KR20140008788A

KR20140008788A - Method of providing information for diagnosis of tuberculosis using ip-10 quantitative reverse transcriptase-pcr(qrt-pcr) and diagnostic kit comprising thereof

Info

Publication number: KR20140008788A
Application number: KR1020120075886A
Authority: KR
Inventors: 조상래; 이혜영; 김성현
Original assignee: 연세대학교 원주산학협력단
Priority date: 2012-07-12
Filing date: 2012-07-12
Publication date: 2014-01-22
Also published as: WO2014010806A1

Abstract

The present invention relates to an information providing method for diagnosing tuberculosis using IP-10 (interferon inducible protein-10) mRNA target real-time reverse transcriptase polymerization and a kit for diagnosing tuberculosis.

Description

IP-10 (Method of providing information for diagnosis of tuberculosis using tube-10, quantitative reverse transcriptase-) PCR (qRT-PCR) and diagnostic kit comprising particular}

Tuberculosis is usually mycobacterium. Chronic infectious disease caused by M. tuberculosis, which is not only a major disease in developing countries but also increases its severity in developed countries around the world, with about 8 million new cases per year and about 300 Ten thousand patients die. Although tuberculosis may be asymptomatic for a significant time even after infection, the disease most commonly manifests as acute inflammation of the lungs, resulting in fever and unproductive cough, which if not treated usually leads to serious complications and death.

Therefore, the early diagnosis and treatment of tuberculosis is of the utmost importance, and the tuberculin skin test (TST) has conventionally been used worldwide to monitor tuberculosis infection. TST is an antigen-specific reaction that measures the degree of reaction (delayed hypersensitivity reaction) appearing at the injection site after 2-3 days after injecting tuberculin purified by filtering the culture solution obtained by heat sterilization of the tuberculosis bacteria culture medium.

However, TST cross-reacts in people who have been sensitized to non-tuberculosis mycobacteria (NTM), and the probability of false positives is very high when BCG vaccination is common in Korea. In addition, some patients with tuberculosis responded negatively, reducing their credibility as a criterion for screening TB infection. However, due to its low specificity, high sensitivity, and low cost, it is still widely used as a method for detecting tuberculosis infection in developing and developing countries.

A commonly used method is a culture method. However, when the bacteria are directly isolated from the patient's specimen in the laboratory and tested, the risk of infection is very high, and since the tuberculosis bacteria take at least 4-6 weeks to grow, there is a considerable time and cost.

On the other hand, the detection method using the blood of the patient is safer, faster, and can be performed using a part of the blood necessary for a general clinical test because it detects the immune response caused by the infection of Mycobacterium tuberculosis rather than Mycobacterium tuberculosis. It's a convenient way for everyone.

The test methods for blood developed so far include serological methods for detecting antibodies to Mycobacterium tuberculosis antigens and IGRA assays for detecting the amount of IFN-γ NCBI ACCESSION NO: NM_000619) secreted by Mycobacterium tuberculosis infection.

Specifically, the serological diagnostic method has the advantage of being very easy to use, easy and quick to interpret the results, but has the disadvantage that the specificity and sensitivity are very low and the quantitative test cannot be performed.

The IGRA test, which is a method of quantitatively analyzing IFN-γ protein secreted by T cells stimulated by Mycobacterium tuberculosis-specific antigen, was performed by QuantiFERON, an ELISA company using a single antibody against IFN-γ, and T-Spot.TB using ELISPOT. It is widely used in developed countries because of its high specificity compared to the existing test method. However, IGRA testing has the following disadvantages that are difficult to commercialize worldwide.

First, the IGRA test requires about 3ml of whole blood of the patient, but it is very difficult to obtain the blood volume for children or the elderly who have difficulty collecting blood because blood must be collected through a syringe to obtain the blood volume. There was a very troublesome problem for the general public.

Secondly, it takes about two to two days for the test results to take 16-24 hours to process the TB-specific antigen in the sampled blood.

Third, commercial kits rely on imports, and the price is also very expensive, about 5 million won per 100 tests.

Fourth, in case of IGRA test using ELISA method, a standard calibration curve should be set for each test, so it is costly to test a small number of samples, and when testing a large number of samples at a time, There is a problem that it is difficult to obtain a constant result because the action of the coloration reagent used may be delayed.

Therefore, in order to overcome this drawback, a real-time reverse transcriptase amplification method targeting IFN-γ mRNA was developed, which significantly reduced the amount of blood, time and effort required for the test, thereby making the test more efficient and easier. Although the improvement in the sensitivity of the test was insignificant compared to the existing IGRA test, the addition of additional biomarkers in addition to the existing test target IFN-γ for immunological tuberculosis testing.

As a related prior patent, Korean Patent Publication No. 1020040092299 relates to a novel tuberculosis specific antigen and a tuberculosis diagnostic kit using the same, and proposes a new tuberculosis specific antigen (Mt-1), It provides an antigen composition comprising Mt-1 with improved sensitivity and specificity, and it is described that it can be usefully used for diagnosing and preventing tuberculosis by also presenting a diagnostic method and a diagnostic kit using the same.

