KR20130075760A - Sets of primers and taqman mgb probes for real-time pcr-based assays to discriminate ginseng cultivars - Google Patents

Abstract

PURPOSE: A primer for the ginseng fingerprinting and probe set is quick with the realtime PCR reaction only DNA of the specific base sequence region. It amplifies. And the amplification amount can be quantitively measured. CONSTITUTION: A gene expression analysis set for the ginseng fingerprinting comprises the probe noted in the base sequence of the primer set consisting of the base sequence of the sequence number 5 and sequence number 6 and sequence number 7 to the beak (VIC) and the probe which it is hollowed in the base sequence of the sequence number 8 it notes to (FAM). The ginseng species is the cloth [Chunpoong], breeze [Yunpoong], antiquity [Gopoong], autumnal breeze [Kumpoong] or the cyclonic [Sunpoong]. The base sequence of the probe and primer set originates from the ginseng (Panax ginseng C. A. Meyer). The method for quantitively measuring with the realtime PCR analysis method comprises the following steps. The ginseng species gene is quantitively measured with the realtime PCR analysis method. The realtime PCR analysis may use the gene expression analysis set.

Description

Sets of primers and TaqMan MGB probes for real-time PCR-based assays to discriminate ginseng cultivars}

The present invention relates to a set of primers and probes for discriminating ginseng variety by real-time PCR analysis, and more particularly, by gene that can be used to quantitatively measure the specific amplification results of DNA related to ginseng variety discrimination by real-time PCR analysis. It relates to a set of specific primers and probes.

Conventionally, a method that has been traditionally used to measure the expression of a gene is by combining an mRNA isolated from an analysis object with a DNA probe labeled with a radioisotope with complementarity, and comparing the gel image that is sensitized by the radioisotope. Quantitative Northern blotting analysis (Parker and Barnes, 1999) has been the mainstream, but when the amount of mRNA of the target gene expressed by a specific treatment is small, its sensitivity is relatively low, and gene expression between individuals or between treatments It has the disadvantage of not being able to accurately perform quantitative comparisons of amounts (Melton et al., 1984).

In addition, the reverse transcription polymerase chain reaction (RT-PCR), developed with the development of the PCR reaction method, uses mRNA as a template to produce cDNA through PCR-based reverse transcription and measure its relative amplification amount. (Rappolee et al., 1988) has been used as a substitute for the northern blotting method, but it has a disadvantage that requires a lot of time and specialized skills such as cDNA cloning (Bustin, 2000).

Higuchi et al. (1992, 1993) reported that the amplification product obtained by PCR reaction using a DNA primer to obtain the nucleotide sequence of the target gene to be analyzed and very high complementarity and specificity was prepared by using Ethidium bromide or other fluorescent dyes. fluorescent dyes) so that they are intercalated into the double helix structure of the DNA amplification product, and then irradiated with ultraviolet light to detect the colored fluorescence with a CCD camera, and it according to the PCR kinetics model. A system to measure quantitatively was devised. Since then, this method has been called "real-time PCR" (real-time PCR reaction method), an analysis system that can be applied to the detection of specific genes and quantification of mRNA, the primary product of gene expression.

However, this method had a decisive weakness in that the reproducibility or accuracy of the experimental result was degraded because the target gene and the product that reacted nonspecifically were detected together in the PCR process. As an alternative to solving this, Holland et al. (1991) used the DNA cleavage property (5' to 3'exonuclease activity) from the 5'end to the 3'end of Taq DNA polymerase, a polymerase that amplifies DNA in PCR reactions. Thus, by using a labeled probe that specifically binds to the target gene and a pair of PCR primers in the PCR reaction, most of the non-specific products in the conventional real-time PCR reaction are removed, and a method of selectively amplifying only the site of the target gene is developed. I did.

In addition, the development of a "fluorogenic probe" with a 5'-reporter fluorescent dye labeled at the 5'end and a quencher dye that controls it at the 3'end was developed by Lee et al. (1993). A simple real-time PCR reaction method was established, and two fluorescent dyes to be labeled on the fluorogenic probe, SYBR Green I dye and TaqMan MGB probe, were developed by PE Biosystems. Selective detection and quantitative analysis of gene expression levels can be performed more accurately and conveniently in large volumes.

