KR20130041274A - Alga in which production of photosynthetic products is improved, and use for said alga - Google Patents

Abstract

Algae and their use which improve the productivity of photosynthetic products are provided. Algae according to the present invention increases the glutathione concentration in the chloroplast. In addition, the method for producing biomass according to the present invention prepares the biomass using the alga according to the present invention or the alga prepared by the method for producing algae according to the present invention.

Description

Algae in which production of photosynthetic products is improved, and use for said alga}

The present invention relates to algae and their use to improve the productivity of photosynthetic products. Specifically, the present invention relates to algae, a method for producing algae, and a method for producing biomass using the algae, which improves productivity of photosynthetic products.

As fuels to replace fossil fuels, fuels derived from biomass and so-called biofuels (for example, bioethanol and biodiesel) are expected.

Biomass, such as sugars (for example, starch) and fats and oils, which are raw materials for biofuels, is produced by plants performing photosynthesis. For this reason, plants which actively perform photosynthesis and accumulate sugars or fats and oils in cells can be used as means for producing biomass. Currently, corn and soybeans are mainly used to produce biomass. Corn and soybeans are also used as food and feed. For this reason, a large increase in the price of food and feed due to the significant increase in biofuel is a problem.

Therefore, biomass production by algae is attracting attention as a biomass production means which replaces corn and soybeans (for example, refer patent document 1 and patent document 2). Biomass production by algae does not compete with food or feed, and has the advantage of being able to multiply in large quantities.

For example, with respect to a not shown Klein Pseudomonas (Chlamydomonas) type of bird, a variant that is deficient cell wall a variant or thin cell walls is known (cw15, cw92 etc.). Since these variants have convenient properties when DNA is introduced into the cell from the outside, they are widely used in gene introduction experiments. In addition, since the cells are susceptible to destruction, the productivity of the biomass is increased in the sense of easy recovery of the cell contents, and thus, the production of biomass using these variants has been reported. For example, Patent Literature 3 describes a technique for producing fat or oil using a variant in which cell walls in Chlamydomonas are deleted. In addition, Non-Patent Document 1 reports that, in addition to cell wall variation (cw15), Chlamydomonas having a deficiency of starch synthetic gene is released out of a cell with oil or fat. Non-Patent Document 2 reports that the productivity of fats and oils is increased by destroying the gene of starch synthesis in the cell wall variant (cw 15) of Chlamydomonas. In addition, Non-Patent Document 3 is known as a report on variation of Chlamydomonas cell wall.

Moreover, the technique which releases the starch which produced the chlorella which is a kind of algae as a material extracellularly, and then performs ethanol fermentation is also reported (patent document 4).

Patent Document 1: Japanese Patent Application Laid-Open No. 11-196885 (published on July 27, 1999) Patent Document 2: Japanese Unexamined Patent Publication No. 2003-310288 (published 11/05/2003) Patent Document 3: International Publication No. 2009/153439 Pamphlet (Published December 23, 2009) Patent Document 4: Japanese Unexamined Patent Publication No. 2010-88334 (published 4/22/2010)

[Non-Patent Document 1] Zi Teng Wang, Nico Ullrich, Sunjoo Joo, Sabine Waffenschmidt, and Ursula Goodenough (2009) Eukaryotic Cell Vol. 8 (12): 1856-1868. Algal Lipid Bodies: Stress Induction, Purification, and Biochemical Characterization in Wild-Type and Starchless Chlamydomonas reinhardtii. [Non-Patent Document 2] Yantao Li, Danxiang Ha, Guongrong Hu, David Dauville, Milton Sommerfeld, Steven Ball and Quiang Hu (2010) Metabolic Engineering Vol. 12 (4): 387-391. Chlamydomonas starchless mutant defective in ADP-glucose pyrophosphorylase hyper-accumulates triacylglycerol. [Non-Patent Document 3] Hyams, J., Davies, D.R. (1972) Mutation Research 14 (4): 381-389. The induction and characterization of cell wall mutants of Chlamydonas reinhardi.

However, there is a problem in productivity in the production technology of biomass using alga as described above. For example, in the case of culturing algae in heterotrophic conditions and producing biomass using a carbon source such as acetic acid, in order to induce the production and accumulation of biomass in algae, a nutrient restriction process such as nitrogen starvation is performed. It is necessary. In general, in order to proliferate and culture algae using a culture medium containing nitrogen, it is necessary to exchange it with a culture medium containing no nitrogen in order to bring it into a nitrogen starvation state. Because of this, there is a problem that the process is complicated, productivity is lowered, or costs are increased.

The present invention has been made in view of the above conventional problems, and its object is to provide algae and its use which can improve the productivity of biomass without carrying out a nutrient limiting step.

MEANS TO SOLVE THE PROBLEM As a main object of this invention, as a result of repeated examination, as a result of artificially increasing the glutathione concentration in the chloroplast of an algae, even if it does not carry out a nutrient-limiting process, such as nitrogen starvation, in an algae cell, It has been found that the productivity of biomass can be improved, and the present invention has been completed.

That is, the alga according to the present invention is characterized in that the concentration of glutathione in the chloroplast is increased.

Algae production method according to the present invention is a method for producing the algae, characterized in that it comprises a glutathione concentration increasing process for increasing the glutathione concentration in the chloroplast of algae.

Biomass production method according to the invention is characterized in that using the alga according to the present invention or the alga prepared by the method for producing an alga according to the present invention.

Method for producing a biomass according to the invention is characterized in that it comprises a step of culturing algae in the presence of a substance that increases the concentration of glutathione in the chloroplast of the algae.

The alga according to the present invention increases the glutathione concentration in the chloroplast of the alga, thereby improving the productivity of the photosynthetic product in the algae cells even when the algae are not starved. For this reason, the use of the algae according to the present invention eliminates the need for replacement with a culture medium that does not contain nitrogen to induce the accumulation of photosynthetic products. As a result, according to the present invention, induction of accumulation of photosynthetic products can be performed easily and efficiently. Therefore, according to the manufacturing method of the biomass which concerns on this invention, biomass can be manufactured from alga efficiently and cheaply compared with the former.

Other objects, features, and advantages of the present invention will be apparent from the following description. Further advantages of the present invention will become apparent from the following description with reference to the accompanying drawings.

Figure 1 shows the results of examining the proliferation capacity and starch production capacity of the GSH1 overexpressing strain prepared in Example 1, (a) is a graph showing the growth capacity of the GSH1 overexpressing strain, (b) is 309 hours from the start of culture (C) is a figure which shows the result of the urea starch reaction in the sample 4. FIG.
Figure 2 shows the results of examining the proliferation capacity and starch production capacity of the parent strain (wild-type strain), (a) is a graph showing the growth capacity of the parent strain (wild-type strain), (b) is a culture medium after 215 hours after the start of culture It is a figure which shows the state of.
Fig. 3 shows the results of examining the state of the parent strain (wild strain strain) of Sample 8, and (a) shows the histogram of cells (particles) showing chlorophyll-derived fluorescence in the parent strain (wild strain strain) of Sample 8. (B) is a figure which shows the correlation of the particle | grains floating in the culture of the parent strain (wild-type strain) of the sample 8, and the complexity inside a particle | grain.
4 shows the results of examining the state of GSH1 overexpression strain of Sample 4, (a) is a diagram showing a histogram of cells (particles) showing fluorescence of chlorophyll in GSH1 overexpression strain of Sample 4, ( b) shows the correlation between the size of particles suspended in the culture of GSH1 overexpressing strain of Sample 4 and the complexity within the particles.
FIG. 5 is a graph showing changes over time in the particles showing fluorescence derived from chlorophyll, that is, cells not showing fluorescence derived from chlorophyll, that is, starch particles, in samples 9 and 10, and (b). ) Is a graph showing the change over time of the starch amount per culture in Samples 9 and 10, and (c) is a graph showing the change over time in the amount of starch per cell in Samples 9 and 10. In addition, in (b) and (c), "TAP normal" and "TAP N-free" mean "TAP medium containing a nitrogen source" and "TAP medium containing no nitrogen source", respectively.
FIG. 6 (a) is a graph showing changes over time in the chlorophyll-derived particles, that is, the cells and the fluorescence-derived fluorescence-derived particles, ie, the density of starch particles, in Samples 11 and 12; , (b) is a graph showing the change over time of the starch amount per culture in Samples 11 and 12, and (c) is a graph showing the change over time of the starch amount per cell in Samples 11 and 12. to be. In addition, in (b) and (c), "TAP normal" and "TAP N-free" mean "TAP medium containing a nitrogen source" and "TAP medium containing no nitrogen source", respectively.
FIG. 7 (a) is a graph showing the change over time of the density of chlorophyll-derived fluorescence in GSH1 overexpressing strain and parent strain (wild-type strain) and the density of particles having no chlorophyll-derived fluorescence. b) is a graph showing changes over time in the amount of starch per culture.
Fig. 8 shows the results of urea starch reaction in GSH1 overexpressing strains and parent strains (wild-type strains).
9 is a diagram showing the results of examining the proliferation capacity of GSH1 overexpressing strains.
Fig. 10 shows the results of examining the state of GSH1 overexpressing strains at each passage point, and (a) shows the size and intracellular complexity of the cells of GSH1 overexpressing strains when “passage 1” shown in Fig. 9 is performed. (B) is a diagram showing a correlation between the size of cells of GSH1 overexpressing strain and the complexity within the cells when "passage 2" shown in FIG. 9 is performed. c) is a diagram showing the correlation between the size of cells of GSH1 overexpressing strain and the complexity within the cells when "passage 3" shown in FIG. 9 is performed.
11 is a view showing the results of observing the shape of the starch particles released out of the cells from the GSH1 overexpressing strain, (a) is a view showing the results of observing the starch particles using a scanning electron microscope, ( b) shows the results of the urea starch reaction in the starch particles released from the GSH1 overexpressing strain, (c) is a case where BSO, an inhibitor of GSH synthase, is added to the medium so that the final concentration is 8 mM , GSH1 overexpressing starch production capacity.
Fig. 12 shows the result of examining the maintenance production capacity of GSH1 overexpressing strain, (a) is a diagram showing a histogram of cells showing fluorescence derived from nile red in the parent strain (wild-type strain), ( b) shows a histogram of cells exhibiting fluorescence of Nile red urea in GSH1 overexpressing strain, and (c) shows observation results by confocal laser microscopy of Nile stained parent strain (wild-type strain). It is a figure, (d) is a figure which shows the observation result by the confocal laser microscope of GSH1 overexpression strain stained with Nile red.
Figure 13 shows the results of examining the state of GSH1 overexpressing strain, (a) is a diagram showing the correlation between the size of the cells and the complexity of the GSH1 overexpressing strain, (b) is GSH1 overexpressing cells Is a graph showing the correlation between the size of and the fluorescence intensity derived from Nile red. (D) is a diagram showing the correlation between the cell size of the parent strain (wild-type strain) and the complexity within the cell.
Fig. 14 shows the results of gas chromatography mass spectrometry.
FIG. 15 shows the results of examining the state of the GSH1 overexpressing strain (sta6-background) and its parent strain (sta6-), and (a) shows the correlation between the cell size of the parent strain (sta6-) and intracellular complexity. (B) is a diagram showing the correlation between the size of the cells in the GSH1 overexpressing strain (sta6-background) strain and the complexity within the cells.
Figure 16 shows the results of the maintenance of the production capacity of GSH1 overexpression (sta6- background) and its parent strain (sta6-) after preculture and 3 days after medium exchange, (a) is GSH1 overexpression after preculture (sta6-background) and histogram of cells showing fluorescence derived from Nile red in its parent strain (sta6-), (b) is GSH1 overexpressing strain 3 days after medium exchange (sta6-background) And a histogram of cells showing fluorescence derived from Nile red in its parent strain (sta6- strain).
It is a figure which shows the result of having examined the amount of chlorophylls of GSH1 overexpression strain manufactured in Example 1. FIG.
FIG. 18 shows the results obtained by examining the absorption spectra of pigments extracted from transformants of Cyanobacteria, EcgshA plus and EcgshA minus, (a) is a diagram showing the absorption spectrum of EcgshA plus strain, (b) Is a figure which shows the absorption spectrum of EcgshA minus stock, (c) is a figure which shows the spectrum which subtracted the spectrum of EcgshA minus stock from the spectrum of EcgshA plus stock.
19 (a) is a graph showing the change over time of the chlorophyll-derived particles, ie, the density of cells and the fluorine-derived fluorescence, that is, the density of starch particles in Samples 9 and 10; , (b) is a graph showing the change over time of the starch amount per culture in Samples 9 and 10, (c) is a graph showing the change over time of the starch amount per cell in Samples 9 and 10 to be. In (b) and (c), "TAP normal" and "TAP N-free" mean "a TAP medium containing a nitrogen source" and "a TAP medium containing no nitrogen source", respectively.
20 (a) is a graph showing changes over time in the chlorophyll-derived particles, that is, the cells and the fluorine-derived fluorescence-derived particles, that is, the density of starch particles, in Samples 11 and 12; , (b) is a graph showing the change over time of the starch per culture medium in Samples 11 and 12, (c) is a graph showing the change over time of the amount of starch per cell in Samples 11 and 12 It is a graph. In (b) and (c), "TAP normal" and "TAP N-free" mean "a TAP medium containing a nitrogen source" and "a TAP medium containing no nitrogen source", respectively.

EMBODIMENT OF THE INVENTION Hereinafter, embodiment of this invention is described in detail. However, the present invention is not limited to this, and may be practiced with various modifications within the described range. In addition, all of the scholarly documents and patent documents described in this specification are incorporated by reference in this specification. In addition, "A-B" which shows a numerical range means "A or more and B or less" unless there is particular notice in this specification.

[One. Algae according to the present invention]

The alga according to the present invention may be one in which the concentration of glutathione in the chloroplast is increased, and the other algae is not limited but is preferably an algae in which the productivity of the photosynthetic product is improved.

Here, in the present invention, "the concentration of glutathione in the chloroplast increases" means that the glutathione concentration in the chloroplast is higher than that of the glutathione in the chloroplast of the same type of wild type algae. When the glutathione concentration in the chloroplast is 1.1 times or more compared to the glutathione concentration in the chloroplast of the same type of wild-type algae grown under the same conditions, it is preferable to determine that the glutathione concentration in the chloroplast is increasing. If there is a significant difference of 5% in the assay, it is more preferable to determine that the glutathione concentration in the chloroplast is increasing. The glutathione concentration in the chloroplasts of wild-type algae is preferably measured at the same time by the same method, but the accumulated data can be used as background data.

Glutathione concentration in the chloroplasts of algae can be measured directly by the presence of roGFP2 in the chloroplast, a molecular probe that changes color tone to reflect the redox state (eg, Mayer AJ, et al. (2007) Plant Journal 52: 973-986.Redox-sensitive GFP in Arabidopsis thaliana is a quantitative biosensor for the redox potential of the cellular glutathione redox buffer. And Gutscher M. et al. (2008) Nat Methods 5: 553-559. -time imaging of the intracellular glutathione redox potential). In addition to this, the expression level of the protein involved in the glutathione biosynthesis system or the expression level of the polynucleotide encoding the protein can be measured indirectly as the glutathione concentration is increased when they increase. As a method for measuring the expression level of proteins and polynucleotides, conventionally known methods can be appropriately used.

Examples of the "glutathione" include reduced glutathione (hereinafter referred to as GSH) and oxidized glutathione (hereinafter referred to as "GSSG"). In the method according to the present invention, GSH is used to increase the concentration of either glutathione of GSSG. Can increase the concentration of both GSH and GSSG.

In addition, "the productivity of a photosynthetic product improves" means that the productivity of a photosynthetic product is high compared with the productivity of the photosynthetic product of the wild-type algae of the same kind. When the productivity of the photosynthetic product is 1.1 times or more compared with the productivity of the photosynthetic product of the same type of wild type algae grown under the same conditions, it is preferable to judge that the productivity of the photosynthetic product is improved. When there is a significant difference of the% level, it is more preferable to judge that the productivity of the photosynthetic product is improved. For example, productivity can be evaluated from various viewpoints, such as the conditions of light to be irradiated (light quantity, intensity, time, etc.), the nutrients to be administered, whether the process of starvation per unit time is essential, and the culture temperature.

In addition, in the present specification, the term "photosynthate" refers to a substance that algae produces by carbon fixing by photosynthesis, and specifically, for example, biomass such as sugars (for example, starch), fats and oils, and the like. And derivatives thereof (such as metabolites). In addition, carbon fixation by photosynthesis here refers to the overall metabolism of carbon compounds using chemical energy derived from light energy. Therefore, the origin of carbon contained in a metabolic system is not limited to inorganic compounds, such as carbon dioxide, and organic compounds, such as oxygen, are also included.

In the present specification, the "algae" is not particularly limited as long as it has a photosynthetic ability and can produce a photosynthetic product. Such algae include, for example, fine algae classified as green algae of the algae plant gate, and more specifically, chlamidomonas belonging to the genus Klamido-monas of algae. Chlamydomonas reinhardrii, Chlamydomonas moewusii, Chlamydomonas eugametos, Chlamydomonas segnis and the like; Dunaliella salina, Dunaliella tertiolecta, Dunaliella primolecta, etc. belonging to the genus Dunariella of the green algae; Chlorella vulgaris, belonging to the genus Chlorella of the algae river; Chlorella pyrenoidosa and the like; Haematococcus pluvialis belonging to the genus Hamatococcus of the green algae; Chlorococcum littorale belonging to the genus Chlorococum of the green algae, Botryocuccus braunii belonging to the genus Boliococcus of the green algae or yellow-green crude river, etc .; Choricystis minor, belonging to the genus Corsistis of the algae river; Pseudochoricystis ellipsoidea, belonging to the genus Pseudochonsisis of the green algae; Amphora sp., Belonging to the genus Amphora of diatom steel; Nitzschia alba, Nitzchia closterium, Nitzschia laevis and the like belonging to the Nischchia genus of diatom steel; Crypthecodinium cohnii belonging to the genus Cryptocodinium of overstretched steel; Euglena gracilis, Euglena proxima, etc., belonging to the genus Pseudomonas aureus in the order of the order; Paramecium bursaria belonging to the genus Streptococcus of the ciliary worm; Synechococcus aquatilis belonging to the genus Cenecoccus genus, Synene coccus elongatus, etc .; Spirulina platensis, Spriulina subsalsa, etc. belonging to the genus Saprina spina; Prochlorococcus marinus belonging to the genus Prochlorococcus genus; Oocystis polymorpha belonging to the genus Ossistis; And the like.