In another related prior art, Korean Patent Publication No. 1020080070262 relates to a composition for diagnosing tuberculosis comprising a HHHAA antigen and a diagnostic kit comprising the same, wherein HBHA antigen is used in antigen-antibody reactions with IgM in early tuberculosis patients and chronic tuberculosis patients. It has been shown to have a high response, have a strong specificity for IgM in patients with pulmonary tuberculosis and tuberculous pleurisy, and that the IgM antibody response of HBHA is expected to protect against the spread of pulmonary exotuberculous.

The present invention has been made in view of the above necessity, and an object of the present invention is to provide a method for diagnosing tuberculosis with high sensitivity and specificity.

Another object of the present invention is to provide a composition for said method.

In order to achieve the above object, the present invention comprises the steps of: a) treating tuberculosis-specific antigen in the blood of suspected tuberculosis; b) separating the full-length RNA from the blood treated with the tuberculosis-specific antigen; c) the isolated full length Synthesizing cDNA from RNA; d) comparing the synthesized cDNA with the expression level of a first primer pair capable of amplifying IP-10 (interferon inducible protein-10) and IP-10 (interferon inducible protein-10) Performing RT-PCR using a second primer pair capable of amplifying a control gene for; And e) measuring the mRNA expression level of the amplified IP-10 and the mRNA expression level of a control gene; and providing information providing method for diagnosing tuberculosis.

In an embodiment of the present invention, the step d) may amplify the synthesized cDNA, a first primer pair capable of amplifying IP-10, a first probe capable of binding to the amplified site, and a control gene. Realtime RT-PCR is preferably performed using a second primer pair and a second probe capable of binding to the amplified control gene region, but are not limited thereto.

In another embodiment of the present invention, it is preferable to further include the step of collecting blood of suspected tuberculosis patient before step a), but is not limited thereto.

In another embodiment of the present invention, the tuberculosis specific antigen of step b) is preferably one or more of ESAT-6, CFP-10 and TB7.7, but is not limited thereto.

In a preferred embodiment of the present invention, the control gene is preferably GAPDH, but is not limited thereto.

In another preferred embodiment of the invention, the first primer pair capable of amplifying the IP-10 is a primer pair consisting of SEQ ID NO: 1 and 2, the second primer pair capable of amplifying the control gene is a sequence It is preferably one of a primer pair consisting of Nos. 4 and 5, but is not limited thereto.

In one embodiment of the present invention, after step e), it is preferable to further include a step of comparing the mRNA expression level of IP-10 relative to the mRNA expression level of the control gene, but is not limited thereto.

In another embodiment of the present invention, the first probe is preferably a probe represented by SEQ ID NO: 3,

In another embodiment of the present invention, the second probe is preferably a probe represented by SEQ ID NO: 6, but is not limited thereto.

In another aspect, the present invention provides a composition for diagnosing tuberculosis comprising a primer pair consisting of SEQ ID NO: 1 and 2 as an active ingredient.

In one embodiment of the invention, the composition preferably further comprises a primer pair specifically binding to the gene in order to measure the mRNA expression level of the control gene, but is not limited thereto.

In another embodiment of the present invention, the primer pair is preferably a primer pair consisting of SEQ ID NOs: 4 and 5, but is not limited thereto.

In another embodiment of the present invention, the composition preferably further comprises a first probe and a second probe, but is not limited thereto.

In another aspect, the present invention provides a kit for diagnosing tuberculosis comprising a primer pair consisting of SEQ ID NO: 1 and 2 as an active ingredient.

In one embodiment of the invention, the kit preferably further comprises a primer pair specifically binding to the gene in order to measure the mRNA expression level of the control gene, but is not limited thereto.

In another aspect, the present invention comprises the steps of a) treating the tuberculosis specific antigen in the blood of suspected tuberculosis; b) separating the full-length RNA from the blood treated with the tuberculosis specific antigen; c) synthesizing cDNA from the isolated full-length RNA D) amplifying the synthesized cDNA to a control gene for contrast with the first primer pair capable of amplifying IP-10 (interferon inducible protein-10) and the expression level of IP-10 (interferon inducible protein-10). Performing RT-PCR using a second primer pair, which may be present; And e) measuring the mRNA expression level of the amplified IP-10 and the mRNA expression level of a control gene.

Hereinafter, the present invention will be described.

As mentioned above, in the present invention, about hundreds of biomarkers have been evaluated to find alternative biomarkers from IFN-γ as targets for tuberculosis diagnosis, among which interferon inducible protein-10 (IPBI ACCESSION NO: NM_001565) showed the most meaningful results. Therefore, in the present invention, in addition to the real-time reverse transcriptase amplification method targeting the existing IFN-γ mRNA in addition to the real-time reverse transcriptase amplification method targeting the IP-10 mRNA, a replacement biomarker, tuberculosis diagnosis method with higher sensitivity and specificity Invented.