However, there is a disadvantage in that only the gel image of Northern blotting using radioactive isotopes cannot quantify and quantitatively measure the expression levels of the related genes, and this is of course not able to accurately determine the difference in the genes between ginseng varieties. There is a limitation in that it cannot be used in a breeding program to nurture a new breed because it is directly linked to the inability to find out the difference between individuals within the same species in the amount of gene expression.

In addition, in the literature reported by the present inventors [In & Kim et al (2005), Genetic relationships of Panax species by RAPD and ISSR analyses, Korean Journal of Medicinal Crop Science, 13, 249-253], Korean ginseng variety Cheonpung, Using RAPD and ISSR techniques, the relationship and genetic patterns of Yeonpung, Gopoong, Seonpoong, Geumpung and domestic and overseas collection species Jagyeongjong, Hwangsukjong, Mimaki, Seokjusam, Jukjeolsam ( P. japonicus ), and American ginseng were investigated using RAPD and ISSR techniques. Analysis was performed, but when these techniques were used, it was difficult to distinguish between varieties.

These results are characteristic of the technique using random primers, and the reproducibility of the experimental results is low, and even if polymorphism is found between varieties, the acquisition of genetic information is limited, so it is suitable to be used as a marker for varieties that need to secure discrimination, reproducibility and stability. There is a problem that has not been done.

Other literature [Yang et al (2001), Comparison of ITS and 5.8S rDNA sequences among varieties and cultivars in Panax ginseng , Journal of Photoscience, 8, 55-60] compared and analyzed the ITS and 5.8S rDNA sequences of Korean ginseng varieties Cheonpung, Yeonpung, and collection species Jagyeong, Cheonggyeong, and Hwangsuk. It was said to represent single nucleotide polymorphism.

Meanwhile, in the literature of the present inventors [Kim & Bang et al (2007), Molecular authentication of ginseng cultivars by comparison of internal transcribed spacer and 5.8S rDNA sequences, Plant Biotechnology Report, 1, 163-167], the Korean ginseng variety Cheonpung , Yeonpung, Gopoong, Seonpung, Geumpung and domestic and overseas collection species Jagyeongjong, Hwangsukjong, Mimaki, Seokjusam, Jukjeolsam, and American ginseng ITS and 5.8S rDNA nucleotide sequence and the restriction enzyme TaqⅠ that recognizes polymorphic sites in single nucleotide sequence As a result of comparative analysis of the genetic patterns, it was reported that only Gopoong and Geumpoong were distinguished from other varieties and domestic and foreign collected species.

However, these methods alone had a disadvantage that it was difficult to clearly distinguish the developed ginseng varieties.

Korean Patent Registration No. 10-0215084 discloses a method for determining the origin of Korean ginseng by RAPD mark and a primer used for the method, and Korean Patent Publication No. 2004-0034331 discloses a method for using a single base polymorphism of wild ginseng and cultivated ginseng. A method of discrimination is disclosed, and Korean Patent Registration No. 10-0610312 discloses a kit for discriminating genes between species of ginseng, but is different from the primer set of the present invention.

On the other hand, in the method of using a DNA marker, which is one of the molecular biology techniques used to classify varieties of ginseng, first, DNA must be extracted from a target sample and the extracted DNA must be quantified. Then, PCR is performed using a specific primer capable of amplifying the target DNA, and the target DNA fragment is amplified. After electrophoresis is performed to stain ethidium bromide, the DNA band for each variety should be checked with a UV transilluminator. do.

In particular, in order to search for polymorphism (SNP) of a single nucleotide sequence, PCR is performed to amplify the desired DNA fragment, and then the amplification product is additionally treated with a restriction enzyme and electrophoresis is performed to confirm whether the variety is distinguished. Another method of searching for polymorphism of a single nucleotide sequence is to check the difference between varieties by comparing and analyzing the nucleotide sequences between the obtained varieties after performing nucleotide sequencing analysis of the PCR amplified product through a gene cloning process.

