KR20100039623A - Recombinant microorganism for producing rapamycin and producing method thereof - Google Patents

Abstract

PURPOSE: A method for preparing recombinant Streptomyces strain and enhancing rapamycin productivity is provided to improve rapamycin productivity and to produce antibacterial, anti-cancer, and immunity suppressing drugs. CONSTITUTION: A recombinant Streptomyces strain in which rapamycin productivity contains foreign accA1 gene, pccB gene, and prpE gene. The recombinant Straeptomyces strain is obtained using an expression vector(Pset152-pcc) in which a gene is introduced in PermE downstream. The gene encodes carboxylase(pcc) and propionate CoA ligase(PrpE). The foreign accA1 gene and pccB gene is obtained from Streptomyces coelicolor. The foreign prpE gene is obtained from Salmonella typhimurium.

Description

Recombinant microorganism for producing rapamycin and producing method

The present invention relates to a recombinant strain for the production of large amounts of rapamycin and a method for increasing the productivity of rapamycin using the same.

Macrocyclic lactam-based polyketide compounds represented by rapamycin (cyrrolimus), FK506 (tacrolimus), FK520 (ascomycin), and the like are antifungal, anticancer, and immunosuppressive. It exhibits various physiological activities such as (immunosuppressant) activity.

These polyketide compounds are based on a skeleton synthesized by repetitive polymerization by polyketide synthase (hereinafter referred to as "PKS"), and the basic structure is modified by various tailing enzymes. As a result, bioactive substances of various structures are biosynthesized. In general, the basic synthetic units (malonyl-CoA), methylmalonyl-CoA (methylmalonyl-CoA) to form the overall skeleton structure mainly through condensation reaction. Of these polyketide compounds, rapamycin is an antifungal and immunosuppressive agent produced by Streptomyces hygroscopicus (see US Pat. No. 3,929,992) and is marketed under the trade name rapamune. .

Rapamycin biosynthesis has been found to be responsible for biosynthetic machinery consisting of mixed type 1 polyketide synthase / nonribosomal peptide synthetase (Schwecke et al. (1995), PNAS USA, 92, 7839-7843). The starter unit for the synthesis of rapamycin biosynthesis is DHCHC (4,5-dihydroxycyclohex-1-enecarboxylic acid) derived from shikimate. Here, the condensation reaction of 7 malonylcoa derived from acetate and 7 methylmalonylcoa derived from propionate extends the chain of skeletal structure, and finally L-pipecoline derived from 1 L-lysine. It is assumed that pipecolic acid is condensed.

In general, polyketide compounds require a rich supply of precursors to increase productivity. The method of increasing productivity by increasing the supply of the microbial secondary metabolite precursor is generally a method of increasing the productivity by adding an excessive amount of the precursor to the fermentation medium. However, for rapamycin, the precursors are expensive, so adding large amounts of precursors to the medium is uneconomical. In addition, the increased productivity of actinomycetes secondary metabolites is using the traditional method of obtaining variants with increased productivity through random mutagenesis. However, this method takes a lot of time and effort to secure variants with increased productivity, and it is also difficult to maintain the activity of the variants. Therefore, it is very useful industrially to develop strains with increased productivity through metabolic methods.

Recently, there has been an attempt to increase the productivity of secondary metabolites such as polyketides by increasing the amount of precursors in vivo by manipulating the metabolic process of synthesizing precursors by artificial methods such as genetic modification or introduction. As an example, attempts have been made to improve E. coli to introduce polyketide biosynthesis genes into heterologous hosts to produce polyketide compounds in heterologous hosts (US Pat. No. 6,939,691 B1; Muri S. et al. J. Ind. Microbiol. & Biotechnol. 2003). In the present invention, the malonyl CoA decarboxylase gene matA, the malonyl CoA synthetase gene matB and the propylmalonyl-CoA carboxylase (hereinafter referred to as "pcc") In combination with the gene pccB, accA2 It was obtained from Streptomyces coelicolor , and the malonate transporter gene, matC, was obtained from Rhizobium trifoli and introduced into E. coli. In Escherichia coli expressing MatABC or pcc, the amount of acylcoa in cells was increased. The 6-DEBS (6-deoxyerythromycin B synthase) gene was introduced into the improved E. coli to improve the productivity of 6-deoxyerythronolide B (6-deoxyerythronolide B).

