KR20140061328A - Composition for preventing or treating irritable bowel syndrome - Google Patents

Abstract

The present invention relates to a composition effective for preventing or treating an irritable bowel syndrome, which comprises Lactobacillus acidophilusLA1 (KCTC 11906BP), Lactobacillus plantarumLP1 (KCTC11867BP), Lactobacillus rhamnosusLR (3) (KCTC 11868BP), BifidobacteriumbreveBR (2) (KCTC 11858BP), BifidobacteriumbreveBR (2) (KCTC 11858BP), Bifidobacteriumanimalissubsp.lactisCBT2501H (KCTC 11903BP), Bifidobacterium longumCBT-3 (KCTC 11860BP), and Streptococcus thermophilusST3 (KCTC 11870BP), or cultured products of the sames as active components, and maintains the stability of whole intestinal microorganisms.

Description

Technical Field [0001] The present invention relates to a composition for preventing or treating irritable bowel syndrome,

The present invention relates to a composition useful for the prevention and treatment of irritable bowel syndrome (hereinafter referred to as "IBS "), and more particularly to a composition useful for preventing or treating irritable bowel syndrome And a composition for preventing or treating irritable bowel syndrome containing complex lactic acid bacteria useful for the prevention and treatment of irritable bowel syndrome.

Irritable bowel syndrome (IBS) is a common bowel function disorder characterized by persistent or recurrent abdominal pain, abdominal discomfort, and altered bowel habits in general. Irritable bowel syndrome impairs the quality of life by impairing the social and personal life of patients, and the more severe the symptoms, the lower the quality of life. Although the cause of IBS has not yet been clearly elucidated, it is presumed that it is caused by visceral hypersensitivity, immune activation, intestinal neuromuscular dysfunction, and brain-long axis dysfunction. In terms of pathophysiology of IBS, microbiological factors such as changes in intraluminal milieu are also expected to be one of the causes of IBS. Changes in the fecal microbiota are found in IBS as well as in inflammatory bowel disease (IBD).

Although the concept of IBS has been established decades ago, there is still no fundamental remedy for IBS, and only the symptomatic treatment for the symptom relief of each type of IBS is being performed.

Recently, a method of changing the natural history of IBS using probiotics has been attempted. For example, US Patent No. 7,125,708 discloses a composition useful for the treatment of irritable bowel syndrome including Lactobacillus pentosus NCIMB 41114 .

U.S. Patent No. 7,507,572 discloses a pharmaceutical composition comprising (a) a tannase-producing strain of one or more isolated Lactobacillus plantarum, and (b) tannin, wherein said at least one isolated tannase- producing Lactobacillus plantarum strain Lactobacillus plantarum strain HEAL 9 (DSM 15312), Lactobacillus plantarum strain HEAL 19 (DSM 15313); A strain selected from the group consisting of Lactobacillus plantarum strain HEAL 99 (DSM 15316), and combinations thereof.

However, since the above-mentioned compositions are not sufficient to improve irritable bowel syndrome, development of a composition useful for the treatment of irritable bowel syndrome including probiotics with excellent effect is desired.

It is another object of the present invention to provide novel lactic acid bacterial strains which provide an efficacy for prevention and treatment of IBS.

Another object of the present invention is to provide a composition useful for prevention and treatment of IBS, including various species of lactic acid bacteria.

Another object of the present invention is to provide a composition for preventing or treating diarrhea-predominant irritable bowel syndrome, constipation-predominant irritable bowel syndrome or diarrhea-constipation mixed irritable bowel syndrome comprising various kinds of lactic acid bacteria or cultures thereof as an active ingredient .

One aspect of the present invention to achieve the above objective, Korea Research Institute of Bioscience and Biotechnology Gene Bank (Korean Collection for Type Culture; KCTC ) accession number KCTC Phil Ruth LA1 (Lactobacillus acidophilus LA1) know, the Lactobacillus deposited with the International as 11906BP the Lactic acid bacteria.

Another aspect of the present invention for achieving the above objective, Korea Research Institute of Bioscience and Biotechnology Gene Bank (Korean Collection for Type Culture; KCTC ) accession number KCTC 11858BP international deposit with Bifidobacterium breather bracket BR (2) (Bifidobacterium breve as a BR (2)) lactic acid bacteria.

Another aspect of the present invention relates to a lactic acid bacterium belonging to Bifidobacterium longum CBT-3 , which has been deposited with the Korean Collection for Type Culture (KCTC) under accession number KCTC 11860BP .

Another aspect of the present invention for achieving the above object is Lactobacillus know dopil loose LA1 (Lactobacillus acidophilus LA1 (KCTC 11906BP )), Lactobacillus Planta room LP1 (Lactobacillus plantarum LP1 (KCTC11867BP) ), Lactobacillus ramno Versus LR (3) (Lactobacillus rhamnosus LR ( 3) (KCTC 11868BP)), Bifidobacterium breather bracket BR (2) (Bifidobacterium breve BR (2) (KCTC 11858BP)), BP tobak Te Solarium Annie Marlies lactis CBT2501H (Bifidobacterium animalis subsp. lactis CBT2501H (KCTC 11903BP)), Bifidobacterium ronggum CBT-3 (Bifidobacterium longum CBT- 3 (KCTC 11860BP)), and Streptococcus up a brush loose ST3 (Streptococcus thermophilus ST3 (KCTC 11870BP )) or including these cultures To a composition for preventing or treating irritable bowel syndrome.

The composition for preventing or treating irritable bowel syndrome comprising the complex lactic acid bacteria of the present invention may further comprise other lactic acid bacteria or a pharmaceutically acceptable carrier or adduct.

The composition of the present invention includes seven kinds of probiotic lactic acid bacteria or cultures thereof that maintain the stability of intestinal microorganism guns. Therefore, according to the present invention, excellent therapeutic agents for irritable bowel syndrome or diarrhea-predominant irritable bowel syndrome, constipation- Compositions useful for the treatment of predominant irritable bowel syndrome or diarrhea-constipation mixed irritable bowel syndrome may be provided.

In addition, the composition for preventing or treating irritable bowel syndrome of the present invention maintains the stability of intestinal microbial cells in a patient, thereby inhibiting infections of various intestinal pathogenic bacteria, and additionally, Thus, it can be used as a pharmaceutical, a food, or a health supplement as a composition for preventing or treating irritable bowel syndrome.

