeasy Plant Mini kit). A primer for amplifying a fragment of about 1378 bp predicted to be a promoter region of the gene was designed and a sense primer OsKAT3 promoter-forward (OsKAT3 5'- CAGTGCTGAACAAGGCCCTTCAAA-3 ': SEQ ID NO: 2) and an antisense primer OsKAT3 promoter- '- GGTGGCCAAGAACAAGAACAGCAA -3': SEQ ID NO: 3) was synthesized and inserted into PCR reaction solution together with Invitrogen's Pfx polymerase, and the gene was amplified using Applied Biosystem 9700 machine. The PCR conditions used were denaturation at 95 ° C for 10 min, followed by 30 cycles of 95 ° C for 1 min, 55 ° C for 1 min, and 68 ° C for 2 min, followed by treatment at 68 ° C for 5 min. After the PCR reaction, the amplified gene was electrophoresed on 1% agarose, and the band, which was supposed to be the promoter, was cut out from the agarose gel, purified using a QIAquick gel extraction kit, and then used for topo cloning.

1-2: Cloning into pENTR D-topo vector (Invitrogen, direct entry TOPO Cloning vector kit), which is a gateway entry vector

The amplified gene was subjected to topoisomerase reaction at room temperature for 30 minutes, transformed into DH5 alpha strain by heat shock method, plated on LB medium, and colonies were selected and subjected to colony PCR. As a result, the plasmid of the identified colony was extracted and used for sequencing.

1-3: Sequence analysis

The nucleotide sequence was determined using an ABI 3700 sequencer (SEQ ID NO: 1).

Example  2: Transformation vector production and plant transformation

2-1: OsKAT3  Production of Promoter Carrier

A recombinant expression vector was constructed to express the reporter gene GUS using the OsKAT3 gene promoter isolated in Example 1 above. For this purpose, a recombinant vector in which the promoter was inserted into pBGWFS7 vector for expression of a gateway promoter purchased from Gent University of Belgium was prepared (Fig. 1).

First, LR (Invitrogen) was reacted to transform the vector pBGWFS7 (PSB, Plant System Biology) as a target vector. The genes were identified by colony PCR and sequencing, and then transformed into Agrobacterium for transformation into rice.

In order to transform the completed binary vector into Agrobacterium (LBA4404), the cells were subjected to freezing and thawing 2-3 times, transformed by heat shock method at 37 ° C, and transformed into YEP medium (Yeast 10 g, NaCl 5 g, peptone 10 g, Agar 15 g / 1 L) for two days to confirm colonies. Colony transformed by colony PCR was transformed into AB medium (AB buffer (K ₂ HPO ₄ 60 g, NaH ₂ PO ₄ 20 g / 1 L), AB salt (NH ₄ Cl 60 g, MgSO _{4 4?} 7H ₂ O 6 g, KCl 3 g, CaCl ₂ .2H ₂ O 0.265 g, and FeSO ₄ .7H ₂ O 50 mg / 1 L).

2-2: Rice Transformation

Rice seeds that are used for rice transformation are made of brown rice. After the rice seeds are immersed in 70% ethanol for 1 minute, they are sterilized in water containing 50% of lactose for 40 minutes. At this time, 10 uL Tween 20 per 30 mL of lactose was used by dropping.

After disinfecting all the disinfectants, the rice seeds were washed 5 times with sterilized water. When the disinfectant solution was well washed, the water was removed from the rice seed using a filter paper, and rice seed was applied to the 2N6 medium. At this time, rice seeds were put into the medium to make contact with the medium, and the seeds were turned upward. The 2N6 medium is made from the medium described in the literature with some modified medium (Hiel et al., Plant J., 1994). 4 g / L of a mixture containing a large amount of elements, trace elements and vitamins of N6 medium (Chu et al., Scin Sin, 1975, 18: 659-668), 30 g / L sucrose, 0.5 g / L proline l glutamine, 0.3 g / L casamino acids, 0.01 g / L myo-inositol, 2 mg / L 2,4-D, 4 g / L phytagel (pH 5.8). The incubation temperature was 28 ° C and cancer treatment was performed.

2N6 for 5 days, and when callus is induced, the endosperm is removed. Carefully remove the endosperm using tweezers so that the callus is not damaged, and keep the cotyledon and root parts intact to prevent the callus from being damaged.

Agrobacterium was prepared by inserting the desired gene into AB solid medium for 3 days, and then collected in an AAM liquid medium to prepare a suspension. The concentration of the suspension was measured using an absorbance meter. First, OD595 was adjusted to 0.1, and then diluted 10 times with AAM to obtain OD595 = 0.01.