IP-10 is a small sized chenmokine expressed by antigen presenting cells and is a major derivative of inducing inflammatory immune responses. The secretion of IP-10 begins when T-cells recognize when antigen presenting cells present Mycobacterium tuberculosis specific antigens on the cell surface. Since IP-10 is known to express higher amounts than IFN-γ, targeting of IFN-γ can lead to higher sensitivity in children, HIV-infected, and elderly people who have had sensitivity problems. It is a major biomarker that is being actively researched recently.

Accordingly, in the present invention, (1) the step of treating the tuberculosis bacteria specific antigen by collecting blood of suspected tuberculosis; (2) separating the full-length RNA from the blood treated with Mycobacterium tuberculosis specific antigen; (3) synthesizing cDNA from the isolated full-length RNA; (4) the synthesized cDNA is a first primer pair capable of amplifying IP-10, a first probe capable of binding to the amplified site, and an agent capable of amplifying a control gene for contrast with the expression level of IP-10. Performing qRT-PCR using a second probe pair capable of binding two primer pairs and an amplified control gene region; And (5) providing an information providing method for diagnosing tuberculosis, including measuring the mRNA expression level of the amplified IP-10 and the mRNA expression level of a control gene.

In particular, since IP-10 is quantitatively analyzed at the mRNA expression level, not at the protein expression level, blood volume, test time, and test cost required for the TB test can be significantly reduced.

First, as a step (1), blood from tuberculosis and suspected tuberculosis patients is collected and treated with Mycobacterium tuberculosis-specific antigen. In the conventional IGRA test, the minimum amount of blood required is more than 3 ml. In order to collect this amount of blood, blood must be drawn from a suspected tuberculosis patient through a syringe. Due to the difficulty of blood collection, the elderly, young children and women had a problem that the tuberculosis test is difficult. However, according to one feature of the present invention, since the required blood volume is 1 ml or less, preferably 0.3 to 0.5 ml can provide information to determine whether tuberculosis, blood collection simply by a method using a low-volume blood collection tube It can do much of the psychological burden of blood collection.

On the other hand, the blood used in the present invention may preferably be whole blood. Then, the tuberculosis-specific antigen is treated in the blood of the collected tuberculosis and suspected tuberculosis patient. This is to provide information for determining tuberculosis through the mRNA expression level of IP-10 secreted by T cells in response to Mycobacterium tuberculosis-specific antigen, and in the present invention, IP-10 is not quantitatively expressed. Quantification of mRNA expression levels provides information for diagnosing tuberculosis. Therefore, the Mycobacterium tuberculosis-specific antigen that can be used in step (1) can be used for the IGRA test, and is specifically present only in Mycobacterium tuberculosis, and any conventional Mycobacterium tuberculosis specific antigen known to induce an immune response in the host can be used. . Preferably, ESAT-6 (NCBI ACCESSION NO: YP_178023), CFP-10 (NCBI ACCESSION NO: NP_218391), and TB7.7 (NCBI ACCESSION NO: NP_217171) can be treated as a Mycobacterium tuberculosis specific antigen within about 4 hours. .

On the other hand, the patients with the tuberculosis bacterium specific antigen should be treated immediately after blood collection without isolation of full-length RNA. In the case of patients exposed to tuberculosis, since the patient has information about tuberculosis in memory T cells, the blood of the patients exposed to tuberculosis should be treated. This is because the treatment of tuberculosis antigens can express more IP-10 because T cells remember and show stronger immune responses than normal individuals.

Next, the steps of (2) and (3) specifically to separate the full-length RNA (Total RNA) in the blood treated with the Mycobacterium tuberculosis specific antigen, (3) comprising the step of synthesizing the cDNA from the isolated full-length RNA do. Steps (2) and (3) of the present invention are a method for separating total RNA, which is commonly used as a preliminary step for performing real-time RT-PCR, and a method for synthesizing cDNA therefrom. Method, and a detailed description of this process can be found in Joseph Sambrook et al., Molecular Cloning, ALaboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY (2001); And Noonan, K. F. et al., Which may be incorporated by reference of the present invention.

On the other hand, there are some disadvantages that RT-PCR is difficult to commercialize compared to real-time RT-PCR (qRT-PCR) used in the present invention. First, the analysis time may be delayed because agarose gel electrophoresis, EtBr staining, and densitometer measurements are required to analyze the expression level of IP-10 mRNA after the amplification process (PCR). Second, because of the complexity of the analysis process, the reproducibility of the test may be degraded because skilled persons are required for the test. Third, because the analysis is carried out by staining the amplified amplification products, the sensitivity of the result according to the degree of staining may be reduced (see Reference Example).

On the contrary, since qRT-PCR used in the present invention does not require electrophoresis and EtBr staining, the existing total test time can be reduced, so that TB patients can be identified more quickly. In addition, since the machine reads the signal emitted by the probe labeled on the amplified product sensitively, it can be a more sensitive test than the conventional test. Furthermore, by using a probe labeled with fluorescence or the like, another labeled probe may bind to the inside of the site amplified by the primer pair, and thus may have a higher specificity for the target.

