KR20130135133A - Pharmaceutical composition containing aleurites fordii extract, fractions thereof or diterpene compound isolated from the fraction for anti-aging - Google Patents

Abstract

In the present invention, Aleurites fordii ) anti-aging pharmaceutical composition containing an extract, a fraction thereof, or a phorbol-type diterpene compound isolated from the fraction as an active ingredient, the flow extract, a fraction thereof, or a fraction separated from the fraction A phorbol-type diterpene compound acts on blood cells to induce the production of CD44, a cell surface substance necessary for blood cells to migrate to skin tissue, and acts on skin epithelial cells to moisturize. Since it increases the production enzyme of hyaluronic acid, it can be used as an active ingredient of a functional cosmetic having anti-aging pharmaceutical composition or anti-aging effect for treating skin diseases or preventing skin aging.

Description

Pharmaceutical composition containing Aleurites fordii extract, fractions about or diterpene compound isolated from the fraction for anti-aging}

In the present invention, Aleurites fordii ) extract, fractions thereof, or a diterpene compound isolated from the fractions relates to a pharmaceutical composition for preventing and improving skin aging containing as an active ingredient.

Aleurites fordii ) extract is known to treat swelling, soreness, toothache and rheumatism in throat in oriental traditional medicine. It has also been known to treat smallpox and early breast cancer, but the biological activity of the flow extract is not yet well known. On the other hand, it has been confirmed that the flow extract or fractions thereof have an antiviral effect (Korean Patent Publication No. 10-2011-0049722).

Skin aging is caused by a decrease in collagen, elastin, and hyaluronic acid, which are components of skin cells and extracellular matrix (ECM). Degradation and wrinkles on the skin are known (Exp Dermatol. 2011 May; 20 (5): 454-6).

Hyaluronic acid is a natural moisturizing ingredient present in the interstitial cells of the epidermal and dermal layers, and maintains moisture in the skin to maintain moisturizing and skin elasticity. It has the ability to attract about 80 times its own weight and has excellent water absorption. Such hyaluronic acid decreases with age, causing wrinkles. In addition, when the skin is exposed to ultraviolet rays, harmful free radicals are generated, thereby reducing collagen and intercellular substance hyaluronic acid in the dermal layer, resulting in wrinkles. In order to scientifically analyze the skin aging phenomenon, it is necessary to analyze the change of skin tissue and to develop a bioactive substance to induce the increase of hyaluronic acid which is a component of skin tissue according to aging.

Wrinkle improvement products are used to promote skin elasticity and collagen synthesis, and to promote epidermal metabolism. Wrinkle improvement functions include retinol, adenosine, polyethoxylateddretinamide and retinyl palmitate. Since 2000s, the products of catechin, coenzyme Q-10, and yeast extract, which are a kind of plant hormone synthesized from natural products such as angelica, adenosine, apple, pear and rosemary, and ursolic acid contained in herbs It was used as an enhancement function ingredient. In particular, the natural products obtained from plants have no problem in the stability of the human body, and has advantages in that they are easy to manufacture and inexpensive. Although natural extracts such as wild pansy extract, edelweiss extract, and olive leaf are added to the wrinkle improvement products, there has been no use of liquid extracts to treat skin diseases or to improve wrinkles.

The inventors have found a substance for inducing the production of hyaluronan which is rapidly reduced in aging including wrinkles. As a result of attempting to excavate from the extract of natural products, the flow extract, fractions thereof or diterpene compounds isolated from the fractions of CD44, a ligand for recognizing hyaluronan in blood cells and moving to skin tissue The present invention was completed by confirming that the ability to induce expression is excellent and the production of hyaluronic synthase, a production enzyme of hyaluronic acid, which is involved in skin moisturization in skin cells, exhibits anti-aging effect through skin moisturization. .

It is an object of the present invention to provide a pharmaceutical composition, health food or cosmetic composition for preventing and improving skin aging containing a flow extract, a fraction thereof or a diterpene compound isolated therefrom as an active ingredient.

In order to solve the above problems, the present invention provides a pharmaceutical composition, health food or cosmetic composition for preventing and improving skin aging containing a flow extract or a fraction thereof as an active ingredient.

In another aspect, the present invention provides a pharmaceutical composition, health food, or cosmetic composition for preventing and improving skin aging containing a diterpene compound represented by the following formula (1) or a pharmaceutically acceptable salt thereof as an active ingredient .

[Formula 1]

는 단일 또는 이중 결합이고, 이때 상기

가 이웃하는 경우 적어도 하나는 단일 결합이고,(In the formula 1,

Is a single or double bond, wherein

Is neighboring at least one is a single bond,

R 1 is C 1 -C 4 straight or branched alkyl, unsubstituted or substituted with hydroxy,

R 2 is H or hydroxy, and

가 이중결합인 경우에 치환된다)
R 3 is H or O, wherein O is

Is substituted when is a double bond)

In the present invention, Aleurites Fordii ) extract, a fraction thereof or an anti-aging pharmaceutical composition containing a phorbol-type diterpene compound isolated from the fraction as an active ingredient, the flow extract acts on blood cells Induces the production of CD44, a cell surface substance necessary for migration to skin tissue, and increases the production enzyme of hyaluronic acid, which has a moisturizing effect by acting on skin epithelial cells, thereby preventing skin aging or preventing skin aging. It can be used as an active ingredient of a functional composition having an anti-aging pharmaceutical composition, anti-aging and improving health food, or anti-wrinkle effect.

1 shows the Aleurites fordii ) is a diagram showing the chemical structure of a diterpene compound of the pobol type isolated from the extract.
Figure 2 is the expression level of the mRNA of the CD44 marker protein required for the recruitment of blood (immune) cells in epidermal epithelial tissue in the blood cells treated with flow extract K562, U937, HMC cells and epithelial cells A549, CRL2076 cells The result was confirmed by RT-PCR (FIG. 2A), and the expression level of CD44 labeled protein was confirmed by FACS (FIG. 2B).
Figure 3 shows the expression of hyaluronic acid synthase-2 (HAS-2), which is an enzyme related to the production of hyaluronic acid in CRL2076, a Hacat cell treated with flow extracts, and the concentration of the extract (3A and 3C) and time (3B) is confirmed that the result.
Figure 4 shows the CD44 mRNA expression according to the concentration of the extract treated in the flow-treated blood cells K562 (Fig. 4A) and the treatment time (Fig. 4B), CD44 protein (Fig. 4C) with the treatment time It is the figure which confirmed that this increased.
Figure 5 Normal balb / C mouse skin is removed and tape strapping is induced to induce some wounds and then skin shine during skin regeneration;
Control group: cream only group; And
Flow Extract Treatment Group: A creamed treatment group containing a 70 μg / ml flow extract component.

