KR101391911B1 - Bee venom composition having improved growth rate and immune function - Google Patents

Bee venom composition having improved growth rate and immune function Download PDF

Info

Publication number
KR101391911B1
KR101391911B1 KR1020100130671A KR20100130671A KR101391911B1 KR 101391911 B1 KR101391911 B1 KR 101391911B1 KR 1020100130671 A KR1020100130671 A KR 1020100130671A KR 20100130671 A KR20100130671 A KR 20100130671A KR 101391911 B1 KR101391911 B1 KR 101391911B1
Authority
KR
South Korea
Prior art keywords
bee venom
bee
present
weight
venom
Prior art date
Application number
KR1020100130671A
Other languages
Korean (ko)
Other versions
KR20120069221A (en
Inventor
안창기
박진규
전종운
현풍미
이경진
Original Assignee
(주)비센
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by (주)비센 filed Critical (주)비센
Priority to KR1020100130671A priority Critical patent/KR101391911B1/en
Publication of KR20120069221A publication Critical patent/KR20120069221A/en
Application granted granted Critical
Publication of KR101391911B1 publication Critical patent/KR101391911B1/en

Links

Images

Classifications

    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K35/00Medicinal preparations containing materials or reaction products thereof with undetermined constitution
    • A61K35/56Materials from animals other than mammals
    • A61K35/63Arthropods
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K9/00Medicinal preparations characterised by special physical form
    • A61K9/0012Galenical forms characterised by the site of application
    • A61K9/0019Injectable compositions; Intramuscular, intravenous, arterial, subcutaneous administration; Compositions to be administered through the skin in an invasive manner
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K9/00Medicinal preparations characterised by special physical form
    • A61K9/0012Galenical forms characterised by the site of application
    • A61K9/0048Eye, e.g. artificial tears

Abstract

본 발명은 생체 활성화에 효과적인 봉독조성물에 관한 것으로서, 보다 상세하게는 인간, 가축류, 어류, 가금류 등의 생체에 대하여 질병 예방과 치료 및 면역기능 향상의 효과를 제공하며, 항생제에 내성이 없고, 안전하게 사용할 수 있으며, 기존의 항생제 대체제에 비해 증체율 및 면역기능을 향상시킬 수 있는 봉독조성물에 관한 것이다.
본 발명에 따른 봉독조성물는 봉독을 유효성분으로 포함하는 것을 특징으로 한다.
The present invention relates to a bee keeping composition effective for biological activation, and more particularly, to a bee keeping composition effective for preventing and treating diseases and improving immunity against living organisms such as human, livestock, fish and poultry, And can improve the weight gain and immune function as compared with conventional antibiotic substitutes.
The starch composition according to the present invention is characterized by containing bee venom as an active ingredient.

Description

증체율 및 면역기능이 향상된 봉독조성물{BEE VENOM COMPOSITION HAVING IMPROVED GROWTH RATE AND IMMUNE FUNCTION}TECHNICAL FIELD [0001] The present invention relates to a bee keeping composition having improved weight gain and immune function,

본 발명은 생체 활성화에 효과적인 봉독조성물에 관한 것으로서, 보다 상세하게는 인간, 가축류, 어류, 가금류 등의 생체에 대하여 질병 예방과 치료 및 면역기능 향상의 효과를 제공하며, 항생제에 내성이 없고, 안전하게 사용할 수 있으며, 기존의 항생제 대체제에 비해 증체율 및 면역기능을 향상시킬 수 있는 봉독조성물에 관한 것이다. The present invention relates to a bee keeping composition effective for biological activation, and more particularly, to a bee keeping composition effective for preventing and treating diseases and improving immunity against living organisms such as human, livestock, fish and poultry, And can improve the weight gain and immune function as compared with conventional antibiotic substitutes.

봉독은 벌 복부 끝 독낭(毒囊)에 저장되어 봉침과 연결되어 자극 시에 분비되는 동물성 천연생리 활성물질로서 이 봉독을 이용한 치료는 이집트, 바빌로니아에서 치료목적으로 사용되었다는 기록이 남아 있으며, 히포크라테스도 봉독을 “신비한약”으로 표현하고 있다. The bee venom is an animal natural physiologically active substance that is stored in the venom endotracheal tube (poison 囊) and is connected with the needle and stimulated during stimulation. There is a record that this bee venom treatment was used for therapeutic purposes in Egypt and Babylonia, and Hippocrates Bee ven to "mysterious medicine" is expressed.