Thus, in the present invention, as a step (4), the synthesized cDNA is compared with the expression level of the first primer pair capable of amplifying IP-10, the first probe capable of binding to the amplified site, and IP-10. QRT-PCR was performed using a second primer pair capable of amplifying a control gene and a second probe capable of binding to an amplified control gene region to solve the above-described problems.

The primers of the present invention can be chemically synthesized using the phosphoramidite solid support method, or other well-known methods. Such nucleic acid sequences may also be modified using many means known in the art. Non-limiting examples of such modifications include, but are not limited to, methylation, "capping ", substitution of one or more natural nucleotides into homologues, and modifications between nucleotides, such as uncharged linkers such as methylphosphonate, phosphotriester, (E.g., phosphoramidate, carbamate, etc.) or charged linkages (e.g., phosphorothioate, phosphorodithioate, etc.).

Nucleic acids may be selected from one or more additional covalently linked residues, such as proteins (eg, nucleases, toxins, antibodies, signal peptides, poly-L-lysine, etc.), inserts (eg, acridine, psoralene, etc.). ), Chelating agents (eg, metals, radioactive metals, iron, oxidizing metals, etc.), and alkylating agents. The nucleic acid sequences of the present invention may also be modified using a label capable of directly or indirectly providing a detectable signal. Examples of labels include radioisotopes, fluorescent molecules, biotin, and the like.

In the method of the present invention, the amplified target sequence (IP-10, control gene) can be labeled with a detectable label. In one embodiment, the labeling material may be a fluorescent, phosphorescent, chemiluminescent or radioactive material, but is not limited thereto. Preferably, the labeling substance may be fluorescein, phycoerythrin, rhodamine, lissamine Cy-5 or Cy-3. When amplifying the target sequence, qRT-PCR is performed by labeling Cy-5 or Cy-3 at the 5'-end and / or 3 'end of the primer so that the target sequence can be labeled with a detectable fluorescent labeling substance.

In addition, the label using the radioactive material may add radioactive isotopes such as ³² P or ³⁵ S to the PCR reaction solution when qRT-PCR is performed, and the amplification product may be incorporated into the amplification product while the amplification product is synthesized. have. One or more sets of oligonucleotide primers used to amplify a target sequence can be used. Labeling is carried out in a variety of ways conventionally practiced in the art, such as nick translation methods, random priming methods (Multiprime DNA labeling systems booklet, "Amersham" (1989)) and chination methods (Maxam & Gilbert, Methods). in Enzymology, 65: 499 (1986)). Labels provide signals detectable by fluorescence, radioactivity, colorimetry, gravimetric, X-ray diffraction or absorption, magnetism, enzymatic activity, mass analysis, binding affinity, hybridization high frequency, nanocrystals.

According to an aspect of the present invention, IP-10 is a protein secreted from cytokine and chemokine-activated antigen-presenting cells secreted from T cells stimulated by Mycobacterium tuberculosis-specific antigen, and in the present invention, the protein is expressed through qRT-PCR. Expression levels are measured at the mRNA level. To this end, a novel primer pair and fluorescence-labeled probe specifically binding to the IP-10 gene are required. In the present invention, [5 'ccagaatcgaaggccatcaaga 3' (SEQ ID NO: 1)] as a front primer and a rear primer [ 5 'agggaagtgatgggagaggca 3' (SEQ ID NO: 2)] is available. [5'-FAM-tgcagtgcttccaaggatggaccaca-Quen-3 '(SEQ ID NO: 3)] may be used as a fluorescent labeling probe that binds to an amplification site of IP-10, but is not limited thereto. As long as it can provide a detectable signal to perform qRT-PCR, it can be used without limitation. In the above FAM and Quen (Quencher) means a fluorescent dye.

According to another aspect of the present invention, qRT-PCR may be performed using a primer and a fluorescently labeled probe capable of amplifying a control gene for contrast with the expression level of IP-10. At this time, the control gene that can be applied to the present invention is a reference gene for relatively determining the expression level of IP-10, in the present invention, as an example of the control gene, the same GAPDH gene as the existing IFN-γ qRT-PCR patent. (NCBI ACCESSION NO: NM_002046) can be used to perform qRT-PCR to express mRNA. GAPDH gene is a housekeeping gene, which is a gene that is constantly expressed in a constant amount in order to maintain minimal function in human cells. There are many genes besides GAPDH, but GAPDH is the largest in quantitative qRT-PCR analysis. It is used.

Therefore, the present invention is not limited thereto, and a gene which may be a reference for relatively determining the expression level of IP-10 may be applied to the present invention. Meanwhile, in the present invention, a GAPDH gene is used as a control gene, and thus a primer capable of specifically binding to the gene is required. In the present invention, [5'-CCATCTTCCAGGAGCGAGATCC-3 '(SEQ ID NO: 4)] and a rear primer are used as forward primers. [5'-FAM-ACTGGCGTCTTCACCACCAT-Quen-3 '(SEQ ID NO: 6)] can be used as a novel primer pair as [5'-ATGGTGGTGAAGACGCCAGTG-3' (SEQ ID NO: 5)] as a fluorescent labeling probe. The qRT-PCR method applied to the present invention may be carried out through known procedures commonly used in the art.