The method for obtaining algae with increasing glutathione concentration in the chloroplasts is not particularly limited. Such a method will be described later in "2. The method of preparing algae according to the present invention ”will be described in detail.

The alga according to the present invention is a γ-glutamylcysteine synthetase (hereinafter sometimes referred to as "GSH1"), glutathione synthase (hereinafter sometimes referred to as "GSH2") in the chloroplast, ATP sulfrilase, Preferably, the expression level and / or activity of at least one protein selected from the group consisting of adenosine 5'-phosphosulfate reductase, sulfite reductase, cysteine synthetase and serineacetyl transferase is increased. These proteins are enzymes involved in the glutathione biosynthesis system in the chloroplast, and the increase in their expression level can be understood as the increase in the glutathione concentration in the chloroplast.

In addition, the alga according to the present invention comprises at least one protein selected from the group consisting of GSH1, GSH2, ATP sulfrilase, adenosine 5'-phosphosulfate reductase, sulfite reductase, cysteine synthase and serineacetyl transferase. Polynucleotides that encode may be introduced. Algae in which such exogenous polynucleotides are introduced and (over) expressed can be said to be algae with increased glutathione concentration in the chloroplast.

In other words, the present invention encodes at least one protein selected from the group consisting of GSH1, GSH2, ATPsulfurase, adenosine 5'-phosphosulfate reductase, sulfite reductase, cysteine synthetase and serineacetyl transferase. It can be said that the polynucleotide is introduced to provide a transgenic alga with increased glutathione concentration in the chloroplast. Such a transgenic alga is natural and increases the productivity of photosynthetic products.

In the alga according to the present invention, the polynucleotide encoding the γ-glutamylcysteine synthetase may be selected from the group consisting of the following (a) to (d):

(a) a polynucleotide encoding a polypeptide consisting of the amino acid sequence represented by SEQ ID NO: 1;

(b) the amino acid sequence represented by SEQ ID NO: 1, wherein the polynucleotide consists of an amino acid sequence in which one or several amino acids are deleted, substituted or added, and which encodes a polypeptide having γ-glutamylcysteine synthase activity;

(c) a polynucleotide consisting of the nucleotide sequence represented by SEQ ID NO: 2;

(d) hybridize to polynucleotide consisting of a nucleotide sequence complementary to any one of the polynucleotides of (a) to (d) above under stringent conditions, and furthermore gamma -glutamylcysteine Polynucleotides encoding polypeptides having synthetase activity. The detail of the polynucleotide of said (a)-(d) is mentioned later.

In the alga of the present invention, it can be confirmed that the polynucleotide is introduced into the algae cell by conventionally known PCR, Southern hybridization, Northern hybridization, and the like. It is also possible to confirm the expression of the protein encoded by the polynucleotide by conventionally known immunological methods. It is also possible to confirm the enzyme activity exhibited by the protein encoded by the polynucleotide by conventionally known biochemical techniques.

The algae of the present invention are capable of inducing the production and / or accumulation of photosynthetic products in algae cells without the need for nitrogen starvation due to the increased glutathione concentration in the chloroplasts of the algae. For this reason, the use of the algae of the present invention eliminates the need for replacement with a culture medium that does not contain nitrogen for inducing the accumulation of photosynthetic products.

Referring to the effect of the present invention in comparison with the wild type is as follows. In the case of nitrogen starvation under heterotrophic conditions (with a carbon source such as acetic acid), wild-type algae accumulate slightly photosynthetic products intracellularly during the growth phase and also accumulate photosynthetic products during the normal phase, but rarely outside the cells. Photosynthetic products are not detected. On the other hand, in the algae according to the present invention, photosynthetic products are produced and accumulated in both the growth phase (logarithmic growth phase) and the normal phase, and a large amount of photosynthetic products are detected extracellularly. In the heterotrophic condition, when not in a nitrogen starvation state, the wild-type algae accumulate at least the photosynthetic product in the cell at the growth stage, but its accumulation further decreases in the normal phase and is rarely detected in the extracellular phase. On the other hand, in the algae according to the present invention, photosynthetic products are produced and accumulated in both the growth phase and the normal phase, and many photosynthetic products are detected also in the extracellular phase.

Next, under autotrophic conditions (proliferation dependent on carbon dioxide fixation by photosynthesis), generally in wild type algae, the amount of light required to induce photosynthetic product accumulation in nitrogen starvation is more necessary than in heterotrophic conditions. do. On the other hand, in the algae according to the present invention, photosynthetic products continue to be produced even without increasing the light intensity. Of course, as the light to be irradiated is strong, the productivity of the photosynthetic product also improves in the alga according to the present invention. For example, when using chlamidomonas as algae, it is advantageous to irradiate stronger light for the production of photosynthetic products from its characteristics, but compared to wild type algae, algae according to the present invention accumulate photosynthetic products by light quantity. It can be said that the limitation is extremely limited.

In addition, the alga of the present invention is characterized in that the culture density is kept small. For this reason, the alga of this invention has a high utilization efficiency of light. Thus, the same amount of light (brightness) can produce and accumulate more photosynthetic products than the wild-type algae of the same species. In general, when the cell density is at an appropriate level (eg, kept lower than the wild type), it is useful in terms of light utilization efficiency. Specifically, the ability to produce photosynthetic products is limited in some respects because the light that reaches the culture tank depth is attenuated by the "shading effect" caused by the cells present in the culture tank surface as the cell density increases. Although there is a problem of reaching, in the algae of the present invention, since the culture density is kept smaller than that of the wild type, such a problem can be avoided.

In addition, the algae of the present invention can increase the accumulation of starch particles linearly corresponding to the incubation time. For this reason, by maintaining such a culture state by supplying water or adding a medium, it is possible to continuously produce photosynthetic products by so-called continuous culture (for example, continuously producing starch as starch particles).

Alternatively, the algae of the present invention have greater space for increasing the culture densities than the wild type. By artificial manipulation (e.g., loss of cell dispersion medium (e.g. moisture) by a filtration process or the like), the culture density can be increased to the extent that the productivity of the photosynthetic product is saturated, thereby effectively producing the photosynthetic product.

In addition, the alga of the present invention is small in resting cells. Therefore, if the biomass is prepared using the alga of the present invention, the yield is good, and the culture solution can be saved. In addition, since there is little waste, the waste disposal cost (dehydration, incineration, landfill, etc.) of a waste can be made small, and it is especially advantageous when batch culture is performed. In addition, the less waste is a good yield. Specifically, for example, most of the solids in the waste from fermentation such as wine brewing are cells, but the algae of the present invention rupture and self-melt together with the release of starch particles. The yield is good.

In addition, since the algae of the present invention can discharge the photosynthetic products accumulated in the cells of the algae to the outside of the cells, recovery of the photosynthetic products is easy. For example, when the photosynthetic product is starch, the starch accumulated by photosynthesis can be discharged out of the cells as starch particles without destroying the cells of algae. For this reason, when biomass is manufactured using the algae of this invention, a starch can be refine | purified comparatively easily.

The starch particles produced by the algae of the present invention are characterized in that they are minute. For example, general starch particles made by corn, potato, wheat, etc. have an average particle diameter of 10-50 μm, whereas starch particles produced by the algae of the present invention have a mean diameter of 1.3 μm (standard deviation). 0.181), and are fine and uniform particles having a short diameter of 1.0 mu m (standard deviation 0.204). Rice and quinoa produce fine starch particles with an average particle diameter of about 2 to 3 µm, but they form a close-typed endosperm, like starch particles from which corn, potatoes, and wheat are made. do. Therefore, in order to prepare the finely divided starch particles which are decomposed from each other using corn, potatoes, wheat, rice, quinoa and the like as raw materials, an expensive process such as polishing is required. Such fine starch particles are useful in the manufacture of pharmaceuticals. That is, when the alga of the present invention is used, it is possible to produce a large amount of fine and uniform starch particles, and at the same time, since the starch particles are discharged out of the algae cells, purification can be performed relatively easily. Moreover, these starch particles do not undergo grinding or the like, but are separated from each other.

As such, starch particles produced by GSH1 overexpressing strains are finer than general starch particles produced by corn, potatoes, wheat and the like. Such fine starch particles are useful in the manufacture of pharmaceuticals. Specifically, since the fine starch particles are smaller than the diameter of the bronchioles of the lungs, they are expected to be used as carriers (dry powder inhalers in which therapeutic drugs and starch microparticles are combined) for delivering a therapeutic agent for lung disease to the bronchioles.

In addition, by presenting a peptidic antigen on the surface of starch particles, it is expected to be utilized as a so-called "edible vaccine" (for example, Dauville'e et al. 2010, PLos One Vol. 5, No. 12, e15424; Japan). Patent publication 2003-500060 (patent application 2000-620111 discloses the presentation of malaria antigens to the surface of starch particles of Chlamydomonas).

 In addition, glutathione is a substance that regulates the redox state in cells, and can function as a regulator of differentiation of cells or organs (see pamphlet WO 01/080638), and can function as a plant growth regulator. (See Japanese Laid-Open Patent Publication No. 2004-352679).

However, by increasing the glutathione concentration in the chloroplasts of algae, it is possible to induce the accumulation of photosynthetic products in the algae cells without making them starve to nitrogen starvation, and further release the photosynthetic products accumulated in the algae cells out of the cells. It cannot be predicted at all from the function of glutathione known as such.

When the alga of the present invention is used, both the induction of accumulation of photosynthetic products and the recovery of photosynthetic products can be easily and efficiently performed as compared with the prior art. For this reason, by using the algae of this invention in the manufacturing method of the biomass mentioned later, biomass can be manufactured from algae more cheaply and efficiently than before.

[2. Algae manufacturing method according to the present invention]

Algae production method according to the present invention (hereinafter referred to as "algae production method") of the algae (algae of the present invention) improves the concentration of glutathione and photosynthetic product in the chloroplast compared to the wild-type algae described above It is a method of manufacturing, What is necessary is just to include the glutathione concentration increasing process which increases the glutathione concentration in the chloroplast of algae, and the structure of other conditions, a process, etc. is not limited.

The manufacturing method of the algae of this invention is demonstrated concretely below.

(1.glutathione concentration increasing process)

The glutathione concentration increasing process is a process for increasing the glutathione concentration in the chloroplasts of algae.

Herein, the term " increase glutathione concentration in chloroplasts " means that the glutathione concentration in chloroplasts is increased in comparison with wild type algae of the same type. In other words, algae after the glutathione concentration increasing process have a higher glutathione concentration compared to wild type algae of the same kind. It was found that the glutathione concentration in the chloroplasts of algae was increased compared to the wild type strain of the algae. Can be determined by the method described in the section "Algae according to the present invention".

In the glutathione concentration increasing process, the method of increasing the glutathione concentration in the chloroplast is not particularly limited as long as it can increase the glutathione concentration in the chloroplast of the alga as a result. For example, (i) a method of randomly introducing mutations into a desired alga using known mutagenesis methods; (ii) introducing a substance that increases glutathione concentration in the chloroplast into the cell (and possibly in the algae genome); Or the like.

Below, the method of said (i) and (ii) is demonstrated concretely.

(i) How to introduce random mutations into algae

The method of introducing a mutation randomly into an alga is not particularly limited and a known method can be appropriately selected and used. Specifically, for example, a method of treating algae with chemicals (e.g., EMS, NTG, etc.), a method using radiation, a method using transposon, a method using T-DNA, prokaryotic cells A method of using interconjugation, a method of physically introducing into a gene gun, and the like. By this method, for example, it is involved in the biosynthetic system of glutathione in chloroplasts such as GSH1, GSH2, ATP-sulfurylase, adenosine 5'-phosphosulfate reductase, sulfite reductase, cysteine synthase, and serine acetyl transferase. An alga can be obtained by introducing a mutation into a polynucleotide encoding a protein to increase the expression level and / or activity of the protein, and as a result, the glutathione concentration in the chloroplast is increased.

The method of selecting the algae into which the desired mutation is introduced may also use a known method, and is not particularly limited. For example, by using the method of directly measuring the concentration of glutathione in the chloroplasts described above, a method of obtaining a mutant algae having an increased glutathione concentration, or GSH1, GSH2, ATPsulfurase, adenosine 5'-phosphosulfate reductase, sulfite reduction And a method of obtaining a mutant alga with increased expression and / or activity of proteins such as enzymes, cysteine synthetases, serineacetyl transferases, and the like.

(ii) introducing a substance into the cell which increases the concentration of glutathione in the chloroplast;

As said "method of increasing the glutathione concentration in the chloroplast," for example, (A) the expression of the polynucleotide encoding the protein which increases the glutathione concentration in the chloroplast, or (B) the expression of the protein which decreases the glutathione concentration in the chloroplast of the algae. By introducing a polynucleotide having a function of lowering the amount, algae having an increased glutathione concentration in the chloroplast can be obtained. The polynucleotides of (A) or (B) can be used alone or in combination.

In addition, when used herein, the term "polypeptide" is used interchangeably with "peptide" or "protein". As used herein, the term "polynucleotide" is used interchangeably with "gene", "nucleic acid" or "nucleic acid molecule", and a polymer of nucleotides is intended.

In addition, the above-mentioned "polynucleotide is introduced" includes the case where the polynucleotide to be introduced may be present in an algae cell, and the polynucleotide to be introduced is inserted (introduced) into the genome of the algae. The introduction of the polynucleotide into the cells of algae can be confirmed by conventionally known PCR, Southern hybridization, Northern hybridization, and the like.

By introducing at least one polynucleotide of the above (A) into the cells of algae, it is possible to increase the expression level of the protein which increases the glutathione concentration in the chloroplast, and as a result, the glutathione concentration in the chloroplast can be increased.

As such a polynucleotide, for example, a polynucleotide encoding γ-glutamylcysteine synthase (hereinafter sometimes referred to as a "GSH1 gene"), and a polynucleotide encoding a glutathione synthase (hereinafter referred to as "GSH2 gene" Polynucleotides encoding ATP-sulfurase, polynucleotides encoding adenosine 5'-phosphosulfate reductase, polynucleotides encoding sulfite reductase, cysteine A polynucleotide encoding a synthetase, a polynucleotide encoding a serine acetyl transferase, and the like can be preferably exemplified. These polynucleotides are preferably plant-derived, more preferably polynucleotides possessed by the host algae themselves, but polynucleotides derived from host algae and other algae or other higher plants are also suitable. Can be used.

Said "(gamma) -glutamylcysteine synthase (GSH1)" is an enzyme which synthesize | combines (gamma) -glutamylcysteine by amide-bonding glutamic acid with cysteine in a (gamma) position. The term "glutathione synthase (GSH2)" is an enzyme that synthesizes glutathione by adding glycine to γ-glutamylcysteine.

Although it does not specifically limit as a specific example of said "GSH1 gene", As one kind of suitable GSH1 gene used by this invention, the GSH1 gene (CHLREDRAFT_181975) of chlamidomonas used by the present inventors can be mentioned. GSH1 of Chlamydomonas consists of the amino acid sequence shown by SEQ ID NO: 1, and the gene encoding it (full length cDNA) consists of the nucleotide sequence shown by SEQ ID NO: 3. In the nucleotide sequence shown in SEQ ID NO: 3, positions 134 to 136 are start codons, and positions 1571 to 1573 are stop codons. That is, the Chlamydomonas GSH1 gene has positions 134 to 1573 as an open reading frame (ORF) in the nucleotide sequence shown in SEQ ID NO: 3. The nucleotide sequence shown in SEQ ID NO: 2 is the nucleotide sequence of the ORF of Chlamydomonas GSH1 gene. The translation product of the Chlamydomonas GSH1 gene has a chloroplast transition signal peptide in the N-terminal region. Therefore, the translation product of Chlamydomonas GSH1 gene, that is, Chlamydomonas GSH1, is usually present in chloroplasts.

That is, in the present invention, as the nucleotide to be introduced into the alga, polynucleotides of the following (a) to (d) can be preferably exemplified:

(a) a polynucleotide encoding a polypeptide consisting of the amino acid sequence represented by SEQ ID NO: 1;

(b) the amino acid sequence represented by SEQ ID NO: 1, wherein the one or several amino acids consists of an amino acid sequence deleted, substituted or added, and also encodes a polypeptide having γ-glutamylcysteine synthase activity ;

(c) a polynucleotide consisting of the nucleotide sequence represented by SEQ ID NO: 2;

(d) hybridization under polynucleotides consisting of a nucleotide sequence complementary to any one of the polynucleotides of (a) to (c) and under stringent conditions, and further the γ-glutamylcysteine synthase activity Polynucleotide encoding a polypeptide having.

In addition, SEQ ID NO: 2 shows an example of the base sequence which codes the polypeptide which consists of an amino acid sequence shown by SEQ ID NO: 1.

Herein, the term "deleted, substituted or added with one or several amino acids" means a number that can be deleted, substituted, or added by a known variant peptide construction method such as site-specific mutagenesis (preferably 10 or less, more preferably 7 or less, and more preferably 5 or less) amino acids are deleted, substituted or added. Such a mutant protein is not limited to a protein having a mutant artificially introduced by a known mutant polypeptide construction method, and may be an isolated and purified protein that exists naturally.