Figure 1a shows the 16S rRNA sequence of Lactobacillus also know loose fill LA1 (Lactobacillus acidophilus LA1 (KCTC 11906BP )) strains of the invention.
Fig 1b-1c is made a homology and phylogenetic relationships (phylogenetic relationship) of the 16S rRNA sequence of Lactobacillus also know loose fill LA1 and Lactobacillus know also loose fill ^T (ATCC 4356) of the present invention compared to the city.
2 is a Random Amplified Polymorphic DNA (RAPD) analysis result of genomic DNA of Lactobacillus acidophilus strain LA1 of the present invention.
FIG. 3 shows the results of PFGE (Pulse Field Gel Electrophoresis) analysis of genomic DNA of Lactobacillus acidophilus strain LA1 of the present invention.
Figure 4a shows the 16S rRNA sequence of the Bifidobacterium breve BR (2) strain of the present invention (KCTC 11858BP).
FIG. 4b-4c shows the comparative homology and phylogenetic relationship of the 16S rRNA sequence of the Bifidobacterium breather bracket BR (2) and the strain Bifidobacterium breather probe ^T (ATCC 15700) strain of the present invention.
5 shows the results of RAPD analysis of the genomic DNA of the Bifidobacterium breve BR (2) strain of the present invention.
6 shows the results of PFGE analysis of the genomic DNA of the Bifidobacterium breve BR (2) strain of the present invention.
FIG. 7A shows the 16S rRNA sequence of the Bifidobacterium brevis longbum CBT-3 strain (KCTC 11860BP) of the present invention.
Figure 7b-7c is a diagram comparing the homology and phylogenetic relationship of the 16S rRNA sequence of the Bifidobacterium breather probe ronggum CBT-3 strain and Bifidobacterium ronggum ^T (ATCC 15707) strain of the present invention.
FIG. 8 shows the results of RAPD analysis of the genomic DNA of the Bifidobacterium brevis longbum CBT-3 strain of the present invention.
FIG. 9 shows the results of PFGE analysis of the genomic DNA of the Bifidobacterium brevis longbum CBT-3 strain of the present invention.
10 is a schematic diagram for explaining a screening and random extraction procedure of a patient to test the effect of the composition for the prevention or treatment of irritable bowel syndrome according to an embodiment of the present invention.
11 is a schematic diagram illustrating a clinical trial procedure for verifying the efficacy of a composition for the prevention or treatment of irritable bowel syndrome according to an embodiment of the present invention on irritable bowel syndrome.
FIG. 12 is a graph comparing the response rate of the composition for treating irritable bowel syndrome (Example) and the placebo (Comparative Example) during the treatment period according to the present invention.
FIG. 13 is a graph showing the proportion of responder in the placebo administration compared to the composition for treating irritable bowel syndrome of the present invention. FIG.
FIG. 14A is a modified gradient gel electrophoresis image for confirming the change in the composition of the stool microbial count of the patient before and after the treatment in the embodiment. FIG.
14B is a photograph of a modified gradient gel electrophoresis for confirming the change in the composition of the stool microbial cell of the patient before and after the treatment in the comparative example.
15 is a graph showing the agreement rate of the DGGE behavior in Examples and Comparative Examples.

As used herein, the terms "treat" and "treatment" refer to the treatment of irritable bowel syndrome, particularly diarrhea predominant irritable bowel syndrome (d-IBS), constipation predominant irritable bowel syndrome, Or diarrhea-constipation mixed type irritable bowel syndrome.

One aspect of the present invention relates to novel lactic acid bacteria strains, Korea Research Institute of Bioscience and Biotechnology Gene Bank (Korean Collection for Type Culture; KCTC ) accession number KCTC 11906BP international deposit with Lactobacillus know even Phil Ruth LA1 (Lactobacillus acidophilus LA1 as the ) Lactobacillus acidophilus Bifidobacterium breve BR (2 ) Lactobacillus bifidobacterium breve BR (2) , deposited as Accession No. KCTC 11858BP in the Korean Collection for Type Culture (KCTC).

Another aspect of the present invention, Korea Research Institute of Bioscience and Biotechnology Gene Bank; relates to the (Korean Collection for Type Culture KCTC) a Bifidobacterium ronggum CBT-3 (Bifidobacterium longum CBT- 3) Deposits International as accession number KCTC 11860BP lactic acid bacteria.

These lactic acid bacteria strains can improve the intestinal microbial balance and provide an efficacy useful for the treatment of intestinal diseases such as IBS. That is, these lactic acid bacterial strains can maintain homeostasis of intestinal microflora, inhibit intestinal harmful pathogens, and stabilize gastrointestinal barrier function.

Another aspect of the present invention relates to a composition for the prophylaxis or treatment of irritable bowel syndrome. Such a composition includes the following lactic acid bacterial strains. These lactic acid bacterial strains are used in Korean Collection for Type Culture (KCTC) It was deposited as follows.

1) Lactobacillus also know pilru's LA1 ( Lactobacillus acidophilus LA1), KCTC 11906BP,

2) Lactobacillus Planta Room LP1 (Lactobacillus plantarum LP1), KCTC11867BP ,

3) Lactobacillus Lymphosus LR (3) ( Lactobacillus rhamnosus LR (3) ), KCTC 11868BP ,

4) Bifidobacterium breve BR (2) ( Bifidobacterium breve BR (2) ), KCTC 11858BP ,

5) Bifidobacterium lactis tobak Te Solarium Annie Marlies CBT2501H (Bifidobacterium animalis subsp. Lactis CBT2501H ), KCTC 11903BP ,

6) Bifidobacterium Long gum CBT-3 (Bifidobacterium longum CBT- 3), KCTC 11860BP , and

7) Streptococcus up a brush loose ST3 (Streptococcus thermophilus ST3), KCTC 11870BP

Lactobacillus acidophilus LA1 ( L. acidophilus LA1) is a tuberous anaerobic lactic acid bacterium that exists in the intestines of humans and all mammals and other animals and is used for the treatment of intestinal addiction. Lactobacillus Lymphosus LR (3) ( L. rhamnosus ) inhibits growth of most harmful bacteria in the intestines.

Streptococcus up a brush loose ST3 (Streptococcus thermophilus ST3), meanwhile showing the effect of inhibiting the pathogenic bacteria by lowering the pH of the surroundings to produce a large amount of an organic acid such as lactic acid through rapid growth as the species that the fastest growth of the lactic acid bacteria other Lactobacillus produces conditions that can grow comparatively predominantly. In general, lactobacillus is the optimal habitat for small intestine, and the lactic acid bacteria belonging to Bifidobacterium are the most suitable habitat. Therefore, lactic acid bacteria belonging to the genus Lactobacillus and Bifidobacterium Ingestion can provide higher suitability for a formulation than a mixture of lactic acid bacteria consisting of a single species or a small number of different species. When Lactobacillus and Bifidobacterium lactic acid bacteria contained in the present composition are used singly or as a mixture, they provide an effect of inhibiting the growth of harmful bacteria and inducing the proliferation of enteric bacteria in the intestines. In addition, these strains, when used alone or in combination with atopic dermatitis or inflammatory bowel disease model mice, inhibit inflammatory cytokines and induce the synthesis of anti-inflammatory cytokines . These characteristics can help to improve the pathology of hypersensitivity syndrome in view of the imbalance of intestinal microbial masses and low-grade inflammation.

The composition may contain seven kinds of lactic acid bacteria in the same proportion or may contain lactic acid bacteria in the genus Lactobacillus, lactic acid bacteria in the genus Bifidobacterium and lactic acid bacteria in the genus Streptococcus in a ratio of 1: 1: 1 to 3: 3: 1 .

The composition of the present invention contains a mixture of lactic acid bacteria strains as an active ingredient in an amount of 10 ⁸ to 10 ¹² cfu / g, or an equivalent number of live bacteria, relative to the total weight of the composition.