Accordingly, an object of the present invention is to solve the above problems, and to provide a method of increasing the productivity of rapamycin instead of adding an expensive precursor to the culture medium.

The present inventors investigated the amount of acylcoai among the precursors required for rapamycin biosynthesis in a rapamycin producing strain, and studied a method of increasing productivity by in vivo increase of insufficient acylcoai.

The present invention confirms the profile of intracellular acylcoa of rapamycin producing strain Streptomyces hygroscopicus and recognizes the lack of acylcoa, in particular methylmalonylcoa, which is a poor biosynthetic precursor. The present invention relates to a method of improving productivity of rapamycin by increasing the amount of methylmalonylcoay in vivo by improving strains.

According to the present invention, rapamycin productivity can be improved through genetic recombination without using a large amount of expensive precursors. The rapamycin thus obtained can be used for antifungal, anticancer and immunosuppressive applications.

The present invention provides a metabolic method for increasing the productivity of rapamycin. Rapamycin is represented by the following Chemical Formula 1.

The present invention for the productivity of rapamycin and malonyl-CoA (malonyl-CoA) is estimated to be an important precursor for rapamycin biosynthesis of rapamycin fermentation conditions of the rapamycin production actinomycetes Streptomyces hygroscopicus ATCC 29253 The acylcoay profile was investigated around methylmalonylcoay. In particular, methylmalonylcoay was not present in the cells of the production strain. Through this, it can be predicted that methylmalonylcoa is absolutely deficient in rapamycin biosynthesis. Therefore, in the present invention, a system for supplying methylmalonylcoa, which is lacking in cells, was introduced into the wild line by metabolic method to increase the production of rapamycin. To this end, it was intended to express the enzymes required in the wild line to operate the metabolic processes required for methylmalonylcoai production (see Figure 1).

As a strategy for this, also the carboxyl la kinase (pcc) and the propionate such as 2 CoA Riga by introducing a gene which encodes the kinase (PrpE) a Streptomyces promoter ^P ermE downstream for was produced in an expression vector (pSET152-pcc) . Gene prpE was obtained from Salmonella typhimurium , and gene accA1 and pccB were obtained from Streptomyces coelicolor .

As a result of examining the acylcoa profile and the productivity of rapamycin of the transformants into which the expression vector was introduced, the carboxylase (pcc) -expressing transformants produced 2-3 times higher productivity of rapamycin than wild strains. The production of rapamycin was 6-9 fold higher when propionate was added to the transformant fermentation broth. In addition, propionylcoa in transformant cells shows a sharp increase. These results suggest that the introduction of pcc metabolism converts propionate in the medium into propionyl-CoA and methylmalonyl-CoA to be used for the production of rapamycin, which ultimately improves the productivity of rapamycin. Because it can be done.

The present invention can be said to have great utility since it can be applied to the development of rapamycin as an industrial production strain.

The configuration of the present invention will be described in more detail with reference to the following Examples. However, it will be apparent to those skilled in the art that the exemplary embodiments of the present invention are merely a description of the configuration of the present invention and do not limit the scope of the present invention.

Example 1: Bacterial Lineage and Genetic Manipulation

The wild strain Streptomyces hygroscopicus ATCC 29253 was used for the preparation of the recombinant transformants of the present invention. Genetic manipulations were performed in E. coli DH5α according to the general procedure (Sambrook J et al. (2001) Molecular Cloning: A Laboratory Manual, 3 ^rd Edn. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY). Litmus 28, New England Biolabs, T-easy vector (Promega) and pGEM-3Zf (+) (Promega) were used for subcloning.