It is well known in the art that some amino acids in an amino acid sequence of a protein are readily modified without significantly affecting the structure or function of the protein. It is also well known that there are variants which, in addition to artificially modifying them artificially, also in the native protein do not significantly alter the structure or function of the protein.

Preferred variants have conservative or non-conservative amino acid substitutions, deletions, or additions. Preferred are silent substitutions, additions and deletions, particularly preferably dependent substitutions. They do not alter the polypeptide activity according to the invention.

Representative conservative substitutions typically include substitution of one amino acid from another of the aliphatic amino acids Ala, Val, Leu, and Ile, exchange of hydroxyl residues Ser and Thr, exchange of acidic residues Asp and Glu, amide residues Asn and Substitution between Gln, exchange of basic residues Lys and Arg, and substitution between aromatic residues Phe, Tyr.

As used herein, the term “stringent condition” refers to hybridization only when at least 90% identity, preferably at least 95% identity, and most preferably at least 97% identity exists between sequences. This means that it happens. Specifically, for example hybridization solution (50% formamide, 5 × SSC (150 mM NaCl, 15 mM trisodium citrate), 50 mM sodium phosphate (pH 7.6), 5 × denhardt solution, Conditions for washing the filter in 0.1 × SSC at about 65 ° C. after overnight incubation at 42 ° C. in 10% dextran sulfate, and 20 μg / ml denatured shear salmon sperm DNA).

Hybridization can be carried out by well-known methods such as those described in Sambrook et al., Molecular Cloning, A Laboratory Manual, 3rd Ed., Cold Spring Harbor Laboratory (2001). In general, the higher the temperature, the lower the salt concentration, the higher the stringency (it becomes difficult to hybridize), and a more homologous polynucleotide can be obtained.

The identity of the amino acid sequences or base sequences can be found in Karlin and Alschul (Karlin S, Altsuchul SF, Proc. Natl. Acad. Sci. USA, 87: 2264-2268 (1990); Karlin S, Altschul SF, Proc. Natl. Acad Sci. USA, 90: 5873-5877 (1993)). Based on BLAST's algorithm, a program called BLASTN or BLASTX has been developed (Altschul SF, et al., J. Mol. Biol., 215: 403 (1990)).

In the present invention, the "γ-glutamylcysteine synthase activity" means an activity of catalyzing the reaction of amide bonding glutamic acid to cysteine at the γ position. "Γ-glutamylcysteine synthase activity" is a reaction containing cysteine, glutamic acid, and ATP as a sample, for example, by taking an anti-oxidation measure by nitrogen replacement of a solution, and then using a supernatant obtained by centrifuging crushed algae as a sample. After adding a sample to a liquid, it can obtain | require as an amount of (gamma)-glutamyl cysteine synthesize | combined at a fixed time. With the reaction thereof, the amount of phosphoric acid produced can be quantified and determined.

Examples of GSH1 genes derived from plants other than Chlamydomonas include A. thaliana (TAIR Accession Gene: 2127172, Name AT4G23100.1), Zinnia elegans (Genbank accession: AB158510), Oryza sativa (Genbank accession: AJ508915), Nicotiana tabacum GSH1 genes such as (Genbank accession: DQ444219) are known, and these can also be suitably used in the present invention. The translation products of these genes also have a chloroplast transition signal peptide in the N-terminal region, similar to Chlamydomonas.

In addition, by introducing the polynucleotide of the above (B) into the cells of the algae, it is possible to reduce the amount of expression of the protein lowering the glutathione concentration in the chloroplast, and consequently to increase the glutathione concentration in the chloroplast. Examples of such polynucleotides include double-stranded RNA (dsRNA), siRNA (short interfering RnA), template DNA of these RNA, and the like, which are used in a conventionally known RNA interference (RNAi) method. do.

As said "protein which lowers glutathione concentration in algae chloroplast", CLT1 etc. can be illustrated preferably, for example. The term "CLT1" is a transporter for transporting glutathione from the chloroplast to the cytoplasm and is named CLT1, which is first found in Shiroinunazuna (see Pro Natl Acad Sci USA (2010) vol. 107 (5) 2331-2336). . Therefore, as an example of the above (B), polynucleotides intended to reduce the expression level of glutathione transporters such as CTL1 can be listed.

The "polynucleotide" used in the algae production method of the present invention may be derived from genomic DNA, may be derived from cDNA, or may be chemically synthesized DNA. It may also be RNA. The method of preparing the algae may be appropriately selected depending on the purpose.

As a method for obtaining a polynucleotide used in the algae production method of the present invention, for example, when obtaining a GSH1 gene, a method for isolating and cloning a DNA fragment encoding GSH1 by a known technique is listed. . Probes that hybridize specifically with a portion of the nucleotide sequence of the DNA encoding GSH1 of Chlamydomonas can be prepared, and a genomic DNA library or a cDNA library can be screened.

Or as a method of obtaining the polynucleotide used by the manufacturing method of the algae of this invention, the method of using amplification means, such as PCR, can be mentioned. For example, in the case of obtaining the GSH1 gene, primers are prepared from an array (or its complementary sequence) at the 5 'and 3' positions in the cDNA encoding GSH1 of Chlamydomonas, and the genomic DNA is prepared using these primers. By performing PCR or the like (or cDNA) as a template and amplifying the DNA region between the two prides, a large amount of DNA short side (GSH1 gene) encoding GHS1 used in the present invention can be obtained. The GSH2 gene, the ATP sulfillase gene, the adenosine 5'-phospho sulfate reductase gene, the ahang reductase gene, the cysteine synthase gene, the serine acetyl transferase gene, and the CLT1 gene can be obtained by the same method.

The ropolynucleotides used in the algae production method of the present invention can obtain the desired algae as a source.

In the method for producing an alga of the present invention, the method for introducing a polynucleotide into an alga is not particularly limited. For example, by introducing an expression vector having the polynucleotide, the polynucleotide can be introduced into a bird cell. In addition, a conventionally well-known method can be used as a construction method of an expression vector, It does not specifically limit. For example, according to the method of constructing the expression vector disclosed in Japanese Patent Application Laid-Open No. 2007-43926 and Japanese Patent Application Laid-open No. Hei 10-0570868, and transformation method of algae, A promoter that acts as an algae cell upstream of the nucleotide and a terminator that acts as an algae cell downstream can be constructed and introduced into the algae.

As said "promoter", a PsaD promoter can be used suitably, for example. The PsaD promoter has stronger promoter activity than the endogenous promoter of the GSH1 gene. Therefore, by using the PsaD promoter, it is possible to express more gamma -glutamylcysteine synthase. In addition, since the PsaD gene is a gene involved in photosynthesis, the expression vector obtained using the PsaD promoter can control the expression amount of the gene to be introduced by the intensity of light to be irradiated when introduced into the cells of algae.

(2.Other Processes)

In addition to the above-described "glutathione concentration increasing step", the algae production method of the present invention may further include a screening step of screening algae in which glutathione concentration in chlorophyll increases.

For example, a transgenic bird into which a gene of interest has been introduced is first selected using a conventionally known drug selection method as an index by expression of drug resistance markers such as kanamycin resistance or hygromycin resistance. Thereafter, it is possible to confirm whether the target gene has been introduced into the algae by PCR, Southern hybridization, Northern hybridization or the like. For example, PCR is performed by preparing DNA from a transgenic bird and designing specific primers for the introduced DNA. Thereafter, amplification products were subjected to agarose gel electrophoresis, polyacrylamide gel electrophoresis or capillary electrophoresis, stained with ethidium bromide, or the like, and transformed by detecting the desired amplification products. You can see that.

For the screening of the individual whose glutathione concentration in the chloroplast increases, the above-mentioned measuring method of glutathione concentration in the chloroplast can be used.

In addition, since the productivity of the photosynthetic product is improved as a result of the increase in the concentration of glutathione in the chloroplasts, whether the algae having increased glutathione concentrations in the chloroplasts is improving the productivity of the photosynthetic products as described above. It can confirm by a method.

[3. Method for producing biomass according to the present invention]

The production method of the biomass according to the present invention (hereinafter referred to as "manufacturing method of the biomass of the present invention"), algae (algae of the present invention) or the present in which the concentration of glutathione in the chloroplast increases as compared to the wild type alga described above. A method of producing biomass using algae prepared by the algae production method of the invention.

Regarding the alga of the present invention, "1. The alga according to the present invention will be described in detail, and the alga according to the present invention will be described in "2. Since it is as described in the term "a method for producing algae according to the present invention", it is omitted here.

In the present specification, the term "biomass" is intended to be a substance produced by carbon fixing by photosynthesis, for example, sugars (for example, starch), fats and oils, and is also called "photosynthetic product".

In the production method of the biomass of the present invention, the method of inducing the production or accumulation of photosynthetic products in the cells of algae is not particularly limited. For example, the method for producing a biomass of the present invention may include a light irradiation step of irradiating light to the algae in order to induce production or accumulation of photosynthetic products in algae cells.

In the conventional method, in order to induce the accumulation of photosynthetic products in the cells of the algae, it is necessary to under nitrogen starvation conditions, and in order to satisfy the remarkable accumulation of photosynthetic products, it is necessary to irradiate light with a light amount of 200 μE / m 2 / sec or more. There was. However, in the production method of the biomass of the present invention, it is possible to induce the accumulation of photosynthetic products without particularly adjusting the amount of light, but preferably 1000 μE / m 2 / sec or less, and more preferably 500 μE / m 2 / Sec or less, more preferably 400 μE / m 2 / sec or less, 300 μE / m 2 / sec or less, 200 μE / m 2 / sec or less, 150 μE / m 2 / sec or less, 100 μE / m 2 / sec or less, 80 μE / m 2 It is preferable to irradiate light with a light amount of less than / second. The smaller the amount of light to be irradiated, the higher the energy efficiency and the higher the productivity. Algae according to the present invention are superior in that they can produce photosynthetic products intracellularly and extracellularly, even at a small amount of light, compared to conventional wild type algae. The lower limit of the amount of light to be irradiated is not particularly limited, but for example, 40 µE / m 2 / sec or more can be set realistically.

As a light irradiation apparatus for irradiating light of the above-mentioned range, a special light irradiation apparatus is not needed. Solar light, for example; Light in which the sunlight is qualitatively and quantitatively controlled by a mirror, an optical fiber, a filter, a mesh, and the like: artificial light such as an incandescent lamp, a fluorescent lamp, a mercury lamp, and a light emitting diode can be used. Moreover, the light to irradiate can use the light of the wavelength range suitable for photosynthesis of general algae, for example, 400 nm-700 nm is preferable.

In addition, the biomass production method of the present invention does not require culturing algae under nitrogen starvation conditions in order to induce production or accumulation of photosynthetic products in algae cells. For this reason, the light irradiation process can be carried out under conditions that are not nitrogen starvation. Herein, the term "non-nitrogen starvation" means culturing in a culture solution containing an amount of inorganic nitrogen necessary for the algae to grow.

Herein, the amount necessary for the growth of algae is 0.001 to 0.1% by weight, preferably 0.005 to 0.05% by weight, of inorganic nitrogen contained in the culture medium in terms of nitrogen atoms. The term " inorganic nitrogen " refers to nitrogen such as ammonia nitrogen, nitrogen sulfite and nitrogen sulfate. In addition, in the TAP medium used in Examples described later, the inorganic nitrogen contained in the culture solution is about 0.01% by weight in terms of nitrogen atoms.

As a culture liquid containing the amount of inorganic nitrogen necessary for the algae to grow, a culture solution usually used for culturing algae can be used, and is not particularly limited. As such a culture liquid, a conventionally well-known TAP medium, HSM medium, ATCC 897 medium, etc. can be mentioned, for example.

In one embodiment, the algae of the present invention can be cultured while irradiating 45 μE / m 2 / sec of light in TAP medium to induce accumulation of starch in cells. In another embodiment, the algae of the present invention can be cultured while irradiating 80 μE / m 2 / sec light in TAP medium to induce accumulation of starch into cells.

The light irradiation process may be carried out under nitrogen starvation conditions. The term "nitrogen starvation condition" means culturing in a culture medium in which the content of inorganic nitrogen is less than 0.001% by weight in terms of nitrogen atoms. Although not particularly limited, when the light irradiation step is performed under nitrogen starvation conditions, for example, TAP N-free medium can be suitably used as a culture medium containing no nitrogen. In one embodiment, the algae of the invention can be incubated under nitrogen starvation conditions (in TAP N-free medium) with 80 μE / m 2 / sec of light to induce accumulation of starch into cells.

As described above, as a feature point of the alga according to the present invention, when producing a photosynthetic product, it is possible to enumerate that it does not require a nutritional restriction process such as nitrogen starvation. That is, in the method for producing a biomass of the present invention, an embodiment in which the nutrition restriction step such as nitrogen starvation is not substantially performed (substantially no nutrition restriction step such as nitrogen starvation state) is possible. By this feature, the process can be simplified, and the productivity of the photosynthetic product is improved.

The light irradiation process can also be carried out under autotrophic conditions. Here, the term "independent nutrient condition" refers to a condition of culturing without supplying a carbon source other than carbon dioxide. Specifically, for example, the algae of the present invention can be cultured by a method of irradiating the air in HSM culture medium while ventilating the atmosphere, so that the light irradiation process can be performed under autotrophic conditions. In addition, the carbon dioxide source is not limited to the atmosphere, and carbon dioxide contained in the year of a thermal power plant or steel mill can be used to feed carbon dioxide into the medium at a higher concentration than the atmosphere, thereby increasing productivity.

Under autotrophic conditions, carbon dioxide or a gas containing carbon dioxide is sent (aerated) from near the bottom of the culture vessel. The diffusion rate of carbon dioxide in water is extremely slow compared to the atmosphere. Therefore, it is necessary to stir the medium. It is also possible to irradiate light uniformly to algae by stirring the medium. Since carbon dioxide becomes an anion in water, if the buffer capacity of the medium is weak, the medium is inclined to the acidic side by aeration, so that the solubility of carbon dioxide is lowered and it is difficult to be used for photosynthesis. Therefore, it is preferable that the medium has a buffering capacity such that the pH is maintained near neutral or alkaline. As such a medium, a conventionally well-known HSM medium etc. are illustrated preferably.

(2.Other Processes)

The biomass production method of the present invention may further include a step of recovering the photosynthetic product in addition to the "light irradiation step" described above.

For example, when the photosynthetic product is starch, according to the biomass production method of the present invention, since the starch accumulated in the cell can be discharged out of the cells as starch particles, the starch discharged out of the cell in the step of recovering the photosynthetic product. The particles and algae can be separated and the separated starch particles can be recovered. The method of separating the starch particles and algae discharged out of the cell is not particularly limited. For example, it may be made by separation means based on material properties such as particle diameter and / or shape of starch particles and algae cells by spontaneous sedimentation by centrifugation, centrifugation, sieve and the like.

In addition, the production method of the biomass of the present invention can be carried out by using an algae in which the concentration of glutathione in the chloroplast is increased by using a substance which can be absorbed by the algae. That is, the present invention also includes a method for producing a biomass comprising a step of culturing algae in the presence of a substance that increases glutathione concentration in the chloroplast of algae.

Examples of substances that increase the concentration of glutathione in chloroplasts of algae and which can be absorbed by algae by contacting algae include, for example, glutathione, glutathione conjugates, active oxygen (eg hydrogen peroxide, etc.), active nitrogen, Polyamines, titanium oxides, jasmonic acid, salicylic acid, cysteine, cystine, heavy metal cadmium, and iron ions. Moreover, polyamine becomes a raw material of hydrogen peroxide. Titanium oxide produces free radicals by light. Cysteine, cystine, is a precursor of glutathione. Overdose is suitable for mesoporous cadmium and iron ions. Particularly in view of cost, hydrogenated photoacid is preferable.

A substance that increases the concentration of glutathione in the algal chloroplast, and a substance that can be contacted with the algae and absorbed by the algae can be brought into contact with the algae, for example, by containing the substance in a culture solution used for photosynthesis. Can be absorbed by algae.

The biomass production method of the present invention performs the production of biomass using the algae of the present invention or the algae prepared by the algae production method of the present invention. Irradiation or nitrogen starvation can lead to the accumulation of photosynthetic products in algae cells without the need for culturing algae. In addition, by increasing the concentration of glutathione in the chloroplast, the photosynthetic product accumulated in the algae cells can be discharged out of the cell, so that the photosynthetic product is easily recovered. That is, according to the method for producing a biomass of the present invention, both the induction of accumulation of photosynthetic products and the recovery of photosynthetic products can be easily and efficiently performed as compared with the prior art. Therefore, according to the manufacturing method of the biomass of this invention, biomass can be manufactured from algae cheaply and efficiently compared with the conventional.

Algae according to the present invention, in the chloroplast, γ-glutamylcysteine synthase, glutathione synthase, ATP sulfase, adenosine 5'-phosphosulfate reductase, sulfite reductase, cysteine synthase and serineacetyl transferase The amount and / or activity of at least one protein selected from the group consisting of can be increased.

In the alga according to the present invention, the γ-glutamylcysteine synthetase, glutathione synthase, ATP sulfrilase, adenosine 5'-phosphosulfate reductase, sulfite reductase, cysteine synthase and serineacetyl transferase Exogenous polynucleotides encoding at least one protein of choice can be introduced.

In the alga according to the present invention, the polynucleotide encoding the γ-glutamylcysteine synthase may be selected from the group consisting of the following (a) to (d):

(a) a polynucleotide encoding a polypeptide consisting of the amino acid sequence represented by SEQ ID NO: 1;

(b) in the amino acid sequence represented by SEQ ID NO: 1, a polynucleotide consisting of an amino acid sequence in which one or several amino acids are deleted, substituted or added, and which encodes a polypeptide having γ-glutamylcysteine synthase activity;

(c) a polynucleotide consisting of the nucleotide sequence represented by SEQ ID NO: 2;

(d) hybridization under polyvinylnucleotides consisting of a nucleotide sequence complementary to any of the polynucleotides of (a) to (c) and under stringent conditions, and further the γ-glutamylcysteine synthase activity Polynucleotides encoding polypeptides having.

