KR20130031773A - Lipid water soluble bee venom extracts for improving immunity and for curing inflammation and for curing pain and composition for parenteral medicines and manufacturing method of the same - Google Patents

Abstract

PURPOSE: A method for manufacturing a bee venom composition is provided to remarkably enhance immunity and to prevent and treat various diseases. CONSTITUTION: A method for manufacturing a bee venom composition comprises: a step of identifying bee venom using a water soluble solvent and a fat soluble solvent(S10); a step of adding a fat soluble solvent to a primary water soluble layer and identifying bee venom(S20); a step of adding a fat soluble solvent to the secondary water soluble layer and identifying bee venom(S30); a step of removing water insoluble ingredient from a tertiary water soluble layer and preparing a water soluble layer(S40); a step of mixing a primary fat soluble layer with secondary and tertiary fat soluble layers and removing water insoluble ingredients through filtering to prepare a fat soluble layer(S50); a step of mixing the water soluble layer of S40 and the fat soluble layer of S50(S60); and a step of concentrating and drying the mixture(S70). [Reference numerals] (AA) Bee venom(powder); (BB) EA layer 1; (CC) EA layer 2; (DD) EA layer 3; (EE) EA layer 1 + EA layer 2 + EA layer 3; (FF,HH) Filtration; (GG,II) Insoluble material; (JJ) Concentration, drying; (S10) DW layer 1; (S20) DW layer 2; (S30) DW layer 3; (S60) Mixing; (S70) Resin bee venom(powder)

Description

TECHNICAL FIELD The present invention relates to a resin bee for immunity enhancement, inflammation treatment and pain treatment, and a composition for parenteral administration using the same, and a method for preparing the same. THE SAME}

The present invention relates to a resin bee venom for the treatment of immune enhancement, inflammation and pain, and a composition for parenteral administration using the same, and more particularly to a composition for parenteral administration, And a resin composition for parenteral administration using the same, and to a method for preparing the same. 2. Description of the Related Art

The present invention relates to a method for producing an immunosuppressive resin bee keeping composition applicable to animals and humans. The bee venom is the venomous liquid that comes out of the ovipositor.

The bee venom is an animal natural physiologically active substance that is stored in the bee venom endotracheal tube and is connected to the needle and is secreted at the time of stimulation. There is a record that this bee venom treatment was used for therapeutic purposes in Egypt and Babylonia. Hippocrates also read bee poison as "mysterious Medicine ".

The Dongbok-Bo and the Mahon-wang white paper (the first acupuncture document) describes the use of the raw needle to treat pain and rheumatoid arthritis pain.

Bee venom acts on synovial cells of patients with arthritis, and the main component of bee venom melittin reduces the amount of Nitric Oxide (NO) by inactivating NF-KB (Nuclear factor kappa B) 2 (COX-2) is inhibited and anti-inflammatory effect is produced.

In oriental medicine, bee venom has been used for a long time as a therapeutic agent for inflammatory diseases, and physiological studies are being conducted to separate and purify the components of bee venom to use it in the treatment of dementia and cancer.

Research on the development of anti-inflammatory drugs for arthritis or anti-inflammatory in animals using bee venom has been conducted by many government agencies, including the Rural Development Administration.

As such, bee venom is relatively effective in the treatment of immune enhancement, anti-inflammation and pain in a lot of experience of treatment. However, standardization of the bee venom samples and the standardization of the composition suitable for the efficacy have not been fully realized, As a functional drug for the disease, there is a problem that specific and practical research results have not been obtained.

A study on the disappearance and denaturation of some active substances caused by the drying process of bee venom, and the standardization of the active ingredient constituting the indicator component of bee venom including melitin or other bee venom, and thus can be applied to a more stable and effective new concept treatment There is a need to develop a drug.

Antibiotics, on the other hand, are substances that are extracted from living organisms and inhibit or kill the growth of other microorganisms. More than 4,000 antibiotics have been discovered so far and more than 50 species are currently in clinical use.

The age of antibiotics, which began with the discovery of penicillin in 1929, seems to be ending with the emergence of resistant strains of antibiotics (superbugs), which are increasing due to antibiotic overuse, and there is no cure for these superbugs There has been growing interest in antibiotic substitutes that can cope with antibiotic resistance.

Particularly, in the case of livestock and poultry raised for food, the problem of food and processed products made of animals infected with resistant bacteria is becoming serious all the time.

Antibiotics were totally prohibited in animal feed in 2006 and in Korea in 2012 due to the generation of antibiotic resistant microorganisms due to overuse of antibiotics such as wide range of antibiotic abuse, inaccurate diagnosis and unnecessary antibiotic prescription worldwide.

Although various studies have been made on such antibiotic substitutes as enzymes, herbal extract essential oils, organic acids, lactic acid and propolis, they are generally more effective than antibiotics in terms of growth, therapeutic effect and immunity And it was difficult to use because of low economical efficiency.

Also, the following problems may arise when using bee venom as a kind of antibiotics.

That is, in the case of a conventional method for directing the bee poisoning of a live bee directly from a living bee, or directly separating the needles of a bee containing poison of a bee and directly acting on the affected part, It is difficult to control. In addition, due to the change of bee venom components depending on the age of the bees and the time of collection, it is difficult to apply the same bee venom continuously with the quantitative standardization of the active ingredients.

Therefore, bee venom collected in the form of dry powder is purified by using a bee venom collector that collects venom from bees producing bee poison through electrical stimulation, and injected with purified solvent is used. Such a method of injection is referred to as a parenteral administration method.

It is known that melittin, apamin and MCD (mast cell degranulating) - peptides, which are the main components of bee venom, are responsible for analgesic, anti - inflammatory and antimicrobial actions, promote pituitary hormone secretion and promote blood circulation.

Korean Patent Registration No. 10-0483496 discloses a composition for anti-inflammatory and analgesic composition containing bee venom components, which comprises extracting bee venom with hexane to remove hexane supernatant, extracting the hexane-removed bee venom with ether and removing the ethyl acetate supernatant, And a bee venom fraction obtained from a fraction and having a molecular weight of 10 kDa or less and having anti-inflammation and analgesic effect.

However, this has the disadvantage that only the water-soluble bee venom ingredient is used in the bee venom ingredient. Korean Patent Laid-Open Publication No. 10-2010-0118629 A cosmetic composition comprising bee venom or bee venom extract as an active ingredient, wherein the bee venom extract contains water, an organic solvent or a mixture of water and ethanol Wherein the cosmetic composition is an extract obtained by extraction with a solvent.

However, this is also using only the water-soluble component of bee venom, and there is still a method for manufacturing a medicament for treating immune enhancement and pain that can be applied to human or animal using bee venom liposoluble components among the bee venom components .

Korean Patent Registration No. 10-0483496 entitled " Anti-inflammatory and analgesic composition containing bee venom water-soluble component " Korean Patent Publication No. 10-2010-0118629 " Cosmetic composition containing bee venom or bee venom extract "

SUMMARY OF THE INVENTION The present invention has been made to solve the above-mentioned problems, and it is an object of the present invention to provide a bee venom which is capable of increasing the rate of weight gain when administered to a living body, And to provide a bee keeping composition capable of improving the therapeutic and immune function and improving the anti-inflammatory function.

Another object of the present invention is to provide a method of manufacturing a resin bee keeping composition for immunity enhancement, inflammation treatment and pain treatment which can be applied to animals and humans including cattle, pigs, chickens, ducks and the like.

In order to achieve the above-mentioned object, the present invention provides a resin-enamel composition for treating immunity and pain, which comprises suspending bee venom in water, extracting ethyl acetate with a solvent several times, extracting the separated water-soluble layer again with butanol, concentrating each layer under reduced pressure And a bee venom obtained by fractionation. The amount of the solvent (ethyl acetate and butanol) is 50 to 300 ml per gram of the bee venom.

The resin beeing for treating immunity and pain of the present invention is 0.01 to 4 parts by weight based on 100 parts by weight of the bee keeping composition.

The resin preserving composition for treating immunity and pain of the present invention further comprises saponin or alpha-pinene.

In the resin preserving composition for treating immunity and pain of the present invention, the saponin is 0.01 to 5 parts by weight and the alpha-pinene is 0.01 to 1 part by weight.

Further, the resin preserving composition for treating immunity and pain of the present invention further includes one or more selected from propylene glycol, ethanol, and sorbic acid.

In the resin preserving composition for treating immunity and pain of the present invention, the propylene glycol is 0.01 to 2 parts by weight, the ethanol is 0.01 to 2 parts by weight, and the sorbic acid is 0.0001 to 0.1 part by weight.

The present invention provides a method for preparing a resin preserving composition for the treatment of immune enhancement and pain, comprising the steps of: (S10) separating bee venom using a water-soluble solvent and a fat-soluble solvent; (10) adding a fat-soluble solvent to the separated water- (S30) of adding a water-soluble solvent to the separated secondary water-soluble layer (S30), filtering the separated tertiary water-soluble layer to remove insoluble components to prepare a water-soluble layer (S40 A step (S50) of preparing a liposoluble layer by removing the insoluble components by combining the liposoluble layer which is secondarily separated and the thirdly separated liposoluble layer to the first primary liposoluble layer which is firstly separated, (S60) of mixing the filtered water-soluble layer and the filtered liposoluble layer and a step (S70) of concentrating and drying the mixture of the water-soluble layer and the oil-soluble layer to obtain a resin bee keeping composition.

In addition, the present invention provides a method for producing an immunosuppressive resin beverages composition, comprising the steps of (S11) extracting bee venom using a water-soluble solvent, centrifuging the bee venom extracted using a water-soluble solvent, A step S31 of removing the water-soluble solvent by drying the residue obtained by centrifugal separation, a step S41 of adding and removing a fat-soluble solvent to the dried residue, a step S41 of extracting the beverage (S51) of mixing the prepared water-soluble layer and the liposoluble layer with each other (S61), and concentrating and drying the mixture of the water-soluble layer and the oil-soluble layer to obtain a resin bee keeping composition (S71 ).