Next, the mRNA expression level of the amplified IP-10 and the mRNA expression level of the control gene are measured as step (5). This step is for relatively measuring the expression level of mRNA of IFN-γ and mRNA of the control gene, and can be used without limitation as long as it is a method for measuring the normal mRNA expression level, depending on the type of probe label used radioactive Measurement, fluorescence measurement or phosphorescence measurement may be performed, but is not limited thereto. As a method of detecting an amplification product, a fluorescence measurement method is performed by performing qRT-PCR by labeling Cy-5 or Cy-3 at the 5'-end of a primer, and a target sequence is labeled with a detectable fluorescent labeling substance. Labeled fluorescence can be measured using a fluorimeter. In addition, the radiometric method is performed by adding radioisotopes such as ³² P or ³⁵ S to the PCR reaction solution to label the amplification products when performing qRT-PCR, followed by radiometric measuring apparatus such as Geiger counter or Radioactivity can be measured using a liquid scintillation counter.

According to a preferred embodiment of the present invention, the PCR product amplified by the qRT-PCR attached to the fluorescence-labeled probe to give a fluorescence of a specific wavelength, at the same time the amplification of the mRNA of IP-10 in the fluorescence meter of the qPCR device Expression level and expression level of the mRNA of the control gene is measured in real time, and the measured value is calculated and visualized through the PC, the examiner can easily check the expression level. In other words, the amount of expression of IP-10 and GAPDH mRNA is calculated for each blood sample (sample), and the amount of expression of IP-10 is corrected according to the amount of expression of GAPDH mRNA and Nil control, a negative control group. Compared to how many times the increase and decrease of IP-10 mRNA expression in the samples stimulated with Mycobacterium tuberculosis-specific antigens can be used to provide information that can be used to determine tuberculosis. It can be.

According to another aspect of the present invention includes a diagnostic composition for tuberculosis comprising a primer and a fluorescence-labeled probe specifically binding to the gene for measuring the mRNA expression level of the human IP-10 gene. As a specific aspect, the diagnostic kit may be a kit for diagnosing tuberculosis, characterized in that it includes essential elements necessary to perform reverse transcriptase. The reverse transcriptase polymerase kit may comprise respective primer pairs specific for the human IP-10 gene. The primer is a nucleotide having a sequence specific to the nucleic acid sequence of each marker gene, and may be about 7 bp to 50 bp in length, more preferably about 10 bp to 30 bp in length, and more preferably SEQ ID NOs: 1 and 2 It may include a novel primer pair represented by and a fluorescently labeled probe represented by SEQ ID NO: 3.

It may also include primers and probes specific for the nucleic acid sequence of the control gene, preferably may further include primers and probes specifically binding to the gene in order to measure the mRNA expression level of GAPDH, more preferably Preferably, the primer may include a novel primer pair consisting of SEQ ID NOs: 4 and 5 and a fluorescently labeled probe represented by SEQ ID NO: 6.

Other reverse transcriptase kits include test tubes or other suitable containers, reaction buffers (pH and magnesium concentrations vary), enzymes such as deoxynucleotides (dNTPs), Taq-polymerase and reverse transcriptase, DNAse, RNAse inhibitor DEPC -May include DEPCwater, sterile water, and the like.

After all, the conventional IGRA method for testing IFN-γ and IP-10 protein requires at least 3ml or more blood, which can be burdensome for patients because blood is drawn using a larger blood cllection tube. Tuberculosis testing is possible with very small blood volumes of less than ㎖, so the use of a smaller blood collection tube can significantly reduce the burden on the patient, and is easier for elderly patients and children who have difficulty collecting blood. In addition, since the amount of expression of IP-10 itself is known to be very high compared to IFN-γ, it led to the improvement of the insufficient sensitivity, which was considered as a limitation.

As can be seen through the present invention, the present invention can be tested for tuberculosis with very little blood of 1 ml or less, so that the burden of the patient can be significantly reduced by using a smaller blood collection tube, and elderly patients who have difficulty in collecting blood. It is easy even in child patient. In addition, since the expression amount of IP-10 itself is known to be very high compared to IFN-γ, there is an effect that can lead to the improvement of the insufficient sensitivity, which was considered as a conventional limitation.