Hereinafter, the terms of the present invention will be described in detail.

In the present invention, "improvement" means any action that improves or advantageously changes the symptoms of the disease by administration of the composition.

In the present invention, "administration" means providing the patient with the desired substance in any suitable way, and the route of administration of the composition of the present invention is oral or parenteral via all common routes as long as the target tissue can be reached. Oral administration. The composition may also be administered by any device capable of transferring the active agent to the target cell.

Hereinafter, the present invention will be described in detail.

The present invention provides a pharmaceutical composition for preventing and improving skin aging containing a flow extract or a fraction thereof as an active ingredient.

The flow extract is preferably prepared by a manufacturing method comprising the following steps, but not always limited thereto:

1) extracting by adding an extraction solvent to the flow;

2) filtering the extract of step 1); And

3) Concentrating the filtered extract of step 2) under reduced pressure and drying.

In the above method, the flow of step 1) can be used without limitation, such as grown or commercially available. The flow is not limited to all the flowers, stems, leaves or fruit of the flow is available.

In the above method, the extraction solvent of step 1) is preferably water, alcohol or a mixture thereof. As the alcohol, C1 to C2 lower alcohols are preferably used, and as lower alcohols, ethanol or methanol is preferably used. As the extraction method, it is preferable to use shaking extraction, Soxhlet extraction or reflux extraction, but is not limited thereto. The extraction solvent is preferably extracted by adding 2 to 20 times the dried flow amount. Extraction temperature is preferably 20 to 50 ℃ but is not limited thereto. In addition, the extraction time is preferably 10 to 48 hours, more preferably 24 hours is not limited thereto. In addition, the number of times the extraction is preferably 3 to 5 times, more preferably three times repeated extraction is not limited thereto.

In the above method, it is preferable to use a vacuum decompression concentrator or a vacuum rotary evaporator for the decompression concentration in step 3), but it is not limited thereto. In addition, the drying is preferably reduced pressure drying, vacuum drying, boiling drying, spray drying or freeze drying, but is not limited thereto.

In the above method, it is preferable to use a vacuum decompression concentrator or a vacuum rotary evaporator for the decompression concentration in step 3), but it is not limited thereto. In addition, the drying is preferably reduced pressure drying, vacuum drying, boiling drying, spray drying or freeze drying, but is not limited thereto.

The fraction may be obtained using an organic solvent selected from the group consisting of hexane, chloroform and ethyl acetate, but is not limited thereto.

The flow extract or fractions thereof may be one having skin regeneration, wrinkle improvement or moisturizing enhancement activity, but is not limited thereto.

In a specific embodiment of the present invention, we prepared a flow extract and prepared fractions from the extract. Flux extract was treated with K562, U937, HMC cells, epithelial cells, A549, CRL2076 cells, and mRNA expression and protein of CD44 marker protein required for recruitment of blood (immune) cells into epidermal epithelial tissue. The degree of expression was confirmed. It was confirmed that the expression of mRNA of the CD44 marker protein was increased when the flow extract was treated (see FIG. 2A), and the CD44 protein was also increased (see FIG. 2B).

Changes in mRNA levels associated with the production of hyaluronic acid synthase 2 (HAS-2) were observed in epidermal epithelial cells, CRL2076 and Hacat, and HAS-2 production increased at a concentration of 0.5 μg / ml. It was confirmed that showing the phenomenon of the increase in transcriptional activity 1 hour after treatment (see Fig. 3A, B and C).

MRNA expression and protein expression levels of CD44 were confirmed in K562 cells according to the treatment concentration and treatment time of the flow extract. As a result, CD44 increase in K562 cells was also strong in 0.1 ㎍ / ml of the flow extract (see FIG. 4A), and the transcript began to increase after 3 hours and had a maximum transcription activity after 12 hours. It was confirmed (see FIG. 4B). As a result of analyzing the surface protein change in FACS, it was confirmed that the expression of CD44 protein also showed the same pattern (see FIG. 4C).

To analyze the skin-improving effect of the liquid extract in the mouse, tape strapping was performed on the depilated skin of normal Balb / C mice to induce skin damage and then treated with the extract to regenerate the skin and resilience. Was analyzed. As a result, in the case of the flow extract treatment group coated with a cream extract containing the flow extract compared to the cream-only control group, it was confirmed that it exhibits an excellent effect of inhibiting wrinkles of the skin and inducing skin activity (Fig. 5). Reference).

Therefore, the composition according to the present invention induces the production of CD44, a cell surface material required for blood cells to move to skin tissue, and also acts on skin epithelial cells to have hyaluronic effect (Hyaluronic acid). It can be used as an active ingredient of the pharmaceutical composition for preventing and improving skin aging because it can prevent or improve skin wrinkles by exhibiting an effect of increasing the production enzyme of).

When formulating the composition, it is prepared using commonly used diluents or excipients, such as fillers, extenders, binders, wetting agents, disintegrating agents, surfactants.

Solid formulations for oral administration include tablets, patients, powders, granules, capsules, troches and the like, which may contain one or more excipients such as starch, calcium carbonate Sucrose, lactose, or gelatin. In addition to simple excipients, lubricants such as magnesium stearate talc are also used. Liquid preparations for oral administration include suspensions, solutions, emulsions or syrups. Various excipients such as wetting agents, sweeteners, fragrances, preservatives and the like are included in addition to commonly used simple diluents such as water and liquid paraffin. .

Formulations for parenteral administration include sterilized aqueous solutions, non-aqueous solutions, suspensions, emulsions, freeze-dried preparations, suppositories, and the like.

Examples of the non-aqueous solvent and suspending agent include propylene glycol, polyethylene glycol, vegetable oil such as olive oil, injectable ester such as ethyl oleate, and the like. As a base for suppositories, witepsol, macrogol, tween 61, cacao paper, laurin, glycerol, gelatin and the like can be used.