In the method for preparing the resin preserving composition for treating immunity and pain according to the present invention, the water-soluble solvent is any one selected from water, ethyl alcohol and methyl alcohol.

Further, in the method for preparing the resin preserving composition for treating immunity and pain of the present invention, the fat-soluble solvent is any one selected from the group consisting of hexane, ethyl acetate, chloroform, ether and butanol.

(S80) the high-voltage treatment is performed for a time period of 1 to 50 μs at a voltage of 20,000 to 30,000 V with respect to the resin preserving composition obtained by concentrating and drying in the method of manufacturing the resin preserving composition for treating immunity and pain of the present invention, .

In the method for manufacturing a resin bee-ting composition for treating immune-enhancement and pain, the volume ratio of the water-soluble layer and the fat-soluble layer is 1: 0.1 to 1.

In the method for producing the resin bee venom composition for treating inflammation according to the present invention, a resin bee keeping composition having a volume ratio of water-soluble layer and liposoluble layer of 0 to 0.5: 1 is obtained.

Also, in the method of manufacturing the resin preserving composition for treating immune enhancement, inflammation and pain according to the present invention, the resin bee venom composition has a CD4 + / CD8 + ratio of 0.4 to 1.5 in the spleen of broiler chickens when administered to broiler chickens.

In the method for manufacturing a resin bee-ting composition for treating immunity and pain according to the present invention, the resin bee-poisoning composition has a lysozyme activity of 7 to 14 占 퐂 / ml when administered to broiler chickens.

Also, in the method of manufacturing the resin bee venom composition for treating immune enhancement and pain according to the present invention, the resin bee venom composition comprises non-protein components cytidine, adenosine, chrysin, 11-eicosenol ), Dinonyl phthalate, and pinocembrin.

In the method for producing a resin bee venom composition for treating immunity and pain according to the present invention, the resin bee venom composition includes at least one selected from melitin, phospholipase A-2, MC dipeptide and afamin as a protein component.

INDUSTRIAL APPLICABILITY As described above, the resin preserving composition for the treatment of immune enhancement and pain according to the present invention significantly enhances the body weight gain and immune function, and has a preventive and therapeutic effect on various diseases.

In addition, according to the present invention, the bee venom composition for treating immunity, inflammation and pain has no resistance against antibiotics, and can secure stability even when used for a long period of time.

Also, according to the bee venom composition for treating immune enhancement and pain according to the present invention, the effect of preventing and treating diseases is more excellent than that of conventional antibiotic substitutes, and it is economically effective.

BRIEF DESCRIPTION OF THE DRAWINGS FIG. 1 is a flow chart showing an analysis process of live bee venom and dry bee venom in the preservative composition according to the present invention. FIG.
2 is an image of proteins separated by SDS-PAGE of the bee venom composition according to the present invention.
FIG. 3 is an image of proteins separated by two-dimensional electrophoresis of the bee keeping composition according to the present invention.
4 is data summarizing the protein components of bee venom isolated from SDS-PAGE gels in the bee venom composition according to the present invention.
5 is data summarizing the protein components of bee venom isolated from 2D gels in the bee venom composition according to the present invention.
Fig. 6 is a schematic view showing the bee venom and its solvent fraction extraction process in the bee keeping composition according to the present invention. Fig.
7 is a graph showing the effect of the bee keeping composition according to the present invention on the weight gain of broiler chickens.
8 is a graph showing the effect of the bee venom composition according to the present invention on the spleen weight change of broiler chickens.
9 is a graph showing the effect of the bee venom composition according to the present invention on the lymphocyte proliferative capacity of broiler chickens.
10A to 10B are graphs showing the ratio of B cell to T cell in lymphocytes isolated from the spleen of broiler chickens.
Figures 11a-11c are graphs showing the CD4 ⁺ : CD8 ⁺ ratio in lymphocytes isolated from the spleen of broiler chickens (helper T cells).
FIG. 12 is a graph showing the effect of the bee venom composition for treating immunity and pain according to the present invention on the activity of blood lysozyme in broiler chickens.
13a to 13c are graphs showing the effect of extracting m-RNA on the expression ability of cytokines (IL-4, IL-18 and IFN-gamma) in the spleen of broiler chickens administered with the bee venom composition for treating immunity and pain according to the present invention .
14 is a photograph showing antimicrobial effect of tablet bee venom in vitro in the bee venom composition for treating immune enhancement and pain according to the present invention.
15 is a graph showing the effect as an antibiotic substitute agent according to the growth rate of broiler chickens.
16A to 16B are conceptual diagrams showing a method for separating a protease from a useful substance using a nanostructure.
17 is a view showing a method of manufacturing a resin bee nosing composition for treating immune enhancement and pain according to the present invention.
18 is a graph showing the results of analyzing the protein components of the resin bee keeping composition used in the present invention.
19A to 19G are graphs showing the results of analyzing the non-protein components of the resin bee keeping composition used in the present invention.
20A and 20B are graphs showing quantitative changes of CBE (crude bee venom), water-soluble bee venom (CBV) and LWBV (Lipid and Water soluble bee venom) before and after a high voltage treatment (Pulsed Electric Field to be.
21 is a view showing still another method of manufacturing a resin bee keeping composition for treating immunity and pain according to the present invention.
FIG. 22A is a graph showing the weight gain of the broiler during the effect test of the resin bee keeping composition according to the present invention, and FIG. 22B is a graph showing a comparison of cumulative weight gain of the broiler during the effect test of the resin bee keeping composition according to the present invention.
FIG. 23A shows the change in the amount of gain according to the number of administration of the resin bee venom.
FIG. 23B is a graph showing the degree to which the activity of B cells varies with the number of administration of resin bee venom. FIG.
23C is a graph showing the degree to which the activity of T cells varies with the number of administration of resin bee venom.
FIG. 23D is a graph showing the degree to which the ratio of CD4 ⁺ / CD8 ⁺ varies with the number of administration of resin bee venom.
24 is a graph showing the ratio of CD4 ⁺ to CD8 ⁺ in lymphocytes (helper T cells) isolated from the spleen of broiler chickens administered with the resin bee venom composition for treating immunity and pain according to the present invention.
25 is a graph showing the results of lysozyme activity of resin bee venom according to the present invention.
26 is a bar graph showing cytotoxicity according to the bee venom composition according to the present invention. CBV means untreated bee venom, LBV means S50 step in FIG. 17, and LWBV means sample in step S70.
27 is a bar graph showing the anti-inflammatory effect according to the bee venom composition according to the present invention. CBV means untreated bee venom, LBV means S50 step in FIG. 17, and LWBV means sample in step S70.
28 is a bar graph showing anti-pain effects according to the composition of the resin bee venom according to the present invention.
29 is a line graph showing the anti-pain effect according to the composition of the resin bee venom according to the present invention.

Hereinafter, preferred embodiments of the present invention will be described in detail with reference to the accompanying drawings. However, it will be understood by those skilled in the art that the following embodiments are provided so that those skilled in the art will be able to fully understand the present invention, and that various changes and modifications may be made without departing from the scope of the present invention. It is not. Wherein like reference numerals refer to like elements throughout.

Bee venom is a poisonous liquid from the honey bee's ovipositor, which includes live bee venom, dry bee venom, bee venom extract and tablets bee venom.

The bee venom contains melittin, apamin, mast cell degranulation peptide (MCD-Peptide), protease inhibitor, Secarpin, Tertiapin), Procamine (Procamine) and contains a variety of peptides.

Raw bee venom has not been dried or purified and has a specific gravity of 1.1 to 1.3, pH (pH) of 5.2 to 5.5, and 70 to 80% by weight of the protein or peptide.

Bee venom extract can be extracted using various extraction methods known in the art, preferably water, anhydrous or hydrous lower alcohol having 1 to 4 carbon atoms (methanol, ethanol, propanol, butanol, etc.), such as lower alcohol and water Mixed solvent with acetone, ethyl acetate and butylene glycol can be obtained as an extraction solvent.

More preferably, bee venom is suspended with water, ethyl acetate is extracted several times with a solvent, and the separated aqueous layer is extracted again with butanol, and each layer is obtained by concentrating under reduced pressure.

In the bee keeping composition according to the present invention, the solvent is preferably 50 to 300 ml per 1 g of bee venom.

Tablet bee poisoning includes bee poisoning purified by a conventional purification process other than the above-described extract by the above-mentioned extraction solvent, separation using a filtration membrane, separation by various chromatography, and purification method.

When expressed in terms of weight ratio, bee venom is preferably 0.01 to 4 parts by weight based on 100 parts by weight of the viscous poison composition. More preferably 0.1 to 4 parts by weight.

In contrast, when the bee venom is less than 0.01 part by weight, the body weight gain, immune function, and pain treatment effect are weak. When the bee venom is more than 4 parts by weight, the increase in the effect is insignificant.

The bee venom composition for the treatment of immune enhancement and pain according to the present invention preferably contains 0.01 to 5 parts by weight, more preferably 0.07 to 4 parts by weight, of saponin in order to improve the body weight gain, immune function and pain treatment function .

Saponin is a glycoside in the vegetable system, which is composed of several cyclic compounds, not a sugar, and acts as a cardiotonic agent or diuretic. In any case, it acts as a surface active agent to increase the permeability of a substance in a cell membrane .

In particular, in the present invention, administration of the bee keeping composition of the present invention in the form of eye drops can improve the effect of the dosage, and this phenomenon can be further increased by adding saponin.

It is more preferable that the composition of the present invention contains 0.01 to 1 part by weight of alpha-pinene.

(1R, 5R) - (-) - alpha-pinene and (1SR, 5S) - (-) - alpha-pinene as a terpene compound, which can be extracted from pine, There are two isomers of alpha-pinene.

Alpha-phyinene has antimicrobial, antifungal, sedative, and anti-stress effects and is particularly effective against immune-related diseases, particularly in the production of inflammatory cytokines.

Saponins and alpha-phyinne can be used in various ways and can be extracted by steam distillation, compression, or solvent extraction.