In the algae production method according to the present invention, the glutathione concentration increasing step is γ-glutamylcysteine synthetase, glutathione synthase, ATP sulfrilase, adenosine 5'-phosphosulfate reductase, sulfite reductase, cysteine synthetase And an exogenous polynucleotide encoding at least one protein selected from the group consisting of serine acetyl transferase.

The biomass production method according to the present invention may include a light irradiation step of irradiating light to the algae.

In the method for producing a biomass according to the present invention, the light irradiation process may be performed under conditions that are not substantially nitrogen starvation.

The present invention is not limited to the above-described embodiments, but various modifications are possible within the scope shown in the claims, and the technical scope of the present invention also relates to the embodiments obtained by appropriately combining the technical means disclosed in the different embodiments. Included in

Example

EMBODIMENT OF THE INVENTION Hereinafter, although this invention is demonstrated concretely based on an Example, this invention is not limited by an Example.

Example 1

<Production of GSH1 overexpression strain>

A plasmid was prepared in which the GSH1 gene (SEQ ID NO: 2) encoding γ-glutamylcysteine synthase (SEQ ID NO: 1) derived from Chlamydomonas was connected downstream of the promoter (PsaD promoter) of the PsaD gene.

Specifically, the cyclic DNA, pSP124S (see Plant Journal (1998) Vol. 14 (4): 441-447), which is a vector for Chlamydomonas, is opened by simultaneously treating restriction enzymes EcoRI and EcoR5, and SEQ ID NO: 4 Polynucleotides (about 3.13 kilo base pairs) were linked together and re-circulated. Such cyclic DNA was amplified by E. coli in a known method, and extracted and purified from E. coli.

The polynucleotide represented by SEQ ID NO: 4 was produced by the following method.

(1) Chlamydomonas Reinhardt CC503 strain (prepared from Chlamydomonas Center, Duke University, USA) was incubated for 4 days in TAP medium, 24 ° C., 5 μE / m 2 / sec. Using the cells collected from these cultures as a material, a cDNA synthesis reagent kit (Takara Bio Inc., Solid Phase cDNA synthesis kit) was used to prepare a mixture of cDNA. Using this cDNA mixture as a template, using the oligonucleotides of SEQ ID NOs: 5 and 6, PCR reaction (annealing temperature is 58 ° C.) was carried out by a known method, and the Chlamydomonas GSH1 gene was subjected to ORF and subsequent 3 The 'UTR region was recovered as a continuous polynucleotide of about 2.27 kilo base pairs. In addition, the terminal structures were processed using restriction enzyme EcoR1.

(2) Genomic DNA was prepared by using a DNA extraction reagent kit (Japan Gene Co., Ltd., Isoplant) as a material of cells of CC503 cultured and collected as in (1) above. Using such genomic DNA as the template, oligonucleotides of SEQ ID NOs: 7 and 8 were subjected to PCR reaction (annealing temperature is 56 ° C) by a known method, and the promoter region of the Chlamydomonas PsaD gene was approximately 0.86 kilobase pairs. Recovered as a polynucleotide. Further terminal structures were processed using restriction enzyme Hpal.

(3) The two kinds of polynucleotide fragments prepared in (1) and (2) above were linked by a known method using DNA ligase (orientation spinning agent, Ligation High). By the above experimental procedure, the polynucleotide fragment of the PsD promoter-GSH1 gene whose one end was the blunt end and the other end was the sticky end by EcoR1 was able to be adjusted. In the nucleotide sequence shown in SEQ ID NO: 4, positions 853 to 855 are start codons, and positions 2294 to 2296 are end codons. That is, the Chlamydomonas GSH1 gene has positions 853 to 2296 as an open reading frame (ORF) in the nucleotide sequence shown in SEQ ID NO: 3.

5 'GCTCTCGCCTCAGGCGTT 3' (SEQ ID NO: 5)

5 'GGGGAATTCCTGAGCGAGGGCCTTACAAG 3' (SEQ ID NO: 6)

5 'ATCAGCACACACAGCAGGCTCAC 3' (SEQ ID NO: 7)

5 'TGTTAACCATTTTGGCTTGTTGTGAGTAGC 3' (SEQ ID NO: 8)

The plasmid containing the polynucleotide of the PsaD promoter-GSH1 prepared as described above was linearized with the restriction enzyme EcoR1, followed by electroporation (Funct. Plant Biol. (2002) vol. 29: 231-241. Chlamydomonas by Chlamydomonas reinhardtii ) was introduced into the CC503 strain (hereinafter referred to as "Cramidomonas"). Transformation strains (hereinafter referred to as "GSH1 overexpression strains") which the polynucleotide is inserted into genomic DNA and are stably inherited by the young generation accompanying the replication of the cells, the strain CC503 obtained bleomycin resistance Was selected as an indicator. Insertion of the plasmid DNA containing the polynucleotide into genomic DNA was confirmed by PCR.

In addition, the PsaD gene is a gene involved in photosynthesis. Therefore, by changing the intensity of light to be irradiated, it is possible to regulate the activity of the PsaD promoter and to regulate the expression level of the GSH1 gene. In other words, when strong light is irradiated to the GSH1 overexpressing strain, the expression level of the exogenous GSH1 in the GSH1 overexpressing strain increases, and when the light is irradiated, the amount of the exogenous GSH1 expression in the GSH1 overexpression strain decreases.

[Example 2]

GSH1 overexpressing strains prepared in Example 1 were subjected to semi-dependent nutritional conditions using Tris-acetic acid-phosphate (TAP) medium, pH 7 (see Proc. Natl. Acad. Sci. USA, 54, 1665-1669). And cultured under the condition of growth and starch production. As a control, CC503 strain (hereinafter referred to as “parent strain (wild-type strain)”), which is a wild-type Chlamydomonas strain, was used. The culture conditions of each sample are shown in Tables 1 and 2.

sample Cell types Culture solution Intensity of irradiated continuous light (μE / ㎡ / sec) One GSH1 Overexpression TAP badge 45 2 GSH1 Overexpression TAP Medium + 8mM BSO 45 3 GSH1 Overexpression TAP badge 17 4 GSH1 Overexpression TAP badge 80 5 Parent wine TAP badge 45 6 Parent wine TAP Medium + 8mM BSO 45 7 Parent wine TAP badge 17 8 Parent wine TAP badge 80

Intensity of irradiated continuous light (μE / ㎡ / sec) Any of 17,45,80 Temperature (℃) 24 Mixing ratio of media volume and preculture at the start of culture 95: 5 Medium used for preculture and intensity of irradiated continuous light (μE / ㎡ / sec) TAP badge
17 Rotational Shaft Rotational Speed (rpm) 120 Swing shaker amplitude (mm) 30 Medium amount at the start of culture (mL) 100 Form and volume of culture vessel (mL) Erlenmeyer flask, 500

In Samples 2 and 6, L-Buthionine-sulfoximine (abbreviated BSO (Model No. B2515, manufactured by Sigma Aldrich)) added to TAP medium is an inhibitor of GSH synthase.

The results are shown in Fig. 1 and Fig. Figure 1 (a) is a graph showing the proliferative capacity of GSH1 overexpressing strains. (b) is a figure which shows the state of the culture liquid 309 hours after the start of culture. 2 (a) is a graph showing the proliferative capacity of the parent strain (wild-type strain), and (b) is a diagram showing the state of the culture solution after 215 hours from the start of the culture.

The vertical axis of the graphs of FIGS. 1A and 2A shows the optical density OD, and the horizontal axis shows the incubation time. The optical density shown by the vertical axis | shaft was measured by the apparatus (ODSensor-S / ODBox-A by TAITEC company) which measures 0D value based on the amount of transmitted light of infrared rays (950 nm). In addition, arrows written in the graph indicate timings of performing flow cytometry (FCM).

As shown in Fig. 1 (a), all the cells of Samples 1 to 4 had proliferative capacity under semi-dependent nutritional conditions. Since there was no significant difference in the proliferative capacity of each sample, it was confirmed that the expression of the exogenous GSH1 gene did not affect the growth of Chlamydomonas. In addition, as shown in FIG. 1 (b), in the sample 1 or the sample 4, turbidity of the culture solution was recognized.

In addition, the term "semi-dependent nutrition" referred to in the present example means that acetic acid in the medium is incubated as a main carbon source, but since the light is irradiated and the culture flask is not sealed, the growth contribution is smaller than that of acetic acid. Carbon dioxide also means the thing used as a carbon source.

The culture solution of Sample 4 in which the clouding of the culture solution was recognized was collected in a microtube, and the urea starch reaction was performed on the white precipitate obtained by centrifugation. The results are shown in Fig. 1C. As shown in Fig. 1 (c), since the white particles recovered from Sample 4 were colored in blue violet by the urea starch reaction, it became clear that the starch was agglomerated. Therefore, it became clear that starch was produced in sample 1 or sample 4 in which turbidity of the culture solution was recognized. In addition, starch produced in GSH1 overexpressing cells was thought to be excreted out of the cells as starch particles.

On the other hand, in the sample 2 or the sample 3, the phenomenon that the culture liquid became cloudy was not recognized. In sample 2 to which BSO, an inhibitor of GSH synthetase, was added, it was considered that starch was not excreted from the cells because BSO inhibited the synthesis of GSH in the GSH1 overexpressing strain of sample 2. In addition, in sample 3 irradiated with weaker light to sample 1 or sample 4, the expression level of exogenous GSH1 in GSH1 overexpressing strain was smaller than that of sample 1 or sample 4, so that starch was not discharged out of the cells to the extent that the turbidity of the culture solution was recognized. Was fed.

On the other hand, as shown in (a) of FIG. 2, all of the cells of Samples 5 to 8 have proliferative capacity under semi-dependent nutritional conditions, but as shown in FIG. Was not recognized. In other words, starch particles were not discharged out of the cell under the culture conditions irradiated with light of 80 μE / m 2 / sec or less in the TAP medium in the parent strain (wild type strain).

In addition, flow cytometry was performed in order to analyze in more detail the state of the GSH1 overexpressing strain of Sample 4 and the parent strain (wild-type strain) of Sample 8. Specifically, each cell was irradiated with 488 nm excitation light and the fluorescence intensity around 600 nm was measured. This fluorescence near 600 nm corresponds to the fluorescence of chlorophyll. At the same time as the fluorescence of chlorophyll, fluorescent fine particles (trade name: Flow count) manufactured by Beckman Coulter Co., Ltd. were coexisted as an internal standard for measuring cell density, and 525 nm to 700 nm fluorescence emitted by 488 nm excitation light was measured. In addition, the size of the cell (particle) and the complexity inside the cell (particle) were measured by measuring forward scattered light and lateral scattered light.

The results are shown in FIGS. 3 and 4. (A) is a figure which shows the histogram of the cell (particle) which shows the fluorescence of the chlorophyll in the parent strain (wild-type strain) of sample 8, (b) shows in the culture of the parent strain (wild-type strain) of sample 8. A diagram showing the correlation between the size of suspended particles and the complexity inside the particles. 4A is a diagram showing a histogram of cells (particles) exhibiting chlorophyll fluorescence in the GSH1 overexpression of Sample 4, and (b) is suspended in the culture of GSH1 overexpression of Sample 4 A diagram showing the correlation between the particle size and the complexity inside the particle. In addition, the arrow shown in the drawing of FIG.3 (a) and FIG.4 (a) shows the peak of an internal standard. In addition, the rectangular frame described in the drawings of FIGS. 3 (b) and 4 (b) indicates the fraction in which live cells exist.

As shown in (a) and (b) of FIG. 3, in the parent strain (wild-type strain) of Sample 8, it was confirmed that most cells were living cells having chloroplasts (chlorophyll).

On the other hand, in the GSH1 overexpressing strain of Sample 4, as shown in FIG. 4 (a), chlorophyll fluorescence was hardly detected. As shown in FIG. 4B, in the GSH1 overexpressing strain of Sample 4, many living cells did not exist. In FIG. 4B, the particles present outside the quadrangular frame were considered to be starch particles discharged out of the cells. In other words, in GSH1 overexpressing strains, starch produced in cells is thought to be released out of the cells as starch particles with cell death.

Table 3 shows the "density of particles which emit fluorine derived from chlorophyll by irradiation with excitation light (488 nm)" in Figs. 3A and 4A, and the excitation light (488 nm) irradiation. Density of particles which do not emit chlorophyll-derived fluorescent particles ”are shown in Table 4. In addition, the number of the cells (particles) shown in Table 3 and Table 4 was computed based on the value of an internal standard, and was shown by the numerical value obtained by dividing the number of particles contained in 1 mL of culture liquid by the power of 10.

45 μE / ㎡ / sec BSO Free 45 μE / ㎡ / sec 8 mM BSO addition 17 μE / ㎡ / sec BSO Free 80 μE / ㎡ / sec BSO Free Parent wine 11,906 19,633 10,591 10,804 GSH1 overexpressing strain 1,451 4,228 2,380 241

45 μE / ㎡ / sec BSO Free 45 μE / ㎡ / sec 8 mM BSO addition 17 μE / ㎡ / sec BSO Free 80 μE / ㎡ / sec BSO Free Parent wine 48 27 22 57 GSH1 overexpressing strain 1,883 602 789 6,708

 [Example 3]

The GSH1 overexpressing strain prepared in Example 1 was cultured under nitrogen starvation conditions, and the proliferation ability and the production capacity of starch particles were evaluated. Specifically, GSH1 overexpressing strains were shaken in a swing subject for 8 days at 24 ° C. continuous light with a light quantity of 17 μE / m 2 / sec using the same TAP medium as in Example 2. Then, the cells were recovered as sediments by centrifugation (2000 g, 5 minutes) in order to exchange the culture solution, and the recovered cells were divided into two, and the cells were divided into TAP and N-free medium containing no nitrogen source (Gorman And Levine (see Proc. Natl. Acad. Sci. USA, 54, 1665-1669), in the composition of the TAP medium of the invention, a medium in which ammonium chloride was substituted with the same amount of potassium chloride) and resuspended in another cell. Was resuspended using conventional TAP medium containing ammonium. The cell density upon resuspension was adjusted to be about 1.1 times the cell density at the end of preculture with TAP medium. That is, the cells contained in 90 mL of preculture were resuspended in 100 mL of fresh medium. Shake culture was carried out in the swinging object at a light amount of 80 μE / m 2 / sec, and a portion of the culture was aliquoted daily, and the growth capacity and starch production capacity were evaluated. Parent strain (wild type strain, CC503 strain) was used as a control. The culture conditions of each sample are shown in Tables 5 and 6.

sample Cell types Culture solution 9 GSH1 overexpression TAP medium (N-containing) 10 GSH1 overexpression TAP N-free badge 11 Chinju (wild type liquor) TAP medium (N-containing) 12 Chinju (wild type liquor) TAP N-free badge

Intensity of irradiated continuous light (μE / ㎡ / sec) 80 Temperature (℃) 24 Rotating Shaft Rotation Speed (rpm) 120 Amplitude of swing shaker (mm) 30 Medium amount at the start of culture (mL) 100 Culture vessel shape and volume (mL) Erlenmeyer flask, 300

The results are shown in FIGS. 5 and 6. 5 is a graph showing changes over time in "density of cells (particles) exhibiting fluorescence of chlorophyll" and "density of cells (particles) exhibiting no fluorescence of chlorophyll" in Samples 9 and 10. FIG. FIG. 6 is a graph showing changes over time in "density of cells (particles) exhibiting fluorescence of chlorophyll" and "density of cells (particles) exhibiting no fluorescence of chlorophyll" in Samples 11 and 12. FIG. In the graphs of FIGS. 5 and 6, the vertical axis represents the density of cells (particles), and the horizontal axis represents the incubation time. The incubation time is expressed as 0 hours when the culture medium is replaced. 5 and 6, the "density of cells (particles) not exhibiting fluorescence of chlorophyll" corresponds to "density of starch particles". 5 and 6, "TAP normal" and "TAP N-free" in (b) and (c) are the meanings of "TAP containing nitrogen" and "TAP containing no nitrogen", respectively. .

As shown in (a) of FIG. 5, in the GSH1 overexpressing strain, in the culture medium containing the nitrogen source, the density of the cells having chloroplasts tended to increase once after incubation and then decrease thereafter. On the other hand, in the culture solution containing no nitrogen source, cells with chloroplasts hardly proliferated. In addition, the density of starch particles increased with time regardless of the presence of a nitrogen source in the culture. In addition, when the density of cells (cells with chloroplasts) in the culture medium decreased, the density of starch particles tended to increase.

On the other hand, as shown in (a) of FIG. 6, in the parent strain (wild strain), the cells proliferated in the culture medium containing the nitrogen source, but gradually increased in the culture medium containing the nitrogen source. In addition, in the parent strain (wild type strain), the density of the starch particles did not increase regardless of the presence or absence of a nitrogen source in the culture solution. It has been reported that starch accumulation occurs in parent strains (wild type strains) under nitrogen starvation conditions. However, starch particles are not discharged out of the cell even under nitrogen starvation conditions at the light intensity (80 μE / m 2 / sec) under conditions for culturing Chlamydomonas. Although the results were not shown, the starch particles were not discharged out of the cells in the parent strain (wild-type strain) in the case of irradiation with light of 250 µE / m 2 / sec.

From the cultures of samples 9, 10, 11, and 12, the starch contained in the sample which was partially extracted at intervals of 1 to 2 days was quantified. A glucose test Wako (manufactured by Wako Pure Chemical Industries, Ltd.) was used for quantification. The results are shown in Figs. 5B and 5C and Figs. 6B and 6C.