The composition according to the present invention is administered in a pharmaceutically effective amount. In the present invention, "pharmaceutically effective amount" means an amount sufficient to treat a disease at a reasonable benefit / risk ratio applicable to medical treatment, and the effective dose level will depend on the type of disease, severity, , Sensitivity to the drug, time of administration, route of administration and rate of release, duration of treatment, factors including co-administered drugs, and other factors well known in the medical arts. The composition of the present invention can be administered as an individual therapeutic agent or in combination with other therapeutic agents, and can be administered sequentially or simultaneously with conventional therapeutic agents, and can be administered singly or in multiple doses. It is important to take into account all of the above factors and to administer the amount in which the maximum effect can be obtained in a minimal amount without side effects, which can be easily determined by those skilled in the art.

Specifically, the effective amount of the flow extract and fractions thereof according to the present invention may vary depending on the age, sex and weight of the patient, generally between 0.1 and 100 mg, preferably between 0.5 and 10 mg per kg of body weight daily or It can be administered every other day or divided into 1 to 3 times a day. However, the dosage may be varied depending on the route of administration, the severity of obesity, sex, weight, age, etc. Therefore, the dosage is not limited to the scope of the present invention by any means.

In addition, the present invention provides a healthy food for preventing and improving skin aging containing a flow extract or a fraction thereof as an active ingredient.

The flow extract or fractions thereof may be one having skin regeneration, wrinkle improvement or moisturizing enhancement activity, but is not limited thereto.

The flow extract or fractions thereof of the present invention act on blood cells to induce the production of CD44, a cell surface material necessary for blood cells to migrate to skin tissues, and also act on skin epithelial cells to produce hyaluronic acid having a moisturizing effect. Since it can prevent or improve skin wrinkles by showing an effect of increasing the enzyme, it can be used as an active ingredient of a healthy food for preventing and improving skin aging.

There is no particular limitation on the kind of the food. Examples of the foods to which the above substances can be added include dairy products including dairy products, meat, sausage, bread, biscuits, rice cakes, chocolate, candies, snacks, confectionery, pizza, ramen and other noodles, gums, ice cream, Beverages, alcoholic beverages and vitamin complexes, dairy products, and dairy products, all of which include health functional foods in a conventional sense.

The flow extract of the present invention or a fraction thereof may be added to the food as it is or used with other food or food ingredients, and may be appropriately used according to a conventional method. The amount of the active ingredient to be mixed can be suitably determined according to the intended use (for prevention or improvement). Generally, the amount of the compound in the health food may be 0.1 to 90 parts by weight of the total food. However, in the case of long-term intake intended for health and hygiene purposes or for the purpose of controlling health, the amount may be less than the above range, and since there is no problem in terms of safety, the active ingredient may be used in an amount exceeding the above range.

The health functional beverage composition of the present invention is not particularly limited to the other ingredients other than the above-mentioned compounds as essential ingredients in the indicated ratios and may contain various flavors or natural carbohydrates as additional ingredients such as ordinary beverages. Examples of the above-mentioned natural carbohydrates include monosaccharides such as glucose, fructose and the like; Disaccharides such as maltose, sucrose and the like; And conventional sugars such as polysaccharides such as dextrin, cyclodextrin, and sugar alcohols such as xylitol, sorbitol, and erythritol. Natural flavors (tau martin, stevia extracts (e.g., rebaudioside A, glycyrrhizin, etc.) and synthetic flavors (saccharin, aspartame, etc.) can be advantageously used as flavors other than those described above The ratio of the natural carbohydrate is generally about 1 to 20 g, preferably about 5 to 12 g per 100 of the composition of the present invention.

In addition to the above, the fluid extract or fractions thereof of the present invention are various nutrients, vitamins, minerals (electrolytes), synthetic flavors such as synthetic and natural flavors, coloring and neutralizing agents (such as cheese, chocolate), pectic acid and salts thereof. , Alginic acid and salts thereof, organic acids, protective colloidal thickeners, pH adjusters, stabilizers, preservatives, glycerin, alcohols, carbonation agents used in carbonated drinks and the like. In addition, the flow extract or fractions thereof of the present invention may contain flesh for the production of natural fruit juices and fruit juice beverages and vegetable beverages.

These components may be used independently or in combination. The proportion of such additives is not so critical but is generally selected in the range of 0.1 to about 20 parts by weight per 100 parts by weight of the flow extract or fractions thereof of the present invention.

The present invention also provides a cosmetic composition for preventing and improving skin aging containing a flow extract or a fraction thereof as an active ingredient.

The flow extract or fractions thereof may be one having skin regeneration, wrinkle improvement or moisturizing enhancement activity, but is not limited thereto.

The flow extract or fractions thereof of the present invention act on blood cells to induce the production of CD44, a cell surface material necessary for blood cells to migrate to skin tissues, and also act on skin epithelial cells to produce hyaluronic acid having a moisturizing effect. It can be used to prevent skin aging, for example, skin atrophy, collagen loss, elastic fiber loss, connective tissue loss, cellulite, wrinkle formation, etc., as it has the effect of enhancing the enzyme to prevent or improve skin wrinkles. have.

The cosmetic composition for preventing or improving skin aging according to the present invention includes, but is not limited to, lotions, ointments, gels, creams, patches or sprays. In preparing the cosmetic composition for preventing skin aging according to the present invention, the flow extract of the present invention or a fraction thereof may be added in an amount of 1 to 15 parts by weight, preferably 2 or 10 parts by weight, to the externally used skin composition. In addition to the fluid extract of the present invention or fractions thereof, the external preparation for skin may include fatty substances, organic solvents, solubilizers, thickening and gelling agents, emollients, antioxidants, suspending agents, stabilizers, foaming agents, fragrances, interfaces. Active, water, ionic or nonionic emulsifiers, fillers, metal ion sequestrants and chelating agents, preservatives, vitamins, blockers, wetting agents, essential oils, dyes, pigments, hydrophilic or lipophilic active agents, lipid vesicles or external preparations for the skin It may contain adjuvants commonly used in the field of dermatology, such as any other ingredients commonly used in the art. The ingredients may also be introduced in amounts generally used in the field of dermatology.