The compositions of the present invention other than the above-mentioned lactic acid bacteria Lactobacillus raised Bari right switch (Lactobacillus salivarius), Lactobacillus brevis (Lactobacillus brevis), Lactobacillus helveticus (Lactobacillus helveticus), Lactobacillus buffer lactofermentum (Lactobacillus fermentum), Lactobacillus para casein is (Lactobacillus paracasei), Lactobacillus Kasei (Lactobacillus casei), Lactobacillus del Brewer station (Lactobacillus delbrueckii), Lactobacillus Leu Terry (Lactobacillus reuteri), Lactobacillus boots Neri (Lactobacillus buchneri), Lactobacillus biasing Li (Lactobacillus gasseri ), Lactobacillus Jones you (Lactobacillus johonsonii), Lactobacillus Kane pireu (Lactobacillus kefir), Lactobacillus nose Syracuse lactis (Lactococcus lactis), Bifidobacterium Bifidobacterium Doom (Bifidobacterium bifidum), Bifidobacterium Infante Tees (Bifidobacterium infantis ), Bifidobac ( Bifidobac) pseudolongum terium), can include a Bifidobacterium write a brush room (B ifidobacterium themophilu m), Bifidobacterium Adolfo sentiseu adding one or more lactic acid bacteria selected from the group consisting of (Bifidobacterium adolescentis).

The lactic acid bacterial strains are grown by a general culture method for lactic acid bacteria, recovered by a separation process such as centrifugation, and can be prepared into a prodrug form by drying, e.g., lyophilization.

The composition of the present invention may further include a conventional pharmaceutically acceptable carrier and / or excipient in addition to the above-mentioned effective ingredients. In addition, various additives commonly used in pharmaceuticals such as binders, disintegrating agents, coating agents, lubricants, And the like.

The composition of the present invention may be formulated into powders, granules, tablets, capsules or liquid form by mixing the lactic acid bacteria with appropriate carriers, excipients, auxiliary active ingredients and the like. In addition, the composition of the present invention can be commercialized using a known method, after being passed through the stomach and reaching the small intestine so that the microorganism as the active ingredient is quickly released into the intestines.

Excipients usable in the present invention include sugars such as sucrose, lactose, mannitol, glucose and the like and starches such as corn starch, potato starch, rice starch and partially gelatinized starch. The binder may be a natural-occurring macromolecular substance such as dextrin, sodium alginate, carrageenan, guar gum, acacia, agar, etc., such as polacaccharide, tragacanth, gelatin and gluten, hydroxypropylcellulose, methylcellulose, Cellulose derivatives such as cellulose, ethyl cellulose, hydroxypropyl ethyl cellulose and carboxymethyl cellulose sodium, and cellulose derivatives such as polyvinyl pyrrolidone, polyvinyl alcohol, polyvinylacetate, polyethylene glycol, polyacrylic acid, polymethacrylic acid and vinyl acetate resin Polymer.

Examples of the decomposing agent include cellulose derivatives such as carboxymethylcellulose, carboxymethylcellulose calcium and low substituted hydroxypropylcellulose, and sodium carboxymethyl starch, hydroxypropyl starch, corn starch, potato starch, rice starch and partially pregelatinized starch Of starch can be used.

Examples of lubricants that can be used in the present invention include talc, stearic acid, calcium stearate, magnesium stearate, colloidal silica, hydrous silicon dioxide, various types of waxes and hydrogenated oils and the like.

Examples of the coating agent include dimethylaminoethyl methacrylate-methacrylic acid copolymer, polyvinyl acetal diethylaminoacetate, ethyl acrylate-methacrylic acid copolymer, ethyl acrylate-methyl methacrylate-chlorotrimethylammonium ethyl methacrylate A water-insoluble polymer such as a copolymer, a water-insoluble polymer such as ethylcellulose, a methacrylic acid-ethyl acrylate copolymer, hydroxypropylmethylcellulose phthalate, hydroxypropylmethylcellulose acetate succinate and the like and a thickener such as methylcellulose, hydroxypropylmethylcellulose , Polyvinyl pyrrolidone, polyethylene glycol, and the like, but are not limited thereto.

The dose of the lactic acid bacteria strain as an active ingredient in the composition for preventing or treating irritable bowel syndrome of the present invention is suitably determined in consideration of the purpose of treatment or prevention, the type of the patient to be treated or prevented, the symptom of the patient, . Generally, in the case of an adult patient, 1 x 10 ⁶ or more live cells, preferably 1 x 10 ⁸ to 1 x 10 ¹² live cells can be administered once or divided as needed.

The composition for preventing or treating irritable bowel syndrome containing lactic acid bacterium of the present invention can be administered or ingested as a medicine or food to humans or animals. The pharmaceutical composition containing the composition for preventing or treating irritable bowel syndrome of the present invention is an embodiment of the present invention, and the food containing the composition for preventing or treating irritable bowel syndrome containing the lactic acid bacterium of the present invention is also an embodiment of the present invention to be. Examples of such foods include, but are not necessarily limited to, yogurt and fermented dairy products.

Hereinafter, the present invention will be described in detail by way of examples. However, the following examples are illustrative of the present invention, and the contents of the present invention are not limited by the following examples.

Example

1. Isolation and Identification of Lactobacillus acidophilus LA1 Strains of Lactobacillus acidophilus LA1

1-1. Selection of strain

1 g of human feces was serially diluted in sterile anaerobic water and 1 ml of each dilution was poured into a BL (BL. BD, USA) solid medium and incubated for 3 days in anaerobic condition. The resulting colonies were transferred to a lactobacillus selective medium (BL solid medium) supplemented with BCP (Bromocresol purple, 0.17 g / l) and cultured for 3 days under the same conditions. The BCP indicator changes from purple to yellow when the lactic acid bacteria form lactic acid and the surrounding pH is lowered. The colony was transformed into a yellow color, and biochemical and molecular biochemical identification was carried out. One of the strains with the highest functionality and safety was finally selected.

1-2. Identification of selected strains

1) Usability analysis

The API 50 CHL Carbohydrate Test Kit (bioMerieux Co., France) was used to determine the sugar availability of selected strains. After culturing in a 10 ml MRS (Man-Rogosa-Sharpe) medium for 16 hours at 37 ° C, 1 ml of the culture broth was collected and washed twice with CHL solution. The cells were then collected by centrifugation and resuspended in 9 ml of CHL solution. 150 [mu] l of the strain suspension was placed in each well of the API 50 CHL kit, and the autoclaved paraffin oil was dispensed into the middle layer on the strain suspension. After 3 days of incubation at 37 ° C, the sugar availability was compared. The use of each carbon source was observed by observing changes in color due to microbial growth of 49 carbon sources, and the results of the final identification were analyzed using the identification program API web and shown in Table 1 below.

2) Identification of 16s rRNA

Genomic DNA was extracted from selected strains and analyzed for 16s rRNA sequence. Genomic DNA was extracted from 1 ml of the pure culture of the strain isolated from the feces using Accuprep genome extraction kit (Bioneer, Korea). (MyCycler, BIO-RAD, USA) was performed using primers F (5'-AGAGTTTGATCCTGGCTCAG-3 ') and primer R (5'-AAGGAGGTGATCCAGCC-3') in the 16s rRNA region using the extracted DNA as a template.