As shown in FIGS. 5B and 6B, in the case of nitrogen starvation conditions (TAP N-free medium), the starch concentration in the culture medium increased in both GSH1 overexpressing strain and parent strain (wild type strain). Doing. On the other hand, starch concentration in the medium did not increase in the case of non-nitrogen starvation conditions (TAP medium (containing N)) and parent strains (wild type strains). have.

5 (c) and 6 (c) show the results of expressing the amount of starch in the culture solution per cell with 1 million chloroplasts. As shown in the same figure, it was found that the productivity per cell of the GSH1 overexpressing strain was remarkably increased with or without nitrogen starvation conditions as compared to the parent strain (wild-type strain). This means that the yield of the medium component which is part of the raw material with respect to the accumulation of starch is superior to the parent strain (wild type strain) of the GSH1 overexpressing strain. It also means that the amount of waste consisting of cellular components is lower than that of GSH1 overexpressing strains (wild-type strains), and further, in terms of purification of starch, In contrast, it also means easy. In addition, when the cells are transferred from the proliferation stage to the production stage, it is also very easy to actually increase the cell density, and thus it is very advantageous to improve the productivity per cell.

In addition, the results of independently repeating the same experiments as those shown in FIGS. 5 and 6 are shown in FIGS. 19 and 20. FIG. 19 shows a time-dependent change in "density of cells (particles) exhibiting fluorescence of chlorophyll" and "density of cells (particles) exhibiting no fluorescence of chlorophyll" in Samples 9 and 10 as in FIG. It is a graph. FIG. 20 shows changes over time in "density of cells (particles) exhibiting chlorophyll fluorescence" and "density of cells (particles) not exhibiting chlorophyll fluorescence" in Samples 11 and 12 as in FIG. It is a graph. As shown in Fig. 19 and Fig. 20, the results obtained when the same experiment as in Fig. 5 and Fig. 6 were repeatedly performed showed the same tendency as the results shown in Figs. It was confirmed to be high.

Example 4

The GSH1 overexpressing strain prepared in Example 1 was cultured under independent nutritional conditions, and the proliferative capacity and the production capacity of starch particles were evaluated. Specifically, GSH1 overexpressing strains were precultured in TAP medium, then passaged to HSM medium (see Proc. Natl. Acad. Sci. USA (1960) 46, 83-91) and inserted near the bottom of the culture vessel. It was irradiated with light while supplying sterile air through one glass tube. A magnetic stirrer was used for stirring the culture solution. Detailed culture conditions are shown in Table 7. As a control, parent strain (wild strain) was cultured under the same conditions, and the proliferation ability and the production ability of starch particles were evaluated.

Intensity of irradiated continuous light (μE / ㎡ / sec) 80 Temperature (℃) 24 Mixing ratio of media volume and preculture at the start of culture 12: 1 Intensity of medium and irradiated continuous light used for preculture
(μE / ㎡ / sec) TAP badge
17 Aeration amount (L / min) 1-2 Medium amount at the start of culture (mL) 325 Form and volume of culture vessel (mL) Cylindrical Median Bottle, 500

Sterilized water was supplemented in a timely manner to maintain approximately 300 mL of media volume decreased by evaporation following aeration.

 The results are shown in Table 7. 7A shows the density of "cells (particles) exhibiting chloroplast fluorescence" and "density of cells (particles) not showing chloroplast fluorescence" in GSH1 overexpressing strains and parent strains (wild-type strains). It is a graph which shows the change over time, (b) is a graph which shows the change over time of the amount of starch per culture. In the graph of Fig. 7A, the vertical axis represents the density of cells (particles), and the horizontal axis represents the incubation time. Incubation time is expressed as 0 hours when the incubation is started under autotrophic conditions. In addition, in the graph of FIG. 7A, the "density of cells (particles) not showing fluorescence of chloroplasts" corresponds to "density of starch particles".

As shown in (a) of FIG. 7, in the GSH1 overexpressing strain, the rate of increase was slower than that of the parent strain (wild-type strain), but the cell density increased over time. In addition, the density of starch particles tended to increase linearly with the increase of cell density. In contrast, in wild-type strains, the cell density increased, but starch particles were hardly discharged out of the cells.

In addition, urea starch reactions were performed on GSH1 overexpressing strains and parent strains (wild-type strains) 10 days after culture under independent nutritional conditions. Specifically, cells (particles) were recovered by centrifugation from 1 mL of GSH1 overexpressing culture medium. Similarly with respect to the parent strain (wild strain strain), cells (particles) were recovered from the culture solution. The recovered cells (particles) were treated with acetone, chlorophyll was removed from the cells, and then urea starch reaction was performed. The removal of chlorophyll from the cells is easy to see the result of the urea starch reaction.

The result is shown in FIG. It is a figure which shows the result of the urea starch reaction in GSH1 overexpressing strain and parent strain (wild-type strain). As shown in FIG. 8, in the GSH1 overexpressing strain, the white particles were colored deep blue violet by the urea starch reaction, and it was confirmed that the starch particles were discharged out of the cells. Also in the parent strain (wild type strain), the coloration was weak but a slight urea starch reaction was recognized. From these results, it was suggested that a certain amount of starch was produced in the parent wine (wild-type wine) even under the conditions of independent nutrition under nitrogen starvation.

Starch was quantified using 1 mL of a culture solution sample obtained daily over time for the culture under the independent nutrient condition shown in FIG. Glucose test Waco (made by Wako Pure Chemical Industries Ltd.) was used for quantification.

The results are shown in Fig. 7B. In the GSH1 overexpressed strain, starch production is faster than the parent strain (wild-type strain). In the GSH1 overexpressing strains, starch production was higher than that of the parent strain (wild-type strains) subjected to the same culture. For example, the starch concentration in the culture solution on the 10th day of culture was 416.8 mg in GSH1 overexpressing strain and 196.4 mg in parent strain (wild-type strain) per 1 L of culture medium. Therefore, the productivity per culture was more than twice as high as the parent strain (wild type strain) of the GSH1 overexpression strain. This means that the yield of the medium component which is part of the raw material with respect to the accumulation of starch is superior to the parent strain (wild type strain) of the GSH1 overexpressing strain. In addition, it means that the generation amount of waste consisting of cellular components is lower than that of GSH1 overexpressing strains (wild-type strains), and that the GSH1 overexpression strain is easier than starches (wild-type strains) in terms of starch purification. It also means. In addition, the results of the examples shown in (a) and (b) of FIG. 7 show that the cell proliferation is suppressed with respect to the amount of starch produced. Thus, GSH1 overexpressing strains can be used more effectively than the parent strains (wild type strains). It is a strain, suggesting that it is more preferable as a cell line when starch production by photosynthesis is performed continuously.

[Example 5]

100 mL of TAP medium was inoculated with the GSH1 overexpressing strain prepared in Example 1 and cultured under continuous light of 80 μE / m 2 / sec. Continuously monitor the OD value based on the amount of transmitted light of infrared light (950 nm), separate 5 mL of the culture medium in the logarithmic growth phase or the normal phase, transplant the separated culture medium into a new 100 mL of TAP medium, and continue culturing in the same manner. It was.

9 shows the results of examining the proliferative capacity of GSH1 overexpression strains. The arrows shown in FIG. 9 indicate the time points at which the culture solution was separated. In Fig. 9, "primary" means primary culture, "passage 1" means first passage culture, "passage 2" means second passage culture, and "passage 3". "Means passage 3rd passage, and" passage 4 "means passage 4th passage.

As shown in FIG. 9, the GSH1 overexpressing strain as well as the logarithmic growth phase, even if the culture was about 150 hours after entering the normal phase, it was confirmed that new growth is possible as a seed culture (seed culture). In addition, the approximation of the exponential irrigation growth interval of the primary culture (primary) is expressed as y = 0.0067 x-0.4287, R ² = 0.9959. In addition, the approximation of the exponential irrigation growth interval of the first passage (passage 1) is expressed as y = 0.0085 x-1.774, and R ² = 0.9952.

However, in the case of using the seed cultured for about 150 hours after entering the normal phase as the seed, the increase in proliferation was slowed by about 18 hours compared with the case in which the culture immediately after entering the normal phase was used as the species. As a result, it was clear that in the GSH overexpressing strain, not all cells were destined for cell death at the end of the logarithmic growth phase, but that cells having proliferative capacity were included in the population in which the logarithmic growth phase was terminated. That is, it became clear that in GSH1 overexpressing strain, repeated batch culture using the cells of a logarithmic growth phase and a normal phase was possible.

The result of having analyzed the characteristic of GSH1 overexpressing strain in each propagation stage in more detail is shown in FIG. Fig. 10 shows the results of investigating the state of GSH1 overexpressing strain at each passage point, and (a) shows the size and complexity of cells inside the GSH1 overexpressing strain when performing "passage 1" shown in Fig. 9. (B) is a diagram showing a correlation between the size of cells of GSH1 overexpressing strain and the complexity within the cells when "passage 2" shown in FIG. 9 is performed. c) is a diagram which shows the correlation between the size of the GSH1 overexpressing cell and the complexity inside the cell when "passage 3" shown in FIG. 9 is performed.

As shown in FIG. 10, it was confirmed that starch particles were released at any culture period (log phase and normal phase) in the GSH1 overexpressing strain. In the correlation diagram between forward scattering and lateral scattering of FIGS. 10A to 10D, the group of particles recognized at the lower left angle corresponds to starch particles. It is confirmed from FIG. 10 (a)-(c) that starch particle is contained abundantly.

From the above results, it became clear that even in the culture of logarithmic growth phase, starch particles were released from the GSH1 overexpressing strain.

[Example 6]

In the GSH1 overexpressing strain prepared in Example 1, the shape of the starch particles released out of the cells was observed. Specifically, starch particles released out of the cells were suspended in 1 mL of 0.01% Tween 20 (trademark, manufactured by Sigma, Model No. P1379), and further 9 mL of Percoll (trademark, manufactured by Sigma, Model No. P1644). Was added, dispersed, and centrifuged (9,100 xg, 30 minutes) to purify, and the resulting starch particles were observed using a scanning electron microscope.

It is a figure which shows the result of having observed the shape of the starch particle discharged out of the cell from the GSH1 overexpressing strain. (A) is a figure which shows the result of having observed the starch particle using the scanning electron microscope. As shown in Fig. 11 (a), the starch particles produced by the GSH1 overexpressing strain has a small average particle diameter of 1.3 mu m (standard deviation 0.181), short diameter 1.0 mu m (standard deviation 0.204), It was also confirmed that the particles were uniform in size. Since general starch particles made by corn, potato, wheat and the like have an average particle diameter of 10 to 50 μm, it can be seen how minute the starch particles produced by the GSH1 overexpressing strain are.

Thus, starch particles produced by GSH1 overexpressing strains are finer than general starch particles made by corn, potatoes, wheat and the like. Such fine starch particles are useful in the manufacture of pharmaceuticals.

In addition, the release of starch particles in the GSH1 overexpressing strain is due to cell rupture. Autolysis occurs before and after cell rupture, but the starch particles themselves are not degraded by enzymes that cause self-lysis. For this reason, starch particles with small impurities are obtained in GSH1 overexpressing strains.

Specifically, in the case where the cells do not self-melt, a step of destroying the cells by chemical or physical means such as polishing is required to extract the starch particles that accumulate in the cells, and debris of the broken cells becomes residue. Incorporate into starch particles. On the other hand, when cells self-thaw, polymer proteins, carbohydrates, membrane systems, and the like are further decomposed into small molecules by the enzymatic reaction, resulting in fewer cell fragments. In addition, the absence of cells means that the production efficiency of starch particles per raw material (medium component) is high, and the yield is good. In addition, low-molecular substances produced by self-melting are considered to be available for the growth of algae, and it is thought that the saving of the medium necessary for the growth of algae can be expected by the recycling of such substances. Cell fusion does not occur in wild-type lines, but only in GSH1 excess cell lines.

In addition, although FIG. 11 (a) is a figure which shows the result of the urea starch reaction in the starch particle | grains released from GSH1 overexpression strain, the starch particle | grains released from GSH1 overexpression strain as shown in FIG.11 (b). It was confirmed that was colored blue violet by urea starch reaction as corn starch used as a control.

In addition, Figure 11 (c) is a diagram showing the starch production capacity of GSH1 overexpression strain when BSO is added as inhibitor of GSH synthase, GSH synthesis is not inhibited in GSH1 overexpression strain without BSO addition Starch is excreted out of cells, whereas starch is not excreted out of cells in BSH-added GSH1 overexpressing strains, since the synthesis of GSH is inhibited by BSO.

[Example 7]

The fat production capacity in the GSH1 overexpressing strain was examined. Specifically, the GSH1 overexpressing strain prepared in Example 1 was pre-cultured in 200 mL of TAP medium (including a nitrogen source) under a continuous light of 17 μE / m 2 / sec over 4 days. Cells contained in 90 mL of culture are then recovered by centrifugation (2,000 g, 5 minutes), and the collected cells are collected in TAP medium containing a fresh nitrogen source (100 mL) or without a fresh nitrogen source. Medium exchange was performed by resuspending in medium (100 mL). Thereafter, the cells were incubated for 6 days under continuous light of 80 µE / m 2 / sec. Cells at the end of preculture and 6 days after medium exchange were stained with nile red, and the stained cells were provided by flow cytometry.

As a control, the same experiment was performed using the Chlamydomonas Reinharditi CC503 strain (wild-type strain), the parent strain of the GSH1 overexpressing strain.

Fig. 12 shows the results of the maintenance of the production capacity of the GSH1 overexpressing strain, (a) shows a histogram of cells showing fluorescence derived from Nile red in the parent strain (wild-type strain), and (b) shows GSH1. It is a figure which shows the histogram of the cell which shows the fluorescence derived from Nile red in overexpressing strain, (c) The observation result by the confocal laser microscope of the parent strain (wild-type strain) stained Nile red contained in preculture. (D) is a figure which shows the observation result by the confocal laser microscope of the GSH1 overexpression strain stained with Nile red contained in preculture. In addition, in the histograms at the top of FIGS. 12A and 12B, the light gray peak corresponds to the cells incubated with a TAP medium containing a nitrogen source, and the gray hair peak is a cell cultured in a TAP medium containing no nitrogen source. And the peak of the first right side (the first fluorescence intensity is strong) corresponds to the artificial fluorescent beads (internal standard) added to determine the particle density. Histograms at the bottom of FIGS. 12A and 12B correspond to Nile red stained cells included in preculture.

As shown in FIG. 12, in GSH1 overexpressing strains, culture samples of pre-culture (containing nitrogen sources) in which the fluorescence intensity per cell was incubated for 4 days, culture samples after 6 days of exchange with nitrogen source-containing medium, and medium without nitrogen source In all of these three-point culture samples after 6 days, the samples were increased compared with the parent strain. These results indicate that the amount of GSH1 overexpressing strains is higher than that of parent strains (wild-type strains) with respect to the amount of fat or oil contained in individual cells. Specifically, the fluorescence intensity of fluorescence derived from Nile red in the GSH1 overexpressing strain was 0.5-fold fold (about 3.2-fold) of about 10 compared to the parent strain (wild-type strain).

Figure 13 shows the results of examining the state of GSH1 overexpressing strain, (a) is a diagram showing the correlation between the size of the GSH1 overexpressing cells and the complexity of the cells, (b) is GSH1 overexpressing cells (C) is a diagram showing the correlation between the size of and the fluorescence intensity derived from Nile red, and (c) shows the size of the cell and the complexity within the cell with respect to the cells contained in the quadrangular region in the diagram of (b). (D) is a figure which shows the correlation between the size of the cell of a parent strain (wild-type strain), and the complexity inside a cell.

 As shown in (c) of FIG. 13, when the gate is gated with respect to the population of particles that strongly fluoresce in FIG. 13 (b) (particles in the four-cornered region in FIG. 13 (b)), the cells become stronger. It was found that light emission. On the other hand, it was found that the beneficial microparticles (ie, the population of the microparticles to which the starch particles belong) did not emit light. From the above, it was confirmed that the fine particles made of fats and oils were not included in the population of the fine particles which displayed forward scattering at the same level as the starch particles and displayed side scattering at the same level as the starch particles.

In addition, the strong emission of fluorescence derived from Nile red is when a cell leaves its morphology, and when a cell is destroyed and the fat contained therein is advantageous from the cell, it cannot be detected by the flow cytometer (FCM) (detection). Hard to be). For this reason, when cell disruption in GSH1 overexpressing strain advances, the difference in the maintenance amount between GSH1 overexpressing strain and parent strain (wild-type strain) is considered that the estimate may come out smaller than actually.

Here, in order to clarify the difference between GSH1 overexpressing strain and parent strain (wild-type strain), fatty acids were extracted from each cell and quantitative quantitative analysis was performed. Specifically, the same cells as those provided in the flow cytometry (cells cultured for 6 days under a continuous light of 80 μE / m 2 / sec in a TAP medium containing a nitrogen source or a TAP medium containing no nitrogen source) The fatty acid produced by the GSH1 overexpressing strain was recovered by the method developed by Blig and Dyer (see Can. J. Biochem. Physiol. 37 (8): 911-917), and the recovered fatty acid. After methyl esterification, it was provided by gas chromatograph mass spectrometry (GC / MS). In GC / MS pentadecanoic acid was added as internal standard. Pentadecanoic acid was added in the same amount for all samples. The same experiment was performed using the Chlamydomonas Reinhardti CC503 strain (wild-type strain), the parent strain of the GSH1 overexpressing strain, as a control.

