KR20140052303A - Method for increasing productivity of tricyclo compounds - Google Patents

Abstract

The present invention provides a method for increasing productivity of tacrolimus, ascomycin, rapamycin, etc. which are tricyclocompounds, by introducing a gene encoding chorismatase to a microorganism producing tricyclocompounds. More specifically, the present invention relates to the method for increasing productivity of tricyclocompounds, which have FkbO or RapK as the gene encoding chorismatase.

Description

[0001] The present invention relates to a method for increasing the productivity of a trivalent cyclic compound,

The gene fkbO encoding chorismatase involved in the synthesis of dihydroxycyclohexanecarboxylic acid (DHCHC), an early precursor starter unit of biosynthesis of a three-ring compound, is introduced into Streptomyces sp. The present invention relates to a method for improving the productivity of a three-membered ring compound including crawling moth.

Tacrolimus (FK506), ascomycin (FK520) and rapamycin are tricyclo compounds and are macrolide-based polyketide compounds. The ternary ring compound is a pharmacologically very useful substance having various physiological activities such as antifungal, anticancer and immunosuppressive activity. In particular, tacrolimus is used not only for suppression of immune rejection in organ transplant patients but also for the treatment of autoimmune diseases such as atopy. Tacrolimus may be produced by a variety of methods including, but not limited to, Streptomyces tsukubaensis 9993 (US Patent No. 4,894,366), Streptomyces sp. ATCC 55098, Streptomyces sp. ATCC 53770, Have been reported to be produced in strains such as Streptomyces clavuligerus CKD1119 (Korean Patent 10-0485877) and Streptomyces kanamyceticus KCC S-043 (KCTC 9225) (Muramatsu H. et al. , 2005).

Tricyclocompounds belong to the hybrid group of polyketide and nonribosomal peptide. Their chemical structure is formed by condensing two carbon units to form a polyketide formed by connecting a cyclohexyl structure to a pipecolic acid (unusual amino acid) Macrolide-based compounds.

The mechanism of biosynthesis of the macrolide compounds produced by microorganisms is a megasynthase composed of multiple large protein complexes. In particular, polyketide region biosynthesis is accomplished by the claisen condensation of acyl-CoA, and the enzyme encoded by the gene responsible for the biosynthesis of these substances is expressed as a unit of module And are known to act sequentially. It is classified as a so-called modular type I polyketide synthase (PKS). Modular type 1 polyketide synthase (modular type I PKS) consists of a series of sets of catalytic domains that elongate and modify each chain length. As a module progresses by one cycle, two carbon atoms constituting the skeleton become larger. The module type 1 polyketide synthase is a multienzyme system, and is typically composed of a loading module, multiple extender modules, and a releasing module.

Tacrolimus biosynthesis has been shown to be responsible for biosynthetic machinery consisting of modulo type 1 polyketide and non-ribosome peptide synthase (Motamedi et al. (1998), Eur. J. Biochem., 256, 528-534). Other biosynthetic mechanism of Crawley mousse fkbA, fkbB, fkbC (poly Kane Tide synthase gene), fkbO (DHCHC synthetic gene), fkbP (non-ribosomal peptide synthase), fkbL (Lysine cyclodeaminase), fkbD (P450 hydroxylase), fkbM a (O-methyl transferse), fkbN ( transcription control genes), fkbG, H, I, J, etc. K (methoxymalonyl ACP synthesis gene) and tcsA, tcsB, tcsC, tcsD (Ali malonyl Koei synthetic gene) 97kb (Sang Joon Mo et al. (2011), JACS, 133, 976-985).

The biosynthesis of the ternary ring compound, typically tacrolimus, is the synthetic starting unit material is DHCHC (4,5-dihydroxycyclohex-1-enecarboxylic acid) derived from Shikimate, in which two malonyl-CoA and two The condensation reaction of methoxymonyl ACP, 5 methoxymonyl CoA and 1 allyl malonyl CoA results in the extension of the backbone chain and finally the condensation of L-pipecolinic acid derived from one L-lysine It is known.

Polycetide compounds containing ternary ring compounds are very difficult to chemically synthesize and produced in very small amounts by wild-type production strains. In general, the polyketide compound must be abundant in its precursor supply to increase productivity. A method of increasing the productivity by increasing the amount of the precursors of the secondary metabolites is generally a method of increasing the productivity by adding an excess amount of the precursor to the fermentation medium. However, secondary metabolite precursors are expensive and it is uneconomical to add large amounts of precursors to the medium. In addition, the productivity of actinomycetes secondary metabolites is increased by random mutagenesis using conventional methods to obtain variants with increased productivity. However, this method takes a lot of time and effort to obtain mutant with increased productivity, and it is difficult to maintain the activity of the mutant. Therefore, it is industrially useful to develop a strain with increased productivity through metabolic engineering.