The composition for treating immunity and pain according to the present invention may further comprise 0.01 to 2 parts by weight of propylene glycol, 0.01 to 2 parts by weight of ethanol, and 0.001 to 0.1 part by weight of sorbic acid, based on 100 parts by weight of the tobacco composition.

Such propylene glycol, ethanol, and sorbic acid may be added so that the active ingredient of bee venom can be stored for a long period of time.

Propylene glycol The formula is C ₃ H ₈ O ₂ , specific gravity is 1.036 to 1.04, boiling point is 185 to 189 ° C. Propylene glycol has excellent dissolving power, prevents the propagation of fungi, and does not ferment, so that the composition of the present invention can be stored for a long time.

The sorbic acid formula is C ₆ H ₈ O ₂ , and its melting point is around 134.5 ° C, which inhibits the growth of microorganisms such as filamentous bacteria, yeast, and aerobic bacteria.

The ethanol molecular formula is C ₂ H ₅ OH, which has anesthetic properties and can be added to preserve the animal's central nervous system and long-term preservation of bee venom.

The composition of the present invention may further comprise an appropriate carrier, excipient and diluent which can be prepared into eyedrops or eyedrops and subcutaneous injections and can be inoculated into a living body and routinely used in the preparation of eye drops or injections.

The composition for treating immunity and pain according to the present invention can be formulated into oral dosage forms such as powders, granules, tablets, capsules, suspensions, emulsions and aerosols, external preparations and injection solutions, Livestock, poultry, fish, and the like.

When preparing the composition for treating immunity and pain according to the present invention, a diluent or excipient such as a filler, an extender, a binder, a wetting agent, a disintegrant or a surfactant is usually used. In addition, it includes sterilized aqueous solutions with various excipients other than water and liquid paraffin as simple diluents, non-aqueous solvents, suspensions, emulsions, and freeze-dried preparations. Non-aqueous vehicles, suspensions, injectable esters such as propylene glycol, polyethylene glycol, ethyl oleate, and / or vegetable oils such as olive oil may be used.

Hereinafter, the present invention will be described in more detail with reference to Examples and Experimental Examples.

First, specific proteins (peptides) were analyzed by proteomics to compare and analyze the components of bee venom and bee venom.

The same amount of live bee venom and dry bee venom were separated by two-dimensional electrophoresis to identify proteins (or peptides) specifically present in live bean gum or dry bee venom.

 FIG. 1 is a flow chart showing the analysis of live bee venom and bee venom in the bee venom composition for the treatment of immune enhancement and pain according to the present invention, and FIG. 2 is a view showing an image of proteins separated by SDS- , The proteins were separated by SDS-PAGE (Sodium Dodecyl Sulfate Polyacrylamide Gel Electrophoresis) as shown in the figure.

FIG. 3 is an image showing a specific spot of the protein separated by the two-dimensional electrophoresis of the dry bee venom and the live bee venom. In FIG. 3, 13 speckle-specific spots (pink), 7 common spots Color display).

Then, the protein was hydrolyzed with trypsin to prepare polypeptide fragments.

Fig. 4 is a summary data of the protein components of bee venom isolated from the 2D gel. Data shown in blue are data for common spots in live bean gum and dry bee venom. The protein components listed in Spot No. 1, 2, 4, 8, 10, 14, 17, and 19 were found only in the bee venom, indicating that there is a significant difference in the proteins contained in the bee venom and the dry bee venom .

Figure 5 summarizes the protein components of bee venom isolated from SDS-PAGE gels. It contains the melittin components of live bean gum and dry bee venom, respectively, but spot numbers A, B, C, D, Protein.

Example 1. Preparation of fractions and bee venom composition from bee venom

FIG. 6 is a schematic view showing a process of extracting bee venom and a solvent fraction. As shown in FIG. 6, 5 g of bee venom was suspended in 500 ml of water and placed in a separating funnel.

Then, it was extracted three times with 500 ml of ethyl acetate (EtOAc). The aqueous layer was extracted twice with 500 ml of n-BuOH (butanol), and the layers were concentrated under reduced pressure. The EtOAc fraction (BVE, 420 mg), the n-BuOH fraction (BVB, 820 mg) and the H ₂ O fraction ) And a residue (2.5 g).

Purified bee venom was prepared by mixing 420 mg of the EtOAc fraction and 820 mg of the n-BuOH fraction. The purified bee venom was mixed with water to obtain a high concentration (8,400 占 퐂 / ml), an intermediate concentration (2,100 占 퐂 / The bee venom composition of the present invention was prepared according to the concentration of each test sample.

On the other hand, for each of the obtained fractions, non-whitening component profiles were examined by TLC (Thin Layer Chromatography).

The EtOAc fraction was found to contain about 5 major components. It was assumed to be an aliphatic compound with no UV absorption and a yellow color when heated after spraying with sulfuric acid.

The n-BuOH fraction showed the presence of three compounds with UV absorption besides fructose.

Most of the water layer was found to contain three non-whitening compounds with UV absorption, similar to the fructose and n-BuOH fractions.

Experimental Example 1 Experimental method and administration of purified bee venom

One day old broiler chick (Ross) was admitted and fed with feed and water for 4 weeks.

(8, 400 μg / ml), medium concentration (2,100 μg / ml) and low concentration (420 μg / ml) prepared in Example 1 were inoculated into the broiler chickens (100 占 퐇).

To confirm the appropriate frequency of tablet bee venom administration, administration was performed twice or four times per week.

In other words, tablet bee venom was inoculated according to the respective concentration and administration route on the 1st and 8th days after the entry into the second administration group. In the fourth administration group, on the 1st, 8th, 15th and 22nd days, And the bee venom was inoculated.

The meanings of the symbols shown in the graphs of FIGS. 7 to 13 are as follows.

** control: Tablet bee venom-free

** OL2: 2 tablets of low concentration (low conc.

** OM4: 4 tablets of middle bean concentrate through the eyelids.

** SH4: 4 tablets of high concentration (high conc.) Through subcutaneous tissue.

(Except the control group, 12 kinds of tablets are tested.)

** (n = 18): 18 birds of control broiler

** ↗: Significantly increased

Experimental Example 2 Comparison of the effects of broiler weight gain

In order to compare the weight gain of broiler chick according to tablet bee venom administration, feed and drinking water were given for 4 weeks. The results are shown in the graph of FIG.

As shown in FIG. 7, the body weight of all the subjects was measured by electronic scales, and the body weight was significantly increased (P <0.05) in the tablet bee administered group compared to the control group (841 ± 71g in the no-treatment group).

In particular, the highest weight gain was observed in the OM4 group (4 doses of medium concentration through the rats: 1,114 ± 80 g) and OH4 (4 doses of high concentration through the rats: 1,117 ± 113 g).

Experimental Example 3. Comparison of immunity increase effect of broiler chickens

3-1. Spleen weight change of chicken

The spleen weight of broiler chickens was measured to see how the tablet bee venom administration affected the improvement of the immunity of broiler chickens. The results are shown in the graph of FIG.

As shown in FIG. 8, the weight of immunological organs (spleen) of broiler chickens according to the administration of tablets bee venom was found to be increased in a dose-dependent manner in the 4-dose groups administered by the feces compared to the control group (0.968 ± 0.115 g) , And increased significantly in the OH4 group (4-dose group: 1.268 ± 0.228g at high concentration through the rim).

3-2. Evaluation of lymphocyte proliferative ability

The spleen was collected from broiler chickens of each group to compare the lymphocyte proliferative capacity of broiler chicks with tablets bee venom.

The collected spleen was used for lymphocyte isolation in aseptic condition and this experiment was performed using isolated lymphocytes.

The number of living lymphocytes was counted in a trypan blue microscope, and the number of viable lymphocytes was counted and finally diluted in RPMI-1640 medium at a concentration of 1 × 10 ⁶ cells / ml.

Cells diluted by 100 μl were dispensed into each well of a 96-well cell culture plate, and the cells were suspended in RPMI-1640 medium (ConA, 5 μg / ml) or lipid polysaccharide LPS (Lipopolysaccharide, 50 μg / Was added to the culture medium or 100 쨉 l of a medium containing no mitogen such as a mitogen was added thereto and cultured at 41 째 C under 5% carbon dioxide for 48 hours. Here, cone-A is a vegetable protein that inhibits the growth of cancer cells, but does not kill cancer cells but acts to reduce them to normal cells.

After adding 20 μl of a 5 mg / ml solution of MTT (3- (4,5-Dimethylthiazol-2-yl) -2,5-diphenyltetrazolium bromide, a yellow tetrazole) to each of the wells cultured for 48 hours, % Carbon dioxide for 4 hours.

After the incubation, the supernatant was removed and 200 μl of DMSO (dimethyl sulfoxide) was added to each well.

After all the cells were dissolved, the absorbance at 540 nm was measured to compare the proliferative capacity of the lymphocytes. The results are shown in the graph of FIG.

As shown in FIG. 9, the proliferative capacity of the lymphocytes was not different in each group when mitogens were not added. However, when stimulated with LPS (B cell mitogen) and T cell mitogen (LPS: 0.614 OM4 group (LPS: 1.030 ± 0.09, Cone: 1.032 ± 0.05) showed the greatest increase in the proliferative capacity compared to the control group (± 0.02, Cone: 0.601 ± 0.05)

3-3. Comparison of the proportion of cells in the spleen

The ratio of lymphocytes isolated from the spleen was analyzed by flow cytometry.

After splenectomy, the cells were freed using a cell strainer and then suspended in a red blood cell lysis buffer (RBC) for 10 minutes to destroy the red blood cells.

The erythrocyte lysis buffer method corresponds to a method of enzymatic treatment as a method of disrupting cells. A detergent separates proteins or lipoproteins from the cell membrane and causes the intracellular material to leak out. It is mainly used in fatty acids (bile salt) and sodium laurylsulphate, and is sensitive to pH and temperature. However, bubbles, protein denaturation, sedimentation, etc. occur and are not commonly used.

After centrifugation at 2,500 rpm for 5 minutes, the supernatant was removed and centrifuged with PBS (Phosphate Buffered Saline) to dilute the number of lymphocytes to 5.0 × 10 ⁶ cells / ㎖.