The PCR product was ligated to pGEM-Teasy vector (Promega, USA), transformed into E. coli strain DH5α, plated on LB / x-gal / ampplate and incubated overnight at 37 ° C. After the recombinant plasmid containing the insert was isolated from the transformant through screening, DNA sequencing was performed. DNA sequencing was performed using the Cluster V method of the DNA STAR program to compare homology with Lactobacillus acidophilus ^T (ATCC 4356). The 16s rRNA sequence of the isolated strain showed 99.0% homology with Lactobacillus acidophilus ^T (ATCC 4356) as shown in Figs. 1B-1C.

3) Random Amplified Polymorphic DNA (RAPD) analysis

RAPD analysis was performed using PCR-RAPD (MyCycler, BIO-RAD, USA) using primers (GTG) ₅ (5'-GTGGTGGTGGTGGTTG-3 ' Respectively. The final product, PCR product, was stained with EtBr (ethidium bromide) followed by G: BOX (SYNGENE, UK). As shown in FIG. 2, the strain isolated from the RAPD results showed a band pattern different from that of Lactobacillus acidophilus ^T (ATCC 4356). Therefore, it was confirmed that the strain isolated from the feces from the above results is a novel strain different from Lactobacillus acidophilus ^T (ATCC 4356). In Figure 2, lane 1 is the result of Lactobacillus acidophilus ^T (ATCC 4356) and lane 2 is the result of the test strain.

4) Pulse Field Gel Electrophoresis (PFGE) analysis

The OD of Lactobacillus acidophilus LA1 (ATCC 11906BP) and Lactobacillus acidophilus ^T (ATCC 4356) cultured in MRS broth was measured and then adjusted to final OD ₆₀₀ = 4 using 2% Low Melting Agarose A plug was produced. The prepared plugs were placed in 1 ml lysozyme buffer (2 mg / ml Lysozyme (Sigma), 0.05% N-lauorylsarcosine (Sigma)) and 10 μl of 4 mg / ml Lysostaphin (Sigma) was added thereto and reacted overnight at 37 ° C. The plug was carefully removed and placed in 4 ml of NDS buffer (1 ml 1M Tris-HCl (pH = 8.0), 10 ml 100% SDS, 89 ml 0.5 M EDTA (pH = 8.5) and reacted overnight at 50 ° C. After washing the plug six times with 10 ml of 50 mM EDTA (pH 8.5), carefully transfer the plug to 400 μl of the enzyme buffer to be treated, and allow to stand at room temperature for 30 minutes After transferring the plug to 400 μl of the new enzyme buffer, (Bio-Rad, USA) was used for the electrophoresis. The electrophoresis was performed at 0.5X TBE at 5.3 cm / V for 1 s, and then incubated at 37 ° C overnight at 37 ° C. The restriction enzymes SmaI and XhoI were used. 15 s pulse time for 20 hours. After the electrophoresis was completed, the band pattern was observed with G: BOX (SYNGENE, UK) after staining with EtBr solution.

The strain isolated from the PFGE results showed a band pattern different from that of Lactobacillus acidophilus ^T (ATCC 4356) as indicated by a triangle in FIG . In Figure 3, lane 1 is the result of Lactobacillus acidophilus ^T (ATCC 4356) and lane 2 is the result of the test strain. From the above results, it was confirmed that the strain isolated from feces was a novel strain different from Lactobacillus acidophilus ^T (ATCC 4356).

5) Antibiotic resistance test

For antibiotic resistance experiments on Lactobacillus acidophilus LA1 isolated from human feces, colonies of test strains were selected on MRS agar plates and the turbidity was adjusted to 1.0 McFarland standard with 0.85% NaCl solution. The MIC of ampicillin (AMP), vancomycin (VAN), gentamicin (GEN), kanamycin (KAN), streptomycin (STM), erythromycin (ERM), clindamycin (CLM), tetracycline (TET) and chloramphenicol Were measured in 96- shell microplates in the concentration range of 0.5 to 256 [mu] g / ml. Sensitivity to quinupristin + dalfopristin (QU + DA) was also measured in a concentration range of 0.02 to 32 / / ml. The microplate was incubated at 37 캜 under anaerobic conditions for 48 hours, and then the MIC was measured at the lowest antibiotic concentration at which no visible growth was observed. Based on the EFSA breakpoint, it was confirmed whether Lactobacillus acidophilus LA1 is resistant to each antibiotic and is shown in Table 2 below. The MIC values of Lactobacillus acidophilus LA1 were lower than the respective EFSA breakpoints, indicating that the strains of Lactobacillus acidophilus LA1 were AMP, VAN, GEN, KAN, STEM, ERM, CLM, , TET, and CP.

The strain on the basis of these results, "you know Lactobacillus also necessary Ruth LA1 (Lactobacillus acidophilus LA1)" named strains, and on April 28, 2011. The accession of the Republic of Korea patent strains deposited with institutions microbial Resource Center (KCTC) accession number KCTC 11906BP.

2. Isolation and Identification of Bifidobacterium breather bracket BR (2) (Bifidobacterium breve BR (2) (KCTC 11858BP)

2-1. Selection of strain

1 g of human feces was serially diluted in sterile anaerobic water and 1 ml of each dilution was poured into a solid medium of Glucose Vlood Liver (BL. BD, USA) and incubated for 3 days in anaerobic condition. The resulting colonies were picked again on a Lactobacillus culture medium supplemented with BCP (Bromocresol purple, 0.17 g / L) in BL, and then cultured again for 3 days under the same conditions. The colony was transformed into a yellow color, and biochemical and molecular biology identification was performed. One of the strains with the best physical properties was finally selected.

2-2. Identification of selected strains

1) Usability analysis

The strains isolated from human feces were tested for their glycosylation using an API CHL50 kit. As a result of the identification, as shown in Table 3, 99.9% of Bifidobacterium tribe ^T ( B. breve ^T ) and 99.9% of Bifidobacterium tribe ^T Showed the same biochemical characteristics. In the table below, w represents a weak change.

2) Identification of 16s rRNA

In order to identify new microorganisms using molecular biology, 16s rRNA base sequences were analyzed. Genomic DNA was extracted from 1 ml of the pure culture of the strain isolated from the feces using Accuprep genome extraction kit (Bioneer, Korea). (MyCycler, BIO-RAD, USA) was performed using primers F (5'-AGAGTTTGATCCTGGCTCAG-3 ') and primer R (5'-AAGGAGGTGATCCAGCC-3') in the 16s rRNA region using the extracted DNA as a template. The PCR product was ligated to pGEM-Teasy vector (Promega, USA), transformed into E. coli strain DH5α, plated on LB / x-gal / ampplate and incubated overnight at 37 ° C. After the recombinant plasmid containing the insert was isolated from the transformant through screening, DNA sequencing was performed. DNA sequencing was performed using the Cluster V method of the DNA STAR program to compare homology with B. breve ^T ( ATCC 15700). The 16s rRNA sequence of the isolated strain showed 98.8% percentage identity scores with Bifidobacterium Bleb ^T (ATCC 15700) as shown in Figures 4a-4c.