That is, the samples provided to GC / MS are four types:

(i) Parent strains (wild-type strains) cultured in the presence of nitrogen

(ii) Parent strains cultured under nitrogen starvation conditions (wild strains)

(iii) GSH1 overexpressing strains cultured in the presence of nitrogen

(iv) GSH1 fruit expression strains cultured under nitrogen starvation conditions

In addition, the following commercial items were used as a standard of fatty acid. Pentadecanoic acid (manufactured by GL Sciences, model number 1021-43150), palmitic acid (manufactured by Sigma, model number P0500), palmitoleic acid (manufactured by Sigma, model number P9417), stearic acid (manufactured by Sigma, model number S4751 ), Oleic acid (manufactured by Sigma, model number 01008), linoleic acid (manufactured by Sigma, model number L1376), linolenic acid (manufactured by Sigma, model number L2376).

Fig. 14 shows the results of gas chromatography mass spectrometry. As shown in FIG. 14, the peak corresponding to palmitic acid (C _{16: 0} ) contained in the standard was observed in all the samples. As a result, it was confirmed that palmitic acid is produced as fatty acid in the parent strain (wild type strain) and GSH1 overexpression strain.

Table 8 shows the results of quantifying the maintenance amount contained in the parent strain (wild-type strain) and the GSH1 overexpressing strain.

Cell strain Nitrogen source Μg / mL culture Μg / million cells Parent
(Wild type liquor) Exists 4.7 0.3 Absent 14.3 1.0 GSH1 Overexpression
Exists 3.9 2.6 Absent 5.4 5.0

As shown in Table 8, when the amount of oil contained per million cells was compared, it was confirmed that the amount of oil contained in the GSH1 overexpressing strain was more than five times higher than that of the parent strain (wild type strain). From the above, it was confirmed that the amount of oil and fat contained in the cells was increased by increasing the glutathione concentration in the chloroplast in algae.

[Example 8]

Chlamydomonas Reinhardt sta6 deletion mutant (also called "sta6 mutant") has been reported to have a higher fat content than wild type (Cramidomonas reinhardt sta6) strains. Staining oil bodies, reservoirs of intracellular maintenance with Nile Red, has been reported to contain larger and more oil bodies than the wild type (Wang et al. (2009) Eukaryotic Cell Vol. 8 (12)). : 1856-1868. (Non-Patent Document 1).

In this regard, GSH1 overexpressing strains were prepared using sta6 deletion mutants as parent strains. Specifically, the GSH1 overexpression strain (see Example 1) was used in the same manner as in Example 1, except that the CC4333 strain, which was a sta6 mutant strain (received from Kramido Monas Center, Duke University, USA), was used instead of the Chlamydomonas Reinhardt CC503 strain. GSH overexpressing strain (sta6-background) ".

FIG. 15 shows the results of examining the state of GSH1 overexpressing strain (sta6-background) and its parent strain (sta6-), and (a) shows the correlation between the cell size of the parent strain (sta6-) and intracellular complexity. (B) is a diagram showing the correlation between the size of the cells of the GSH1 overexpressing strain (sta6-background) and the complexity within the cells.

As shown in FIG. 15, no difference was observed between the GSH1 overexpressing strain (sta6-background) and the parent strain (sta6-) with respect to the correlation diagram between forward scattering and lateral scattering. This means that, as observed by flow cytometry, no difference was observed in cell size or intracellular structure between the GSH1 overexpression strain (sta6-background) and parent strain (sta6-).

Next, 100 ml of TAP medium was inoculated with GSH1 overexpressing strain (sta6-background), and precultured for 5 days under continuous light of 17 μE / m 2 / sec. Thereafter, cells contained in 90 mL of culture were collected by centrifugation (2,000 g, 5 minutes). Media exchange is performed by resuspending the collected cells in TAP medium containing 90 mL of fresh nitrogen source, or TAP medium containing no 90 mL of fresh nitrogen source, and further subjected to continuous light of 80 μE / m 2 / sec for 3 days. Incubated at. At the end of preculture and on day 3 after medium exchange, the cells were stained with Nile Red and the stained cells were fed to flow cytometry. The same experiment was performed using the sta6 mutant strain (CC4333 strain, sta6-), the parent strain of the GSH1 overexpressing strain (sta6-background).

Figure 16 shows the results of the maintenance production capacity of GSH1 overexpressing strain (sta6-background) and its parent strain (stat6-) after preculture and 3 days after medium exchange, and (a) shows GSH1 overexpression after preculture. A diagram showing a histogram of cells showing fluorescence derived from Nile red in the strain (sta6-background) and its parent strain (sta6-), and (b) shows the GSH1 overexpressing strain (sta6-background) on day 3 after medium exchange. And a histogram of cells showing fluorescence derived from nired in its parent strain (sta6-). In Figs. 16A and 16B, the result of the parent strain sta6- indicates a dark gray histogram, and the result of the GSH1 overexpression strain (sta6-background) is indicated by a light gray histogram.

As shown in Fig. 16B, in the GSH1 overexpressing strain (sta6-background) strain on the third day after the medium exchange, the distribution region of the fluorescence intensity is moved to the stronger side (right) than the parent strain (sta6-). It was. This indicates that the GSH1 overexpressing strain (sta6-background) strain has higher intracellular maintenance content than the parent strain (sta6-).

From the above results, it was confirmed that the amount of oil contained in the cells was increased by increasing the glutathione concentration in the chloroplast in algae.

[Example 9]

The GSH1 overexpressing strain prepared in Example 1 was inoculated in Tris-acetic acid-phosphate (TAP) medium, pH 7 (see Pro. Natl. Acad. Sci. USA, 54, 1665-1669), and It was placed in a culture chamber, shaken, and incubated under semi-dependent nutritional conditions of irradiating continuous light of 100 µE / m 2 / sec. Every 2 days, cells contained in 1 mL of culture were collected and chlorophyll a and chlorophyll b were extracted using a solvent consisting of 80% acetone / 20% water. Measure the absorbance at wavelength 645 nm and 663 nm using a spectrophotometer, and calculate the chlorophyll a by the formula calculated by Porra from these values (see Biochim, Biophys, Acta (1989), 975, 384-394). And the amount of chlorophyll b was calculated.

It is a figure which shows the result of having examined the amount of chlorophylls of GSH1 overexpression strain manufactured in Example 1. FIG. As shown in FIG. 17, the total amount of chlorophyll (the sum of the amount of chlorophyll a and the amount of chlorophyll b) increases with the proliferation of cells from the fourth day to the tenth day of culture, but thereafter, mainly decreases due to degradation of chlorophyll a. The total amount of chlorophyll reached its maximum at day 10 of culture and was 3.8 μg / mL per culture. This is less than 7.6 μg / mL, the total amount of chlorophyll in the parent strain (wild type strain). In other words, the total amount of chlorophyll per culture was smaller than the parent strain (wild type strain) of the GSH1 overexpression strain throughout the entire culture period.

The smaller the total amount of chlorophyll per culture, the smaller the loss of light energy due to excess light absorption by algae. In other words, when liquid culture is carried out under the same amount of light, it can be said that the smaller the total amount of chlorophyll per culture can deliver the light energy to the deeper part of the culture. A study of reducing the chlorophyll antenna size of photochemical system 2 by reducing the amount of chlorophyll b has been reported (Tanaka et al. (1998) Proc. Natl. Acad. Sci. USA, Vol. 95, 12719-12723 and Polle et al. ( 2000) Planta Vol. 211, 335-344). Operation to reduce the amount of chlorophyll b also has the effect of delivering light energy to the deeper parts of the culture.

The total amount of pigments associated with photosynthesis suggests that changing the composition ratio contributes to the improvement of the productivity of photosynthetic products.

As shown in FIG. 17, it is possible to change the total amount of pigments and the composition ratio of pigments by overexpression of GSH1. Therefore, it is suggested that overexpression of GSH1 contributes to productivity improvement of photosynthetic products.

[Example 10]

The recombinant DNA molecule | numerator was produced by the following procedures in order to express gshA which is the gamma glutamyl cysteine synthase gene derived from E. coli in the cyanobacteria Synechococcus.

 (1) The 3700th base of Escherichia coli vector-pACYC187 (manufactured by Japan Gene, Model No. 313-02201, SEQ ID NO: 9) was replaced with cytosine from adenine to prepare a recognition site for restriction enzyme Smal. This vector was then treated with two restriction enzymes, SmaI and SalI, to prepare a DNA fragment of about 2.7 kb that contained the chloramphenicol resistance gene and the replication origin (p15A ori).

(2) PCR method using about 1.6 kb of DNA fragment (SEQ ID NO: 10) containing the gshA gene as the template and genomic DNA of E. coli JM109 strain, and using two kinds of primer DNA (SEQ ID NO: 12 and SEQ ID NO: 13) It prepared by. The obtained PCR fragment was treated with restriction enzyme Xhol.

(3) The DNA fragments prepared in steps (1) and (2) were linked by T4 DNA ligase and amplified using E. coli. The size of the digested product by various restriction enzymes was examined, and a plasmid having a structure (hereinafter referred to as "CAT-gshA gene cassette") in which gshA was linked downstream of the target chloramphenicol resistance gene (hereinafter, abbreviated as CAT). It was confirmed that was completed. This plasmid was named "pACYC184R-SmaI-E.c.gshA".

(4) Next, a gene region called a replication region that drives autonomous DNA replication in cyanobacteria was cloned. Specifically, referring to Akiyama et al. (1999) DNA RESEARCH 5, 327-334, the replication region included in the plasmid pAQ1 present in the cells of the cyanobacteria Synechococcus PCC7002 strain (American type culture collection ATCC 27264) 11) was amplified by the PCR method. The two types of PCR primer sequences used are shown in SEQ ID NO: 14 and SEQ ID NO: 15. The DNA fragment obtained by ringing the obtained PCR fragment of about 3.4 kb and the plasmid vector pZero2 (registered trademark, Invitrogen) with the restriction enzyme EcoRV was linked by T4 DNA ligase and amplified using E. coli. The size of the digested product by various restriction enzymes was examined, and it was confirmed that a plasmid having a gene region capable of autonomously replicating DNA in the target cyanobacteria was completed. This plasmid was named "pZero2-pAQ1-ori".

(5) Finally, a gene cassette expressing Escherichia coli gshA by readthrough of CAT was placed on a plasmid that autonomously replicates in cyanobacteria. Specifically, pACYC184R-SmaI-E.c.gshA prepared in step (3) was used as a template and amplified by PCR using two kinds of PCR primers (SEQ ID NO: 16 and SEQ ID NO: 17). A PCR fragment of about 2.7 kb obtained and a DNA fragment of about 6.2 kb generated by digesting pZero2-pAQ1-ori prepared in step (4) with restriction enzyme StuI were linked by T4 DNA ligase and amplified using E. coli. I was. The size of the digested product by various restriction enzymes was examined, and it was confirmed that a plasmid having a gene region and a CAT-gshA gene cassette capable of autonomous DNA replication in a desired cyanobacteria was completed. This plasmid was named "pSyn5".

(6) The plasmid used for the control experiment of the experiment which introduces Syn5 to cyanobacteria was constructed. This is a plasmid with only CAT and no gshA. Specifically, pACYC184 was amplified by PCR using two kinds of PCR primers (SEQ ID NO: 16 and SEQ ID NO: 18) as a template. The obtained 1.1 kb PCR fragment and the 6.2 kb DNA fragment generated by digesting pZero2-pAQ1-ori prepared in step (4) with restriction enzyme StuI were linked by T4 DNA ligase and amplified using E. coli. I was. The size of the digested product by each restriction enzyme was examined, and it was confirmed that the plasmid having the gene region and the CAT gene that enables autonomous DNA replication in the target algae was completed. This plasmid was named "pSyn3".

Plasmids pSyn5 and pSyn3 were introduced separately as cyanobacteria Synechococcus PC7002 strains by known methods (see Fringaard et al. (2004) Methods in Molecular Biology, Vol. 274, 325-340). The transformants into which each of the plasmids were introduced were identified as "E. c. gshA plus strain "," E. c. gshA minus strain ”. `` E. c. In the gshA plus strain, γ glutamyl cysteine synthase derived from Escherichia coli acts. E. c. In the gshA minus strain, γ glutamyl cysteine synthase derived from Escherichia coli does not exist.

Separately, these two kinds of cyanobacteria are 80 mg of Daigo medium (in 1 L of purified water, 500 mg of Daigo IMK medium (Japan Pharmaceutical, Model No. 398-01333), artificial seawater SP (Japan Pharmaceutical, Model No. 395-013443) ) 36 g, trishydroxymethylaminomethane (Nakalai, model number 35434-21) 1 g, sodium bicarbonate (Wako quasi-agent, Model No. 198-01315) 1 g, chloramphenicol (Wako quasi-agent, Model No. 034-) 10572) 10 mg of the solution was dissolved and filtered and sterilized, and the mixture was stirred while passing through the air, kept at 30 ° C, and irradiated with continuous light of 70 µE / µE / m 2 / sec for 3 days.

Cells contained in 1 mL of culture were collected by centrifugation and suspended in 0.2 mL of water. Next, 0.8 mL of acetone was added and the mixture was stirred vigorously to extract a dye. Cell debris was removed by centrifugation, and the absorbance spectrum of the solution of the clear pigment was measured using a spectrophotometer.

18 is a diagram showing the results obtained by examining the absorption spectra of pigments extracted from the EcgshA plus strain and the EcgshA minus strain, which are transformants of cyanobacteria. (A) is a figure which shows the absorption spectrum of the EcgshA plus strain, (b) is a figure which shows the EcgshA minus strain, (c) the spectrum which subtracted the spectrum of the EcgshA minus strain from the spectrum of the EcgshA plus strain The figure which shows. As in the result obtained in Example 9, in the case of cyanobacteria, the EcgshA plus strain was found to have a change in pigment composition compared to the EcgshA minus strain (FIG. 18). As a result, even when γ glutamyl cysteine synthase was overexpressed with cyanobacteria, the same effects on photosynthesis as those of the GSH1 overexpressing strain prepared in Example 1 were obtained.

Industrial availability

According to the present invention, biomass can be produced from algae more efficiently and at a lower cost than before. Biomass is expected to be used as a raw material for biofuels. For this reason, the present invention has applicability in a wide range of industries such as the energy industry.