FITC anti-chicken CD3 (total T cells) and PE anti-chicken BU-1 (B cells) or FITC (Fluorescein Isothio-Cyanate) anti-chicken CD4 (help T cell) And stained with anti-chicken CD8 (cytotoxic T-cell) antibody for 30 min in the dark room.

After the reaction, the cells were centrifuged twice, and 1 ml of PBS was dispensed. The ratio of lymphocytes in the spleen was measured using a flow cytometer (FACSCalibur FACS, BD Biosciences, USA). The results are shown in the graphs of FIGS. 10a to 11c.

As shown in FIGS. 10A, 10B, 11A, 11B, and 11C, there was no significant change in the ratio of B cell to T cell.

The helper T cell ratio of the OM4 group (19.08 ± 4.00%) was higher than that of the control group (6.80 ± 2.98%), The ratio showed the greatest increase.

In addition, the ratio of cytotoxic T cells was significantly reduced in the OM4 group (41.41 ± 4.19%) compared with the control group (54.83 ± 11.10%).

Analysis of the CD 4 ⁺ : CD 8 ⁺ ratio showed the greatest increase in the OM4 group (0.47 ± 0.14) as compared to the control group (0.13 ± 0.08) as shown in Figures 11a to 11c.

3-4. Comparison of lysozyme activity in blood

The activity of macrophages was evaluated by comparing the concentration of serum lysozyme in the control and bee venom groups using the degree of degradation of the crystalline lysozyme as a standard curve.

To measure lysozyme activity in serum, crystalline lysozyme was dissolved at a concentration of 0.5, 1, 2, 3, 4, 5 μg / ml and prepared as standard. To each well of the 96-well plate was added 200 [mu] l of lysodeikticus solution and 20 [mu] l of the standard lysozyme prepared beforehand or serum was added.

The samples thus prepared were incubated at 41 ° C for 1 hour and the absorbance was measured at intervals of 15 minutes (540 nm). The lysozyme activity of the sample was determined by substituting the change in absorbance of the sample over time in a standard curve, and the result is shown in the graph of FIG.

As shown in FIG. 12, although there was no statistical significance, it was confirmed that the average lysozyme activity tended to increase in all of the group 12 tablet bee administered group compared to the control group.

3-5. Comparison of cytokine m-RNA expression level

M-RNA was extracted from the spleen of the control and purified bee venom groups and the expression of cytokines (IL-4, IL-18 and IFN-gamma) was measured using real-time PCR 13a, 13b, 13c to Table 1.

As shown in Figs. 13A to 13C and Table 1, there was no significant difference in the degree of cytokine expression between the control group and the tablet bee-administered groups.

Target Accession No. Nucleotide sequence (5'-3 ') GAPDH Forward
NM_204305 CCTAGGATACACAGAGGACCAGGTT GAPDH Reverse GGTGGAGGAATGGCTGTCA IL-4 Forward
NM_001007079 GCTCTCAGTGCCGCTGATG IL-4 Reverse GAAACCTCTCCCTGGATGTCAT IL-18 Forward
NM_204608 AGGTGAAATCTGGCAGTGGAAT IL-18 Reverse TGAAGGCGCGGTGGTTT IFN gamma forward
NM_205149 GCTCCCGATGAACGACTTGA IFN gamma Reverse TGTAAGATGCTGAAGAGTTCATTCG

3-6. Comparison of antibacterial effects of in-vitro purified bee venom

Salmonella Gallinarum (SG 3001) was used to investigate the antibacterial effect of tablets bee venom in vitro .

As a positive control, bee venom (V3375) (1,000 μg / ml, 500 μg / ml, 250 μg / ml) of Sigma was used as the experimental group. (8,400 ㎍ / ㎖), medium concentration (2,100 ㎍ / ㎖) and low concentration (420 ㎍ / ㎖)] were used as negative control. As a result, as shown in the photograph of FIG. 14, the bacterial growth inhibition band was confirmed in the high-concentration tablets bee venom.

4. Experimental results on bee venom composition for immunity enhancement and pain treatment

The effects of bee venom spraying method and eyedrop administration method on the determination of proper dose concentration, stability evaluation, evaluation of effect on growth rate, immunity increasing effect (macrophage activity, immune cell proliferation ability, measurement of T lymphocyte distribution in spleen, (CD4 +: CD8 + ratio, measurement of cytokine expression, and the like). As a result, it was found that bee venom is specifically involved in improving the growth rate and immunity of broiler chickens.

Table 2 shows the experimental group in which the effect of enhancing the body weight and the immunity function of the broiler were most excellent in Experimental Examples 2 to 3 (3-1 to 3-6).

As a result, it can be confirmed that the growth rate and immune function are significantly increased in a concentration-dependent manner relative to the useful components of bee venom.

Experimental Example 2 Experimental Example 3 3-1 3-2 3-3 3-4 3-5 3-6 In the experimental group,
OH4 group

OH4 group

OM4 group

OM4 group
12
All Counties

No significance
High concentration group

FIG. 15 is a graph showing an effect as an antibiotic substitute agent according to the growth rate of broiler chickens. As shown in the figure, compared to the case of using antibiotics, probiotics, organic acids and enzymes, the bee- It can be confirmed that it is remarkably high.

As a result of the clinical test, the weight gain (more than 20% of the control) and nonspecific immunity enhancement effect (increase of CD4 ⁺ / CD8 ⁺ ratio, control group 0.13 ± 0.08, 0.47 ± 0.14) was also observed.

Therefore, when the ophthalmic spray vaccine is administered in a poultry farm, the use of the bee venom composition can conveniently and effectively increase the immune response of the chicken, so that not only an antibiotic substitute but also high quality livestock products can be developed.

Hereinafter, a method for separating a protease and a useful substance from each other to improve the stability of a live bee venom ingredient in the bee keeping composition according to the present invention will be described in detail.

As shown in FIGS. 4 to 5, since bee venom contains a protease, hydrolysis of the protein occurs during drying and purification of bee venom, so that fragmentation or inactivation of the useful protein may occur.

16A and 16B are conceptual diagrams of a method for separating a protease and a useful substance using a nanostructure. As shown in FIG. 16A, a protease degrades a useful substance such as a peptide or a protein in an aqueous solution state, As shown in FIG. 16b, by using the nanostructure, when the protease and the protein are captured in the nanostructure, the useful substance is not decomposed.

Specifically, in order to solve the above problems, a model system can be used to confirm whether proteolysis of the protein is inhibited by using trypsin, which is well known as a protease, and mixing it with a nanostructure using albumin as a substrate thereof .

In addition, peptides and proteins, which are useful components of live bee venom, are encapsulated with nanoparticles such as PLGA (Poly D, L-Lactic-co-Glycolic Acid) to enhance stability and to allow sustained release It can be formulated into a livestock preparation (eyedrops or spray) to enhance its efficacy.

These PLGAs are used as biomaterials for porous scaffolds. PLGA has been widely used as a biodegradable and biostable scaffold material. However, it has been reported that PLGA alone does not provide a bone inducing environment for the formation of bone tissue of MSCs (mesenchymal stem cells).

And the problem of excessive use of antibiotics in the livestock industry, which is getting worse day by day, can be played as a substitute for antibiotics by standardizing and reconstituting the effective ingredient of bee venom which is a natural substance.

The present invention also relates to the use of the components of bee venom (e.g., phospholipase (PLA2), melittin, and MC dipeptide) as a natural bee venom (bee venom from bees) Which is excellent in efficacy and minimized in side effects. The present invention also provides a method for producing a resin bee keeping composition.

Table 3 shows the constituents and effects of the bee keeping composition according to the present invention.

Kinds ingredient weight(%) efficacy
Enzyme


Phospholipase A2 10-12 Destruction of cell tissue, hemolysis, catalysis Hyaluronidase &lt; / RTI &gt; 1-3 Tissue degradation, antigenic component Acid phosphoesterase Enhance antibody role Lysophospholipase
(lysophospholipase) Inhibition of PLA2 function Alpha-glucosidase &lt; / RTI &gt; Enhance antibody role
Other proteins and peptides Melittin 50 Cell lysis (leukocyte, mast cell, lysosome, mitochondria), anti-inflammatory action, immune function Apamin 1-3 Neuralgia relief, analgesia, anti-inflammation, immunity, neurotoxicity Mast cell granule reducing peptide 1-2 Anti-inflammatory action Cicarpine 0.5-2.0 Hypothermia, sedation Procamine 1-2 Radiation Protection Adola Finn Anti-inflammatory analgesic Proteinase inhibitor Protein and ester dissolution inhibition, anti-inflammation Touch affine 0.1 Mast cell. Degranulation action Small peptide 13-15 Physiological active amines Histamine 0.5-2.0 Blood pressure strengthening effect, intestinal contraction effect, gastric acid secretion promotion action Dopamine 0.2-1.0 Neurotransmitter Noradrenaline 0.1-0.5 amino acid T-amino acids (t-amino acids) 0.5 A-amino acids &lt; RTI ID = 0.0 &gt; 1.0 Sugar Glucose and fructose. 2 Volatile component 4-8

As shown in Table 3, various bee venom components include water-soluble components, lipid-soluble components, and insoluble components. However, in the past, only melittin (Melittin), a typical peptide protein among the water soluble components of bee venom, is quality-controlled as an indicator (functional) component. In addition, bee venom has been proven effective as an anti inflammatory agent for arthritis, and has been developed as a product approved by the Korean Food and Drug Administration for injection of human medicines.

In addition, animals are also registered as inflammatory drugs such as arthritis, but the scope of application is limited to arthritis of the dog and is not registered or permitted to be applied to livestock such as cattle, pigs, chickens, and ducks.

In recent years, the use of antibiotics added to cattle feed such as cattle, pigs, chickens, and ducks has been regulated, and there is a need for safe and inexpensive substitutes that are not toxic to livestock and accumulate in the body while producing antibiotic effects .