1 is a diagram related to the construction of a primer and TaqMan Probe for IP-10 mRNA target qRT-PCR,
2 is a view related to the sensitivity test of the prepared primer and TaqMan probe,
Figure 3 is a comparison of the results of IP-10 qRT-PCR and IFN-γ qRT-PCR for patients and healthy people,
Figure 4 is a view showing an antigen tube (three control / 1 person) containing Mycobacterium tuberculosis specific antigen (peptide),
FIG. 5 shows the results of IP-10 mRNA qRT-PCR of active TB patients and recent contacts, as shown in FIG. 5, in active TB patients and recent contacts. Since this is in progress, it can be seen that the amount of IP-10 mRNA expression is significantly increased when treated with Mycobacterium tuberculosis-specific antigen (TB Ag control) compared to before nil control (nil control). Referring to the results of FIG. 5, in the case of TB Ag control, the Ct value is about 24 to 26, but in Nil control, the Ct value is about 30, and the difference in Ct value is about 5 degrees. In this result, since the graph peak in TB Ag control was shown in PCR cycle of less cycle, more IP-10 mRNA was expressed in preparation for Nil control. This is an example of experiments using peripheral blood from tuberculosis patients.
6 shows that IP-10 mRNA qRT-PCR results in normal (healthy) patients were not exposed to Mycobacterium tuberculosis, so that the amount of IP-10 mRNA expression was compared to nil control. When treated with Mycobacterium tuberculosis specific antigen (TB Ag control), it can be seen that there is no significant change. In the results of FIG. 6, in the case of TB Ag control, the Ct value is about 30, and in the Nil control, the Ct value is about 30, indicating that there is no significant difference in Ct value. In this result, the graph peak pattern was similar in TB Ag control and Nil control, indicating no IP-10 mRNA expression for Mycobacterium tuberculosis specific antigen. This is an example of experiments using peripheral blood from a healthy person.

Hereinafter, the structure of the present invention will be described in more detail with reference to the following Examples, but the scope of the present invention is not limited to the following Examples.

Example 1 Preparation of Antigen-treated Blood

After collecting blood from Mycobacterium tuberculosis-specific antigen-treated patients in whole blood, tubes containing antigens used for IGRA testing were imported from Cellestis, Australia, and 1 ml of blood was added to each of the three tubes. 4). The nil tube contains no antigen and is used as a negative control in the IGRA test. The TB antigen tube is a tube containing three antigens, ESAT-6, CFP-10, and TB7.7, which are specific to Mycobacterium tuberculosis and are known to induce an immune response in the host. The TB mitogen tube contains phytohaemagglutinin (PHA) that acts as a mitogen to help differentiate T cells and was used as a positive control in the IGRA test.

Example 2 Isolation of Total RNA from Antigened Blood

In Example 1, the antigen-treated blood was centrifuged (3,000xg, 15 minutes), plasma was collected, and the existing IGRA test was performed. (Roche diagnostics) and completely hemolyzed using MagNA Pure LC (Roche Diagnostics) and MagNA Pure LC RNA Isolation Kit-High Performance, using the RNA HP Blood External Lysis protocol stored in the automated nucleic acid extractor Total RNA was extracted.

Example 3 Synthesis of Complementary cDNA from Isolated Total RNA

9 μl total RNA isolated, 0.25ug random primer (Invitrogen), 250uM dNTP (Cosmo gene tech) 250mM, Tris-HCl (pH 8.3) 50mM, KCl 75mM, 3gMgCl2, 8mM DTT and 200units of MMLV reverse transcriptase (Invitrogen) DEPC treated DW was added to the final volume to 25ul and stirred. The cDNA synthesis reaction was then reacted with a thermocycler (GeneAmp PCR System 2700, Applied Biosystem) for 10 minutes at 25 ℃, 50 minutes at 37 ℃, 15 minutes at 70 ℃ to synthesize cDNA.

<Example 4> IP-10 and GAPDH amplification using synthesized cDNA as a template

The composition of the qRT-PCR reactants was 50 mM KCl, Tris-HCl 10 mM (pH8.3), MgCl2 1.5 mM, gelatin 0.001% (w / v), 250 uM dNTP, 1 unit Tag DNA polymerase (Solgent), respectively. The front primer and the back primer are 10 pmole. In addition, oligo probes labeled with fluorescent probes were added to 5 pmole. 3 μl of the synthesized cDNA was added thereto, and the final volume was 20 μl. The base sequence of each primer added is as follows.

(1) IP-10 primer (size of amplification product-144bp)

Forward-5 'ccagaatcgaaggccatcaaga 3' (SEQ ID NO: 1)

Reverse-5 'agggaagtgatgggagaggca 3' (SEQ ID NO: 2)

Probe-5 'FAM-tgcagtgcttccaaggatggaccaca-Quen 3' (SEQ ID NO: 3)

(2) GAPDH primer (size of amplification product-91bp)

Forward-5 'CGGGAAGCTTGTGATCAATGG 3' (SEQ ID NO: 4)

Reverse-5 'GGCAGTGATGGCATGGACTG 3' (SEQ ID NO: 5)

Probe-5 'FAM-ACTGGCGTCTTCACCACCAT-Quen 3' (SEQ ID NO: 6)

q The RT-PCR reaction (ABI 7500 FAST real-time PCR system, Applied Biosystem) was performed once at a denaturation temperature of 95 ° C. for 5 minutes, 40 cycles of 10 seconds at denaturation temperature of 95 ° C. and 30 seconds at annealing temperature of 60 ° C. Repeated times were performed. The total run time is 1 hour (65 minutes).

Example 5 Confirmation of Amplification by Software Analysis and Quantification of Amplified Product

After Realtime RT-PCR, the product amplification was confirmed using 7500 Software V.2.04. And the results were analyzed and quantified through PCR efficiency and Ct value.