The callus, from which the ending oil was removed, was immersed in the suspension for 2 minutes to inoculate Agrobacterium, and the solution was gently shaken for 2 minutes. After the inoculation, only the suspension was discarded from the callus, and the filtrate was removed using a filter paper. Do this quickly and be careful that the callus is not overly dry on the filter paper. Callus was transferred to 2N6-AS medium and co-cultured. 2N6-AS medium was adjusted to pH 5.2 with medium prepared by adding 10 g / L glucose and 100 uM acetosyringone to 2N6 medium. The filter paper was placed on the medium in advance, so that the media components were sufficiently impregnated, and then the inoculated callus was placed on the filter paper. The filter paper is intended to prevent the agglutination of callus by excessive growth of Agrobacterium during co-cultivation. The co-cultures were incubated at 25 ° C for 7 days.

After co-cultivation, Agrobacterium, which was responsible for inserting useful genes into the callus, was no longer needed and was removed by washing. Washing was performed with 1 L of sterilized distilled water and 500 mg of carbenicillin as an antibiotic. The callus was washed three times and then all the filtrate was removed using a filter paper. The callus is transferred to 2N6-CH medium supplemented with 200 mg / L of cefotaxime and 40 mg / L of hygromycin, which are antibiotics, in 2N6 medium. At this time, cotyledons and roots were removed using tweezers, and the callus was divided into 2 ~ 3 pieces and cultured by moving to the maximum area of contact with the medium. The culture temperature was 28 ° C, and the transformed callus was induced by culturing in a cancer incubator for 14 days.

After 14 days, the callus transformed in the 2N6-CH medium supplemented with the hygromycin, an antibiotic, was grown with division and subcultured with MSR medium, which is a regeneration medium capable of inducing shoots and roots. The distinction of the transformed callus is judged by the presence of a newly differentiated callus mass and discarding the callus dead. The seedlings grown in the MSR regeneration medium were transferred to the soil and grown in the greenhouse.

Example  3: OsKAT3   Promoter GUS  Analysis of Expression by Dyeing

Histochemistry of the promoter region by GUS staining was carried out by analyzing the expression of the promoter using the transformed plant oil for 2 weeks.

The site where the OsKAT3 promoter is activated is stained blue by GUS staining. When the leaves of the second parked seedling were stained in blue, the OsKAT3 promoter was found to express the gene of interest in the leaves . However, it was not stained at the root, indicating that the OsKAT3 promoter mainly expresses the gene of interest on the leaf.

Analysis of the expression of the promoter in various tissues using adults grown for about 2 months revealed that leaf blades were strongly stained and leaf sheath portions were stained. However, it was found that the OsKAT3 promoter was able to express the target gene mainly in the leaf part in the rice plant, which is a typical terminal plant, (Fig. 2) .

A representative model in which the OsKAT3 promoter operates The transgenic plants of Arabidopsis, a dicotyledonous plant, were analyzed by GUS staining. As a result, it was confirmed that the root of the underwife was hardly stained and stained with flowers and stems. Were mainly expressed only in leaves such as cauline leaf and rossette leaf. As a result, it was confirmed that the OsKAT3 promoter can mainly express the target gene in the leaf part in the representative dicotyledonous Arabidopsis thaliana (Fig. 3).