If the use of antibiotics is totally prohibited in livestock feed, it is urgent to develop a substitute for antibiotics. In the European Union (EU) since January 2006, the use of feed additive antibiotics without a veterinary prescription has been totally prohibited in the use of growth-promoting antibiotics (GPAs) for the growth of livestock.

The reason for adding antibiotics to feeds in general is to prevent disease and improve the body weight gain of livestock. Since the antibiotics added to the feed are not used alone but mixed with more than two kinds of antibiotics, abuse of the antibiotics causes the problem to remain in the livestock and the emergence of pathogens resistant to antibiotics.

Because of these problems, minimizing the addition of antibiotics to the feed has been legislated, and the use of self-diagnostic antibiotics on farms is strictly regulated without the veterinary prescription. For example, in Japan, antibiotics that require attention are prescribed to be used only by veterinary prescriptions. The United States also restricts the use of veterinary prescription drugs, veterinary medicine, and general medicine by strictly classifying animal drugs.

However, if such antibiotics abuse only strengthens the regulations on the use of antibiotics, the productivity will drop sharply due to the decrease in the animal growth rate, the decrease in the feed efficiency and the increase in the mortality rate, and the farmers will face difficulties. .

As a part of these efforts, products using oil, inorganic acid, plant-derived extracts, and probiotics have been developed and commercialized, but the substitution effect of antibiotics has not been developed yet, and excellent products that can replace antibiotics have not yet been developed. (For example, organic acids, lactic acid bacteria, immunostimulating agents, etc.) are mixed at random. In order to become an antibiotic substitute, it must first have a similar level of antimicrobial activity to antibiotics. It should be a safe substance that is not toxic to livestock and does not accumulate in the body. In addition, since it is not expensive compared to antibiotics in terms of price, it has utility and business feasibility. Therefore, it is easy to obtain a substance which is a raw material of natural antimicrobial agent, but it should be free of price burden.

Bee venom is a toxin possessed by natural bees and has been known to be effective in treating diseases by activating immune function. In particular, some farmers have used the whole bee venom as a pilot to prevent disease and have obtained very positive results.

The main components of bee venom are melittin, apamin and MCD-peptide (mast cell degranulating peptide) as shown in Table 3, and the efficacy of pancreatic hormone secretion promotion, blood circulation promotion, etc., have.

Bee venom is a biological drug and it is an animal herbal medicine that can supply and receive stable, and needs to control aspects such as uniformity of raw materials, ingredient ratio, storage and safety.

FIG. 17 is a graph showing the results of analyzing the protein components of the resin bee keeping composition used in the present invention. FIG.

18 is a graph showing that the resin beeing is superior in terms of effectiveness and safety as compared with the water-soluble beacon. In Fig. 18, EnBV represents encapsulated bee venom, WBV represents water soluble bee venom, and LWBV represents resin bee venom. Also, PEF represents high-voltage processed bee venom.

19A to 19G are graphs showing the results of analyzing the non-protein components of the resin bee keeping composition used in the present invention.

In Figures 19a-19e, Figure 19a shows the components analyzing the non-protein components of a standard bee venom. In Fig. 19A, EBV7 represents dinonyl phthalate and EBV11-7 represents chrysin. The abscissa represents UV (UltraViolet) absorbance and mAu is used as a unit.

FIG. 19F is a diagram showing cytidine and adenosine analysis in bee venom using TLC. FIG.

19g is a diagram showing the analysis of pinocembrin in bee venom using TLC.

Here, CBV (Crude bee venom) refers to crude bee venom which is a natural ingredient. Water soluble bee venom (WBV) is a bee venom composed of water-soluble components obtained from CBV. Lipid soluble bee venom (LBV) is a lipid soluble bee venom (LBBV) Means a bee venom (resin bee venom) composed of water-soluble and lipophilic components.

Table 4 shows the analysis of non-protein components of bee venom.

Fraction Molecular weight (MW) No inhibitor added Cytotoxicity test Remarks BVE - 5-10 g ++ (at 10 / / ml) Fraction BVB - 80 g - (at 100 [mu] g / ml) Fraction BV-3 296.31 > 200 uM + (at 80uM) compound BV-7 418.31 > 60 uM - (at 60 uM) compound BV11-7 286.05 60 uM + (at40uM) compound

In Table 4, BVE represents one component of the ethyl acetate extract fraction of bee venom. BVB represents one component of butanol extract fraction of bee venom. BV-3 means 11-eicosanol, BV-7 means dinonyl phthalate, and BV11-7 means chrysin.

The protein analysis data for bee venom as shown in Fig. 18 or Figs. 19a to 19g can be standardized on the basis of protein (peptide and the like) indicator components (enzymes and peptides) other than six non-white index components. As a result of studies on the indicator component and stability of bee venom, bee venom can be selectively changed by high-voltage treatment (pulsed electric field; PEF) or encapsulation.

FIGS. 20A and 20B are graphs showing quantitative changes of crude bee venom (CBV), water-soluble bee venom (WBV), and Lipid and Water soluble bee venom (LWBV) before and after high-voltage treatment (PEF) for bee venom.

Table 5 is a table showing the results of high performance liquid chromatography (HPLC) after high voltage treatment of the sweetener composition.

CBV WBV LWBV Before processing After processing Before processing After processing Before processing After processing Phospholipase 4393 ± 27 4720 + 24 (7% ↑) 2378 ± 3 2941 ± 2 (23% ↑) 2710 ± 17 2778 ± 29 Melitin 31269 ± 159 38353 ± 1243 (22% ↑) 19689 ± 178 20826 ± 519 (5.6% ↑) 20153 ± 173 21045 ± 111 (4% ↑)

The data shown in Table 5 represents the HPLC area before and after the high voltage treatment, with the mean standard deviation. Referring to Table 5, it can be seen that the PEF treatment resulted in a 22% increase in melittin in CBV and a 23% increase in phospholipase in water-soluble bee venom (WBV). However, in the case of resin bee venom (LBVW), no significant changes of phospholipase and melitin were observed.

However, in the case of water-soluble bee venom (WBV) or resin bee venom (LWBV), the amount of phospholipase and melitin decreased in the process of purification from CBV, but resin bee venom was more stable than high- I could confirm the fact.

The present invention provides a method for producing a resin bee keeping composition for treatment of immune enhancement and pain, comprising the steps of: (S10) separating bee venom using a water-soluble solvent and a fat-soluble solvent; (10) adding a fat-soluble solvent to the separated water- (S30) of adding a fat-soluble solvent to the separated second water-soluble layer (S30), filtering the separated third water-soluble layer to remove insoluble components to prepare a water-soluble layer (S50) of preparing a liposoluble layer by removing the insoluble components by combining the liposoluble layer which is secondarily separated and the thirdly separated liposoluble layer by a first step (S40) Mixing the water-soluble layer filtered with the water-soluble layer and the filtered liposoluble layer (S60), and concentrating and drying the mixture of the water-soluble layer and the liposoluble layer to obtain a resin bee keeping composition (S70).

FIG. 21 is a view showing still another method for producing the resin bee nosyzing composition for immune enhancement according to the present invention.

21, a method of producing beejing composition for immunostaining according to the present invention comprises the steps of (S11) extracting bee venom using a water-soluble solvent, and centrifuging the bee venom extracted using the water-soluble solvent to take a water- A step S21 of removing the insoluble component by filtering to remove the water-soluble solvent, a step S41 of adding a fat-soluble solvent to the dried residue to extract the fat-soluble solvent, Mixing the prepared water-soluble layer and the oil-soluble layer with each other (S61), and concentrating and drying the mixture of the water-soluble layer and the oil-soluble layer to obtain a resin And a step (S71) of obtaining a sweetener composition.

When the resin bee keeping composition thus obtained was subjected to a high voltage treatment for a time of 1 to 50 μs at a voltage of 20,000 to 30,000 V, it was confirmed that melittin and phospholipase were relatively increased in the case of the crude bee venom and the aqueous bee venom have.

When the volume ratio of the water-soluble layer and the liposoluble layer of the resin bee venom composition is 1: 0.1 ~ 1, it exhibits the most effective characteristics for the immunity enhancement and the pain treatment. It has inflammation efficacy.

Here, the water-soluble solvent is preferably any one selected from water, ethyl alcohol and methyl alcohol.

Here, the fat-soluble solvent is preferably any one selected from ethyl acetate, chloroform, ether and butanol.

In addition, in the case of the resin bee venom composition according to the present invention, it is also possible to perform nano encapsulation in order to regulate immunity and obtain a growth effect.

Hereinafter, embodiments of the method for manufacturing the immunosuppressive resin preserving composition according to the present invention will be described more specifically, and the present invention is not limited to the following examples.

&Lt; Example 2 >

Example 2 is an example showing a method for producing the resin-enumerating composition for immunostaining according to the present invention.

FIG. 17 is a view showing a method for producing the resin-enriched bee-isotonic composition for immunostaining according to the present invention.

Referring to Figure 17, 2.5 g of crude bee venom (CBV) was placed in a beaker and dissolved in 100 ml of distilled water (DW). The dissolved bee venom was added to a separatory funnel and added while washing the inner wall of the beaker with 150 ml of distilled water. Add 250 ml of ethyl acetate (EA) and shake well. The mixture thus prepared is allowed to stand through a separating funnel, the lid is opened, the pressure is released, and the mixture is allowed to stand, whereby the EA layer and the distilled water layer are separated by a difference in properties.

Distilled water in the lower layer of the separated upper layer (EA layer 1) and the lower layer (DW layer 1) was received through a beaker.

At this time, the upper layer was separately received. Separate the distilled water layer (DW layer 1) into a separatory funnel, add 250 ml of EA and mix well. Separate the upper and lower layers.

Distilled water in the lower layer of the separated upper layer (EA layer 2) and the lower layer (DW layer 2) was received through a beaker.

At this time, the upper layer was separately received. Separate the distilled water layer (DW layer 2) into a separatory funnel, add 250 ml of EA and mix well. Separate the upper and lower layers.

Distilled water in the lower layer of the separated upper layer (EA layer 3) and the lower layer (DW layer 3) was received through a beaker.