On the other hand, the Ct values from three tubes, TB mitogen tube, TB antigen tube, and Nil tube, which are used in the embodiment of the present invention, were determined, and Comparative Ct Method, which is one of methods for quantifying the expression level of specific genes of qRT-PCR It is measured according to the following relation, and this formula is inherent in 7500 Software V.2.04 and automatically calculated.

[Relationship 1]

ΔΔCt = ΔCt (sample)-ΔCt (reference gene)

Here, the Ct value represents the number of cycles in which amplification began to increase significantly during the PCR process.

ΔΔCt means the value of the vertical axis (mRNA expression ratio) in FIG. 3.

[Relation 2]

Expression Analysis of IP-10 Expression in Positive Control

Mitogen's ΔCt value = Ct value of IP-10 in Mitogen-Ct value of reference gene (GAPDH) in Mitogen

ΔCt value of Nil = Ct value of IP-10 in Nil-Ct value of reference (GAPDH) gene in Nil

R (expression) = ΔCt of mitogen-ΔCt of nil

[Relation 3]

Expression Analysis of IP-10 Expression in Stimulation of TB Antigens

ΔCt value in TB antigen = Ct value of IP-10 in TB antigen-Ct value of reference (GAPDH) gene in IP-10

R (expression) = ΔCt value in TB antigen-ΔCt value of Nil

The Ct value of the reference gene used in this experiment represents the Ct value for GAPDH, and the reference gene may include other house keeping genes in addition to the GAPDH used in this experiment.

TB mitogen: As a positive control, it is possible to confirm whether the expression level is actually overexpressed.

Differences in Ct values between TB control and Nil control: In tuberculosis patients, the difference in Ct value was 2 or more on average, and the difference in Ct value between control groups was 2 or less (Figs. 5 and 6).

Evaluation Example 1 Preparation of Primer and TaqMan Probe for IP-10 mRNA Target qRT-PCR

Based on the standard sequence of IP-10 (CXCL10) (NCBI ACCESSION NO: NM_001565) registered in NCBI GeneBank, amplifiable anterior and posterior primers and TaqMan probes were prepared (FIG. 1).

Evaluation Example 2 Sensitivity Test of Prepared Primer and TaqMan Probe

As a result of the sensitivity test of the primer targeted to IP-10, it was confirmed that the sensitivity of the primer could be amplified up to 1x10 ³ copies, and that the IP-10 qRT-PCR was amplified to 1x10 ² copies using TaqMan probe. It was confirmed that the sensitivity increased by 10 times than when using only the primer (Fig. 2).

Evaluation Example 3 Possibility Assessment of Tuberculosis Diagnosis by Quantifying IP-10 mRNA Isolated from Antigenated Blood

Table 1 is a table showing the clinical information of the clinical sample provider used in the present invention.

About 87 clinical specimens, QuatiFERON (IFN-γ ELISA; IGRA), tuberculin skin test (TST), culture test and clinical diagnostic test were received from Shinchon Severance Hospital of Yonsei University. The clinical specimens included 23 patients who were diagnosed with pulmonary tuberculosis before the start of anti-tuberculosis treatment, 17 recent contacts with positive TST and IGRA tests among the active patients with tuberculosis, and no clinical signs of tuberculosis. Forty-seven health-negative subjects from the IGRA test were included (Table 1).

Therefore, peripheral blood was collected from 87 patients and healthy individuals, and the IFN-γ mRNA was developed by extracting total RNA from cells obtained after incubating the blood for 16-18 hours at 37 ° C with TB-specific antigen. Targeted qRT-PCR and targeted qRT-PCR targeting IP-10 mRNA were performed, and the sensitivity of IP-10 qRT-PCR was confirmed compared to IFN-γ qRT-PCR.

As a result, the mean value of the expression level of IP-10 was close to about 100 in patients with active pulmonary tuberculosis, and the expression level of IP-10 was about 10 in the case of IFN-γ. It confirmed that it increased more than 10 times. Recently, the average value of the expression level of IP-10 was close to about 60 for IFN-γ, and about 2.5 for IFN-γ. It was confirmed to appear high. On the other hand, both biomarkers were confirmed to have no visible response to Mycobacterium tuberculosis specific antigen as 1 in the health control group (FIG. 3). These results confirm that IP-10 qRT-PCR results in higher sensitivity when IFN-γ qRT-PCR is performed. Because it was very high, it is expected that significant results can be obtained even when using the existing blood volume of 1ml or less, and showed no specific immune response to tuberculosis antigen in active control group compared to active pulmonary tuberculosis and recent contacts. Like IFN-γ, it was confirmed that IP-10 reacts specifically with Mycobacterium tuberculosis antigen, indicating that the specificity of the test is appropriate for the diagnosis of tuberculosis.

Reference Example Comparison of IFN-γ RT-PCR and Real-time qRT-PCR Results in Various Groups after Treatment with TB Specific Antigen for 4 hours.

The concordance rate of the conventional commercialized IFN-γ ELISA and IFN-γ RT-PCR was about 79% (19/24), and the concordance rate of the IFN-γ ELISA and IFN-γ real-time qRT-PCR was about 88%. (21/24) confirmed that the result of IFN-γ real-time qRT-PCR was about 9% higher than that of IFN-γ ELISA compared to IFN-γ RT-PCR.