Thus, efforts have been made to acquire biosynthetic genes of tacrolimus in order to increase the productivity of tacrolimus through gene manipulation. Recently, the genes for tacrolimus biosynthesis have been completely revealed.

Recent studies have shown that FkbO and RapK in the biosynthesis mechanism of trivalent cyclic compounds exhibit chorismatase activity and are involved in the synthesis of 3,4-dihydroxycyclohex-1-enecarboxylic acid (DHCHC), the starting unit for the synthesis of tertiary cyclic compounds (Andexer et al. (2011), PNAS, 108, 4776-4781), these RapK and FkbO show high homology of over 70%.

In view of this point, the inventors of the present invention thought that it would be possible to increase the productivity of the three-ring compound by introducing a gene encoding the tacrolimus biosynthesis gene, which is a gene encoding tacrolimus, without adding a synthesis starting unit material. There is no report that the use of the gene coding for cholestyramine has increased the production of trivalent cyclic compounds.

It is an object of the present invention to provide a method for enhancing the productivity of a trivalent cyclic compound through overexpression of a gene encoding a chlorimethase involved in synthesis of a starting material for synthesis in a trivalent cyclic compound producing strain.

The present inventors investigated a gene involved in the synthesis of a starting material for synthesis of tacrolimus, a three-membered ring compound, and investigated a method for enhancing productivity through overexpression of the gene.

In the present invention, the expression vector of the fkbO gene, which is a gene encoding the chrysanthemies protein, is introduced into the Streptomyces sp. Strain, a tacrolimus producing strain, and the amount of the starting material for synthesis in vivo is increased by improving the strain by a metabolic engineering method To improve the productivity of tacrolimus.

The present invention provides a method for enhancing the production of a three-membered ring compound by introducing a gene encoding a chorismatease into a strain of Streptomyces producing a three-membered ring compound.

In addition, the present invention provides a method for enhancing the production of a three-ring compound, wherein the gene encoding the cholesteatoma is FkbO or RapK .

In addition, the present invention provides a method for enhancing the production of a three-ring compound, which is obtained by obtaining or synthesizing a gene encoding a chlorimethase in a microorganism.

In addition, the present invention provides a method for enhancing the production of a three-ring compound, wherein the microorganism is a Streptomyces strain.

The present invention also relates to a method for enhancing the production of a three-membered ring compound by introducing a gene coding for the above-mentioned colistemase into a strain of Streptomyces producing a three-membered ring compound

Inserting a gene encoding a chorismate into an expression vector;

Transforming the microorganism with an expression vector into which the cholesteatism-encoding gene has been inserted; And

And transforming the transformed microorganism with a strain of the genus Streptomyces producing Streptomyces, to transform Streptomyces spp., Thereby providing a method for enhancing the production of a triple ring compound .

In addition, the present invention is characterized in that the nucleotide sequence of the gene encoding the above-mentioned colismatic is the same as that of SEQ ID NO: 5, SEQ ID NO: 7 or 9.

In the present invention, the nucleotide sequence of SEQ ID NO: 5, SEQ ID NO: 7, or SEQ ID NO: 9, or a nucleotide sequence in which at least one base of the nucleotide sequence is deleted, substituted or inserted.

It is apparent to those skilled in the art that the gene sequences coding for the above-mentioned chorismetes are not limited to these examples. Sequences having substantial sequence identity or substantial sequence homology to the sequences are also within the scope of the present invention. As used herein, the term "substantial sequence identity" or "substantial sequence identity" is used to denote that the sequence represents substantial structural or functional identity with another sequence. These differences are due, for example, to inherent variations in the codon usage between different species. If there is a significant amount of sequence redundancy or similarity between two or more different sequences, the structural differences will be negligible if they have similar physical properties even if the length or structure of these sequences is different.

(2001)) and Frederick et al. (Frederick et al., Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY (Ausubel et al., Current protocols in molecular biology volume 1, 2, 3, John Wiley & Sons, Inc. (1994)).