3) Random Amplified Polymorphic DNA (RAPD) analysis

RAPD assay using a genome DNA was extracted from Bifidobacterium breather bracket BR (2) isolated from feces, the isolated DNA as a template _{(GTG) 5 (5'-GTGGTGGTGGTGGTG} -3 ') primers PCR-RAPD (MyCycler, BIO-RAD, USA). The final product, the PCR product, was stained with EtBr and stained with G: BOX (SYNGENE, UK). In addition, PFGE analysis was performed by preparing a plug of Bifidobacterium breve BR (2) cultured in a final OD of OD ₆₀₀ = 4, digesting genomic DNA using various enzymes, and then performing electrophoresis And compared with the control group B. breve ^T (ATCC 157000).

As shown in FIG. 5, the strains isolated from the RAPD showed a band pattern similar to B. breve ^T (ATCC 15700) for Bifidobacterium breve BR (2), but different band patterns It looked. In FIG. 5, M is the molecular weight marker, lane 1 is the result of bifidobacterium breve BR (2), and lane 2 is the result of B. breve ^T (ATCC 15700). Based on the above results, it was confirmed that Bifidobacterium breve BR (2), a microorganism isolated from feces, was a new strain different from B. breve ^T (ATCC 15700).

4) Pulse Field Gel Electrophoresis (PFGE) analysis

The OD of the pure cultured Bifidobacterium breve BR (2) (KCTC 11858BP) and B. breve ^T (ATCC 15700) in the MRS broth was measured and then adjusted to final OD ₆₀₀ = 4 using 2% Low Melting Agarose A plug was produced. The prepared plugs were put into 1 ml lysozyme buffer (2 mg / ml Lysozyme (Sigma), 0.05% N-lauorylsarcosine (Sigma)) and 10 μl of 4 mg / ml Lysostaphin (Sigma) was added thereto and reacted overnight at 37 ° C. The plug was carefully removed and placed in 4 ml of NDS buffer (1 ml 1M Tris-HCl (pH = 8.0), 10 ml 100% SDS, 89 ml 0.5 M EDTA (pH = 8.5) and reacted overnight at 50 ° C. After washing the plug 6 times with 10 ml of 50 mM EDTA (pH 8.5), carefully transfer the plug to 400 μl of the enzyme buffer to be treated, and allow to stand for 30 minutes at room temperature. After transferring the plug to 400 μl of the new enzyme buffer, The electrophoresis was carried out using a CHEF system (BIO-RAD, USA) at a rate of 5.3 cm / V at 0.5 × TBE, 1 s to 15 s pulse time , ≪ / RTI > for 20 hours.

After the electrophoresis was completed, the band pattern was observed with G: BOX (SYNGENE, UK) after staining with EtBr solution. As a result of PFGE using XbaI, As shown in FIG. 6, it was confirmed that the band pattern was different from B. breve ^T (ATCC 15700) strain. In FIG. 6, lane 1 represents the results of the test strain, and lane 2 represents the results of B. breve ^T (ATCC 15700). From the above results, it was confirmed that the test strain isolated from feces was a new strain different from B. breve ^T (ATCC 15700).

5 Evaluation of antibiotic resistance

Antibiotic resistance experiments on Bifidobacterium breve BR (2) isolated from human feces were performed by selecting colonies of test strains from MRS agar plates and adjusting turbidity to 1.0 McFarland standard with 0.85% NaCl solution. The MIC of ampicillin (AMP), vancomycin (VAN), gentamicin (GEN), kanamycin (KAN), streptomycin (STM), erythromycin (ERM), clindamycin (CLM), tetracycline (TET) and chloramphenicol Were measured in 96- shell microplates in the concentration range of 0.5 to 256 [mu] g / ml. Sensitivity to quinupristin + dalfopristin (QU + DA) was also measured in a concentration range of 0.02 to 32 / / ml. The microplate was incubated at 37 캜 under anaerobic conditions for 48 hours, and then the MIC was measured at the lowest antibiotic concentration at which no visible growth was observed. Based on the EFSA breakpoint, it was confirmed whether or not Bifidobacterium breve BR (2) is resistant to each antibiotic, and is shown in Table 4 below. The MIC values of Bifidobacterium breve BR (2) were lower than the respective EFSA breakpoints for all antibiotics except tetracycline, indicating that the strain of Bifidobacterium breve BR (2) , VAN, GEN, KAN, STEM, ERM, CLM, thinner and CP.

Was based on the results, naming a novel microorganism isolated from feces to Bifidobacterium breather bracket BR (2) (Bifidobacterium bereve BR (2)), March 2011 Republic of Korea Patent strain deposited in the February date agency microbial resource centers ( KCTC) and received grant number KCTC 11858BP.

3. Isolation and Identification of Bifidobacterium longum CBT-3 (KCTC 11860BP)

3-1. Selection of new strains

1 g of human feces was serially diluted in sterile anaerobic water and 1 ml of each dilution was poured into a solid medium of Glucose Blood Liver (BL BD, USA) and incubated for 3 days in anaerobic condition. The resulting colonies were picked again on a Lactobacillus culture medium supplemented with BCP (Bromocresol purple, 0.17 g / L) in BL, and then cultured again for 3 days under the same conditions. The colony was transformed into a yellow color, and biochemical and molecular biology identification was performed. One of the strains with the best physical properties was finally selected.

3-2. Identification of selected strains

1) Usability analysis

The strains isolated from human feces were tested for their glycosylation using an API CHL50 kit. The results of confirmation of the usability were entered into the API web (https://apiweb.biomerieux.com), and the results are shown in Table 5 below.

B. longum ^T (ATCC 15707) metabolizes both arabinose and melezitose whereas B. infantis ^T (ATCC 15697) does not metabolize arabinose. The selected strain is a carbon source, It was confirmed that the selected strain belongs to Bifidobacterium longum because it can metabolize both nose and meleletose .

2) Identification of 16s rRNA

In order to identify the selected strains by molecular biology, 16s rRNA sequence was analyzed. Genomic DNA was extracted from 1 ml of the pure culture of the strain isolated from the feces using Accuprep genome extraction kit (Bioneer, Korea). (MyCycler, BIO-RAD, USA) was performed using primers F (5'-AGAGTTTGATCCTGGCTCAG-3 ') and primer R (5'-AAGGAGGTGATCCAGCC-3') in the 16s rRNA region using the extracted DNA as a template. The PCR product was ligated to pGEM-Teasy vector (Promega, USA), transformed into E. coli strain DH5α, plated on LB / x-gal / ampplate and incubated overnight at 37 ° C. After the recombinant plasmid containing the insert was isolated from the transformant through screening, DNA sequencing was performed. DNA sequencing was performed using the cluster V method of the DNA STAR program to compare homology with several strains of Bifidobacterium including B. longum ^T (ATCC 15707). The 16s rRNA sequence of the isolated strain showed 99.3% homology with B. infantis ^T (ATCC 15697) as shown in Fig. B. longum ^T (ATCC 15707) and B. infantis ^T (ATCC 15697) showed 98.8% homology.

3) Random Amplified Polymorphic DNA (RAPD) analysis

RAPD analysis was performed by extracting the genomic DNA from Bifidobacterium longum CBT-3 isolated from feces and using PCR-RAPD (MyCycler, RAPD) primer using ₅ (GTG) ₅ (GTGGTGGTGGTGGTG 3 ' BIO-RAD, USA) was performed. The final product, the PCR product, was stained with EtBr and stained with G: BOX (SYNGENE, UK). In addition, PFGE analysis was performed by preparing a plug of pure cultured Bifidobacterium longum CBT-3 with a final OD of OD ₆₀₀ = 4, digesting the genomic DNA using various enzymes, and then performing the electrophoresis of B. longum ^T (ATCC 15707).