<110> JAPAN SCIENCE AND TECHNOLOGY AGENCY   <120> ALGA IN WHICH PRODUCTION OF PHOTOSYNTHETIC PRODUCTS IS IMPROVED, AND USE FOR SAID ALGA <130> IPA130106 <150> JP 2010-194210 <151> 2010-08-31 <160> 18 <170> KopatentIn 2.0 <210> 1 <211> 479 <212> PRT <213> Chlamydomonas reinhardtii <400> 1 Met Ala Leu Ala Ser Gly Val Gly Arg Arg Gln His Val Ser Ala Ser 1 5 10 15 Pro Ser Arg Ser Arg Gly Val Pro Ser Pro Arg Leu Ser Pro Val His             20 25 30 Ala Asn Ala Pro Ala Val Ala Glu Arg Arg Thr Glu Pro Leu Leu Lys         35 40 45 Gln Glu Leu Val Asp Tyr Leu Lys Ser Gly Cys Arg Pro Arg Ser Ala     50 55 60 Trp Arg Ile Gly Thr Glu His Glu Lys Leu Gly Phe Asn Leu Ala Asp 65 70 75 80 Asn Ser Arg Met Asn Tyr Asp Gln Ile Ala Gln Val Leu Arg Lys Leu                 85 90 95 Glu Ala Arg Phe Gly Trp Glu Pro Ile Met Glu Glu Gly Arg Ile Ile             100 105 110 Gly Val Gln Leu Asp Gly Gln Ser Val Thr Leu Glu Pro Gly Gly Gln         115 120 125 Phe Glu Leu Ser Gly Ala Pro Val Glu Thr Ile His Lys Thr Cys Ala     130 135 140 Glu Val Asn Ser His Leu Tyr Gln Val Lys Ala Ile Cys Glu Glu Leu 145 150 155 160 Gln Thr Gly Phe Leu Gly Val Gly Phe Asp Pro Lys Trp Ala Ile Ser                 165 170 175 Asp Val Pro Met Met Pro Lys Gly Arg Tyr Lys Leu Met Lys Ser Tyr             180 185 190 Met Pro Thr Val Gly Ser Met Gly Leu Asp Met Met Phe Arg Thr Cys         195 200 205 Thr Val Gln Val Asn Leu Asp Phe Glu Ser Glu Gln Asp Met Val Glu     210 215 220 Lys Phe Arg Ile Gly Leu Ala Leu Gln Pro Ile Ala Asn Ala Leu Phe 225 230 235 240 Ala Ser Ser Pro Phe Lys Glu Gly Lys Pro Thr Gly Tyr Leu Ser Thr                 245 250 255 Arg Gly His Val Trp Thr Asp Val Asp Ala Ser Arg Thr Gly Asn Leu             260 265 270 Pro Phe Val Phe Glu Lys Asp Met Cys Phe Glu Ser Tyr Val Asp Tyr         275 280 285 Ala Met Ala Val Pro Met Tyr Phe Val Tyr Arg Asn Gly Gln Tyr Ile     290 295 300 Asn Ala Leu Gly Met Ser Trp Lys Asp Phe Met Ala Gly Lys Leu Pro 305 310 315 320 Ala Leu Pro Gly Glu Tyr Pro Thr Ile Ala Asp Trp Ala Asn His Leu                 325 330 335 Thr Thr Ile Phe Pro Glu Val Arg Leu Lys Lys Phe Leu Glu Met Arg             340 345 350 Gly Ala Asp Gly Gly Pro Trp Arg Met Leu Cys Ala Leu Pro Ala Leu         355 360 365 Trp Val Gly Leu Ile Tyr Asp Pro Glu Ala Gln Arg Gln Ala Leu Ala     370 375 380 Leu Ile Glu Asp Trp Thr Pro Ala Glu Arg Asp Tyr Leu Arg Thr Glu 385 390 395 400 Val Thr Arg Phe Gly Leu Arg Thr Pro Phe Arg Ala Gly Thr Val Gln                 405 410 415 Asp Val Ala Lys Gln Val Val Ser Ile Ala His Gly Gly Leu Glu Arg             420 425 430 Arg Gly Tyr Asp Glu Thr Ser Phe Leu Lys Arg Leu Glu Val Ile Ala         435 440 445 Glu Thr Gly Leu Thr Gln Ala Asp His Leu Leu Glu Leu Tyr Glu Thr     450 455 460 Lys Trp Gln Arg Ser Val Asp Pro Leu Tyr Lys Glu Phe Met Tyr 465 470 475 <210> 2 <211> 1440 <212> DNA <213> Chlamydomonas reinhardtii <400> 2 atggctctcg cctcaggcgt tggccgtcgc cagcatgtgt cggcctcgcc ctcgcgcagt 60 cggggtgtgc caagcccacg cttgagccct gtccacgcga acgcgcctgc ggttgcggag 120 cgtcgcacag agcccctctt aaagcaggag ctggtggatt acctgaaatc ggggtgtagg 180 cctcgcagcg cgtggcgaat cggcaccgag cacgagaagc tgggtttcaa cctggcagac 240 aacagccgca tgaactacga ccagattgca caggtgctac gcaagctgga ggcccggttt 300 ggttgggagc ccatcatgga ggagggccgt atcatcggcg tgcagttgga tggtcagagt 360 gtgacgctgg agcccggcgg ccagtttgaa ctgagcgggg cgcccgtgga gaccattcac 420 aagacgtgtg cggaggtgaa cagccacctc taccaggtca aggccatctg cgaggagctt 480 cagacaggat tcctgggcgt gggctttgac cccaagtggg ccatcagcga cgttcccatg 540 atgcccaagg gccgctacaa gctgatgaag tcgtacatgc ccacggtggg ctccatgggc 600 ctggacatga tgttccgcac atgcaccgtg caggtgaacc tggactttga gagcgagcag 660 gacatggtgg agaagttccg catcggcctg gcgctgcagc ccatcgccaa cgcgctcttc 720 gccagctcgc cattcaagga gggcaagccc accgggtacc tgagcacccg cggtcacgtg 780 tggacggacg tggacgcctc gcgcaccggc aacctgccgt tcgtgttcga gaaggacatg 840 tgcttcgaga gctacgtgga ctacgccatg gcggtgccca tgtacttcgt gtaccgcaac 900 gggcagtaca tcaacgcgct gggcatgagc tggaaggact tcatggccgg caagctgccc 960 gcgctgccgg gcgaataccc caccatcgcc gactgggcca accacctgac caccatcttc 1020 cccgaggtgc ggctcaagaa gttcctggag atgcgcggcg cggacggcgg cccctggcgc 1080 atgctgtgcg cgctgccggc gctgtgggtg gggctcatat acgatccgga ggcgcagcgc 1140 caggccctgg cgctgattga ggattggacg cccgcggagc gcgactacct gcgcaccgag 1200 gtgacccgct tcggcctgcg cacgcccttc cgcgccggca ccgtgcagga cgtggccaag 1260 caggtggtgt ccatcgcgca cggcggcctg gagcggcgag gctacgacga gacgtccttc 1320 ctcaagcgcc tggaggtcat cgcggagact ggcctcacac aggccgacca cctgcttgag 1380 ctgtacgaga ccaagtggca gcgctcggtg gacccgctgt acaaggagtt catgtactga 1440 <210> 3 <211> 2403 <212> DNA <213> Chlamydomonas reinhardtii <400> 3 gagtgtcatt actacttgat aagaatcacc agcacttggg cgaccacagc gagcgaacga 60 ttattcttca ctgttacgtt gcactacatc ttggccctgt tccgatcaat ccctaggctg 120 ccgcactagt gcgatggctc tcgcctcagg cgttggccgt cgccagcatg tgtcggcctc 180 gccctcgcgc agtcggggtg tgccaagccc acgcttgagc cctgtccacg cgaacgcgcc 240 tgcggttgcg gagcgtcgca cagagcccct cttaaagcag gagctggtgg attacctgaa 300 atcggggtgt aggcctcgca gcgcgtggcg aatcggcacc gagcacgaga agctgggttt 360 caacctggca gacaacagcc gcatgaacta cgaccagatt gcacaggtgc tacgcaagct 420 ggaggcccgg tttggttggg agcccatcat ggaggagggc cgtatcatcg gcgtgcagtt 480 ggatggtcag agtgtgacgc tggagcccgg cggccagttt gaactgagcg gggcgcccgt 540 ggagaccatt cacaagacgt gtgcggaggt gaacagccac ctctaccagg tcaaggccat 600 ctgcgaggag cttcagacag gattcctggg cgtgggcttt gaccccaagt gggccatcag 660 cgacgttccc atgatgccca agggccgcta caagctgatg aagtcgtaca tgcccacggt 720 gggctccatg ggcctggaca tgatgttccg cacatgcacc gtgcaggtga acctggactt 780 tgagagcgag caggacatgg tggagaagtt ccgcatcggc ctggcgctgc agcccatcgc 840 caacgcgctc ttcgccagct cgccattcaa ggagggcaag cccaccgggt acctgagcac 900 ccgcggtcac gtgtggacgg acgtggacgc ctcgcgcacc ggcaacctgc cgttcgtgtt 960 cgagaaggac atgtgcttcg agagctacgt ggactacgcc atggcggtgc ccatgtactt 1020 cgtgtaccgc aacgggcagt acatcaacgc gctgggcatg agctggaagg acttcatggc 1080 cggcaagctg cccgcgctgc cgggcgaata ccccaccatc gccgactggg ccaaccacct 1140 gaccaccatc ttccccgagg tgcggctcaa gaagttcctg gagatgcgcg gcgcggacgg 1200 cggcccctgg cgcatgctgt gcgcgctgcc ggcgctgtgg gtggggctca tatacgatcc 1260 ggaggcgcag cgccaggccc tggcgctgat tgaggattgg acgcccgcgg agcgcgacta 1320 cctgcgcacc gaggtgaccc gcttcggcct gcgcacgccc ttccgcgccg gcaccgtgca 1380 ggacgtggcc aagcaggtgg tgtccatcgc gcacggcggc ctggagcggc gaggctacga 1440 cgagacgtcc ttcctcaagc gcctggaggt catcgcggag actggcctca cacaggccga 1500 ccacctgctt gagctgtacg agaccaagtg gcagcgctcg gtggacccgc tgtacaagga 1560 gttcatgtac tgagcaggag gaggggcagc ggcagcagca gcaggaggtg gcggcggagc 1620 aggaggaagt gtatcggtat gtcggaaaga cgacgttaag tgacttgaaa gtgatgtttg 1680 cgagaggctg atgcctgtgc cgtttgatgt gagtgtgagt actgcgccag tattcgctgt 1740 tcgcaacggc gttaccaaca tattgcggtg ggatgcatag ttgatcagtt tggttgtgcc 1800 aacccaacat ttctcgcttg ggctgatgca tgggcgaact gccgaatgcc tgggtggcgc 1860 tgggggtcag caacatgaag cttgttgtgt gtacagccag accagcttga aggaagacca 1920 gcttgaagga atgagctcgg cctcgagcgt tgtgacaatc gtgctgtcgt gcggacaaca 1980 tattatgttg gtgtgccctc cgatgttatg aacttgcttc gcgtgggatg cgaacgcagg 2040 tacaggtaga gacctcaaac ggtgacaggg acgggtctgg ggcggaaacc tatgggtatc 2100 aggcgatctg atcaagaggt ggatccgctt gggacatagc acgcgtgcgt cgtacgatga 2160 ggcaatcggg cctgtgcccc ggttcctcag gcagtcaggc gccgggttag tgcggcgatg 2220 aagtacggta tagtgcctac tcagtgcatc gggcggcggt gcggatatgg gcttcacccg 2280 tgcgttgcgt gaagcttttg gggtcgtgtg gcttcgctgt gcggcgtgcc agacgaggct 2340 ccgagatggt gctgaactgg ttgtgaaggt ggccggttcg gacttgtaag gccctcgctc 2400 agg 2403 <210> 4 <211> 3130 <212> DNA <213> Chlamydomonas reinhardtii <400> 4 atcagcacac acagcaggct cactgccgcg gatcccacac acctgcccgt ctgcctgaca 60 ggaagtgaac gcatgtcgag ggaggcctca ccaatcgtca cacgagccct cgtcagaaac 120 acgtctccgc cacgctctcc ctctcacggc cgaccccgca gcccttttgc cctttcctag 180 gccaccgaca ggacccaggc gctctcagca tgcctcaaca acccgtactc gtgccagcgg 240 tgcccttgtg ctggtgatcg cttggaagcg catgcgaaga cgaaggggcg gagcaggcgg 300 cctggctgtt cgaagggctc gccgccagtt cgggtgcctt tctccacgcg cgcctccaca 360 cctaccgatg cgtgaaggca ggcaaatgct catgtttgcc cgaactcgga gtccttaaaa 420 agccgcttct tgtcgtcgtt ccgagacatg ttagcagatc gcagtgccac ctttcctgac 480 gcgctcggcc ccatattcgg acgcaattgt catttgtagc acaattggag caaatctggc 540 gaggcagtag gcttttaagt tgcaaggcga gagagcaaag tgggacgcgg cgtgattatt 600 ggtatttacg cgacggcccg gcgcgttagc ggcccttccc ccaggccagg gacgattatg 660 tatcaatatt gttgcgttcg ggcactcgtg cgagggctcc tgcgggctgg ggagggggat 720 ctgggaattg gaggtacgac cgagatggct tgctcggggg gaggtttcct cgccgagcaa 780 gccagggtta ggtgttgcgc tcttgactcg ttgtgcattc taggacccca ctgctactca 840 caacaagcca aaatggttgc tctcgcctca ggcgttggcc gtcgccagca tgtgtcggcc 900 tcgccctcgc gcagtcgggg tgtgccaagc ccacgcttga gccctgtcca cgcgaacgcg 960 cctgcggttg cggagcgtcg cacagagccc ctcttaaagc aggagctggt ggattacctg 1020 aaatcggggt gtaggcctcg cagcgcgtgg cgaatcggca ccgagcacga gaagctgggt 1080 ttcaacctgg cagacaacag ccgcatgaac tacgaccaga ttgcacaggt gctacgcaag 1140 ctggaggccc ggtttggttg ggagcccatc atggaggagg gccgtatcat cggcgtgcag 1200 ttggatggtc agagtgtgac gctggagccc ggcggccagt ttgaactgag cggggcgccc 1260 gtggagacca ttcacaagac gtgtgcggag gtgaacagcc acctctacca ggtcaaggcc 1320 atctgcgagg agcttcagac aggattcctg ggcgtgggct ttgaccccaa gtgggccatc 1380 agcgacgttc ccatgatgcc caagggccgc tacaagctga tgaagtcgta catgcccacg 1440 gtgggctcca tgggcctgga catgatgttc cgcacatgca ccgtgcaggt gaacctggac 1500 tttgagagcg agcaggacat ggtggagaag ttccgcatcg gcctggcgct gcagcccatc 1560 gccaacgcgc tcttcgccag ctcgccattc aaggagggca agcccaccgg gtacctgagc 1620 acccgcggtc acgtgtggac ggacgtggac gcctcgcgca ccggcaacct gccgttcgtg 1680 ttcgagaagg acatgtgctt cgagagctac gtggactacg ccatggcggt gcccatgtac 1740 ttcgtgtacc gcaacgggca gtacatcaac gcgctgggca tgagctggaa ggacttcatg 1800 gccggcaagc tgcccgcgct gccgggcgaa taccccacca tcgccgactg ggccaaccac 1860 ctgaccacca tcttccccga ggtgcggctc aagaagttcc tggagatgcg cggcgcggac 1920 ggcggcccct ggcgcatgct gtgcgcgctg ccggcgctgt gggtggggct catatacgat 1980 ccggaggcgc agcgccaggc cctggcgctg attgaggatt ggacgcccgc ggagcgcgac 2040 tacctgcgca ccgaggtgac ccgcttcggc ctgcgcacgc ccttccgcgc cggcaccgtg 2100 caggacgtgg ccaagcaggt ggtgtccatc gcgcacggcg gcctggagcg gcgaggctac 2160 gacgagacgt ccttcctcaa gcgcctggag gtcatcgcgg agactggcct cacacaggcc 2220 gaccacctgc ttgagctgta cgagaccaag tggcagcgct cggtggaccc gctgtacaag 2280 gagttcatgt actgagcagg aggaggggca gcggcagcag cagcaggagg tggcggcgga 2340 gcaggaggaa gtgtatcggt atgtcggaaa gacgacgtta agtgacttga aagtgatgtt 2400 tgcgagaggc tgatgcctgt gccgtttgat gtgagtgtga gtactgcgcc agtattcgct 2460 gttcgcaacg gcgttaccaa catattgcgg tgggatgcat agttgatcag tttggttgtg 2520 ccaacccaac atttctcgct tgggctgatg catgggcgaa ctgccgaatg cctgggtggc 2580 gctgggggtc agcaacatga agcttgttgt gtgtacagcc agaccagctt gaaggaagac 2640 cagcttgaag gaatgagctc ggcctcgagc gttgtgacaa tcgtgctgtc gtgcggacaa 2700 catattatgt tggtgtgccc tccgatgtta tgaacttgct tcgcgtggga tgcgaacgca 2760 ggtacaggta gagacctcaa acggtgacag ggacgggtct ggggcggaaa cctatgggta 2820 tcaggcgatc tgatcaagag gtggatccgc ttgggacata gcacgcgtgc gtcgtacgat 2880 gaggcaatcg ggcctgtgcc ccggttcctc aggcagtcag gcgccgggtt agtgcggcga 2940 tgaagtacgg tatagtgcct actcagtgca tcgggcggcg gtgcggatat gggcttcacc 3000 cgtgcgttgc gtgaagcttt tggggtcgtg tggcttcgct gtgcggcgtg ccagacgagg 3060 ctccgagatg gtgctgaact ggttgtgaag gtggccggtt cggacttgta aggccctcgc 3120 tcaggaattc 3130 <210> 5 <211> 18 <212> DNA <213> Artificial <220> <223> Primer <400> 5 gctctcgcct caggcgtt 18 <210> 6 <211> 29 <212> DNA <213> Artificial <220> <223> Primer <400> 6 ggggaattcc tgagcgaggg ccttacaag 29 <210> 7 <211> 23 <212> DNA <213> Artificial <220> <223> Primer <400> 7 atcagcacac acagcaggct cac 23 <210> 8 <211> 30 <212> DNA <213> Artificial <220> <223> Primer <400> 8 tgttaaccat tttggcttgt tgtgagtagc 30 <210> 9 <211> 4245 <212> DNA <213> artificial <220> <223> pACYC187 <400> 9 gaattccgga tgagcattca tcaggcgggc aagaatgtga ataaaggccg gataaaactt 60 gtgcttattt ttctttacgg tctttaaaaa ggccgtaata tccagctgaa cggtctggtt 120 ataggtacat tgagcaactg actgaaatgc ctcaaaatgt tctttacgat gccattggga 180 tatatcaacg gtggtatatc cagtgatttt tttctccatt ttagcttcct tagctcctga 240 aaatctcgat aactcaaaaa atacgcccgg tagtgatctt atttcattat ggtgaaagtt 300 ggaacctctt acgtgccgat caacgtctca ttttcgccaa aagttggccc agggcttccc 360 ggtatcaaca gggacaccag gatttattta ttctgcgaag tgatcttccg tcacaggtat 420 ttattcggcg caaagtgcgt cgggtgatgc tgccaactta ctgatttagt gtatgatggt 480 gtttttgagg tgctccagtg gcttctgttt ctatcagctg tccctcctgt tcagctactg 540 acggggtggt gcgtaacggc aaaagcaccg ccggacatca gcgctagcgg agtgtatact 600 ggcttactat gttggcactg atgagggtgt cagtgaagtg cttcatgtgg caggagaaaa 660 aaggctgcac cggtgcgtca gcagaatatg tgatacagga tatattccgc ttcctcgctc 720 actgactcgc tacgctcggt cgttcgactg cggcgagcgg aaatggctta cgaacggggc 780 ggagatttcc tggaagatgc caggaagata cttaacaggg aagtgagagg gccgcggcaa 840 agccgttttt ccataggctc cgcccccctg acaagcatca cgaaatctga cgctcaaatc 900 agtggtggcg aaacccgaca ggactataaa gataccaggc gtttccccct ggcggctccc 960 tcgtgcgctc tcctgttcct gcctttcggt ttaccggtgt cattccgctg ttatggccgc 1020 gtttgtctca ttccacgcct gacactcagt tccgggtagg cagttcgctc caagctggac 1080 tgtatgcacg aaccccccgt tcagtccgac cgctgcgcct tatccggtaa ctatcgtctt 1140 gagtccaacc cggaaagaca tgcaaaagca ccactggcag cagccactgg taattgattt 1200 agaggagtta gtcttgaagt catgcgccgg ttaaggctaa actgaaagga caagttttgg 1260 tgactgcgct cctccaagcc agttacctcg gttcaaagag ttggtagctc agagaacctt 1320 cgaaaaaccg ccctgcaagg cggttttttc gttttcagag caagagatta cgcgcagacc 1380 aaaacgatct caagaagatc atcttattaa tcagataaaa tatttctaga tttcagtgca 1440 atttatctct tcaaatgtag cacctgaagt cagccccata cgatataagt tgtaattctc 1500 atgtttgaca gcttatcatc gataagcttt aatgcggtag tttatcacag ttaaattgct 1560 aacgcagtca ggcaccgtgt atgaaatcta acaatgcgct catcgtcatc ctcggcaccg 1620 tcaccctgga tgctgtaggc ataggcttgg ttatgccggt actgccgggc ctcttgcggg 1680 atatcgtcca ttccgacagc atcgccagtc actatggcgt gctgctagcg ctatatgcgt 1740 tgatgcaatt tctatgcgca cccgttctcg gagcactgtc cgaccgcttt ggccgccgcc 1800 cagtcctgct cgcttcgcta cttggagcca ctatcgacta cgcgatcatg gcgaccacac 1860 ccgtcctgtg gatcctctac gccggacgca tcgtggccgg catcaccggc gccacaggtg 1920 cggttgctgg cgcctatatc gccgacatca ccgatgggga agatcgggct cgccacttcg 1980 ggctcatgag cgcttgtttc ggcgtgggta tggtggcagg ccccgtggcc gggggactgt 2040 tgggcgccat ctccttgcat gcaccattcc ttgcggcggc ggtgctcaac ggcctcaacc 2100 tactactggg ctgcttccta atgcaggagt cgcataaggg agagcgtcga ccgatgccct 2160 tgagagcctt caacccagtc agctccttcc ggtgggcgcg gggcatgact atcgtcgccg 2220 cacttatgac tgtcttcttt atcatgcaac tcgtaggaca ggtgccggca gcgctctggg 2280 tcattttcgg cgaggaccgc tttcgctgga gcgcgacgat gatcggcctg tcgcttgcgg 2340 tattcggaat cttgcacgcc ctcgctcaag ccttcgtcac tggtcccgcc accaaacgtt 2400 tcggcgagaa gcaggccatt atcgccggca tggcggccga cgcgctgggc tacgtcttgc 2460 tggcgttcgc gacgcgaggc tggatggcct tccccattat gattcttctc gcttccggcg 2520 gcatcgggat gcccgcgttg caggccatgc tgtccaggca ggtagatgac gaccatcagg 2580 gacagcttca aggatcgctc gcggctctta ccagcctaac ttcgatcact ggaccgctga 2640 tcgtcacggc gatttatgcc gcctcggcga gcacatggaa cgggttggca tggattgtag 2700 gcgccgccct ataccttgtc tgcctccccg cgttgcgtcg cggtgcatgg agccgggcca 2760 cctcgacctg aatggaagcc ggcggcacct cgctaacgga ttcaccactc caagaattgg 2820 agccaatcaa ttcttgcgga gaactgtgaa tgcgcaaacc aacccttggc agaacatatc 2880 catcgcgtcc gccatctcca gcagccgcac gcggcgcatc tcgggcagcg ttgggtcctg 2940 gccacgggtg cgcatgatcg tgctcctgtc gttgaggacc cggctaggct ggcggggttg 3000 ccttactggt tagcagaatg aatcaccgat acgcgagcga acgtgaagcg actgctgctg 3060 caaaacgtct gcgacctgag caacaacatg aatggtcttc ggtttccgtg tttcgtaaag 3120 tctggaaacg cggaagtccc ctacgtgctg ctgaagttgc ccgcaacaga gagtggaacc 3180 aaccggtgat accacgatac tatgactgag agtcaacgcc atgagcggcc tcatttctta 3240 ttctgagtta caacagtccg caccgctgtc cggtagctcc ttccggtggg cgcggggcat 3300 gactatcgtc gccgcactta tgactgtctt ctttatcatg caactcgtag gacaggtgcc 3360 ggcagcgccc aacagtcccc cggccacggg gcctgccacc atacccacgc cgaaacaagc 3420 gccctgcacc attatgttcc ggatctgcat cgcaggatgc tgctggctac cctgtggaac 3480 acctacatct gtattaacga agcgctaacc gtttttatca ggctctggga ggcagaataa 3540 atgatcatat cgtcaattat tacctccacg gggagagcct gagcaaactg gcctcaggca 3600 tttgagaagc acacggtcac actgcttccg gtagtcaata aaccggtaaa ccagcaatag 3660 acataagcgg ctatttaacg accctgccct gaaccgacga ccgggtcgaa tttgctttcg 3720 aatttctgcc attcatccgc ttattatcac ttattcaggc gtagcaccag gcgtttaagg 3780 gcaccaataa ctgccttaaa aaaattacgc cccgccctgc cactcatcgc agtactgttg 3840 taattcatta agcattctgc cgacatggaa gccatcacag acggcatgat gaacctgaat 3900 cgccagcggc atcagcacct tgtcgccttg cgtataatat ttgcccatgg tgaaaacggg 3960 ggcgaagaag ttgtccatat tggccacgtt taaatcaaaa ctggtgaaac tcacccaggg 4020 attggctgag acgaaaaaca tattctcaat aaacccttta gggaaatagg ccaggttttc 4080 accgtaacac gccacatctt gcgaatatat gtgtagaaac tgccggaaat cgtcgtggta 4140 ttcactccag agcgatgaaa acgtttcagt ttgctcatgg aaaacggtgt aacaagggtg 4200 aacactatcc catatcacca gctcaccgtc tttcattgcc atacg 4245 <210> 10 <211> 1578 <212> DNA <213> Escherichia coli <400> 10 gacaggcggg aggtcaattt gatcccggac gtatcacagg cgctggcctg gctggaaaaa 60 catcctcagg cgttaaaggg gatacagcgt gggctggagc gcgaaacttt gcgtgttaat 120 gctgatggca cactggcaac aacaggtcat cctgaagcat taggttccgc actgacgcac 180 aaatggatta ctaccgattt tgcggaagca ttgctggaat tcattacacc agtggatggt 240 gatattgaac atatgctgac ctttatgcgc gatctgcatc gttatacggc gcgcaatatg 300 ggcgatgagc ggatgtggcc gttaagtatg ccatgctaca tcgcagaagg tcaggacatc 360 gaactggcac agtacggcac ttctaacacc ggacgcttta aaacgctgta tcgtgaaggg 420 ctgaaaaatc gctacggcgc gctgatgcaa accatttccg gcgtgcacta caatttctct 480 ttgccaatgg cattctggca agcgaagtgc ggtgatatct cgggcgctga tgccaaagag 540 aaaatttctg cgggctattt ccgcgttatc cgcaattact atcgtttcgg ttgggtcatt 600 ccttatctgt ttggtgcatc tccggcgatt tgttcttctt tcctgcaagg aaaaccaacg 660 tcgctgccgt ttgagaaaac cgagtgcggt atgtattacc tgccgtatgc gacctctctt 720 cgtttgagcg atctcggcta taccaataaa tcgcaaagca atcttggtat taccttcaac 780 gatctttacg agtacgtagc gggccttaaa caggcaatca aaacgccatc ggaagagtac 840 gcgaagattg gtattgagaa agacggtaag aggctgcaaa tcaacagcaa cgtgttgcag 900 attgaaaacg aactgtacgc gccgattcgt ccaaaacgcg ttacccgcag cggcgagtcg 960 ccttctgatg cgctgttacg tggcggcatt gaatatattg aagtgcgttc gctggacatc 1020 aacccgttct cgccgattgg tgtagatgaa cagcaggtgc gattcctcga cctgtttatg 1080 gtctggtgtg cgctggctga tgcaccggaa atgagcagta gcgaacttgc ctgtacacgc 1140 gttaactgga accgggtgat cctcgaaggt cgcaaaccgg gtctgacgct gggtatcggc 1200 tgcgaaaccg cacagttccc gttaccgcag gtgggtaaag atctgttccg cgatctgaaa 1260 cgcgtcgcgc aaacgctgga tagtattaac ggcggcgaag cgtatcagaa agtgtgtgat 1320 gaactggttg cctgcttcga taatcccgat ctgactttct ctgcccgtat cttaaggtct 1380 atgattgata ctggtattgg cggaacaggc aaagcatttg cagaagccta ccgtaatctg 1440 ctgcgtgaag agccgctgga aattctgcgc gaagaggatt ttgtagccga gcgcgaggcg 1500 tctgaacgcc gtcagcagga aatggaagcc gctgataccg aaccgtttgc ggtgtggctg 1560 gaaaaacacg cctgacag 1578 <210> 11 <211> 3397 <212> DNA <213> Synechococcus sp. PCC7002 <220> <223> pAQ1 <400> 11 cggatcaaga tgctgcctaa acacgagaaa acccccaaaa gtttggcgac cggcgggggc 60 ttctctaaac caaataaaag caaacaggga cggcaaaacc gagccctaat tgatcatgat 120 cgtcaaggcg aaggaggcct taactcactg tgatcgtatc agataatttt acatctagca 180 gtaataccgg ggcagattta gcgagtagcg tcagtgagaa ccgttctcat tttatcgcag 240 aatctcacta tagggaatgg gtagagggtt ccggggtcgc ccctgagatt gcccggttaa 300 atgttagatc gttgtcaggg atgacgccct atgaatacct gctctacagt gatgagccag 360 cattacgccg caatgatggc aggcttcggg atacttggct taagcgatat gcctttgtcg 420 agcatggcgg ttggtggtgc tcaggcatcg atattaagac cgggaaagat tctctttggg 480 gttgcttcaa aggcgatcgc ccccgtaaag atcgcgaaga taagaaaccg atcaagtatg 540 agcacccgcc acgggtagcc accgaaattt tcactctcaa ggtagaccgg ggcacctggc 600 gcaagattgc caagcgccac aaagtcgagc taccagaaac cgatcaaggc ttctgggaat 660 gggtactagc ccatcctgag ctaccgatca tcatcactga gggcgcgaag aaggcagggg 720 ccctcctaac cgctggttat tgcgccatcg gtctaccggg gatttacaac ggctacagaa 780 cgccaaaaaa tgaccatggc gagccaatgc gacagctacg gcacctcatt ccagagcttg 840 acctgttggc gaaaaataac cgggcgatcg ccttctgttt tgaccaagac aagaaaccca 900 agacgatcaa ggcagtgaac ggggcgatcc aaactaccgg ggcactccta gagaaggccg 960 gggcgaaagt atcggtgatc acctggcacc aggacgcgaa aggtgttgat gatctgatcg 1020 tcgagcacgg agcgaaagca ctccataacc gctacaagca ccgcaagccc ttagcagtct 1080 gggagatgga taatctcacc gatatcacca cgcaagtcga tctaacggtc gatcagcgct 1140 atctcgacat cgatccgcgt gctatcccca aggatgctca gattattttc attaaatctg 1200 ccaagggcac cgggaaaaca gaatggttag ggaaaatcgt taagctcgcc caagatgatt 1260 gcgctcgcgt actggttttg actcaccgca tccaattagc caaggagctc gcccgccgtc 1320 tcgatatcga tcacattagc gagctcgaca gtagcccgac cgggggcgct ctagggatgg 1380 cgatgtgtat cgatagccta catcccgata gccaagctca ttttaatttc atggaatggc 1440 acggcgctca cattgtccta gacgaaatcg agcaagtttt agggcacgct ttgggtagct 1500 cgacctgtac ccaagaccgg gcgaaaatcc ttgaaacgtt ctacaaccta atcctttatg 1560 ccctaaggac aggcggaaaa ctctactgct ctgatgctga tttatctccc atctcctatg 1620 agctaatcaa gtacattctt gacggttgtg agttcaaacc attcaccatt ctgaatacct 1680 ataagccctg tttagagcaa caaagagacc tgtttttcta tgaagggaat gaccctagag 1740 acctgttaac caatctcaga caagcgattg agaacggtga gaaaacactt gtctttaccg 1800 ctgcccaaaa gaccgcatcg acctacagca cgcagaactt agaatcactc tttagggaga 1860 aatatcccga taagagaatc ttgagaatcg atgctgaatc ggtcgctgaa ccggggcacc 1920 ctgcctatgg ttgtattgac tcgctgaatg caattttgcc cctgtacgat attgtgctct 1980 gctcgcccgc tgtcgagacc ggggtgagta tcgatatcaa ggatcatttt gattctgttt 2040 ggggcatggg ttcaggggtt cagaccgtta acggtttctg ccaagggcta gagcggttac 2100 gggataacgt ccctcgccat gtttggatac cgaaattttc cccacactcg aaccggatcg 2160 ccaatggggg ctacaccgct aaggcgatcg cccgtgacca gcaccgctat gcagagctca 2220 cccacaaatt aatcggtgag cacgccgctg aatgcagtgg gttagaagat tctttaaaac 2280 cattcctttg ggcctattgt cgctatgcgg cgcttgctaa ccgtggcttt ggcagttacc 2340 gggaagcgat tttaaataag ctgctttctg agggctatgt acagaaagat ttgagcgaaa 2400 tcgatccagc attggctaag gattatcgag acgaattaaa agcggtgaaa gaccataatt 2460 atctacagga aagggttgcg atttctaaag tagaaaatcc tgacgatcgc cagtacgaaa 2520 aactgaagcg tcagcgggcg aaatctgaga cggaacggca ccaagaacgc cacgggaaac 2580 tttctcgctc ctatgggtta actgtgaccc ctgagcttgt cgagaaagat gatgatgggt 2640 ggtactctca gctccagctc gaatactact taaccgttgg gaaagcattc tgctctgccc 2700 gcgaccgggc gaaatatgac cagctccaac atgagggctt tgtatttaag ccggatatca 2760 acaggcgatc gctctcacca aagattcacc tgttagagct actcaacatc catcagttct 2820 taaaaccagg ggtgacattc accggggcga gccttgaagg gttcaaggaa aattgtttgc 2880 ggtatgccaa gccgatcaag tggattcttg gcagaacgat caccgacaaa atgagcccgc 2940 tcgaaattgc tcaggcgctc ctaggcaagc ttgaccggaa attggaatac aaggggcgct 3000 ttggatcgcg ggataaccgt cagcgggtct atgaggcgat cgcccctaac gatcagcgcg 3060 aaaaggtctt tgctcattgg ttacagcgtg accaagcaaa attaggggcc gtgtccaacc 3120 cctgtataaa tagatttatt caggaggctt agacccgtga tcgaaatact cgttgtgcag 3180 ctctcccttg gcaatcccaa acaatctcaa gatttgctct gcggtatcgg gacgttttat 3240 gcccttgcgg aaagcgcctt tgctcttctg gtagccccta gactgtgcca gatcataagc 3300 ctcactgagg gtgagggcac taccgggggc atgagctcgc ccaagagatt cagcgaccgg 3360 ggcgatcgcc cttggtaatt ctctcaggcg ctcaact 3397 <210> 12 <211> 30 <212> DNA <213> artificial <220> <223> Primer <400> 12 gggatgcatg acaggcggga ggtcaatttg 30 <210> 13 <211> 30 <212> DNA <213> artificial <220> <223> Primer <400> 13 gggctcgagc tgtcaggcgt gtttttccag 30 <210> 14 <211> 40 <212> DNA <213> artificial <220> <223> Primer <400> 14 cccgtcgaca aagcatgccg gatcaagatg ctgcctaaac 40 <210> 15 <211> 24 <212> DNA <213> artificial <220> <223> Primer <400> 15 agttgagcgc ctgagagaat tacc 24 <210> 16 <211> 23 <212> DNA <213> artificial <220> <223> Primer <400> 16 cagcatcacc cgacgcactt tgc 23 <210> 17 <211> 26 <212> DNA <213> artificial <220> <223> Primer <400> 17 cctaatgcag gagtcgcata agggag 26 <210> 18 <211> 23 <212> DNA <213> artificial <220> <223> Primer <400> 18 gcacacggtc acactgcttc cgg 23