Advantages and features of the present invention and methods of achieving them will become apparent with reference to the embodiments described in detail below. The present invention may, however, be embodied in many different forms and should not be construed as being limited to the embodiments set forth herein. Rather, these embodiments are provided so that this disclosure will be thorough and complete, and will fully convey the scope of the invention to those skilled in the art. Is provided to fully convey the scope of the invention to those skilled in the art, and the invention is only defined by the scope of the claims.

According to the present invention, it is possible to increase the industrial productivity of tacrolimus by increasing the amount of synthetic unit material through a gene recombination method. The tacrolimus produced by the method of the present invention can be used as an antifungal agent, a therapeutic agent for atopic dermatitis and an immunosuppressant agent.

1 is a schematic diagram showing the construction of pSET152-SIO and pSET152-SKO vectors,
FIG. 2 is a graph showing the production amount of tacrolimus of a transformant into which a tacrolimus synthesis starting unit material synthesis gene is introduced.
S. sp: Tacrolimus producing strain
pSET152: Streptomyces sp. strain introduced with only pSET152 vector
pSET152-SIO: pSET152-SIO vector-introduced Streptomyces sp. strain
pSET152-SKO: pSET152-SKO vector-introduced Streptomyces sp. strain
FIG. 3 shows the results of HPLC analysis of a transformant into which a tacrolimus synthesis starting unit material synthesis gene was introduced. (A) is a S. (B) is a strain of Streptomyces genus in which only pSET152 vector is introduced, (C) is a strain of Streptomyces genus in which pSET152-SIO vector is introduced, (D) is a strain of Streptomyces genus in which pSET152- .

The present invention provides a metabolic engineering method for increasing productivity of tacrolimus, ascomycin, rapamycin, and derivatives thereof, which are three-ring compounds. Representative tacrolimus and rapamycin among the trivalent compounds are represented by the following formulas (1) and (2). The present invention enhances the production of a three-ring compound by expressing a chrysanthemate acting as in Scheme 1.

<Reaction Scheme 1>

The gene encoding the chorismate may be obtained from a microorganism or chemically synthesized, and specifically from a strain of actinomycetes. More specifically, Streptomyces tsukubaensis 9993, Streptomyces sp. ATCC 55098, Streptomyces sp. KCTC 11604BP, Streptomyces sp. ATCC 53770, Streptomyces clavuligerus CKD1119, Streptomyces kanamyceticus KCC S-043 (KCTC 9225), Streptomyces hygroscopicus ATCC 29253, or a strain of these strains Or a strain producing a tertiary cyclic compound as a mutant thereof.

In a specific example of the present invention, a group of tacrolimus biosynthesis genes was obtained mainly on polyketide synthase in Streptomyces sp . KCTC 11604BP and Streptomyces kanamyceticus KCTC 9225, and tacrolimus biosynthesis FkbO , which is a gene coding for cholesteatase , was obtained from the gene group.

In addition, in the example of the present invention, it was intended to increase the production of tacrolimus by introducing and expressing the expression gene of chrysanthemiis into the production strain of tacrolimus among the three-ring compounds. However, the method of increasing the productivity of a ternary ring compound of the present invention is not limited to the production of tacrolimus, and the productivity of other ternary ring compounds can be improved by mass production of the starting material for synthesis by this method. It is obvious to those of ordinary skill.

In the same strategy is also genus Streptomyces KCTC11604BP, such as 1 to Streptomyces Kana Mai Shetty kusu KCTC 9225 strain of the derived gene fkbO in encrypting the koriseu methane rise synthesis unit substance synthetase of Streptomyces promoter for ^P ermE ^* downstream To prepare an expression vector. The promoter &lt; ^RTI ID ^{= 0.0} &gt; PermE ^* &lt; / ^RTI & But the scope of the present invention is not limited thereto by general vectors and promoters for overexpression in actinomycetes.

The productivity of tacrolimus in the transformant into which the recombinant expression vector was introduced was examined. As a result, it was confirmed that the productivity of tacrolimus was increased by 58% -64% as compared with that of the non-introduced strain.

Hereinafter, the structure of the present invention will be described in more detail with reference to examples. However, it will be apparent to those skilled in the art that the embodiments of the present invention are for illustrative purposes only and are not intended to limit the scope of the present invention.

Example 1: Bacterial lineage and genetic manipulation

For the production of the recombinant transformant of the present invention, the strain Streptomyces sp. Was used. Genetic manipulation was performed in E. coli DH5a according to the usual procedure (Sambrook J et al. (2001) Molecular Cloning: A Laboratory Manual, 3rd Ed., Cold Spring Harbor Laboratory, Cold Spring Harbor, NY). A T-easy vector (Promega) was used for subcloning.