At this time, the upper layer was separately received.

Four kinds of samples were made in the range of 1: 1 to 1: 0.1 in volume ratio of separated distilled water layer (DW layer 3) and EA layer (EA layer 1, EA layer 2, EA layer 3 mixture solution). The four kinds of samples thus prepared were concentrated and dried.

Before the sample was concentrated and dried, a process was performed to remove insoluble components from the EA layer, which is a lipid soluble layer, and the distilled water layer, which is a water soluble layer.

Immunity test was performed by administering the resin bee keeping composition for immunity enhancement thus prepared to chicken (broiler).

&Lt; Example 3 >

1.0 g of crude bee venom was placed in a beaker and extracted with 100 ml of distilled water.

The water-soluble layer (DW layer) was separated by centrifugation at 3,000 rpm for 10 minutes and then filtered to remove insoluble components and to retain the water-soluble layer.

The centrifuged residue was dried to remove a small amount of the remaining distilled water.

The dried residue was extracted with 200 ml of chloroform, filtered to remove insoluble components, and then a chloroform layer was prepared.

The distilled water layer and chloroform layer were mixed and then concentrated and dried as in Example 1 to prepare a resin bee keeping composition of the present invention.

As will be described later, the volume ratio of the water-soluble layer to the liposoluble layer mixture is in the range of 1: 0.1 to 1 in terms of the volume ratio of the water-soluble layer and the oil-soluble layer.

The meanings of the symbols shown in the graphs of FIGS. 24 to 25 are as follows.

** control: resin bee venom-free (control group)

** Ocular: eye drops

** Spray: Spray

<Experimental Example 4> Experimental method and resin bee venom administration

First, broiler chicks (Ross) were classified into 11 groups and bee venom was prepared according to composition. Prepared bee venom was LBV (liposoluble bee venom), WBV (water soluble bee venom), LWBV (resin bee venom) and nano encapsulated bee venom (EnBV). The number of times of administration for tablet bee poisoning was limited to once or twice. In addition, the timing of administration of eye drops within 24 hours after hatching was used.

&Lt; Experimental Example 5 >

The broiler chicks were compared for 5 weeks. The resin bee venom was divided into 6 kinds according to the composition ratio of the fat soluble fraction and the water soluble fraction and two kinds of the lipid soluble bee venom (LBV) were tested.

FIG. 22A is a graph showing the amount of body weight gain of the broiler during the effect test of the resin bee venom composition according to the present invention, and FIG. 22B is a graph showing a comparison of cumulative body weight gain of the broiler during the effect test of the resin bee venom composition of the present invention. Details of the experiment are described with reference to Table 6.

division Contents n One control Solvent administration 20 2 LWBV-1
A sample containing a mixture of fat-soluble and water-soluble components of bee venom at a certain ratio is administered 19 3 LWBV-2 19 4 LWBV-3 19 5 LWBV-4 19 6 LWBV-5 19 7 LWBV-6 19 8 LBV-1 Applying the fat-soluble ingredient of bee venom 19 9 LBV-2 19 10 WBV Water-soluble components of bee venom are administered 19 11 EnBV Encapsulated bee venom is administered 15

As a result of the experiment according to Experimental Example 5, it was confirmed that the weight gain of broiler chicks observed for 5 weeks was significantly increased only when resin bee venom was administered and when encapsulated bee venom was administered. Experimental results of accumulated weight gain showed about 120% increase compared to the control group.

FIG. 23A shows the change in the amount of gain according to the number of administration of the resin bee venom. FIG. 23B is a graph showing the degree (absorbance) of the activity of B cells varying with the number of administration of the resin bee venom. FIG. 23C is a graph showing the degree (absorbance) of the activity of the T cell according to the number of administrations of the resin bee venom. FIG. FIG. 23D is a graph showing the degree to which the ratio of CD4 ⁺ / CD8 ⁺ varies according to the number of administration of resin bee venom.

CD4 ⁺ cells are immature helper T cells that recognize and bind MHC (Major Histocompatibility Complex, MHC).

CD8 ⁺ cells are immature killer T cells that are responsible for cellular immunity. In order to maintain self-homogeneity, the living body identifies foreign substances entering the living body and destroys them. This is called immunity. The exclusion of living organisms includes foreign substances such as bacteria and viruses, as well as foreign substances such as infected cells, reticulated tissues and cancer cells. The body forms a primary line of defense through epidermal tissue, substances secreted from the epidermis, and internal organs isolated from the body by a tube structure. When an intruder penetrates the body through the first line of defense, the second line of defense works. It is an internal defense line that works immediately against the intruder who penetrated the primary line. It does not distinguish the intruder, and is divided into chemical defense and cell defense.

The invaded cells secrete chemicals that kill the intruder or stop the invasion. Lysozyme is a protein that exists in sweat, saliva, tears, etc. and dissolves bacterial cell walls. At this time, the complement is about 20 types of plasma proteins, which surround the surface of the intruder to promote the phagocytosis (opsonization) of the phagocyte, or to directly puncture the intruder's lipid membrane.

In contrast, nonspecific cell defense means that macrophages (macrophages), leukocytes, and monocytes attack the intruder.

A specific defense mechanism against the above-mentioned nonspecific defense is immunity. Immune responses include humoral immunity and cellular immunity. B lymphocytes are produced in the liver of the red marrow and fetus. Helper T cells help the body to differentiate into plasma cells, secrete antibodies to humoral responses and some become memory cells.

Helper T lymphocytes differentiate in the thymus. It secretes cytokines and differentiates other immune cells, and some of them become memory cells.

Killer T lymphocytes also differentiate in the thymus. It directly destroys viruses or pathogens, or carries a cellular reaction that destroys its own cells or cancer cells infected with them.

Resin bee venom or encapsulated bee venom can be used in the eye (dorsal) or nasal mucosa (nasal) administration mode and it is possible to prevent diarrhea and chronic wasting disease that occurs when immune function is poor. When used to prevent diarrhea and chronic wasting disease, it is advisable to administer very small amounts (less than 10 μg of melitin) to animals or humans. More preferably in a weight range of 0.1 to 10 [mu] g, in a manner to continuously stimulate the immune cells.

This is a concept of preventive treatment utilizing the immune enhancement effect of bee venom, and it functions as a physiologically stabilized western release formulation, differentiating it from the conventional use of water-soluble bee venom, and can be used as a very stable form.

<Experimental Example 6> Comparison of antimicrobial activity of resin bee venom

17, by the method of purifying the resin bee venom shown in FIG. 17, the samples prepared within the range of 1: 1 to 1: 0.1 in liposoluble ratio and the minimum concentration of the bee venom sample, The inhibitory concentration (MIC) test was used to measure the antimicrobial activity against the seven strains.

Table 7 shows the results of the minimum concentration inhibition experiment of resin bee venom according to the present invention.

P.C menstruum No.1 No.2 No.3 No.4 No.5 No.6 No.7 No.8 No.9 No.10 No.11 No.12 S. aureus 125
D.W 500 500 100 250 500 500 500 500 500 500 250 500 DMSO 31.25 31.25 62.5 31.25 31.25 31.25 31.25 31.25 31.25 31.25 31.25 31.25 E. Hirae
62.5
DW 1.95 7.81 1.95 0.98 1.95 1.95 1.95 1.95 1.95 1.95 0.98 0.98 DMSO 7.81 7.81 15.63 15.63 3.91 15.63 7.81 7.81 7.81 7.81 7.81 7.81 M. Luteus 62.5
DW 0.98 1.95 3.91 1.95 0.98 1.95 1.95 0.98 1.95 1.95 0.98 0.95 DMSO 7.81 15.63 15.63 15.63 7.81 15.63 15.63 15.63 15.63 7.81 7.81 7.81 Mutans 62.5
DW 62.5 125 > 1000 62.5 62.5 62.5 250 62.5 62.5 62.5 31.25 31.25 DMSO 62.5 62.5 62.5 31.25 31.25 62.5 62.5 62.5 31.25 31.25 31.25 31.25 S. epidermidis
125
DW 31.25 31.25 62.5 31.25 31.25 62.5 31.25 62.5 31.25 31.25 31.25 31.25 DMSO 62.5 62.5 62.5 62.5 31.25 62.5 125 62.5 62.5 31.25 31.25 62.5 Subtilis 62.5 DW 250 500 500 500 500 500 500 500 500 250 500 500 DMSO 500 1000 1000 1000 500 1000 1000 1000 500 500 500 500 P. acnes
125
DW 500 1000 1000 500 500 500 1000 500 500 500 250 250 DMSO 250 250 250 250 125 250 500 250 250 125 125 125

In Table 7, P.C means a positive control (unit: μg / ml). Nos. 1 to 12 are the indexing numbers according to the characteristics of the sample.

Among the seven strains used in the test, the highest activity was observed in the hirae strain, while the crude bee venom (No.1) and the lipid soluble bee venom (No.3) were treated with DMSO (dimethyl sulfoxide) , The antimicrobial activity was increased to 2 times (No.5) and 4 times (No. 7), respectively. When distilled water (DW) was used as a solvent in four types of resin beads according to the fat solubility ratio, the antimicrobial activity of the two samples (No. 11 and No. 12) was doubled Respectively.

The minimum concentration inhibition test in the bee venom samples was serial dilution after being diluted with the sample medium used for the disk method so that the maximum concentration became 2000 μg / ml (final concentration 1000 μg / ml). In addition, the bacteria cultured for one day were diluted with the medium to an absorbance of 0.2 (final absorbance 0.1) at 600 nm.

The sample treatment was carried out at 37 ° C and 120 rpm (round per minute) for 24 hours.

<Experimental Example 7> Effect of liposoluble content of purified bee venom on immunity of broiler chickens

A total of 4 bee venom samples were used in the immunity test of broiler chicks, and resin bee venom containing both water soluble and liposoluble was the target.

In the preparation method of the composition, 250 ml of a water-soluble solvent and 750 ml of a fat-soluble solvent were used in 2.5 g of CBV, and the resin beeing ratio was set to 1 based on the volume of the solvent used, Ml as 1 and expressed as a ratio of water-soluble: liposoluble.