In addition, the present invention provides a pharmaceutical composition for preventing and improving skin aging containing a diterpene compound represented by the following Formula 1 or a pharmaceutically acceptable salt thereof as an active ingredient.

The present invention also provides a diet for preventing and improving skin aging containing a diterpene-based compound represented by the following Formula 1 or a pharmaceutically acceptable salt thereof as an active ingredient.

The present invention also provides a cosmetic composition for preventing and improving skin aging containing a diterpene-based compound represented by the following Formula 1 or a pharmaceutically acceptable salt thereof as an active ingredient.

[Formula 1]

는 단일 또는 이중 결합이고, 이때 상기

가 이웃하는 경우 적어도 하나는 단일 결합이고,(In the formula 1,

Is a single or double bond, wherein

Is neighboring at least one is a single bond,

R 1 is C 1 -C 4 straight or branched alkyl, unsubstituted or substituted with hydroxy,

R 2 is H or hydroxy, and

가 이중결합인 경우에 치환된다)
R 3 is H or O, wherein O is

Is substituted when is a double bond)

The compound represented by Chemical Formula 1 is preferably one selected from the group represented by Chemical Formulas 2 to 6, but is not limited thereto.

[Formula 2] [Formula 3]

,

,

,

,

[Formula 4] [Formula 5]

,

, 및

,

, And

[Chemical Formula 6]

.

.

The diterpene-based compound of Formula 1 may be separated from the flow extract, but is not limited thereto.

The compound may be one having skin regeneration, wrinkle improvement, or moisturizing activity, but is not limited thereto.

In a specific embodiment of the present invention, the present inventors obtained by purifying the compound of Formula 1 by chromatographic fractionation method from the extract prepared from the flow fruit and analyzed the structure (see Formula 2 to Formula 6).

Therefore, the diterpene-based compound of Formula 1 according to the present invention acts on blood cells to induce the production of CD44, a cell surface material necessary for blood cells to migrate to skin tissue, and also acts on skin epithelial cells to moisturize. It can prevent or improve skin wrinkles by showing the effect of increasing the production enzyme of hyaluronic acid with efficacy, so that it can prevent or improve skin wrinkles, a pharmaceutical composition for preventing and improving skin aging, a cosmetic composition for preventing and improving skin aging or a health food for preventing and improving skin aging It can be used as an effective ingredient of.

Hereinafter, the present invention will be described in detail with reference to Examples, Experimental Examples and Preparation Examples.

However, the following Examples, Experimental Examples and Preparation Examples are merely illustrative of the present invention, and the content of the present invention is not limited by the following Examples, Experimental Examples and Preparation Examples.

< Example  1> Preparation of Flow Extract

Flow Extracts from Aleurites from the buds of fordii ) according to the already reported protocol (Bioorganic & Medicinal Chemistry Letters, Volume 22, Issue 6, 15 March 2012, Pages 2318-2320). Briefly, a liquid methanol extract was prepared by extracting 2.9 kg of dried dried buds of Jeju, Seogwipo, with 4 liters of 100% methanol (SK Chemicals, Korea). The yield of the flow methanol extract obtained through the above procedure was 449.6 g.

< Example  2> of flow extract Fraction  Produce

The <Example 2> of the flow of methanol, respectively 96.3, 53.9 and 85.9 g of extract is suspended in water, 1.5 liter, n - hexane (n -hexane), chloroform (CHCl ₃₎ and the ethyl acetate (EtOAc) each Extraction was continued using 1.5 liters of solvent. Through the above examples, 27.6 g of n -hexane fraction, 28 g of chloroform fraction, and 80 g of ethyl acetate fraction were obtained.

< Example  3> from flow extract Diterpene  Isolation and Purification of the Compound

<3-1> Overall Experimental Process

Optical rotation was measured with a Jasco P2000 polarimeter (Jasco corporation, Japan). UV data were obtained on a UV-VIS spectrometer 2400 (Shimadzu Co. Ltd., Japan), and NMR spectra were recorded on a Varian UNITY 400 (Varian, Inc., Palo Alto, CA) using tetramethylsilane as an internal standard. It was. HRESIMS was performed on a Waters Q-Tof Premier spectrometer (Micromass UK Ltd., Manchester, UK) spectrometer. Silica gel (230-400 mesh, SiliCycle Inc., Quebec, Canada), RP-C18 (Cosmosil 75C18-PREP, Kyoto, Japan), Sephadex LH-20 (25-100 μm, Sigma-Aldrich, Steinheim, Germany) Column chromatography was performed using. TLC was performed on precoated Kiesel-gel 60 F254 (0.25 mm, Merck, Darmstadt, Germany) and Kiesel-gel 60 RP-18F254s (0.25 mm, Merck, Steinheim, Germany).

<3-2> Extraction and Separation

2.9 kg of the leaves dried in air were pulverized and extracted with MeOH three times at room temperature to obtain 449.6 g of solid extract. The MeOH extract was suspended in H ₂ O and then partitioned successively with n-hexane, EtOAc, and n-BuOH to give 96.3 g, 53.9 g and 85.9 g of residue, respectively. The hexane extract was found to have greater IFN-γ inducing activity than other solvent extracts. Thus, the hexane extract was subjected to column chromatography (CC) on silica gel (230-400 mesh) using hexane / EtOAc (50: 1-1: 5) as eluent, followed by CHCl ₃ / MeOH (10: 1- Silica gel column chromatography was performed again using 1: 1) to obtain 38 fractions (LH1-LH38). Were mixed together appears to be similar to the active fraction LH30 and LH31 is on the TLC chromatogram, then, MeOH-H ₂ O (45:55 to 90:10) RP-C18 (75C ₁₈ using a stepwise gradient eluant of a mixture - Chromatography was performed on a medium pressure liquid chromatography (MPLC) column of PREP) to obtain 21 subfractions (LH3031-1 to LH3031-21). Further silica gel column chromatography was performed on the fraction LH3031-20 (30 mg) using hexanes / EtOAc (2.5: 1) to give compound 3 (2.6 mg) and compound 4 (13 mg). Fractions LH3435, a combination of active fractions LH34 and LH35, were subjected to silica gel column chromatography using CHCl ₃ / MeOH (50: 1, 20: 1) to give subfractions LH3435-1 to LH3435-11. Subfraction LH3435-7-1 was further fractionated using Sephadex LH20 column chromatography using hexane / CH ₂ Cl ₂ / MeOH (10: 10: 1) as eluent for fraction LH3435-7 (1.2 g). To LH3435-7-8. LH3435-7-2 (784 mg) was then chromatographed again on silica gel column chromatography using a gradient solvent of CHCl ₃ / acetone (5: 1, 4: 1) to give compound 2 (39.8 mg) And compound 5 (278 mg). Sephadex LH20 column chromatography was performed on the fraction N3435-3 (50.1 mg) using hexanes / CH ₂ Cl ₂ / MeOH (10: 10: 1) as eluent to give four subfractions LH3435-3-1 to LH3435. -3-4 was obtained. Then LH3435-3-2 (30 mg) was subjected to thin layer chromatography (PLC) using CHCl ₃ / acetone (2: 1) to obtain LH-3-2-P, and preparative HPLC (C18, 5um, 92% ACN) was further purified to give compound 6 (6.0 mg).