Example 2: Culture Conditions and Metabolite Analysis

Streptomyces hygroscopius ATCC 29253 and its transformants were M1 agar medium (0.25% corn stew powder, 0.3% yeast extract, 0.3 g calcium carbonate, 0.03% iron sulfate, 2.0% bactoagar, 1.0% wheat starch). Incubated at 30 ° C. for 2 weeks. The mycelium was collected and used in this experiment when the color of wild strain and transformant changed to black. In determining the production of rapamycin through liquid medium, Streptomyces hygrosco picus contains 5 ml of TSB production medium (Typtopic Soy broth 3) containing the appropriate antibiotic apramycin (0.5 mg / ml) as needed. %, Iron sulfate 0.01%, glucose 1.5%, pH = 6.0 adjusted with sulfuric acid) was incubated for 5 days at 240 rpm, 28 ℃ conditions. During rapamycin extraction, fermentation medium and the same amount of ethyl acetate were introduced, and the extract was dissolved in 0.1 ml of methanol. The amount of rapamycin compound was quantitatively analyzed by high performance liquid chromatography (HPLC). The absorption wavelength was 277 nm and 10 μl of extract was analyzed by introducing into a C18 column (4.6 mm × 250 mm Watchers 120 OPS-BP 5 m, DAISO). The analysis conditions were 75% methanol and 25% H ₂ O for 0 to 14 minutes, and 100% methanol for 15 to 30 minutes.

Example 3: Intracellular CoA Extraction and Analysis Method

Extraction and analysis methods for extracts of Koei in Streptomyces hygroscopicus cells are as follows. 500 μl of 15% triacetic acid (TCA) and 800 μl of silicone oil (AR200: DC200, 2: 1, δ = 1.010) were added to a 2 ml microcentrifuge tube and immersed in ice. 800 μl of cell culture was carefully added thereto. Thereafter, centrifuged for 5 minutes in a 20,000 × g centrifuge, about 300 μl TCA solution was extracted with Pasteur pipette and extracted using an OASIS HLB SPE cartridge. The cartridge was first soaked with 3 ml of methanol and then passed through 3 ml of 0.15% TCA solution. Cell extracts were introduced into the cartridge and eluted twice with 0.5 ml of methanol ammonium hydroxide (99: 1, v / v) and dried at room temperature using a vacuum centrifuge. It was then stored at -20 ° C until analysis. Acylcoa isolates extracted from Streptomyces hygroscopicus were analyzed using an instrument equipped with a Waters 2695 HPLC apparatus in Waters / Micromass Quattro micro / MS. A 250 mm × 4.6 mm watchers 120 OPS-BP (5 μl) reverse phase chromatography column was used for the analysis. The solvent rate was 250 μl / min and the solvent condition was a solution (B) containing 5 mM ammonium acetate in 0.05% acetic acid solution (A) and 80% acetonitrile solution in 5 mM ammonium acetate. The HPLC solution was set to maintain 10% Solution B for the first 2 minutes, 40% Solution B for 3 minutes and 80% Solution B again for 15 minutes and return to Solution B 10% for the remaining 10 minutes. The solvent passed through the column was designed to enter the mass spectrometer directly, and the operation was carried out in cation mode. Tuning parameters for ESI-MS / MS operation are as follows. Capillary voltage: 4 kV, cone voltage: 50 V, source temperature: 130 ° C, desolvent temperature: 300 ° C, cone gas: 50 l / hr, desolvent gas velocity: 500 L / hr, range of scanned mass m / z = 200-900 Da.

Example 4 Koei Quantitative Analysis of Wild Strains

For acylcoay extraction in wild strain Streptomyces hygroscopicus cells, the cells were cultured in TSB production medium for 5 days, and the acylcoay was extracted and quantitatively analyzed from the cells cultured as in Example 3 (Table 1). . As a result of the calculation, it was confirmed that the amount of malonylcoa and isobutyrylcoa was 38.9 μM and 55.0 μM, respectively, much higher than those of other acylcoae, and methylmalonylcoa was not present in the separation solution. Since the amount of methylmalonylcoay has an absolute effect on the production of rapamycin, it was predicted that increasing the amount of methylmalonylcoa would have a direct effect on the production of rapamycin. In other words, it was confirmed that increasing the amount of methylmalonylcoay through genetic engineering is required to improve the productivity of rapamycin.