Each sample was different according to the lipid soluble ingredient contents. The maximum lipid soluble content was 1, and the samples were prepared in the range of 1: 1 to 1: 0.1. Each of the bee venom samples was prepared at a concentration of 2.1 mg / ml (medium concentration) using a solvent, and was applied to both the topical and the spraying methods. The dose of bee venom according to each inoculation method was 5ml / 10chicks for spray inoculation and 10μl / chick for instillation.

7-1. CD4 ⁺ / CD8 ⁺ ratio of spleen T cells

The ratio of lymphocytes isolated from the spleen was analyzed by flow cytometry. After splenectomy, the cells were liberated using a cell strainer, and the cells were suspended in RBC (red blood cell) and lysis buffer for 10 minutes to destroy the red blood cells. After centrifugation at 2,500 rpm for 5 minutes, the supernatant was removed and the number of lymphocytes was diluted to 5.0 × 10 ⁶ cells / ㎖ by centrifugation with PBS (Phosphate Buffer Saline). FITC anti-chicken CD3 (total T cells) and PE anti-chicken BU-1 (B cells) or FITC (Fluorescein Isothio-Cyanate) anti-chicken CD4 (help T cell) And stained with anti-chicken CD8 (cytotoxic T-cell) antibody for 30 min in the dark room. After the reaction, the cells were centrifuged twice, and 1 ml of PBS was dispensed. The ratio of lymphocytes in the spleen was measured using a flow cytometer (FACS Calibur FACS, BD Biosciences, USA).

24 is a graph showing the ratio of CD4 ⁺ to CD8 ⁺ in lymphocytes (helper T cells) isolated from the spleen of broiler chickens against the resin composition for treating immunity and pain according to the present invention.

Referring to FIG. 24, results 1 to 4 of ocular were not significantly different from those of the control group, but it can be confirmed that the composition of spray 3 (1: 0.1 to 0.5) shows a significant change.

Analysis of the ratio of CD4 ⁺ to CD8 ⁺ , one of the major components of the general immune status, showed a significant increase of only 1.358 ± 0.225 in the composition of spray 3 compared to the control (0.827 ± 0.210).

7-2. Experiments on the activity of lysozyme activity in blood

The activity of macrophages was evaluated by comparing plasma lysozyme concentrations of control and bee venom groups using the degree of degradation of crystalline lysozyme as a standard curve. To measure lysozyme activity in serum, crystalline lysozyme was dissolved at a concentration of 0.5, 1, 2, 3, 4, 5 μg / ml and prepared as standard. To each well of the 96-well plate was added 200 [mu] l of lysodeikticus solution and 20 [mu] l of the standard lysozyme prepared beforehand or serum was added. The samples thus prepared were incubated at 41 ° C for 1 hour and the absorbance was measured at intervals of 15 minutes (540 nm). The lysozyme activity of the sample was determined by substituting the standard curve for the change in absorbance with time of the sample.

The concentration of lysozyme, a bacterial wall-destroying enzyme secreted mainly from macrophages, was measured as 11.870 ± 0.446, which was significantly higher than that of control (9.113 ± 1.118).

25 is a graph showing the results of lysozyme activity of resin bee venom according to the present invention.

Referring to FIG. 25, it can be seen that the spray 3 resin bee venom (indicated by **) shows significant results as compared with the control group.

7-3. Anti-inflammatory activity of bee venom fraction

Inflammation is a defensive response of the body to a stimulus that can cause injury, and is a series of processes involving various cells and cytokines. This process is characterized by the infiltration of inflammatory cells such as macrophages and granulocytes into inflammatory sites, mainly through internal stimulus sources such as lipopolysaccharide (LPS) or arachidonic acid metabolites. In particular, activated macrophages of inflammatory sites play a major role in mediating inflammation by mass production of not only cytokines but also arachidonic acid metabolites and nitric oxide (NO).

Currently, many candidates developed to prevent inflammatory damage selectively regulate the induction of iNOS and COX-2 expression by directly inhibiting the activity of iNOS or COX-2 or inhibiting NF-B signaling, which regulates transcriptional steps These are materials that have the ability to function.

The cytotoxicity of RAW 264.7 cells according to their concentrations was investigated. RAW 264.7 macrophages were inoculated into each well of a 96-well plate at ⁵ × 10 ⁵ for 8 hours, and LBV samples were added for each concentration and pretreated for 16 hours. LPS (lopopolysaccharide), an intracellular toxin that causes inflammation in macrophages, was treated with cells to a concentration of 2 ug / ml and cultured for 24 hours. The survival rate of RAW 264.7 cells was measured by MTT after cell culture and the amount of nitric oxide (NO) and TNF-α (tumor-necrosis factor-α) contained in the cell culture medium was measured using a quantitative kit The anti-inflammatory effects of BV on LPS-induced macrophage inflammation were measured.

  As a result, it was confirmed that the cytotoxicity was different according to the composition ratio of bee venom fractions, and LBV showed an anti-inflammatory reaction within the range of no cytotoxicity (FIG. 26). As seen from this result, bee venom shows significant difference in toxicity and anti-inflammatory effect according to its composition.

26 is a graph showing cytotoxicity against lipid soluble fraction (LBV) in the bee venom fraction according to the present invention.

Figure 27 is a graph showing the anti-inflammatory effect of the lip balm fraction (LBV) in the bee venom fraction according to the present invention.

The results of the anti-pain test using resin bee venom will be discussed below.

Neuropathic pain is a chronic pain syndrome characterized mainly by spontaneous pain, allodynia, and hyperalgesia that occurs after peripheral nerve injury. It causes severe pain by temperature change or light contact, and pain relieved by general pain medication or drugs. Do not.

Knowledge of the mechanism of neuropathic pain and the ability to identify new medications that regulate it has been greatly enhanced by the introduction of peripheral neuropathic rat models with posttraumatic pain.

To date, neuropathic pain models in rats have been widely used in three models: CCI (Chronic Constriction Injury), PSL (Partial Sciatic Ligation), and SNL (Spinal Nerve Ligation) .

Four types of behavioral assays following the basic process of making these models are used to quantify neuropathic pain symptoms. Protocol 1 (Thermal Hyperalgesia), Mechano Hyperalgesia, Mechano Allodynia, and Protocol 4 (cold allodynia). Are commonly measured to assess the outcome of this basic pain model.

Hyperalgesia refers to a situation where you feel the pain is excessive. Sometimes I feel pain, such as stimuli or temperature stimuli, which usually do not feel pain. The pain is thought to be in a state of irritation, and it can be seen early in neuralgia, neuritis, inflammation of the brain or spinal cord, meningitis. Pain is augmented and sustained over time by stimulation of pain receptors.

Allergic pain means that pain is also present in stimuli that do not activate the nociceptor receptors.

Here, these definitions are as follows. Hyperalgesia is an excessive pain sensation caused by a harmful stimulus, and allodynia is a pain caused by an analogous stimulus. Conceptually, the distinction between the two is different, but the difference is ambiguous in experiments using mice and patients.

(1) Chronic contraction injury model: The CCI model, which is the first model of traumatic peripheral neuropathic pain, forms the partial ganglion of the sciatic nerve. The sciatic nerve is more afferent axillary axillary myelinated afferent axons). Unlike previous models that have completely excised peripheral nerves, the CCI model allows partial pain relief of pain behavior induced by stimulating the hindpaw of the nerve.

(2) local sciatic nerve ligation (PSL) model of neuropathic pain

The PSL model includes local delineation of the sciatic nerve, but the effect is the same in all axon axons.

(3) Spinal nerve ligation (SNL) model of neuropathic pain

Afferent axons in the sciatic nerve have their central branches in the fourth and fifth lumbar dorsal roots. Like the CCI and PSL models, the SNL model provides local delineation of the sciatic nerve. And, like the PSL model, the effect is the same in all sizes of afferent axons. The SNL model is characterized by nerve damage occurring at the level of the nerves 5 and 6. This is where the dorsal roots and the ventral root meet at the distal part of the DRG (Dorsal Root ganglion) and the spinal nerves are located at the proximal part of the lumbar plexus Respectively.

The plexus is the reticular structure of the urogenital nerve in the abdominal wall on both sides of the lumbar vertebra. The human is part of the cells of the anterior nerves of the first, second, and third nerves, have. It is also called sacral plexus combined with sacral plexus. The distribution area is the muscles and skin of the lower abdomen, pelvis, and femur. The main nerves of the abdomen include the iliac lower nerves, the iliac crest, the femoral nerve, the lateral femoral nerve, the femoral nerve, and the closed nerve.

The most advantageous feature of the SNL model is that it does not damage the afferent axon of the sciatic nerve via the fourth lumbar dorsal root.

Hereinafter, behavioral studies on thermal hyperalgesia, mechanical hyperalgesia, mechanical allodynia, and cold sores are described.

(1) Thermal hyperalgesia is measured using a Hargreaves device. The Hargreaves unit goes through a paw-flick test where the mice are trapped in a clear plastic compartment and a bright, heated light source hits the hindpaw.

The main measurement result of this paw-flick test is the mean epithelial latency of each hind paw.

(2) Mechanical hyperalgesia is a needle stab test. The mechanical hyperalgesia test is measured in two ways. Rats are trapped in a transparent plastic cage with wire mesh bottoms, and the net is about 1 cm in diameter. If the hole is bigger, the nerve-damaged foot will fall into the hole, and if it is smaller, it will be hard to see. The general reaction to stabbing is very small amplitudes and short, continuous escape reflections. After nerve damage, the amplitude and duration are increased a lot, and animals will often lick the stimulus area. Stimulated feet often have senseless points, which must stimulate two or three points. At the end of this test, the same stimulus should be applied to the opposite foot. Stimulated rats should be stimulated every time they take a break or take a break. This is because it is difficult to detect an additional flexor reaction in a strongly bent limb.