In contrast, the real-time PCR method can omit restriction enzyme treatment, electrophoresis, and sequencing processes in the above process, and the results can be checked in real time during the PCR process, so it is faster, safer, and more accurate than conventional analysis methods.

Therefore, a probe and primer for amplifying a target DNA fragment by real-time PCR as in the present invention and a probe and primer as a control to be used for the relative quantitative measurement of the target DNA to be analyzed must be developed to activate research between ginseng varieties. I can.

Accordingly, an object of the present invention is to provide a set of specific primers and probes for amplifying DNA fragments related to ginseng variety discrimination by real-time PCR analysis.

Another object of the present invention is to provide a method for quantitatively measuring a target DNA fragment related to ginseng variety identification by a specific real-time PCR analysis method.

In order to achieve the above object, the present invention provides a set of specific primers and probes for amplifying a DNA fragment of interest related to the identification of ginseng varieties by real-time PCR analysis.

The present invention provides a method for quantitatively measuring a target DNA fragment related to ginseng variety identification by a specific real-time PCR analysis method.

Hereinafter, the present invention will be described in detail.

The present invention has a technical feature to provide a specific primer pair and a nucleotide sequence of a probe necessary to measure a DNA fragment significantly amplified in a ginseng variety, specifically, 5 varieties of Korean ginseng, by real-time PCR analysis. In particular, in ginseng varieties, specific DNA fragments are subjected to nucleotide sequence analysis, and specific regions of these DNA fragments can be established as primers and probes, which can be used for quantitative analysis of gene expression based on real-time PCR reactions.

At this time, the species belonging to the five Korean ginseng species may be Chunpoong, Yunpoong, Gopoong, Kumpoong, or Sunpoong, and the primer pair and probe for ginseng variety identification of the present invention The base sequence is Panax ginseng CA Meyer).

The present invention provides a method of quantitatively measuring the amplification amount of a specific DNA fragment by real-time PCR analysis.

In the above, the real-time PCR analysis is preferably quantitatively measured by a real-time PCR analysis method using a primer pair or a probe capable of confirming the amplification amount of the DNA fragment.

At this time, three pairs of primers including sense primers and antisense primers were prepared as the primers, and VIC or FAM was attached as a reporter at the 5'end of the fluorescent probe, and both TaqMan MGB probes and MGB-NFQ were attached to the 3'direction. (See Table 2).

In the above quantitative measurement by real-time PCR analysis, in order to quantitatively calculate the relative amplification amount, in the case of PGP74, the primer set consisting of the nucleotide sequences of SEQ ID NOs: 1 and 2 and the nucleotide sequences of SEQ ID NOs: 3 and 4 are VIC or PAM ( It is preferable to use a gene expression analysis set consisting of probes labeled with FAM), and in the case of PGP110, a primer set consisting of the nucleotide sequences of SEQ ID NOs: 5 and 6 and VIC or FAM (FAM) in the nucleotide sequence of SEQ ID NO: 7,8 It is preferable to use a gene expression analysis set consisting of probes labeled with.

In addition, in the case of PGP130, it is preferable to use a specific DNA amplification analysis set consisting of a primer set consisting of the nucleotide sequences of SEQ ID NOs: 9 and 10 and a probe labeled with VIC or FAM on the nucleotide sequences of SEQ ID NOs: 11 and 12. Do.

The present invention rapidly and accurately amplifies only the target DNA amplified from the above-described DNA fragment by real-time PCR reaction among a plurality of total DNA extracted from ginseng leaves using the primer and probe set, and quantitatively Can be measured.

Accordingly, primers and probe sets for amplifying a target DNA fragment related to ginseng variety discrimination by real-time PCR analysis according to the present invention can be directly or indirectly applied and utilized not only in the research field but also in the field of variety development. If necessary, a kit comprising the specific DNA amplification assay set may be prepared.

The present invention provides a method for quantitative analysis by real-time PCR analysis to amplify the DNA fragments of interest related to discrimination in ginseng varieties, especially 5 Korean ginseng varieties, to quantitatively analyze the amplification results of DNA fragments for each variety by real-time PCR reaction. A set of specific primers and probes for each variety used can be provided.