Example 2 Culture Conditions and Metabolism Analysis

Streptomyces sp. Strains producing tacrolimus were cultivated in ISP4 medium for 2 weeks at 28 ° C, and the resulting spores were collected and used in this experiment. Fermentation of Streptomyces spp. And its transformants was carried out under the following conditions.

The Streptomyces sp. Strain used in the Examples is Streptomyces sp. KCTC11604BP.

The strain was added to 30 ml medium 1 (1% water-soluble starch, 0.7% glycerol, 0.3% bactopeptone, 0.3% yeast extract, 0.5% soybean peptone, pH 6.8) contained in a 500 ml Erlenmeyer Erlenmeyer flask, rpm. After activation, the activated seed culture was inoculated into 30 ml medium 2 (1% oxidized starch, 1% glycerol, 2% soybean wheat, 0.2% CaCO ₃ , 0.5% CSL, pH 6.5) and cultured for one day under the same conditions. The culture broth in a medium 2 500㎖ Erlenmeyer 30㎖ medium 3 loaded in a conical flask (7% of oxidized starch, 1.7% of yeast powder, 0.5% soy bean _{mill, 0.1% (NH 4) 2} SO 4, 0.1% CaCO ₃ , pH 8.5) was inoculated with 10% of the volume of the final culture medium and cultured at 28 ° C and 240 rpm for 6 days.

Tacrolimus extraction was carried out using the same amount of acetone as the fermentation broth. The tacrolimus compound was quantitatively analyzed by HPLC. The absorption wavelength was 210 nm and the column temperature was 60 DEG C, and 20 mu l of the extract was introduced into a C8 column (4.6 mm x 150 mm, Zorbox XDB C8). The assay conditions were 40- 54% acetonitrile and 60-46% H ₂ O containing 0.01% TFA for 0-40 min.

Example 3: Preparation of expression plasmids

The fkbO gene involved in DHCHC synthesis as a starting material of tacrolimus synthesis was obtained by PCR using genomic DNA obtained from Streptomyces genus KCTC11604BP and Streptomyces kanamycetics KCTC9225 as a template. The primers used for securing the above genes are shown in Table 1.

primer Base sequence SI-fkbO-F cg ggatcc gtcgcgcgtacttgtctgcatc ( BamH I) SI-FKBO-R gc tctaga gtttccccgtttccctgacttc ( Xba I) SK-FKBO-F gc tctaga gcatgtctgcgcccgtcgcg ( Xba I) SK-FKBO-R gctctagagctcaccgcaccaccccctc ( Xba I)

The fkbO gene derived from Streptomyces genus KCTC11604BP was amplified by PCR using SI-fkbO-F and SI-fkbO-R primers, and a 1,136 bp PCR product was obtained. The fkbO gene derived from Streptomyces kanamycetixus KCTC 9225 contained SK PCR products were amplified using -fkbO-F and SK-fkbO-R primers to obtain a 999 bp PCR product. Each PCR product was cloned into pGEM T-easy vector and sequenced by base sequence analysis. The fkbO gene derived from Streptomyces sp. KCTC11604BP having the nucleotide sequence confirmed was digested with BamH I and Xba I restriction enzymes and recovered in the pGEM T-easy vector. The fkbO gene derived from Streptomyces kanamycetixus KCTC 9225 was digested with Xba I restriction enzyme And recovered in pGEM T-easy vector. Each of the fkbO gene pSET152 vector ^p ermE ^* downstream same restriction genus Streptomyces KCTC11604BP derived as shown in FIG. 1 by inserting the enzyme spot fkbO expression vector pSET152-SIO and Streptomyces Kana Mai Shetty kusu KCTC 9225 derived fkbO expression of the vector in pSET152-SKO were prepared. The pSET152 vector used in this example has an apramycin-resistant gene { acc (3) IV } and has a property that can be directly introduced into a microorganism genome.