 Acyl Coy  Concentration (μM)  Malonilcoay  38.9  Methylmalonylcoa  0  Propionylcoa  0.4  Butyrylcoai  0.4  Isobutyrylcoei  55.0  Succinylcoay  3.8

Example 5: Expression Plasmid Preparation

In order to increase the amount of methylmalonylcoa, a pcc (propionyl-CoA carboxylase) biosynthesis pathway synthesized from propionate to methylmalonylcoa was predicted as shown in FIG. 1 and the related genes were cloned. First, prpE (Gene ID: 1251890), a CoA-ligase gene that synthesizes propionylcoa from propionate, was obtained from Salmonella typhimurium LT2 genomic DNA, and propionylcoe. Two genes accA1 (Gene ID: SCO4381) and pccB (Gene ID: SCO4926) needed to transform it to methylmalonylcoei were obtained by PCR from Streptomyces coelicolor . AccA1 is an α-subunit of carboxylase and shows the activity of adding CO2 to biotin, and PccB is a β-subunit of carboxylase and shows the activity of transferring Co2 added to biotin to propionyl coei. Therefore, accA1 and pccB genes must be present together to exhibit carboxylase activity.

The primers used to secure the gene are as follows.

Primers for accA1 gene amplification

Forward: ACGTTC AGATCT TGACTGTTCCGAACAGGG ( Bgl II),

Reverse: ATCGTG ATGCAT GTCGTCATCGTTCAGTCC ( Nsi I),

Primers for pccB1 gene amplification

Forward direction: ATCTCG ATGCAT CATGCAACCCACCCTAGG ( Nsi I),

Reverse: TGGTCA AAGCTT CTCCTTACAGGGGGATGT ( Hind III),

Primers for prpE gene amplification

Forward: CCAGCA AAGCTT CATTCTGGATGTCTCCCTGGA ( Hind III),

Reverse: CCACTA TCTAGA CGCTGAGTCTAACCCGTT ( Xba I).

Also by using a restriction enzyme indicated by the underlined base sequence in order to introduce the gene ermE ^P downstream of the vector pSET152 it was prepared pcc expression vector pSET15 pcc-2, and so on. The pSET152 vector used in this example has an apramycin resistance gene ( acc (3) IV ) and has the property of being directly inserted into a microbial genome.

Example 6: Preparation of Streptomyces hygroscopius transformants

Escherichia coli transformed with pSET152-pcc vector having propionylcoei carboxylase biosynthesis gene inserted into pSET152 using 2xTY medium (tryptone 16g / l, yeast extract 10g / l, NaCl 5g / l) Incubate overnight. The next day 1 ml of the culture was transferred to 25 ml of 2 × TY medium and incubated at 37 ° C. until the optical density became 0.25-0.6. Cells in culture were washed twice with 2 × TY medium and concentrated to 0.5 ml of 2 × TY. 200 μl of S. hygroscopicus spore stock were centrifuged, dissolved in 500 μl 2 × TY solution, and thermal shock was applied at 50 ° C. for 10 minutes. 500 μl E. coli concentrate and 500 μl mycelia were mixed with each other and then applied to M1 medium (Example 1) and incubated at 28 ° C. for 16 hours, followed by 1 mg of nalidixic acid and 1 mg of a. Plamycin (apramycin) was plated. Transformants were identified and selected after 3-7 days.