According to the present invention, the primer and probe sets rapidly and accurately amplify only the DNA of the specific nucleotide sequence region described above by a real-time PCR reaction among a plurality of total DNAs extracted from the leaves of the ginseng variety, and quantitatively Because it can be measured, it is possible to clearly distinguish 5 varieties of ginseng. Therefore, it can be used as a variety guarantee indicator for the protection of intellectual property rights of each variety. In addition, as it can be used as a nucleic acid labeling factor for cultivar guarantee, it will be of great help in exercising external intellectual property rights of excellent domestic cultivar developers and distributors.

In addition, it can be used as a base technology for correcting the confusion in the distribution market that can be caused by foreign ginseng in the production of mixed varieties and processed products during ginseng cultivation, and it is possible to increase the genetic stability (purity) of the variety during ginseng breeding. As it can be used, it can be used in projects that supply high-purity seeds to farmers by preventing the mixing of varieties.

1 is a graph showing the results of searching for single base sequence mutations (SNP-A or ANP-G) of 5 varieties of ginseng using the PGP74 probe combination of Table 2.
FIG. 2 is a graph showing the results of searching for single base sequence mutations (SNP-A or ANP-G) of 5 varieties of ginseng using the PGP110 probe combination of Table 2. FIG.
3 is a graph showing the results of searching for single base sequence mutations (SNP-A or ANP-G) of 5 varieties of ginseng using the PGP130 probe combination of Table 2.

The present invention will be described in more detail through the following examples. However, these examples are for explaining the present invention in more detail, and the scope of the present invention is not limited to the matters presented in the examples according to the gist of the present invention.

Example 1: Preparation of ginseng sample and DNA Separation

Target materials were selected from five varieties of Ginseng, Chunpung, Yeonpung, Gopung, Geumpung, and Seonpung, grown in the Ginseng Division of the National Institute of Horticultural Science and Technology of the Rural Development Administration.

The materials used in the experiment were collected by 5 specimens per cultivar by first grasping the morphological characteristics of the above-ground part with the help of a breeding expert of the Ginseng Specialty Department. It was stored separately in Korea Medicinal Herbarium.

In order to define a pair of probes and primers for each gene by real-time PCR analysis in the gene, three-year-old leaves are collected and washed to secure genomic DNA of ginseng, then quenched with liquid nitrogen, ground using a mortar, and then QIAGEN DNA was isolated using the company's DNeasy plant mini kit.

The isolated DNA was subjected to electrophoresis with λDNA on a 1% agarose gel, and then stained with EtBr (Ethidium Bromide), and the concentration was measured by comparing the brightness of the DNA band in UV light. Each DNA sample for which the concentration measurement was completed was used in the PCR reaction by adjusting the final DNA concentration to 10 ng/µl using sterile neutral water.

Example 2: PCR And electrophoresis analysis

The PCR reaction was performed on 5 varieties of ginseng using three pairs of STS primers of UGFp74, MFGp110A, and MFGp130A disclosed in Application No. 10-2008-0080459 previously filed by the present inventors.

For reference, the three pairs of STS primer combinations are shown in Table 1 below:

primer Sequence (5'-3') Sequence number in patent document Tm(℃) One
KGY+0130A
F-GGAAAGCGTTCAGCTCTTACG One 65
R-TAAATGCTGTCAAGCCCAGAG 2 2
KGY+0110A
F-AGTCCCAACGGAATTTCATC 5 65
R-GTTTTCCGCTTATGTTGCAG 6 3
KGY-0074
F-GCGAATTTCACAGAATTAGACG 7 65
R-ACAGGTCTCGAAACAATTGAAG 8

Meanwhile, the composition of the PCR reaction mixture (25 μM) performed to observe polymorphism between ginseng varieties is as follows: 50 ng of genomic DNA of ginseng, 20 pM of each primer, 200 μM of dNTP, 0.5 unit DNA polymerase, 1XPCR reaction buffer ( Solgent, Korea) was used.