(3) Mechanical allodynia is measured using von Frey Hairs. Hairs are nylon monofilaments of different diameters, which exert a certain amount of force when pressure is applied to the skin with a degree of bending of the hair. Commonly used monofilament settings are found in the Semmes-Weinstein series. The monofilament is composed of 20 filaments, the characteristics of which are shown in Table 8.

order Label (Log force (0.1 mg)) Force (g) Diameter (mm) One 1.65 0.0045 0.0635 2 2.36 0.0230 0.0762 3 2.44 0.0275 0.1016 4 2.83 0.0677 0.1270 5 3.22 0.1160 0.1524 6 3.61 0.4082 0.1778 7 3.84 0.6968 0.2032 8 4.08 1.194 0.2286 9 4.17 1.494 0.2540 10 4.31 2.062 0.3048 11 4.56 3.632 0.3556 12 4.74 5.500 0.3810 13 4.94 8.650 0.4064 14 5.07 11.70 0.4318 15 5.18 15.00 0.4826 16 5.46 29.00 0.5588 17 5.88 75.00 0.7112 18 6.10 127.0 0.8128 19 6.45 281.5 1.0160 20 6.65 447.0 1.1430

Some points to note about von Frey Hairs: First, stimuli are sometimes reported in units of pressure (Newton = force × area). The total cross-sectional area of the hair in the stimulus region is estimated by assuming that the skin is in equal contact with the skin, there is no edge effect, and the elasticity of the skin can be ignored. Second, the nylon monofilaments are hydrophilic, and are often influenced by the stiffness and strength of the resulting humidity. This is not a problem when performing left-right comparisons or when all the experimental groups are performing the same day experiment. However, serious errors may occur if the data to be compared is obtained using a few days or weeks of processing. In the latter case, the humidity in the test chamber should be carefully checked. A specific level of humidity can be corrected by comparing each hair with its pan balance.

Third, when the end of the monofilament is blunt, the sharp point is applied instead of the relatively blunt end.

Experimental Example 8

SNL model was used to confirm anti - pain effects on alopecia areata. Male Sprague-Dawley rats of 250-300 g were used in the experiment. All feeds were fed on the bedside to minimize the difficulty of feeding due to the pain caused by the pain. All measurements were performed according to NIH (NIH publication no. 86-23, revised 1985) The experiment was in compliance with the International Association for the Study of Pain (IASP) (Zimmermann M., Pain, 16: 109-110 (1983)).

Rats were anesthetized with a mixture of 2% halothane and N ₂ O / O ₂ (2: 1 ratio), and their dorsal hairs were placed on the operating table in a prone position. All operations were aseptically operated, and the dorsal part of the left lumbar and sacral regions of the rat was incised up and down about 3 cm and the fascia surrounding the dorsal muscle was blunt-tipped scissor The lumbar spine (L6) was removed and the ventral ramus of the L5 spinal nerve passing under the spinal nerve was tightly held with a silk (6.0) A series of ligature surgery was completed by cutting the spinal cord nerve to the lower part of the braid, the knot, and suturing the muscle and skin. In the control group (sham), the same procedure was applied to the pre-ligation and nerve shearing stages, and then the experiment was performed.

(Experiment result)

In the case of the successful completion of the spinal nerve ligation surgery, the foot of the operated side is planar flexion, inward, hind limb slightly, and not completely landed on the ground.

These rats exhibit postural neuropathic behaviors, ie, lifting the soles to the stimulation of soft camel hair. These pain responses peak at five days post-surgery. (LWBV) 0.1 to 0.5 mg / kg body weight (BW) and water soluble bee venom (WBV) 0.1 mg / kg bw ) &Lt; / RTI &gt; That is, 0.025 to 0.25 mg of the resin preserving composition is applied to a test animal in an amount of 0.0001 to 1 mg / kg based on 250 g of the body weight of an experimental animal, in sterilized saline or a solvent (0.05 to 1 wt% of propylene glycol, 0.1 to 5.0 wt% of ethanol, (Mixed solvent). After each intraperitoneal injection, they were evaluated using "von Frey Hairs" by behavioral assays (mechano-allodynia) as described above.

28 is a bar graph showing the results of pain tests of the resin bee venom composition for treating immune enhancement and pain according to the present invention.

29 is a line graph showing the anti-pain effect according to the resin bee venom composition according to the present invention.

Referring to FIGS. 28 to 29, it was confirmed that the anti-pain persistence after 0.5 hours of the resin bee keeping composition for treating immunity and pain according to the present invention was greater and remarkably exhibited.

This shows that the persistence (effect) of pain is differentiated by different bee venom fractions. In addition, this experiment shows the selectivity of the use of the resin bee keeping composition for treating immune enhancement and pain according to the present invention as an anti-pain effect fraction for chronic pain.

To elucidate the differential mechanism of action of resin bee venom, we compared the groups that injected resin bee venom with the pre - surgical method and the group that treated after - treatment bee venom. As a result, the threshold of mechanical pain increased significantly after 2 weeks of neural ligation. In addition, a remarkable difference was observed in mechanical pain when compared with the sham group after 7 days of nerve connection.

The mechanical tolerance (SNL) in the group treated with the resin bee venom composition for the treatment of immune enhancement and pain according to the present invention increased significantly after 7 days. This effect lasted 14 days after SNL.

As mentioned above, although preferred embodiment of this invention was described in detail, this invention is not limited to the said embodiment, A various deformation | transformation by a person of ordinary skill in the art within the scope of the technical idea of this invention is carried out. This is possible.

Claims (16)

(S10) a first step of separating bee venom using a water-soluble solvent and a fat-soluble solvent;
(S20) of adding a fat-soluble solvent to the separated primary water-soluble layer to secondary fractionate it;
A step (S30) of tertiary fractionation by adding a fat-soluble solvent to the separated secondary water-soluble layer;
Filtering the separated tertiary water-soluble layer to remove insoluble components to prepare a water-soluble layer (S40);
A step (S50) of preparing a liposoluble layer by removing an insoluble component by combining the first and second liposoluble layers separated in the first separated liposoluble layer and the third separated liposoluble layer;
Mixing the water-soluble layer filtered with the third water-soluble layer and the filtered liposoluble layer (S60); And
Concentrating and drying the mixture of the water-soluble layer and the fat-soluble layer to obtain a resin poisoning composition (S70) method for producing a resin poisoning composition for immuno-enhancing and pain treatment. Extracting bee venom using a water-soluble solvent (S11);
Centrifuging the bee venom extracted using the water-soluble solvent to remove the insoluble component (S21);
Drying the centrifuged residue to remove the water-soluble solvent (S31);
Adding a fat-soluble solvent to the bee venom and extracting it (S41);
Filtering bee venom extracted using the oil-soluble solvent to remove insoluble components (S51);
Mixing the prepared water-soluble layer and a fat-soluble layer with each other (S61); And
Concentrating and drying the mixture of the water-soluble layer and the fat-soluble layer to obtain a resin poisoning composition (S71); a method of producing a resin poisoning composition for immunological enhancement and pain treatment comprising a. The method according to claim 1 or 2,
The water-soluble solvent is water, ethyl alcohol, methyl alcohol, a method for producing a resin poisoning composition for immunological enhancement and pain treatment, characterized in that any one selected from. The method according to claim 1 or 2,
The fat-soluble solvent is any one selected from hexane, ethyl acetate, chloroform, ether, butanol. The method according to claim 1 or 2,
Resin poisoning composition for immuno-enhancing and pain treatment, characterized in that it further comprises the step (S80) for a high voltage for 1 ~ 50 ㎲ time at a voltage between 20,000 ~ 30,000V with respect to the resin poisoning composition obtained by concentration and drying Manufacturing method. The method according to claim 1 or 2,
When the volume ratio of the water-soluble layer and the fat-soluble layer is 1: 0.1 ~ 1, the method of producing a resin poisoning composition for immuno-enhancing and pain treatment exhibiting effective features for immuno-enhancing and pain treatment. The method according to claim 1 or 2,
The volume ratio of the water-soluble layer and the fat-soluble layer is a method for producing a resin poisoning composition for inflammation treatment, characterized in that it has an excellent anti-inflammatory effect consisting of 0 ~ 0.5: 1. The method according to claim 1 or 2,
The resin bee venom composition is a method of producing a resin bee venom composition for immune augmentation and pain treatment, characterized in that the ratio of CD4 + / CD8 + in the spleen of broiler when administered to broilers. The method according to claim 1 or 2,
The resin bee venom composition is a method for producing a resin bee venom composition for immuno-enhancing and pain treatment characterized in that the lysozyme activity is 7 ~ 14 ㎍ / ㎖ when administered to broilers. The method according to claim 1 or 2,
The resin bee venom composition is a method of producing a resin bee venom composition for immuno-enhancing and pain treatment, characterized in that it can be administered in the eyepiece or nasal administration. The method according to claim 1 or 2,
The resin bee venom composition is a nonprotein component of dinonyl phthalate, chrysin, 11-eicosenol, cytidine, adenosine, and pinocembrin. Method for producing a resin poisoning composition for immuno-enhancing and pain treatment comprising any one or more selected from. The method according to claim 1 or 2,
The resin poisoning composition is a method of producing a resin poisoning composition for immuno-enhancing and pain treatment, characterized in that it comprises any one or more selected from melittin, apamin, phospholipase A-2, MC peptide as a protein component. The method according to claim 1 or 2,
The resin bee venom composition is a method for producing a resin bee venom composition for the treatment of immune augmentation, inflammation and pain, characterized by effects on cytotoxicity and anti-inflammatory. A composition for parenteral administration characterized in that the dose per animal body of the resin bee venom composition obtained by the method of claim 1 or the method of claim 2 is 0.0001 to 1 mg / kg. 15. The method of claim 14,
Wherein the composition for parenteral administration can be injected subcutaneously or intraperitoneally. 15. The method of claim 14,
Wherein the resin bee venom composition is dissolved in 0.1 to 10 ml of sterilized saline or a solvent (0.05 to 1% of propylene glycol, 0.1 to 5.0% of ethanol and sterilized water, etc.) and applied or introduced into the body of an animal Lt; / RTI &gt;

Images