Example 4; Transformation of Actinomycetes by Bonding

The introduction of the expression vector into actinomycetes was carried out by a conjugation method between E. coli / streptomyces (Kieser, T. et al., 2000).

pSET152 and pSET152-SIO-SKO vector synthesized starting material synthesis unit fkbO gene in the vector pSET152 insert was introduced into the dam-, dcm- of E.Coli ET12567 / pUZ8002 with non-methylated to give (non-methylation donor). The transformed E. coli was cultivated in 2 x YT medium (16 g / l of tryptone, 10 g / l of yeast extract, 5 g / l of yeast), 25 g / / L) and cultured at 37 ° C for 12 to 16 hours. 0.1 ml of the culture was transferred to 10 ml of 2 × YT medium and cultured at 37 ° C. until optical density of 0.4 was reached. Cells of the culture were washed twice with 2xYT medium and concentrated with 0.5ml 2xYT medium. 200 ㎕ of Streptomyces sp. Strain spores was centrifuged, and 500 의 of E. coli concentrate and 500 의 of mycelial solution were mixed with each other and applied to modified A medium. After culturing at 28 캜 for 16 hours, 1 mg of nalidixin (nalidixic acid) and 1 mg of apramycin. The transformants were identified after 3 to 7 days.

Example 5: Confirmation of production of tacrolimus in a transformant

As a result of confirming the productivity of tacrolimus of the transformants into which the pSET152-SIO and pSET152-SKO expression vectors were introduced, it was confirmed that the productivity of B. clemmimus was increased by 58 ~ 64% , And the productivity of tacrolimus did not change in the transfectants in which only pSET152 vector was introduced. As a result, it was found that the productivity of tacrolimus could be increased by overexpression of fkbO , a synthesis gene of tacrolimus synthesis starting unit material. In the case of the transgenic overexpressing fkbO gene, it is presumed that the synthesis starting unit material was increased as compared with the production strain, thereby contributing to the improvement of productivity of tacrolimus.

The results of the tacrolimus productivity comparison obtained from the transformants into which pSET152-SIO and pSET152-SKO vectors were introduced according to the present invention and the production strains are shown in Fig.