The PCR reaction using this was repeated at a total of 40 cycles after initial denaturation at 94°C for 5 minutes using TProfessional (Biometra, Germany), then denatured at 94°C for 1 minute, binding at 60°C for 1 minute, and elongation at 72°C for 1 minute, and finally The final elongation reaction was performed at 72° C. for 5 minutes. The amplified PCR product was electrophoresed on 1.5% agarose, stained with EtBr, and the genetic pattern between the varieties was confirmed in an image analyzer. After gene cloning of the PCR products for each of the 5 ginseng varieties, the base sequence between the varieties was determined. Comparative analysis was performed.

As a result, PCR was performed using the MFGp130 primer, and DNA fragments of 375bp size were observed for the three varieties of Chunpoong, Gopoong, and Geumpoong, and DNA fragments of 322bp size were observed for Yeonpung and Seonpoong.

In addition, when two kinds of primers, UFGp74 and MFGp110A, were used, DNA fragments of the same size of 639bp and 930bp were observed, respectively. Meanwhile, DNA fragments obtained through the above process were subjected to gene cloning and nucleotide sequence comparison analysis.

As a result, when using the MFGp130 primer, it was confirmed that 53bp was inserted/deleted, and there was a mutation in one nucleotide sequence. In addition, when the MFGp74 primer was used, two nucleotide sequence mutations were confirmed, and when MFGp110A was used, it was confirmed that there were mutations in six nucleotide sequences.

Example 3: Use of real-time gene amplification primer And fluorescence Probe making

Primers and fluorescent probes to be used for real-time gene amplification were prepared as targets for regions with variations between varieties using the above nucleotide sequence information. First, three pairs of primers including sense primers and antisense primers were prepared as primers, and VIC or FAM was attached as a reporter to the 5'end of the fluorescent probe, and both TaqMan MGB probes and MGB-NFQ were attached to the 3'direction.

The fluorescent probe and primer combinations used in the present invention are summarized in Table 2 below:

Probe combination name Probes and primers Base sequence (5'→3') PGP74


Probe G VIC-CGTTTAACGAATCCTC-MGB (SEQ ID NO: 3) Probe A FAM-CGTTTAACAAATCCTC-MGB (SEQ ID NO: 4) Primer F GCTCAAGAATCGTCAGATTCTGACT (SEQ ID NO: 1) Primer R CGGAATCCGTTAACTTGAAATTCACTT (SEQ ID NO: 2) PGP110


Probe C VIC-CCTCCCCTAG C TACTCT-MGB (SEQ ID NO: 7) Probe T FAM-CCTCCCCTAGTTACTCT-MGB (SEQ ID NO: 8) Primer F GGCCCTTTCATTCTACAACTCTCAA (SEQ ID NO: 5) Primer R GTCGCCTTGTACCGAGTCAA (SEQ ID NO: 6) PGP130


Probe C VIC-ACCTCTGA C ATCTTG-MGB (SEQ ID NO: 11) Probe A FAM-CCTCTGAAATCTTG-MGB (SEQ ID NO: 12) Primer F GCACCCCCAAAAGGGCTAAA (SEQ ID NO:9) Primer R TCGATAGGTGGCTCCATACGAT (SEQ ID NO: 10)

Example 4: Real-time gene amplification and genotyping analysis

Real-time gene amplification reaction was performed using the ABI Step One Plus System. PCR reaction mixture composition (10ul) 50ng genomic DNA of ginseng, TaqMan ^? Universal master mix 5ul, each primer 300nM, each MGB probe 200nM were used, and the PCR reaction conditions were 60℃ for 30 seconds, 95℃ for 10 minutes, 95℃ for 15 seconds, 60℃ for 1 minute, PCR was performed in two steps of 40 cycles. I did. Genotyping between 5 varieties of ginseng was analyzed using 6 TaqMan MGB probes and 3 pairs of primers under the above PCR conditions.In the PCR reaction, the wild type showed a green signal due to the attachment of VIC dye, and the mutant type was FAM dye was attached and showed a blue signal. After PCR was performed, the results were analyzed using Step One ^TM software ver.2.1 (Applied Biosystems, USA), and the genotype of the ginseng variety was determined through this process.

Figs. 1 to 3 show the results of searching for single base sequence mutations (SNP-A or ANP-G) of 5 varieties of ginseng using the PGP74 probe combination, the PGP110 probe combination, and the PGP 130 probe combination of Table 2, respectively.