As shown in Fig. 12, the strains isolated in the RAPD showed different band patterns from B. longum ^T (ATCC 15707), Bifidobacterium longum CBT-3. In FIG. 12, lane 1 is the result of B. longum ^T (ATCC 15707), and lane 2 is the result of Bifidobacterium longum CBT-3. Based on the above results, Bifidobacterium longum CBT-3, a microorganism isolated from feces, was found to be a novel strain different from B. longum ^T (ATCC 15707).

4) Pulse Field Gel Electrophoresis (PFGE) analysis

After the OD of Bifidobacterium longum CBT-3 cultivated in BL broth was measured, a plug was prepared with 2% ow Melting Agarose to a final OD ₆₀₀ = 4, and the DNA of the genome was cut using various enzymes And compared with the control group B. longum ^T (ATCC 15707).

The prepared plugs were put into 1 ml lysozyme buffer (2 mg / ml Lysozyme (Sigma), 0.05% N-lauorylsarcosine (Sigma)) and 10 μl of 4 mg / ml Lysostaphin (Sigma) was added thereto and reacted overnight at 37 ° C. The plug was carefully removed and placed in 4 ml of NDS buffer (1 ml 1M Tris-HCl (pH = 8.0), 10 ml 100% SDS, 89 ml 0.5 M EDTA (pH = 8.5) and reacted overnight at 50 ° C. After washing the plug 6 times with 10 ml of 50 mM EDTA (pH 8.5), carefully transfer the plug to 400 μl of the enzyme buffer to be treated, and allow to stand for 30 minutes at room temperature. After transferring the plug to 400 μl of the new enzyme buffer, The electrophoresis was carried out using a CHEF system (BIO-RAD, USA) at a rate of 5.3 cm / V at 0.5 × TBE, 1 s to 15 s pulse time , ≪ / RTI > for 18 hours.

After the electrophoresis was completed, the band pattern was observed with G: BOX (SYNGENE, UK) after staining with EtBr solution. As a result of PFGE using XbaI, Fecal Bifidobacterium longum CBT-3 was found to be a new strain showing a different band pattern from B. longum ^T (ATCC 15707). In FIG. 9, lane 1 is the result of B. longum ^T (ATCC 15707) and lane 2 is the result of Bifidobacterium longum CBT-3.

5) Evaluation of antibiotic resistance

To verify the safety of the isolated Bifidobacterium longum CBT-3, antibiotic resistance was analyzed using the micro-dilution method recommended by the European Food Safety Authority (EFSA). The antibiotics used in the antibiotic resistance test were 10 kinds of antibiotics including ampicillin (AMP), vancomycin (VAN), gentamicin (GEN), kanamycin (KAN), streptomycin (STM), erythromycin (ERM) ), Clindamycin (CLM), tetracycline (TET) and chloramphenicol (CP). Antibiotics except clindamycin were added at concentrations of 256, 128, 64, 32, 16, 8, 4, 2, 1, and 0.5 ㎍ / ㎖ in broth containing ISO-sensitized broth 10% and MRS broth 90% , The concentrations of antibiotics were added at concentrations of 16, 8, 4, 2, 1, 0.5, 0.25, 0.125, 0.0625, and 0.03125 ㎍ / ㎖ because the EFSA breakpoint value of the lactobacillus group was less than 0.25 ㎍ / . In addition, the thinner was carried out using an E-test strip of BioMeriux.

The microplate was incubated at 37 캜 under anaerobic conditions for 48 hours, and then the MIC was measured at the lowest antibiotic concentration at which no visible growth was observed. Based on the EFSA breakpoint, it was confirmed whether Bifidobacterium longum CBT-3 was resistant to each antibiotic and is shown in Table 6 below.

The isolated Bifidobacterium longum CBT-3 showed lower resistance to all antibiotics except kanamycin than the EFSA antibiotic resistance standard. Therefore, it is considered that the antibiotic safety criteria for EFSA are appropriate for antibiotics other than kanamycin.

A novel microorganism isolated from feces on the basis of the above results, the Bifidobacterium ronggum CBT-3 (Bifidobacterium longum CBT- 3) to the named was, in March 2011 Republic of Korea Patent strain deposited at the two dates agency microorganisms Resource Center (KCTC) Deposited with KCTC 11860BP.

4. Preparation of compositions for the prevention / treatment of irritable bowel syndrome

(1) Lactic acid bacteria fermentation medium

The fermentation medium for the cultivation of the lactic acid bacteria strain contained in the composition of the present invention is a fermentation medium containing 1% -10% (w / v) aqueous solution of skimmed milk powder and soy protein isolate, respectively, (Delvolase; DSM, Netherlands) in the range of -1% (w / w). ratio. Breve , Rain. Longgum, El. The enzyme treatment step was omitted for the lactic acid bacterium of the plantarium.

After the enzyme treatment, the yeast extract in the range of 0.1% to 5% (w / v), the yeast extract in the range of 0.1% to 5% (w / v), the starch such as sucrose, Addition of ionic constituents of soymilk citrate, sodium acetate, dipotassium phosphate, magnesium sulfate, manganese sulfate, sodium chloride in the range of 5% (w / v) soy peptone, 0.01% -0.1% (w / v) And dissolved to prepare a lactic acid bacteria culture medium. The prepared culture medium for lactic acid bacteria was sterilized using a heat exchanger.

(2) Cultivation of lactic acid bacteria and production of lactic acid bacteria

The lactic acid bacterium pre-cultured on the fermentation broth of the lactic acid bacteria prepared in the step (1) was inoculated at a level of 0.1% -1% (v / v) and maintained at 37 ° C and a pH of 5.0-6.0. Followed by fermentation for 18 hours. After the cultivation of the lactic acid bacteria was completed, the lactic acid bacteria were separated and concentrated using a continuous centrifuge. The isolated lactic acid bacteria were lyophilized by adding a cryoprotectant, etc., followed by pulverizing the lactic acid bacteria using a pulverizer to have a uniform particle size and then producing lactic acid bacteria.

(3) Preparation of Lactic Acid Bacteria Composition

The lactic acid bacteria prepared in the step (2) were measured to have the following viable cell counts;

Lactobacillus plantarum LP1 lactic acid bacteria (1X10 ¹¹ CFU / g or more),

Streptococcus thermophilus ST3 lactic acid bacteria (1X10 ¹¹ CFU / g or more),

Lactobacillus Lamsos LR (3) Lactic acid bacteria (1X10 ¹¹ CFU / g or more),

Lactobacillus acidophilus LA1 lactic acid bacteria (1 x ¹⁰ < ¹¹ > CFU / g or more)

Bifidobacterium animaris Lactis CBT2501H Bifidobacterium (1X10 ¹¹ CFU / g or more),

Bifidobacterium breve BR (2) Bifidobacterium (1X10 ¹¹ CFU / g or more),

Bifidobacterium longum CBT-3 bifidus (5X10 ¹⁰ CFU / g or more).