<110> Yonsei University Wonju Industry-Academic Cooperation Foundation <120> A Method of providing information for diagnosis of tuberculosis using IP-10 quantitative reverse transcriptase-PCR (qRT-PCR) and diagnostic kit therefor <160> 6 <170> Kopatentin 1.71 <210> 1 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 1 ccagaatcga aggccatcaa ga 22 <210> 2 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 2 agggaagtga tgggagaggc a 21 <210> 3 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> probe <400> 3 tgcagtgctt ccaaggatgg accaca 26 <210> 4 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 4 cgggaagctt gtgatcaatg g 21 <210> 5 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 5 ggcagtgatg gcatggactg 20 <210> 6 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> probe <400> 6 actggcgtct tcaccaccat 20

Claims

a) treating the tuberculosis specific antigen with blood of a suspected tuberculosis patient;
b) separating the full-length RNA from the blood treated with Mycobacterium tuberculosis specific antigen;
c) synthesizing cDNA from the isolated full-length RNA;
d) the synthesized cDNA can amplify a control gene for contrast with the first primer pair capable of amplifying IP-10 (interferon inducible protein-10) and the expression level of interferon inducible protein-10 (IP-10) Performing RT-PCR using the second primer pair; And
e) measuring the mRNA expression level of the amplified IP-10 and mRNA expression level of the control gene; information providing method for diagnosing tuberculosis.

The method of claim 1, wherein the step d) comprises combining the synthesized cDNA with a first primer pair capable of amplifying IP-10, a first probe capable of binding to an amplified site, and a control gene.
An information providing method for diagnosing tuberculosis, wherein realtime RT-PCR is performed using a second primer pair capable of amplification and a second probe capable of binding to an amplified control gene region.

The method of claim 1, further comprising the step of collecting blood from a suspected tuberculosis patient before step a).

The method of claim 1, wherein the TB bacterium specific antigen of step b) is any one or more of ESAT-6, CFP-10 and TB7.7.

The method of claim 1, wherein the control gene is GAPDH.

The method according to claim 1 or 2, wherein the first primer pair capable of amplifying IP-10 is a primer pair consisting of SEQ ID NOs: 1 and 2, and the second primer pair capable of amplifying the control gene is a sequence. Information providing method for the diagnosis of tuberculosis, characterized in that the primer pair consisting of the number 4 and 5.

According to claim 1, After the step e), based on the mRNA expression level of the control gene relative to the mRNA expression level of IP-10 further comprising the step of providing information for the diagnosis of tuberculosis.

The method of claim 2, wherein the first probe is a probe represented by SEQ ID NO. 3.

The method of claim 2, wherein the second probe is a probe represented by SEQ ID NO. 6.

Tuberculosis diagnostic composition comprising a primer pair consisting of SEQ ID NO: 1 and 2 as an active ingredient.

The composition for diagnosing tuberculosis according to claim 10, wherein the composition further comprises a primer pair specifically binding to the gene to measure mRNA expression level of a control gene.

The composition for diagnosing tuberculosis according to claim 11, wherein the primer pair is a primer pair consisting of SEQ ID NOs: 4 and 5. 13.

The composition for diagnosing tuberculosis according to claim 10, wherein the composition further comprises a first probe and a second probe.

The composition for diagnosing tuberculosis according to claim 13, wherein the first probe is a probe represented by SEQ ID NO: 3.

The composition for diagnosing tuberculosis according to claim 13, wherein the second probe is a probe represented by SEQ ID NO.

Tuberculosis diagnostic kit comprising a primer pair consisting of SEQ ID NO: 1 and 2 as an active ingredient.

The kit for diagnosing tuberculosis according to claim 16, wherein the kit further comprises a primer pair specifically binding to the gene to measure mRNA expression level of a control gene.

18. The kit for diagnosing tuberculosis according to claim 17, wherein the primer pair is a primer pair consisting of SEQ ID NOs: 4 and 5.

The kit for diagnosing tuberculosis according to claim 16, wherein the kit further comprises a first probe and a second probe.

The kit for diagnosing tuberculosis according to claim 19, wherein the first probe is a probe represented by SEQ ID NO: 3.

The kit for diagnosing tuberculosis according to claim 19, wherein the second probe is a probe represented by SEQ ID NO: 6.

a) treating the tuberculosis specific antigen with blood of a suspected tuberculosis patient;
b) separating the full-length RNA from the blood treated with Mycobacterium tuberculosis specific antigen;
c) synthesizing cDNA from the isolated full-length RNA;
d) the synthesized cDNA can amplify a control gene for contrast with the first primer pair capable of amplifying IP-10 (interferon inducible protein-10) and the expression level of interferon inducible protein-10 (IP-10) Performing RT-PCR using the second primer pair; And
e) measuring the mRNA expression level of the amplified IP-10 and mRNA expression level of the control gene; tuberculosis diagnostic method comprising a.