As a result, as a result of confirming the genotype of five ginseng varieties using the PGP74 combination, the genotypes of Cheonpung and Seonpung were SNP-A types, and Yeonpung, Gopoong and Geumpung were SNP-G types, and were divided into two groups. In addition, when the PGP110 combination was used, Cheonpung and Gopung were classified into SNP-T types, and Yeonpung, Geumpung, and Seonpung were classified into SNP-C types.

Finally, when the PGP130 combination was used, Cheonpung, Gopung, and Geumpung were classified as SNP-A types, and Yeonpung and Seonpung were divided into SNP-C types.

In conclusion, as shown in Table 3 below, genotypes of the five ginseng varieties using the selected three probe combinations (PGP74, PGP110, PGP130) are'ATA' for Cheonpung,'GCC' for Yeonpung, and'GTA' for Gopoong, Geumpoong represents the genotype of'GCA' and Seonpoong represents the genotype of'ACC.

Probe combination name
Variety/Genotype Heavenly wind Soft wind Archaic Gold wind whirlwind PGP74 A G G G A PGP110 T C T C C PGP130 A C A A C Genotype combination ATA GCC GTA GCA ACC

<110> REPUBLIC OF KOREA(MANAGEMENT: RURAL DEVELOPMENT ADMINISTRATION) <120> Sets of primers and TaqMan MGB probes for real-time PCR-based assays to discriminate ginseng cultivars <130> pp <160> 12 <170> KopatentIn 1.71 <210> 1 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> GCTCAAGAATCGTCAGATTCTGACT <400> 1 gctcaagaat cgtcagattc tgact 25 <210> 2 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> Reverse Primer <400> 2 cggaatccgt taacttgaaa ttcactt 27 <210> 3 <211> 16 <212> DNA <213> Artificial Sequence <220> <223> TaqMan Probe <400> 3 cgtttaacga atcctc 16 <210> 4 <211> 16 <212> DNA <213> Artificial Sequence <220> <223> TaqMan Probe <400> 4 cgtttaacaa atcctc 16 <210> 5 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> Forward Primer <400> 5 ggccctttca ttctacaact ctcaa 25 <210> 6 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Reverse Primer <400> 6 gtcgccttgt accgagtcaa 20 <210> 7 <211> 17 <212> DNA <213> Artificial Sequence <220> <223> TaqMan Probe <400> 7 cctcccctag ctactct 17 <210> 8 <211> 17 <212> DNA <213> Artificial Sequence <220> <223> TaqMan Probe <400> 8 cctcccctag ttactct 17 <210> 9 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Forward Primer <400> 9 gcacccccaa aagggctaaa 20 <210> 10 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Reverse Primer <400> 10 tcgataggtg gctccatacg at 22 <210> 11 <211> 15 <212> DNA <213> Artificial Sequence <220> <223> TaqMan Probe <400> 11 acctctgaca tcttg 15 <210> 12 <211> 14 <212> DNA <213> Artificial Sequence <220> <223> TaqMan Probe <400> 12 cctctgaaat cttg 14

Claims (5)

Ginseng variety consisting of a primer set consisting of the nucleotide sequences of SEQ ID NO: 5 and SEQ ID NO: 6, a probe labeled VIC on the nucleotide sequence of SEQ ID NO: 7, and a probe labeled FAM on the nucleotide sequence of SEQ ID NO: 8 Gene expression analysis set for discrimination.
According to claim 1, The ginseng varieties Chunpoong, Yunpoong, Gopoong, Gopoong, Kumpoong or Sunpoong gene expression analysis set for determining the ginseng.
The gene expression analysis set for discriminating ginseng varieties according to claim 1, wherein the base sequences of the primer set and the probe are derived from Panax ginseng CA Meyer.
The ginseng variety gene is quantitatively measured by real-time PCR analysis, but real-time PCR analysis is a method of quantitatively measuring by real-time PCR analysis, characterized in that using the gene expression analysis set of claim 1.
5. The method of claim 4, wherein the ginseng variety is Chunpoong, Yunpoong, Gopoong, Kumpoong or Sunpoong.

Images