<110> Genotech Corp. <120> Method for increasing productivity of tricyclo compounds <130> Genotech-fKBO-121024 <160> 10 <170> Kopatentin 2.0 <210> 1 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> forward primer of SI-fkbO <400> 1 cgggatccgt cgcgcgtact tgtctgcatc 30 <210> 2 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> reverse primer of SI-fkbO <400> 2 gctctagagt ttccccgttt ccctgacttc 30 <210> 3 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> forward primer of SK-fkbO <400> 3 gctctagagc atgtctgcgc ccgtcgcg 28 <210> 4 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> Reverse primer of SK-fkbO <400> 4 gctctagagc tcaccgcacc accccctc 28 <210> 5 <211> 993 <212> DNA <213> Streptomyces sp. KCTC11604BP <400> 5 gtgcctgtcg cggcaccgta ctgccgcttc gagaagctcg tgccgtcgga cctcgaaggg 60 gcgagaccg tgctcggcgt catcgagcac ggcaccggtc atgccgaggt gtcgctcacg 120 gacggtgtcc cgcgtgccgc ggtgcacacc acgaccttcg aggaggaggc gttcgccgag 180 gtgtggcgcg cgcagccgcc cgtcgagtcc ggccgggacg gaggcatcgc atgggcccgc 240 accgacgagt acctgttcgg tgtcggccgc gtccccgaga gccgggggta cgccgatgcc 300 gtcgcggcgc tctacacgcg ggtcttcggg ctgacccggt ccctgggaca tccgctgctc 360 gcccggacgt ggaactacat cagtgggatc aacgcggcga acgcggacgg gctggaggtg 420 taccgggact tctgcgtggg ccgtgcgcag gcgctggacg cgggcgggat cgacccggcc 480 ggcctgcccg cggccaccgg catcggcacg cacgggggtg gtatcacctg cgtgttcctc 540 gccgcccgcg gcggaacccg gatcaacatc gagaaccctg ccgtcctcac ggcacaccac 600 taccccacgg cgtacggccc gcgccccccg gtcttcgcac gggccacctg gctgggcccg 660 ccgggcgacg gccggctgtt cgtgtccgcg acggccggaa tcctcgggca cgagaccacg 720 caccacggtg atgtgaccgg tcagtgcgag gtcgccctgg acaacatcgc ccgggtcgtg 780 gccgccgaga acctgcaccg gcacggtgtc cggcggggtt acgccctcac cgacgtcgat 840 cacctcaagg tctacgtccg gcgccgcgcg gacctccccg cggtccgccg ggtctgcgcc 900 gcccgcttgg cgagcaccgc gaccgtcgcg tttctgcaca ccgacatcgc ccgtggcgac 960 ctgctcgtgg agatcgaagg agtggtgtcg tga 993 <210> 6 <211> 330 <212> PRT <213> Streptomyces sp. KCTC11604BP <400> 6 Val Pro Val Ala Pro Tyr Cys Arg Phe Glu Lys Leu Val Pro Ser   1 5 10 15 Asp Leu Glu Gly Asp Glu Thr Val Leu Gly Val Ile Glu His Gly Thr              20 25 30 Gly His Ala Glu Val Ser Leu Thr Asp Gly Val Pro Arg Ala Ala Val          35 40 45 His Thr Thr Thr Phe Glu Glu Glu Ala Phe Ala Glu Val Trp Arg Ala      50 55 60 Gln Pro Pro Val Glu Ser Gly Arg Asp Gly Gly Ile Ala Trp Ala Arg  65 70 75 80 Thr Asp Glu Tyr Leu Phe Gly Val Gly Arg Val Pro Glu Ser Arg Gly                  85 90 95 Tyr Ala Asp Ala Val Ala Ala Leu Tyr Thr Arg Val Phe Gly Leu Thr             100 105 110 Arg Ser Leu Gly His Pro Leu Leu Ala Arg Thr Trp Asn Tyr Ile Ser         115 120 125 Gly Ile Asn Ala Ala Asn Ala Asp Gly Leu Glu Val Tyr Arg Asp Phe     130 135 140 Cys Val Gly Arg Ala Gln Ala Leu Asp Ala Gly Gly Ile Asp Pro Ala 145 150 155 160 Gly Leu Pro Ala Ala Thr Gly Ily Gly Thr His Gly Gly Gly Ile Thr                 165 170 175 Cys Val Phe Leu Ala Ala Arg Gly Gly Thr Arg Ile Asn Ile Glu Asn             180 185 190 Pro Ala Val Leu Thr Ala His His Tyr Pro Thr Ala Tyr Gly Pro Arg         195 200 205 Pro Pro Val Phe Ala Arg Ala Thr Trp Leu Gly Pro Pro Gly Asp Gly     210 215 220 Arg Leu Phe Val Ser Ala Thr Ala Gly Ile Leu Gly His Glu Thr Thr 225 230 235 240 His His Gly Asp Val Thr Gly Gln Cys Glu Val Ala Leu Asp Asn Ile                 245 250 255 Ala Arg Val Val Ala Ala Glu Asn Leu His Arg His Gly Val Arg Arg             260 265 270 Gly Tyr Ala Leu Thr Asp Val Asp His Leu Lys Val Tyr Val Arg Arg         275 280 285 Arg Ala Asp Leu Pro Ala Val Arg Arg Val Cys Ala Ala Arg Leu Ala     290 295 300 Ser Thr Ala Thr Val Ala Phe Leu His Thr Asp Ile