In this Example, each lactic acid bacterial species was mixed with the excipient in the composition shown in Table 7 below to give 500 mg per capsule, and the total viable cell count was 5 × 10 ⁹ CFU / g. The hydroxypropylmethylcellulose capsule was prepared. The thus prepared composition of the present invention was administered to IBS patients for 8 weeks (1.0 × 10 ¹⁰ colony forming units / day) twice a day, orally, once per capsule.

Raw material name ratio (%)  Lactobacillus planta room LP1 lactic acid bacteria 7.0  Streptococcus thermophilus ST3 lactic acid bacteria 7.0  Lactobacillus LAMNOSUS LR (3) Lactic acid bacteria 3.0  Lactobacillus acidophilus LA1 lactic acid bacteria 4.0  Bifidobacterium animaris Lactis CBT2501H 3.0  Bifidobacterium breve BR (2) Bifidobacterium 2.0  Bifidobacterium longum CBT-3 bifidus 2.0  Polydextrose 30.5  Corn starch 40.0  Magnesium stearate 1.5  Sum 100.0

Comparative Example

The comparative example was prepared with the same appearance, color and size of the placebo containing only the excipient of Table 5 without containing the active ingredient, lactic acid bacteria.

Experimental Example

1. Subject Screening

Clinical studies were conducted under the following conditions using patients with diarrhea - predominantly irritable bowel syndrome (IBS).

Subjects had diarrhea-predominant IBS according to the Rome III diagnostic criteria (Longstreth GF, Thompson WG, Chey WD, Houghton LA, Mearin F, Spiller RC, Functional bowel disorders. Gastroenterology 2006; 130: 1480-91) A patient

Number of patients : 60

Test period : 1 week screening period and 10 week treatment period

Referring to FIG. 10, 50 of the patients suffering from diarrhea-predominant IBS in a total of 60 were screened, and 50 of them were randomly extracted into two groups of 25 patients in the Examples and Comparative Examples. Of the 50 men, 26 were males and 25 were females. Experiments were completed for a total of 47 patients because one patient in the composition administration group (Example) of the Example and one patient in the placebo administration group (Comparative Example) of the Comparative Example failed to complete the experiment. Table 8 summarizes the characteristics of patients at baseline before treatment. All values are expressed as mean ± standard deviation (SD).

2. IBS Symptoms and Counterparts Clinical Assessment

The efficacy of the composition for the prevention or treatment of irritable bowel syndrome of the present invention can be evaluated by comparing the efficacy of the composition for preventing or treating irritable bowel syndrome of the present invention in the form of self-questionnaire every day during the treatment period (8 weeks) Were evaluated and recorded. The primary endpoint was the appropriate symptom relief (AR) effect on overall IBS symptoms, and the appropriate symptom relief effect on overall IBS symptoms for 10 weeks after dosing. The responder was defined as a patient who experienced moderate symptom relief of more than half of the 10 weeks (ie, more than 5 weeks). The secondary endpoint was the assessment of the effect of the composition of the present invention on individual IBS symptoms, stool parameters (stool frequency and stiffness), which were analyzed daily through questionnaires and evaluated as average per week.

During the screening and treatment period, seven symptoms associated with the next IBS of the patients were recorded daily and the rate of response to these seven symptoms was assessed: abdominal pain, abdominal discomfort, dilute / watery, urgency, Abdominal bloating, gas passing. Each symptom was rated on a 10-cm visual analogue scale ("VAS") with a maximum score of 10, and the visual analog scale score and the change rate of these scores (% ) Are shown in Table 9 below. Here, the rate of change was calculated by the following equation.

[Equation]

Rate of change (%) = (8 week score 0 week score) / 0 week score X 100

The responder is defined as the patient who responded that the overall symptom of IBS was alleviated by more than half of the tested states (ie, over 5 weeks) during the treatment and follow-up periods. The number of bowel movements was evaluated by the number of bowel movements during the day, and the stool stiffness was evaluated using the Bristol Stool Scale (scale 0 to 6).

As can be seen from the results in Table 9 above, the composition administration group (Example) of the present invention showed a higher response rate than the placebo administration group (comparative example) in all patient symptoms characteristic of diarrheal IBS. Thus, it can be confirmed that the composition of the present invention is useful as a treatment for diarrhea-dominant IBS.

FIG. 12 shows the weekly response rate (i.e., relaxation rate) of the overall IBS symptoms in the administration group administered with the composition prepared in the Example and the placebo administration group in the comparative example during the entire treatment period and the follow-up period. As shown in FIG. 12, the weekly reaction rate was much higher ( P <0.05) in the case of the administration of the composition of the present invention than in the placebo administration.

The proportion of responders who showed adequate relief for overall IBS symptoms over 5 weeks during the 10-week assessment period is shown in FIG. This analysis was done by an intention-to-treat (ITT) method. Referring to FIG. 13, the proportion of responder was 48% (12 out of 25) in the composition administration group, 12% (3 out of 25) in the placebo administration group of the comparative example, ( P = 0.01) was statistically significant.

During the treatment period, the mean value of individual IBS symptom scores in both groups increased, 33.8% in the example, and 33.3% in the comparative example. However, the overall average score and the rate of change in the subscore were not significantly different in both groups (see Table 9).

Jangwoondong was similar in both groups and did not change significantly after treatment. However, the change in the Bristol Stool Scale value before and after the baseline treatment was much higher in the composition-administered group of the example than in the placebo-treated group of the comparative example (Examples: 0.85 占 1.14, vs. Comparative Example: 0.15 占1.11, P = 0.041). The percent change in percent of the example was much higher than the percentage change in the comparative example (-14.5 + 19.7% vs. -0.6 + 25.4%, P = 0.045).

From the above results, it can be confirmed that the composition of the present invention is effective for the treatment of irritable bowel syndrome diarrhea-predominant irritable bowel syndrome.

3. Assessment of irritable bowel syndrome-specific quality of life (IBS-QOL)

Quality of life was assessed at randomization and at the end of treatment using the IBS-specific Quality of Life Assessment Tool (IBS-QOL) developed by Drosman et al. In each case, the following eight domains were evaluated: dysphoria, dysfunction, body image, health concerns, refusal to eat, social response, sexual functioning, and ralationship. The IBS-QOL scores evaluated at the time of randomization and at the end of therapy and the percent change in these scores are shown in Table 10 below. Here, the rate of change was calculated by the following equation.

[Equation]

Rate of change (%) = (8 week score 0 week score) / 0 week score X 100

As can be seen from the results of Table 10 above, the mean of the overall and individual domain scores for IBS-QOL was not significantly different between the groups at baseline and after treatment ( P > 0.05). The percent change in the IBS-QOL score before and after treatment in both groups was significantly higher in the groups of the Examples (21.3% vs. 9.0%, P = 0.073). Among the eight domains in particular, the rate of change in health concerns was significantly higher in the groups of the Examples compared to the Comparative Groups ( P = 0.031). From these results, it can be seen that the composition of the present invention significantly reduced the quality of life due to irritable bowel syndrome.