<3-3> Compound Identification

Compound 2 was isolated as a white amorphous solid. The molecular ion peak of 673.3953 [MH] ⁻ shown in its high resolution electrospray ionization mass spectrum (HRESIMS) confirmed the molecular formula to be C ₃₈ H ₅₈ O ₁₀ (Formula 2). The ¹ H, ¹³ C and DEPT spectra of Compound 2 show two double bonds, four carbonyl groups, five methyl groups, two oxygenated methylene groups, five methyl groups and four quaternary carbons (three oxygenated) (Formula 3 to Formula 5). The large broad peak of δ _H 1.24 of the 1H spectrum showed the presence of long chain units of carbon in this compound. In the HMBC spectrum, the olefin proton δ _H of 6.86 (H-5) is the oxygenated carbon of δ _C 61.3 (C-20) and the two carbonyl groups of δ _C 205.1 (C-3) and 202.6 (C-7) Another olefin proton δ _H of 7.61 (H-1) resonated with a methyl group of 10.6 (C-19) and a carbonyl group of 205.1 (C-3). This indicates that there are two α, β-unsaturated ketone backbones in these compounds and that they are not far from each other. There is also a signal between δ _H 3.83 (H-16) and δ _C 18.4 (C-17), but two singlet protons, C-14, in which the proton is a doublet, and C-15 (quaternary carbon) ), Respectively. This indicates that such carbon constitutes a gem-disubstituted-cyclopropane moiety. In addition, two carbonyl groups were shown at δ _C 173.5 and 174.4. The first peak correlated with protons of δ _H 5.45 (H-12), δ _H 2.30 and 1.60, while the second peak showed the possibility of contact with the singlet methyl of δ _H 2.15 (H-22). It was. This suggests that the carbon of δ _C 174.4 belongs to an acetate group, and the other is a component of the 16-carbon ester chain estimated from mass spectroscopy. The HMBC (H → C) correlation and the COSY (HH) correlation of the compound 2 are shown in Chemical Formula 6.

From the above data, the carbon skeleton of Compound 2 was identified as a pobol -type diterpene ( Pimelea) some similar to 12- O -decanoylpobol-13-acetate (Patricia YH et al., J. Nat . Prod . , 2010, 73, 1907-1913) derived from elongata ). All signals in ¹ H and ¹³ C-NMR of compounds 2 and 3 were similar except that hydroxymethylene (C-16) was present in compound 2 instead of the methyl signal of compound 3. Based on these points, it was confirmed that the structure of Compound 2 was 12- O -hexadecanoyl-7-oxo-5-ene-16-hydroxypobol-13-acetate.

Compound 3 was obtained as a colorless oil. This molecular formula C ₃₈ H ₅₈ O ₉ molecular ion of m / z 657.3969 corresponding to [MH] In HRESIMS ^- are shown. Compared to compound 2, the ¹ H and ¹³ C NMR data of compound 3 were the same as that of compound 2, except that C-16 was replaced by hydroxymethylene instead of methyl group. Therefore, it was found that the structure of compound 3 was 12- O -hexadecanoyl-7-oxo-5-ene-pobol-13-acetate. It has previously been reported as a compound isolated from Sapium sebiferum (Ohigashi H. et al., Agri . Bio . Chem . , 1983, 7, 1617-1622), but its characteristics have not been reported. .

Compound 4 was obtained as a colorless oil. This showed a molecular ion peak [MH] ⁻ of m / z 643.4244 corresponding to the molecular formula C ₃₈ H ₆₀ O ₈ in HRESIMS. The ¹ H and ¹³ C-NMR signals of compound 4 were consistent with the literature NMR data of 12- O- decanoylpobol-13-acetate except for the difference in 16-carbon ester chains identified by mass spectrometry. Therefore, compound 4 was found to be 12- O -hexadecanoyl-pobol-13-acetate.

Compound 5 was isolated as a white amorphous powder. This showed a molecular ion peak [MH] ⁻ of m / z 659.4143 corresponding to molecular formula C ₃₈ H ₆₀ O ₉ in HRESIMS. The ¹ H and ¹³ C NMR spectra of compound 5 contained signals substantially the same as that of compound 4, except that the methyl group at C-16 was replaced by hydroxymethylene. Therefore, the structure of compound 5 was found to be 12- O -hexadecanoyl-16-hydroxypobol-13-acetate.

Compound 6 was obtained as a colorless oil. This showed a molecular ion peak [M + FA-H] ⁻ of m / z 689.4296 corresponding to molecular formula C ₃₈ H ₆₀ O ₈ in HRESIMS. The signals in its ¹ H and ¹³ C NMR spectra were consistent with the signals of compound 5 except that the oxygenated quaternary carbon of δ _C 73.1 (C-4) was reduced to tertiary carbon of δ _C 49.5. ^{In the 1} H- ¹ H Cozy Spectrum (Formula 6), the protons of δ _H 2.78 (H-4) correlated with the protons of δ _H 3.51 (H-10), between C-4 and H1, H5. There was a cross-peak. Therefore, the structure of compound 6 was found to be 12- O -hexadecanoyl-4-deoxy-4α-16-hydroxypobol-13-acetate.