Ala Arg Gly Asp 305 310 315 320 Leu Leu Val Glu Ile Glu Gly Val Val Ser                 325 330 <210> 7 <211> 999 <212> DNA <213> Streptomyces kanamyceticus KCTC9225 <400> 7 atgtctgcgc ccgtcgcggc accgtactgc cgcttcgaga agatcgggtc gccggacctc 60 gaagacgacg agacggtact cggcgtcatc gaacacggca ccggccatac cggggcgtcg 120 ctggtggacg gcgtcccgcg aaccgccttg cacaccacga cccgtgacga ggaggcgttc 180 gccgaggtct ggcacgcgga gccgcccgtc gagtccggta cggacgacgg catcgcgtgg 240 gcccgcaccg gcgagtacct gttcggtgtg gggcgcgtcc ccgagagccg caggtacgcc 300 gatgccgtct cggcgctcta cacgcgcctc ttcgggctga cccggtcgct gggatacccg 360 ctgctcgccc gtacgtggaa ctacgtcagc ggcatcaact cggcgaacgc ggacggcctc 420 gggtgtacc gggacttctg cgtgggccgc gcccaggcgc tcgacgaggg cggcatcgac 480 ccggcgagca tgcccgcggc caccggcatc ggcacgcacg ggggcggcat cgcctgcgcg 540 ttcatcgcgg cccgcggcgg ggtccgggtc aacatcgaga accccgccgt cctcacggca 600 caccactacc ccgcggcata cggcccgcgc tccccggtct tcgcgcgggc cacctgggtg 660 ggcccgccgg acggtggccg gctgttcgtt tccgcgacgg ccggcattct cggacacgag 720 acgacgcacc acggtgacgt gaccggtcag tgcgaggtcg ccctggacaa catcgcccgg 780 gtcgtcggcg cggagaacct gcgccgccac gggatccggc gggggcacgt cctcgccgac 840 gcgccgcgtc 900 tgcgccgccc gcctgtcgag caccgcgacc gtcgcgatat tgcacaccga catcgcccgc 960 ggcgacctgc tcgtcgaaat cgagggggtg gtgcggtga 999 <210> 8 <211> 332 <212> PRT <213> Streptomyces kanamyceticus KCTC9225 <400> 8 Met Ser Ala Pro Val Ala Pro Tyr Cys Arg Phe Glu Lys Ile Gly   1 5 10 15 Ser Pro Asp Leu Glu Asp Asp Glu Thr Val Leu Gly Val Ile Glu His              20 25 30 Gly Thr Gly His Thr Gly Ala Ser Leu Val Asp Gly Val Pro Arg Thr          35 40 45 Ala Leu His Thr Thr Thr Arg Asp Glu Glu Ala Phe Ala Glu Val Trp      50 55 60 His Ala Glu Pro Pro Val Glu Ser Gly Thr Asp Asp Gly Ile Ala Trp  65 70 75 80 Ala Arg Thr Gly Glu Tyr Leu Phe Gly Val Gly Arg Val Val Glu Ser                  85 90 95 Arg Arg Tyr Ala Asp Ala Val Ser Ala Leu Tyr Thr Arg Leu Phe Gly             100 105 110 Leu Thr Arg Ser Leu Gly Tyr Pro Leu Leu Ala Arg Thr Trp Asn Tyr         115 120 125 Val Ser Gly Ile Asn Ser Ala Asn Ala Asp Gly Leu Glu Val Tyr Arg     130 135 140 Asp Phe Cys Val Gly Arg Ala Gln Ala Leu Asp Glu Gly Gly Ile Asp 145 150 155 160 Pro Ala Ser Met Pro Ala Ala Thr Gly Ile Gly Thr His Gly Gly Gly                 165 170 175 Ile Ala Cys Ala Phe Ile Ala Ala Arg Gly Val Val Arg Ile             180 185 190 Glu Asn Pro Ala Val Leu Thr Ala His His Tyr Pro Ala Ala Tyr Gly         195 200 205 Pro Arg Ser Pro Val Phe Ala Arg Ala Thr Trp Val Gly Pro Pro Asp     210 215 220 Gly Gly Arg Leu Phe Val Ser Ala Thr Ala Gly Ile Leu Gly His Glu 225 230 235 240 Thr His His Gly Asp Val Thr Gly Gln Cys Glu Val Ala Leu Asp                 245 250 255 Asn Ile Ala Arg Val Val Gly Ala Glu Asn Leu Arg Arg His Gly Ile             260 265 270 Arg Arg Gly His Val Leu Ala Asp Val Asp His Leu Lys Val Tyr Val         275 280 285 Arg Arg Arg Glu Asp Leu Ala Ala Val Arg Arg Val Cys Ala Ala Arg     290 295 300 Leu Ser Ser Thr Ala Thr Val Ala Ile Leu His Thr Asp Ile Ala Arg 305 310 315 320 Gly Asp Leu Leu Val Glu Ile Glu Gly Val Val Arg                 325 330 <210> 9 <211> 1005 <212> DNA &Lt; 213 > Streptomyces hygroscopicus ATCC29253 <400> 9 gtgaggcaat tgactccgcc ggtcacggca ccgtactgcc gcttcgagaa gctcggcgcc 60 tccgatctcg acggcgacga gacacttctc ggcgtcatcg aacatcgcac cggacacacc 120 ggggtttcac tggccgaggg ctgtccccgg acggccgtac acacgacgac ccgcgaggac 180 gagtcgttcg ccgaggcgtg gcacgcggag gggccgaagg agtcgtcgag gcatgatggc 240 gtcgcctggg ctcggacacc tgactacctc ttcggtgtcg cgcgggtgcc cgagggcggc 300 cggtacgcgg ccggcaccgc ggccgtctac accggaatct tcgacctgat cgggacgctg 360 gggtacccca