4. Gross total microbial counts by denaturing gradient gel electrophoresis (DGGE)

(1) Preparation of genomic DNA from feces samples

To extract genomic DNA from the control strain, one milliliter was taken from the overnight culture and centrifuged at 12,000 rpm for 10 minutes at 4 ° C to recover the cells (MICRO 17R, Hanil, Seoul, Korea). To extract genomic DNA from a feces sample, the feces collected from the patient and frozen were stored at 4 ° C overnight, and then 200 mg of each sample was taken, and 9 ml of C-buffer (0.6% KH ₂ PO ₄ , 0.45 % Na ₂ HPO ₄ , 0.05% Tween 80, and 0.05% cysteine), homogenized and passed through packed glass wool in a disposable 10 ml syringe.

The resultant was centrifuged (MICRO 17R) at 12,000 rpm for 10 minutes at 4 ° C. The pellet was washed three times with the same buffer and 10 mg of final pellet was resuspended in 200 μl of lysozyme solution (20 mM Tris-Cl, pH 8.0, 2 mM EDTA, 1.2% Triton X-100 and 20 mg / )), Followed by incubation at 37 DEG C for 1 hour. Then, whole genomic DNA was extracted using AcuuPrep genome extraction kit (Bioneer, Seoul, Korea) according to the manufacturer's instructions.

(2) PCR-DGGE

In this example, changes in the composition of stool microbial counts in IBS were analyzed by denaturing gradient gel electrophoresis (DGGE). The V2-V3 region of the 16s rRNA gene was amplified by nested PCR and the product of the PCR was analyzed by DGGE. In the case of double-polymerase chain reaction, two sets of primers are used. Primer 27F (5'-AGAGTTTGATCCTGGCTCAG-3 ') and 1429R (5'-GGTTACCTTGTTACGACTT-3'). These primers were used in the first PCR, targeting the 16s rRNA gene. Primers 341F-GC (5'-GC-clamp-CCTACGGG AGGCAGCAG-3 ') and 518R (5'-ATTACCGCGGCTGCTGG-3') were used to amplify the V2-V3 region of the 16s rRNA gene in the secondary PCR. A 40-bp GC-clamp (CGCCCGCCGCGCGCGGCGGGCGGGGCGGGGGCACGGGGGG) was attached to the 5 ' end of the 341F-GC primer. In the first PCR, Fecal community DNA was used as a template and 27F and 1492R primers were used as primers. 1 μl of DNA, 10 μl of 5 × buffer, 2.5 μl of each primer (10 μl), 5 μl of dNTPs (2.5 mM each), 0.25 μl of Go tag polymerase (5 units / μl, Promega) By weight of distilled water. Amplification was carried out by pre-denaturing for 4 minutes at 94 ° C, 30 cycles of denaturation at 94 ° C for 1 minute, annealing at 50 ° C for 30 seconds, and extension at 72 ° C for 90 seconds followed by post-extension at 72 ° C for 10 minutes ) Process. The product obtained by PCR was analyzed with a 1% agarose gel and the agarose gel was visualized by staining with bromate ethidium.

The secondary PCR was performed using 341F-GC primer, 40-bp GC-clamp and 518R as primers, using the product obtained in the above primary PCR as a template. The final 50 μl reaction mixture contained 1 μl of DNA, 10 μl of 5 × buffer, 2.5 μl of each primer (10 μl), 5 μl of dNTPs (2.5 mM each), and 341 F-GC primer (1.25 pmol) (2.5 pmol), 0.25 uL of Go tag polymerase, and distilled water. Amplification was carried out by pre-denaturing for 4 min at 94 ° C, 30 cycles of denaturation at 94 ° C for 45 sec, annealing at 55 ° C for 45 sec, extension at 72 ° C for 45 sec, post-extension at 72 ° C for 10 min ) Process.

DGGE was performed using the DCode Universal Mutation Detection System (Bio-Rad, USA). The PCR products were analyzed on an 8% polyacrylamide gel (37.5: 1 = acrylamide-bisacrylamide) with urea and formaldehyde gradient of 35% to 60% in the electrophoresis direction. Twenty microliters of PCR products were loaded onto the gel and electrophoresed at 80 V in 1X TAE (Tris-acetate-EDTA buffer, pH 8.0) for 15 hours at a constant temperature of 60 ° C. After electrophoresis, the gel was stained with ethidium bromide and visualized using an advanced image analysis system (G: BOX, SYNGENE, UK). For comparison of DGGE behavior, captured gel images were analyzed by UPGMA (unweighted pair group match average) using Dice Coefficient cluster analysis using UVI Bandmap software version 11.9 (UVI Tec, UK).

(3) Total analysis of stool microorganisms

Fecal clustering DNA was extracted from all samples and analyzed by DGGE. The concordance rate of DGGE behavior before and after treatment of each patient in the group of the Examples was compared with the concordance rate of DGGE behavior before and after treatment of each patient in the Comparative Example. Examples of the DGGE behavior of both groups are shown in Figs. 14A and 14B. FIG. 14A is a modified gradient gel electrophoresis image for confirming changes in the composition of the stool microbial counts of the patient before and after the treatment in the embodiment, and FIG. 14B shows the change in the composition of the stool microbial counts Lt; RTI ID = 0.0 &gt; gel electrophoresis. &Lt; / RTI &gt; Each band represents a different organism, and the similarity of band positions represents a population of organisms of the same composition. The agreement rate of the DGGE of the example group was 69.5 ± 10.5%, and the agreement rate of the DGGE behavior of the comparative group was 56.5 ± 13.0%. A statistical analysis of the agreement rates between the groups of both showed significant differences, the agreement rate in the examples being much higher ( P = 0.005) than in the comparative example (see FIG. 15).

These results suggest that the pathophysiology of irritable bowel syndrome may be due to the instability of intestinal microbial composition and suggest that the mechanism of treatment of irritable bowel syndrome in the composition of the present invention is to maintain the total intestinal microbial composition stably do.

As described above, the composition comprising seven kinds of the lactic acid bacteria of the present invention provides appropriate relief of symptoms of IBS, improves stool stiffness, and improves IBS-specific quality of life (IBS-QOL) in diarrhea-dominant IBS And the therapeutic effect of the composition of the present invention was confirmed to be related to the stabilization of intestinal microorganism gun.

The present invention can be variously modified and changed without departing from the spirit and scope thereof, and such facts will be apparent to those skilled in the art. The specific embodiments described herein are merely illustrative of preferred embodiments of the invention and should not be construed as limiting the invention. It is intended that the scope of protection of the present invention be defined by the appended claims, and that the various modifications and variations are intended to be included within the scope of the present invention.

Korea Biotechnology Research Institute KCTC11906BP 20120428 Korea Biotechnology Research Institute KCTC11868BP 20110302 Korea Biotechnology Research Institute KCTC11903BP 20110428 Korea Biotechnology Research Institute KCTC11858BP 20110302 Korea Biotechnology Research Institute KCTC11860BP 20110302 Korea Biotechnology Research Institute KCTC11867BP 20110302 Korea Biotechnology Research Institute KCTC11870BP 20110302

Claims (1)

Korea Research Institute of Bioscience and Biotechnology Gene Bank (Korean Collection for Type Culture; KCTC ) international deposit accession No. KCTC the Lactobacillus even know Phil Ruth LA1 (Lactobacillus acidophilus LA1) lactic acid as a 11906BP.

Images