The structures (compounds 2 to 6), physicochemical characteristics and spectroscopic data of compounds 2 to 6 are shown below:

(2)

12- O - hexadecanoyl- 7-oxo-5-ene-16 -hydroxypobol- 13-acetate (2): white amorphous solid; [α] ²⁰ _D + 10.7 ° (c 1.68, CHCl ₃ ); UV (EtOH); λ max (log ε) 222 (2.84) nm; ¹ H and ¹³ C NMR data, see Table 1 and Table 2 below; HRESIMS m / z 673.3953 [M ⁻ H] ⁻ (calcd for C ₃₈ H ₅₇ O ₁₀ , 673.3952),

(3)

12- O - hexadecanoyl- 7-oxo-5-ene-pobol-13-acetate (3): colorless oil; [α] ²⁰ _D + 41.5 ° (c 0.11, CHCl ₃ ); UV (EtOH); λ max (log ε) 221 (2.46) nm; ¹ H and ¹³ C NMR data, see Table 1 and Table 2 below; HRESIMS m / z 657.3969 [M ⁻ H] ⁻ (calcd for C ₃₈ H ₅₇ O ₉ , 657.4003),

[Chemical Formula 4]

12- O - hexadecanoyl -pobol-13-acetate (4): colorless oil; [α] ²⁰ _D + 42.6 ° (c 0.21, CHCl ₃ ); UV (EtOH); λ max (log ε) 202 (3.22), 228 (1.80) nm; ¹ H and ¹³ C NMR data, see Table 1 and Table 2 below; HRESIMS m / z 643.4244 [M ⁻ H] ⁻ (calcd for C ₃₈ H ₅₉ O ₈ , 643.4210),

[Chemical Formula 5]

12- O - hexadecanoyl- 16 -hydroxypobol- 13-acetate (5): amorphous white powder; [α] ²⁰ _D + 61.06 ° (c 0.34, CHCl ₃ ); UV (EtOH); λ max (logε) 203 (3.32), 227 (1.92) nm; ¹ H and ¹³ C NMR data, see Table 1 and Table 2 below; HRESIMS m / z 659.4143 [M ⁻ H] ⁻ (calcd for C ₃₈ H ₅₉ O ₉ , 659.4159), and

[Chemical Formula 6]

12- O - hexadecanoyl- 4 - deoxy-4α-16 -hydroxypobol - 13-acetate (6): colorless oil; [α] ²⁰ _D -7.6 ° (c 0.45, CHCl ₃ ); UV (EtOH); λ max (log ε) 232 (2.62) nm; ¹ H and ¹³ C NMR data, see Table 1 and Table 2 below; HRESIMS m / z 689.4296 [M ⁻ H] ⁻ (calcd for C ₃₉ H ₆₁ O ₁₀ , 689.4265).

In addition, ¹ H-NMR (400 MHz, CDCl ₃ ) and ¹³ C-NMR (100 MHz, CDCl ₃ ) data of the compounds 2 to 6 are shown in Tables 1 and 2, respectively.

< Example  4> Cell Culture

Cultivation of human cell lines (K562, CRL2076) was performed under humidified conditions of 37 ° C., 5% CO ₂ . Blood cell lines K562 (human lymphoma), U937 (ATCC (Rockville, MD)), HMC-1 (from Dr. J. Butterfield (Mayo Clinic, Rochester, MN)) and epidermal epithelial cells CRL2076 and Hacat Human keratinocytes were purchased from the American Type Culture Collection, Rockville, MD. In addition, K562 cells, U937, HMC and CRL2076, Hacat cells were 10% elegant serum (Fetal Calf Serum, FCS) (HyClone, Logan, UT), 2 mM L-glutamate, 100 μg / ml penicillin, 100 μg / ml streptomycin (Life Life Technologies, DMEM, including Karlsruhe, Germany) medium.

< Experimental Example  1> by flow extract CD44 Confirmation of expression of

<1-1> RT - PCR By flow extract through CD44 of mRNA  Confirmation of expression

Flux extract was treated with K562, U937, HMC cells and epithelial cells A549, CRL2076 cells to express the mRNA expression and protein of CD44 protein required for recruitment of blood (immune) cells into epidermal epithelial tissue. The degree of expression was confirmed.

Specific RT-PCR method is as follows. Total RNA was isolated according to standard protocol and cDNA was synthesized using AccuScript High Fidelity 1 ^st Strand cDNA Synthesis Kit (Stratagene) according to manufacturer's instructions. Two-step RT-PCR reaction was performed using oligo-dT primers and reverse transcriptase, specific primer pairs and Taq polymerase (Takara, Shiga, Japan) as follows. Synthesized 1 μl cDNA was diluted in 20 μl mixture consisting of 0.5 U ExTaq DNA polymerase, 1 × buffer and 1 mM dNTP mix (Takara) and specific primer pairs, and the diluted cDNA mixture was PCR Used for reaction. Amplification by PCR reaction was performed using GeneAmp PCR system 2700 (Applied Biosystems, Foster city, CA, USA) under the following conditions; After 25-40 cycles of 5 minutes at 94 ° C, followed by 45 seconds at 94 ° C, 45 seconds at 56 ° C and 1 minute at 72 ° C, the final extension reaction was carried out at 72 ° C for 7 minutes. PCR primers in Table 3 were designed using the Primer3 program, and were purchased from Bioneer (Korea, Daejeon).

Primers used for cDNA amplification by PCR designation Forward Reverse GAPDH CCATCACCATCTTCCAGGAG ACAGTCTTCTGGGTGGCAGT CD44 AGATCAGTCACAGACCTGCC GCAAACTGCAAGAATCAAAGCC

PCR products were separated on 1.5% agarose gel and stained with ethidium bromide (EtBr) and visualized with Gel Doc 2000 UV trans-illuminator (Bio-Rad Laboratories, Hercules, CA, USA), followed by Quantity One software (Bio-Rad Laboratories) was used for analysis. Each sample was tested three or more times and representative data were presented.

The flow extract was treated with blood cells K562, U937, HMC cells and epithelial cells A549, CRL2076 cells. As a result, mRNA of CD44-labeled protein required for the recruitment of blood (immune) cells into epidermal epithelial tissues in each cell was obtained. It was confirmed that expression increased when the flow extract was treated (FIG. 2A).