Example 7 Rapamycin Production Confirmation and Acylcoai Analysis of Transformants

S. hygroscopicus with pSET152 vector only The strain had a rapamycin production level of 5-6 mg / l, and the transformed strain with pSET152-pcc produced about 10 mg / l of rapamycin, which was about twice as high as the strain transformed with the control pSET152 vector. The productivity of was shown (Fig. 3). In each strain, sodium propionate, a substrate for pcc metabolism, was added to the medium at a concentration of 2 mM, and the strain transformed with the pSET152 vector produced about 10 mg / L of rapamycin, whereas pSET152-pcc About 30 mg / L of rapamycin was produced in the transformants. This suggests that over-expression of the methylmalonylcoay biosynthetic enzyme pcc and propionate, the substrate thereof, result in a very high rate of productivity improvement. In order to determine the cause of this result, coenzyme A (coei, the same meaning as CoA) of wild strains and mutants was extracted and analyzed (FIG. 4). As a result, when propionate (indicated as "prp" in FIG. 4) was added to the production medium, it was confirmed that the amount of propionylcoei was increased in both the control and the pcc metabolic process introduction strains, and the pcc was overexpressed. It can be inferred that propionylcoA was used to increase methylmalonylcoay more than the control group, and ultimately contributed to the improvement of the productivity of rapamycin.

1 shows a schematic diagram predicting propionylcoei metabolism and enzymes related thereto,

2 is a schematic diagram of construction of the pSET152-pcc vector,

Figure 3 is a graph showing the rapamycin production of the propionylcoa metabolic process introduced transformant.

pSET152: S. hygroscopicus control streptomyces containing only the pSET152 vector Strain,

pSET152 (propionate): S. hygroscopicus control streptomyces containing only pSET152 vector Adding propionate to the strain,

PCC: the transformed strain into which the SET152-pcc vector of FIG. 2 was introduced,

PCC (propionate): Propionate was added to the transformed strain into which the SET152-pcc vector of FIG. 2 was introduced.

Figure 4 shows the results of acylcoay LC-MS analysis of propionylcoay metabolic process introduced transformants.

Mm, methylmalonylcoei; Su, succinylcoay; Pr, propionylcoa

<110> Genotech Co., Ltd. <120> Recombinant microorganism for producing rapamycin <130> Genotech-0909-rapamycin <160> 6 <170> KopatentIn 1.71 <210> 1 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> forward primer of accA1 <400> 1 acgttcagat cttgactgtt ccgaacaggg 30 <210> 2 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> reverse primer of accA1 <400> 2 atcgtgatgc atgtcgtcat cgttcagtcc 30 <210> 3 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> forward primer of pccB1 <400> 3 atctcgatgc atcatgcaac ccaccctagg 30 <210> 4 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> reverse primer of pccB1 <400> 4 tggtcaaagc ttctccttac agggggatgt 30 <210> 5 <211> 33 <212> DNA <213> Artificial Sequence <220> <223> forward primer of prpB <400> 5 ccagcaaagc ttcattctgg atgtctccct gga 33 <210> 6 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> reverse primer of prpB <400> 6 ccactatcta gacgctgagt ctaacccgtt 30  

Claims (8)

Recombinant actinomycetes containing foreign accA1 gene, pccB gene and prpE gene, with increased rapamycin productivity. The method of claim 1, The foreign accA1 gene and pccB gene are rapamycin, characterized in that obtained from Streptomyces coelicolor ( Streptomyces coelicolor ). Recombinant actinomycetes with increased productivity. The method of claim 1, The foreign prpE gene is obtained from Salmonella typhimurium , characterized in that the rapamycin productivity of the recombinant actinomycetes increased. The method of claim 1, The actinomycete strain is Streptomyces hygroscopicus ( Streptomyces hygroscopicus ), characterized in that the recombinant actinomycetes increased rapamycin productivity. A method for increasing rapamycin productivity in actinomycetes by recombining foreign accA1 gene, pccB gene and prpE gene to increase the amount of methylmalonylcoay in cells. The method of claim 5, Wherein the foreign accA1 gene and pccB gene is obtained from Streptomyces coelicolor ( Streptomyces coelicolor ), characterized in that the method for increasing the rapamycin productivity in actinomycetes. The method of claim 5, The foreign prpE gene is characterized in that obtained from Salmonella typhimurium , a method for increasing rapamycin productivity in actinomycetes. The method of claim 5, The actinomycete strain is Streptomyces hygroscopicus , characterized in that the method for increasing rapamycin productivity in actinomycetes.

Images