gtctggcccg cacctggaac tacgtcagcg gaatcaacac gccgaacgcc 420 gatggcctcg aggtctaccg ggacttctgt gtgggccgcg ccgaggcgct ggacgcccgt 480 gggatcgacc cggcgaccat gccggcggcg accggcatcg gcgcccacgg cgcgcgcatc 540 acgtgctact tcatcgccgc acgcgccggt gaccgggtca acatggagaa cccggccgtg 600 ctcacggctc accgctaccc gcagcggtac ggcccccgcc cgccggtctt ctccggccac 660 ctggctctcg ccgccggggg cggacggctc ttcgtctccg cgaccgccgg catcgtcggt 720 cggagacgg tgcaccacgg cgacgtcgcc gcgcaatgcg aggtgtcgct cgagaacatc 780 gcccgggtga tcggtgccga gaacctggga cggcacgggc tccgccgggg ctacgccctc 840 gccgacgtcg accatttgaa ggtctatgta cgccaccgcg aggatatttc gaccgtacgt 900 cggatctgcg ccgagcgcct ctcccgcgag gccacggttg ccgtactgca caccgacatc 960 gcgcgcaccg atctgctggt cgagatcgag ggtgtggtgg cgtga 1005 <210> 10 <211> 334 <212> PRT &Lt; 213 > Streptomyces hygroscopicus ATCC29253 <400> 10 Met Arg Gln Leu Thr Pro Pro Val Thr Ala Pro Tyr Cys Arg Phe Glu   1 5 10 15 Lys Leu Gly Ala Ser Asp Leu Asp Gly Asp Glu Thr Leu Leu Gly Val              20 25 30 Ile Glu His Arg Thr Gly His Thr Gly Val Ser Leu Ala Glu Gly Cys          35 40 45 Pro Arg Thr Ala Val His Thr Thr Thr Arg Glu Asp Glu Ser Phe Ala      50 55 60 Glu Ala Trp His Ala Glu Gly Pro Lys Glu Ser Ser Arg His Asp Gly  65 70 75 80 Val Ala Trp Ala Arg Thr Pro Asp Tyr Leu Phe Gly Val Ala Arg Val                  85 90 95 Pro Glu Gly Gly Arg Tyr Ala Gly Thr Ala Ala Val Tyr Thr Gly             100 105 110 Ile Phe Asp Leu Ile Gly Thr Leu Gly Tyr Pro Ser Leu Ala Arg Thr         115 120 125 Trp Asn Tyr Val Ser Gly Ile Asn Thr Pro Asn Ala Asp Gly Leu Glu     130 135 140 Val Tyr Arg Asp Phe Cys Val Gly Arg Ala Glu Ala Leu Asp Ala Arg 145 150 155 160 Gly Ile Asp Pro Ala Thr Met Pro Ala Ala Thr Gly Ile Gly Ala His                 165 170 175 Gly Ala Arg Ile Thr Cys Tyr Phe Ile Ala Ala Arg Ala Gly Asp Arg             180 185 190 Val Asn Met Glu Asn Pro Ala Val Leu Thr Ala His Arg Tyr Pro Gln         195 200 205 Arg Tyr Gly Pro Arg Pro Pro Val Phe Ser Gly His Leu Ala Leu Ala     210 215 220 Ala Gly Gly Gly Arg Leu Phe Val Ser Ala Thr Ala Gly Ile Val Gly 225 230 235 240 Gln Glu Thr Val His His Gly Asp Val Ala Ala Gln Cys Glu Val Ser                 245 250 255 Leu Glu Asn Ile Ala Arg Val Ile Gly Ala Glu Asn Leu Gly Arg His             260 265 270 Gly Leu Arg Arg Gly Tyr Ala Leu Ala Asp Val Asp His Leu Lys Val         275 280 285 Tyr Val Arg His Arg Glu Asp Ile Ser Thr Val Arg Arg Ile Cys Ala     290 295 300 Glu Arg Leu Ser Arg Glu Ala Thr Val Ala Val Leu His Thr Asp Ile 305 310 315 320 Ala Arg Thr Asp Leu Leu Val Glu Ile Glu Gly Val Val Ala                 325 330

Claims (5)

A method for enhancing the production of a three-membered ring compound by introducing a gene encoding a chorismatease into a strain of Streptomyces producing a three-membered ring compound.
The method according to claim 1,
A method for enhancing the production of a three-ring compound, wherein the gene encoding the cholesteatase is FkbO or RapK .
The method according to claim 1,
A method for enhancing the production of a ternary ring compound, wherein the gene encoding the chorismate is obtained or synthesized in a microorganism.
The method of claim 3,
Wherein the microorganism is characterized by Streptomyces spp.
The method according to claim 1,
The method
Inserting a gene encoding a chorismate into an expression vector;
Transforming the microorganism with an expression vector into which the cholesteatism-encoding gene has been inserted; And
And transforming the Streptomyces sp. Strain by conjugating the transformed microorganism with a strain of Streptomyces producing a three-ring compound.

Images