<1-2> FACS ( Fluorescence Activated Cell Sorting By flow extract through CD44 Confirmation of Protein Expression

Flow extracts were treated to blood cells K562, U937, HMC cells and epithelial cells A549, CRL2076 cells to inhibit the expression level of CD44 marker protein required for recruitment of blood (immune) cells into epidermal epithelial tissue. CD44 antibody ((Harlan SeraLab, Sussex, UK) and FACS were identified. Specific FACS method is as follows. Aldehyde immobilized, incubated with anti-CD44-FITC antibody for 1 hour and stained and analyzed using FACScan flow cytometer (Becton Dickinson, San Jose, Calif.).

As a result of analyzing the surface protein by FACS, it was confirmed that the expression of CD44 protein was also increased in K562 cells and A549 cells (FIG. 2B).

< Experimental Example  2> RT - PCR By flow extract through HAS -2 transcription induction confirmation

In order to determine the mRNA level associated with the production of hyaluronic acid synthase 2 (HAS-2) in epidermal epithelial cells, CRL2076 and Hacat, the RT-PCR method of Experimental Example 1 was used. Was performed. The CRL2076 and Hacat cells were incubated with 1 μg / ml flow extract for 15 hours. Subsequently, RNA was isolated after lysing the cells according to known protocols. CDNA was prepared using reverse transcriptase with poly A + primer for RNA. Primers designed for CD44, HAS-2 were used for PCR amplification (Table 4). GAPDH was used as internal standard.

Primers used for cDNA amplification by PCR designation Forward Reverse GAPDH CCATCACCATCTTCCAGGAG ACAGTCTTCTGGGTGGCAGT HAS-2 CGCAGTGTGGCGCTGACCAT CCTACCCGGGGGTCCTCGTC

As a result, it was confirmed that HAS-2 production was induced in epidermal epithelial cells CRL2076 and Hacat (FIG. 3). In addition, the production of HAS-2 in the epithelial cells began to increase at a concentration of 0.5 ㎍ / ml, and showed an increase in transcriptional activity 1 hour after treatment (Fig. 3A, B and C).

< Experimental Example  3> Processing concentration and time of flow extract K562 In a cell CD44 MRNA expression and protein expression level

Using the RT-PCR method of <Experimental Example 1-1> and the FACS method of <Experimental Example 1-2> to confirm the mRNA expression and protein expression level of CD44 in K562 cells according to the treatment concentration and treatment time of the flow extract It was.

As a result, CD44 increase in K562 cells was also strong in the flow extract 0.1 ㎍ / ml (Fig. 4A), and the transcript began to increase after 3 hours, and after 12 hours, the maximum transcription activity was confirmed. (FIG. 4B). Analysis of surface protein changes in FACS, CD44 protein expression was confirmed to show the same aspect (Fig. 4C).

< Experimental Example  4> Skin improvement effect analysis in mouse

The rats used in the experiment were purchased from a central laboratory animal (Korea) and reared without dietary restriction for adaptation, and then normal 5 week old male Balb / C mice (mouse) were also reared in the control environment in the same environment. After attempting to strapping and artificially causing some skin damage, we analyzed the regeneration and skin elasticity of the skin by treating the flow extract. At this time, the mice per group were tested in two replicates of 10 animals.

As a result, it was reduced to normal skin within a short time and at the same time confirmed the elasticity and shine of the skin. In the above experiments, the flow extract induces the activity of skin cells and promotes the production of hyaluronic acid, a kind of extracellular matrix (ECM) of skin tissue, thereby inhibiting wrinkles of the skin and preventing wrinkles. It was confirmed that the excellent effect of inducing the activity of the skin (Fig. 5).

< Manufacturing example  1> Manufacture of Pharmaceuticals

One. Sanje  Produce

Flow extracts, fractions thereof or diterpene compounds isolated therefrom

                                                              500 ng

Lactose 1 g

The above components were mixed and packed in airtight bags to prepare powders.

2. Preparation of tablets

Flow extracts, fractions thereof or diterpene compounds isolated therefrom

                                                              500 ng

Corn starch 100 mg

Lactose 100 mg

2 mg of magnesium stearate

After mixing the above components, tablets were prepared by tableting according to a conventional method for producing tablets.

3. Preparation of Capsule

Flow extracts, fractions thereof or diterpene compounds isolated therefrom

                                                              500 ng

Corn starch 100 mg

Lactose 100 mg

2 mg of magnesium stearate

After mixing the above components, the capsules were filled in gelatin capsules according to the conventional preparation method of capsules.

4. Preparation of injections

Flow extracts, fractions thereof or diterpene compounds isolated therefrom

                                                              500 ng

Mannitol 180 mg

Na ₂ HPO ₄ 2H ₂ O 26 mg

Distilled water 2974 mg

According to a conventional method for preparing an injection, an injection was prepared by containing the above components in the contents shown.

< Manufacturing example  2> Manufacture of health food

1. Manufacture of health food

Flow extracts, fractions thereof or diterpene compounds isolated therefrom

                                                              500 ng

Vitamin mixture quantity

70 μg of Vitamin A Acetate

Vitamin E 1.0 mg

0.13 mg of vitamin

Vitamin B2 0.15 mg

Vitamin B6 0.5 mg

0.2 μg of vitamin B12

Vitamin C 10 mg

10 μg biotin

Nicotinic Acid 1.7 mg

Folic acid 50 mg

Calcium Pantothenate 0.5mg

Mineral mixture

Ferrous Sulfate 1.75 mg

Zinc Oxide 0.82 mg

Magnesium carbonate 25.3 mg

Potassium monophosphate 15 mg

Dibasic calcium phosphate 55 mg

Potassium Citrate 90 mg

Calcium Carbonate 100 mg

24.8 mg of magnesium chloride

Although the composition ratio of the above-mentioned vitamin and mineral mixture is comparatively mixed with a composition suitable for health food as a preferred embodiment, the compounding ratio may be arbitrarily modified, and the above ingredients are mixed according to a conventional method for producing healthy foods , Granules can be prepared and used in the manufacture of health food compositions according to conventional methods.

2. Manufacture of health drinks

Flow extracts, fractions thereof or diterpene compounds isolated therefrom

                                                              500 ng

Citric acid 1000 mg

100 g oligosaccharides

Plum concentrate 2 g

1 g of taurine

Purified water was added to a total of 900 ml

After mixing the above components according to the conventional method for preparing a healthy beverage, and then stirred and heated at 85 ℃ for about 1 hour, the resulting solution is filtered and obtained in a sterilized container, sealed sterilization and refrigerated and then stored in a healthy beverage composition Used for preparation.