Claims (10)

Algae characterized by an increase in glutathione concentration in the chloroplast. The method of claim 1, wherein in the chloroplast, γ-glutamylcysteine synthetase, glutathione synthase, ATPsulfurase, adenosine 5'-phosphosulfate reductase, sulfite reductase, cysteine synthetase and serineacetyl transferase An algae characterized by an increased expression and / or activity of at least one protein selected from the group consisting of: The method according to claim 1 or 2, wherein the γ-glutamylcysteine synthetase, glutathione synthetase, ATPsulfurase, adenosine 5'-phosphosulfate reductase, sulfite reductase, cysteine synthetase and serineacetyl transferase An algae characterized in that exogenous polynucleotides encoding at least one protein selected from the group consisting of are introduced. The algae according to claim 3, wherein the polynucleotide encoding the γ-glutamylcysteine synthase is selected from the group consisting of the following (a) to (d):
(a) a polynucleotide encoding a polypeptide consisting of the amino acid sequence represented by SEQ ID NO: 1;
(b) the amino acid sequence represented by SEQ ID NO: 1, wherein the polynucleotide consists of an amino acid sequence in which one or several amino acids are deleted, substituted or added, and which encodes a polypeptide having γ-glutamylcysteine synthase activity;
(c) a polynucleotide consisting of the nucleotide sequence represented by SEQ ID NO: 2;
(d) hybridize under polynucleotides consisting of a polynucleotide consisting of a base sequence complementary to any of the polynucleotides of (a) to (d) and under stringent conditions, and further gamma -glutamylcysteine synthase activity Polynucleotide encoding a polypeptide having. A method for producing an alga according to any one of claims 1 to 4, comprising a glutathione concentration increasing step of increasing the concentration of glutathione in the chloroplast of the alga. The method of claim 5, wherein the glutathione concentration increasing process comprises: γ-glutamylcysteine synthetase, glutathione synthase, ATPsulfurase, adenosine 5′-phosphosulfate reductase, sulfite reductase, cysteine synthetase, and serineacetyl A method for producing an alga, characterized in that the step of introducing into the algae an exogenous polynucleotide encoding at least one protein selected from the group consisting of a transferase. The algae manufactured by the algae of any one of Claims 1-4, or the algae manufacturing method of Claim 5 or 6 is used, The manufacturing method of the biomass characterized by the above-mentioned. The method of manufacturing a biomass according to claim 7, further comprising a light irradiation step of irradiating light on the algae. 10. The method of claim 8, wherein the light irradiation step is performed under conditions that are substantially not nitrogen starvation. A method of producing a biomass, comprising the step of culturing algae in the presence of a substance that increases the concentration of glutathione in the chloroplast of the algae.

Images