<110> REPUBLIC OF KOREA <120> PROMOTER FROM RICE AND USE THEREOF <130> P120987 <160> 3 <170> Kopatentin 2.0 <210> 1 <211> 2003 <212> DNA <213> Oryza sativa <400> 1 cagtgctgaa caaggccctt caaaaagcag tagaaattcg ttgatatcaa aagataatta 60 ttccatctta atgggataaa ctcaatgtag ttgataagaa tcgaaattac agaagatgca 120 aacgaatcaa caaaaaaaat gcatatttaa tagaaaaaag gttgacatcc caggtagagg 180 atggaccagt agtcacctgt atggaattct gcctctgaaa gtatattgaa gagcatacca 240 gatagggact cgtatggttt agcttttggc caggcccaca aagatagtac taatacacaa 300 atagccctga aatttctatt tcctcgtgtc cttcaaacac gtgcaatggc ataatgatgg 360 ctaggcaaca atggataact aatgcattta tcattgctaa attatagaca agttcaacat 420 agttcctttt ttctggaaag gtttttaaaa tagaaaatga gtaacattgg acgttatttt 480 acaatttaaa aaaatgtata gtttaccttc aaggaaaaga tttaaccagt atatgattgt 540 caatgacttt gacatcaata ccagaaaatt acagaagatg tacgaaaaaa gtatccccag 600 cagcacatcc taacatcaaa gtaggcacca cttattgttg tcagccagta tgccatagta 660 ccctgcatga catgtgagca tctgtcagga tagcaattag caagtgctat atccagccag 720 caaaatcatt acaaaagtaa atcatacgct tattattcag ttataacatc gacaagccca 780 acaattagtg taccaagaag aaggtttttt cctttgtcta gaatataact tcggggtcca 840 ttgcaaagca caagatatga agtgggtacc atctgaccaa gtactggctg attcaccaag 900 aacgcgatac aagacagaac ttcaaataag attgtaaaca agtgaaactt ttgccagaga 960 tcacaataat ggagatacag tctgttcatt cctcactggt cccatgaaaa caggcagccc 1020 aatcagtgca ccggataaac actaattgca gcaactggta ggcatcagaa cacggaggct 1080 acttagactg agtgactgac aagagattgt ggatgatctt attagccatt catctgcttt 1140 aattagttga gatgaacgta gagaatggat ccttcacccc cactaaaaca aatcttagtt 1200 gaacacaact accaaaagaa tatacccaac gattaagtcc attgcagatt actggcagaa 1260 atgacatcca tgattccggc cgtcctgttc acatttgcac aaacatgtgg atggcagtgc 1320 taagaaaaac atatgtcaga agtaaatttg actgagatta acagaatgcc acttactgat 1380 gcacgagttc tttttttaac ctttgacttg ggaaccaatg gctactacaa aagtaacaat 1440 tatgaagaag catagctatc cagaaattaa ttactagtca caattgccac ttcagcacaa 1500 ggactggatg cacaacacac cagcaaaaca atacacacca cagactgttc ttggttgaat 1560 cgaggagagc accagtccac agaaggagcc tgcacattca ccagagcaaa tggttggaga 1620 ggagcctgtt ggttcttgct caacagaagg cattcgcaag agaatctatc cttgcagatc 1680 agctggaaat aaattgcttc aggagttaat ttgactgcag ctgatcatct accaaaagaa 1740 gtcaactctg tctcgtgata gaatctgccg acttgtctta gctaacagct tcccacatct 1800 cccatctaaa acacgcatgc cctgtccgtt gttttcctcg taaggtacag gacacgagca 1860 gtttccggtt cccttctttt taaaattcct caccttgacc ctgcatgttc atcatgtgca 1920 gcatacatat atatatatat ataaagaccc agcctccaca ccctctgcaa acagagttgg 1980 gtggccaaga acaagaacag caa 2003 <210> 2 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> OsKAT3 promoter forward primer <400> 2 cagtgctgaa caaggccctt caaa 24 <210> 3 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> OsKAT3 promoter reverse primer <400> 3 ggtggccaag aacaagaaca gcaa 24

Claims (10)

1. A promoter which induces expression specifically in a leaf, comprising the nucleotide sequence of SEQ ID NO: 1.
A recombinant expression vector comprising a foreign gene operably linked to the promoter of claim 1 and encoding a protein of interest.
3. The method of claim 2,
Wherein the recombinant expression vector is pBGWFS7-pOsKAT3.
A microorganism transformed with the recombinant expression vector of claim 2 or 3.
5. The method of claim 4,
When the microorganism is Agrobacterium tumefaciens ). A transgenic plant transformed with the transgenic microorganism of claim 4.
The method according to claim 6,
Wherein said plant is a dicotyledonous plant or a monocotyledonous plant.
The method according to claim 6,
The dicotyledonous plant is selected from the group consisting of Arabidopsis, soybean, tobacco, eggplant, pepper, potato, tomato, cabbage, radish, cabbage, lettuce, peach, pear, strawberry, watermelon, melon, cucumber, carrot, Lt; / RTI &gt;
The method according to claim 6,
The transgenic plant is selected from the group consisting of rice, barley, wheat, rye, corn, sugar cane, oats and onions.
Preparing a recombinant vector comprising a promoter consisting of the nucleotide sequence of SEQ ID NO: 1 and a foreign gene encoding a target protein operably linked thereto;
Transforming the microorganism with the recombinant expression vector to prepare a transformed microorganism; And
Infecting the plant with the transformed microorganism;
A method for producing a transgenic plant, wherein the target protein is expressed specifically in a leaf.

Images