Although the composition ratio is mixed with a component suitable for a preferred beverage in a preferred embodiment, the composition ratio may be arbitrarily modified according to regional and ethnic preferences such as demand hierarchy, demand country, and usage.

< Formulation example  3> Cosmetics  Preparation of the composition

1. Preparation of Cream

Cetostearyl alcohol 2.8 parts by weight

2.6 parts by weight of beeswax

Stearic acid 1.4 parts by weight

2 parts by weight of glycerol phosphate monostearate

Fiji-100 Stearate 1 part by weight

Sesquioleate sorbitan 1.4 parts by weight

4 parts by weight of jojoba oil

Squalane 3.8 parts by weight

Polysorbate 60 1.1 parts by weight

2 parts by weight of macadamia oil

Tocopherol acetate 0.2 parts by weight

0.4 parts by weight of methylpolysiloxane

0.1 parts by weight of ethyl paraben

0.1 parts by weight of propylparaben

Euxyl K-400 0.1 part by weight

1,3-butylene glycol 7 parts by weight

Methyl paraben 0.05 parts by weight

Glycerin 6 parts by weight

0.2 parts by weight of d-pandenol

Flow extracts, fractions thereof or diterpene compounds isolated therefrom

                                                4.6 parts by weight

0.2 parts by weight of triethanolamine

pt 41891 0.2 parts by weight

pH ₂ O 46.05 parts by weight

2. Preparation of Lotion

Cetostearyl alcohol 1.6 parts by weight

Stearic acid 1.4 parts by weight

Lipophilic monostearic acid 1.8 parts by weight

Fiji-100 Stearate 2.6 parts by weight

0.6 parts by weight of sesquioleate sorbate

4.8 parts by weight of squalene

2 parts by weight of macadamia oil

2 parts by weight of jojoba oil

Tocopherol Acetate 0.4 parts by weight

0.2 parts by weight of methylpolysiloxane

0.1 parts by weight of ethyl paraben

0.1 parts by weight of propylparaben

1,3-butylene glycol 4 parts by weight

0.1 parts by weight of methyl paraben

Xanthan Gum 0.1 parts by weight

Glycerin 4 parts by weight

0.15 parts by weight of d-pandenol

Allantoin 0.1 part by weight

Flow extracts, fractions thereof or diterpene compounds isolated therefrom

                                                3.5 parts by weight

4 parts by weight of carbomer (2% aq.Sol)

0.15 parts by weight of triethanolamine

3 parts by weight of ethanol

pt 41891 0.1 parts by weight

pH ₂ 0 48.3 parts by weight

Claims (15)

A pharmaceutical composition for preventing and improving skin aging containing a flow extract or a fraction thereof as an active ingredient.
The method of claim 1, wherein the extract is water, lower alcohol of C ₁ to C ₂ or a mixture thereof is extracted using a solvent as a solvent, characterized in that the skin aging prevention and improvement pharmaceutical composition.
According to claim 1, wherein the flow extract is a pharmaceutical composition for preventing and improving skin aging, characterized in that the extract obtained from the flow flowers, stems, leaves or berries.
The pharmaceutical composition for preventing and improving skin aging according to claim 1, wherein the fraction is obtained using an organic solvent selected from the group consisting of hexane, chloroform and ethyl acetate.
The pharmaceutical composition for preventing and improving skin aging according to claim 1, wherein the flow extract or a fraction thereof has skin regeneration, wrinkle improvement or moisturizing enhancing activity.
Health food for preventing and improving skin aging containing a liquid extract or a fraction thereof as an active ingredient.
The method of claim 6, wherein the flow extract or fractions thereof Skin aging prevention and improvement health food, characterized in that it has a skin regeneration, wrinkle improvement or moisturizing enhancing activity.
Cosmetic composition for preventing and improving skin aging containing a flow extract or a fraction thereof as an active ingredient.
The cosmetic composition for preventing and improving skin aging according to claim 8, wherein the flow extract or fractions thereof have skin regeneration, wrinkle improvement or moisturizing enhancing activity.
A pharmaceutical composition for preventing and improving skin aging containing a diterpene compound represented by the following Formula 1 or a pharmaceutically acceptable salt thereof as an active ingredient:
[Chemical Formula 1]

(In the formula 1,

Is a single or double bond, wherein

Is neighboring at least one is a single bond,
R 1 is C 1 -C 4 straight or branched alkyl, unsubstituted or substituted with hydroxy,
R 2 is H or hydroxy, and
R 3 is H or O, wherein O is

Is substituted when is a double bond).
The method according to claim 10, wherein the compound represented by the formula (1) is a skin composition for preventing and improving aging, characterized in that one kind selected from the group represented by the following formula (2) to (6):
[Chemical Formula 2] &lt; EMI ID =

,

,
[Chemical Formula 4]

,

, And
[Chemical Formula 6]

.
The pharmaceutical composition for preventing and improving skin aging according to claim 10, wherein the diterpene-based compound of Formula 1 is separated from a flow extract.
The pharmaceutical composition for preventing and improving skin aging according to claim 10, wherein the compound has skin regeneration, wrinkle improvement or moisturizing enhancing activity.
A health food for preventing and improving skin aging containing a diterpene-based compound of Formula 1 or a pharmaceutically acceptable salt thereof as an active ingredient:
[Chemical Formula 1]

(In the formula 1,

Is a single or double bond, wherein

Is neighboring at least one is a single bond,
R 1 is C 1 -C 4 straight or branched alkyl, unsubstituted or substituted with hydroxy,
R 2 is H or hydroxy, and
R 3 is H or O, wherein O is

Is substituted when is a double bond).
A cosmetic composition for preventing and improving skin aging containing a diterpene-based compound of Formula 1 or a pharmaceutically acceptable salt thereof as an active ingredient:
[Chemical Formula 1]

(In the formula 1,

Is a single or double bond, wherein

Is neighboring at least one is a single bond,
R 1 is C 1 -C 4 straight or branched alkyl, unsubstituted or substituted with hydroxy,
R 2 is H or hydroxy, and
R 3 is H or O, wherein O is

Is substituted when is a double bond).

Images