우리나라에서도 마왕퇴백서(최초의 침구학문헌), 동의보감, 민간요법에서 생봉침을 통증 및 류마티스 관절염 치료에 이용하였다는 기록이 남아 있다. There is a record in Korea of the use of raw sticks in the treatment of pain and rheumatoid arthritis in the Maharaja white paper (first acupuncture literature), Dongbuogam and folk remedies.

이런 봉독은 염증유발 동물의 부종을 감소시키고, 관절염 환자의 활막세포에 작용하여 그 주성분 멜리틴(melittin)이 NF-kB를 비활성화시킴으로써 NO의 양을 감소시키며 COX-2를 억제하여 항염증효과를 유발하는 것으로 알려져 있다.This bee venom reduces edema in inflammatory animals, acts on synovial cells in arthritis patients, melittin inactivates NF-kB, thereby reducing the amount of NO and inhibiting COX-2. .

봉독의 성분을 분리 정제하여 치매나 암치료에 이용하는 등의 봉독처리 후 효과를 확인하는 생리적 연구나 건조봉독의 성분분석에 대한 연구결과는 이미 보고되어 있다. Studies have been reported on physiological studies confirming the effects of bee venom treatments, such as separation and purification of bee venom components and their use in the treatment of dementia and cancer, and on the analysis of constituents of dry bee venom.

한의학에서는 염증 질환의 치료제로 오랫동안 사용되어 왔으며 봉독의 항염증 효과와 항암 효과에 대해서 연구하고 있다. In oriental medicine, it has been used for a long time as a treatment for inflammatory diseases, and is studying the antiinflammatory and anticancer effects of bee venom.

봉독을 이용한 동물의 관절염 또는 항염증 치료제 개발 연구는 이미 농진청을 비롯한 많은 정부기관에서 수행된 바 있다.Research on the development of anti-arthritic or anti-inflammatory drugs for bee venom in animals has already been carried out in many government agencies including RDA.

이와 같이 봉독은 많은 치료 경험 과정에서 면역증강 효능이 비교적 자주 관찰되나 이 효능에 맞는 봉독시료의 규격화 및 조성물의 표준화가 온전히 이루어지지 않아 그동안 면역기능 강화 기능성 약물로서 구체적, 실용적 연구결과물이 도출되지 못했다는 문제가 있다.As such, bee venom has a relatively frequent immune enhancement effect in the course of many treatment experiences, but the standardization of the bee venom samples and the standardization of the compositions that do not satisfy the efficacy have not been fully accomplished, and concrete and practical research results have not been obtained as immune function enhancing functional drugs There is a problem.

특히 봉독 자체의 다양한 질환의 치료 내지는 면역기능 향상 및 증체율을 증대시키는 것에 대한 연구는 아직 추진되지 않고 있는 실정이어서, 봉독의 건조과정에서 초래되는 일부 활성 물질의 소실, 변성에 대한 연구와 멜리틴을 포함한 봉독의 유효성분들을 표준화하여 안정적이고 효과적인 신개념 치료제를 개발할 필요가 있다.In particular, there has been no research on the improvement of immunological function and the increase of the growth rate of various diseases of bee venom itself. Therefore, studies on disappearance and denaturation of some active substances caused by the drying process of bee venom, It is necessary to standardize the efficacy of bee venom, and to develop a stable and effective new therapeutic agent.

한편, 항생제는 살아있는 유기물에서 추출한 것으로 다른 미생물의 생장을 억제하거나 죽이는 물질을 말한다. 지금까지 4천여 가지 이상의 항생제가 발견됐고 현재 50 여종이 실제 임상에서 사용되고 있다.Antibiotics, on the other hand, are substances that are extracted from living organisms and inhibit or kill the growth of other microorganisms. More than 4,000 antibiotics have been discovered so far and more than 50 species are currently in clinical use.

1929년 페니실린의 발견과 함께 시작된 항생제 시대는 항생제 과용 등에 의해 급속도로 증가하고 있는 기존 항생제에 대한 내성균주의 출현과 함께 끝나가고 있는 것처럼 보이며, 이들 슈퍼 버그에 대해서는 더 이상 치료제가 없는 지경에 이르러, 항생제 내성에 대한 우려가 높아가고 있다.The period of antibiotics that began with the discovery of penicillin in 1929 seems to be ending with the emergence of resistant microorganisms against existing antibiotics that are rapidly increasing due to antibiotic overuse, and since these superbugs no longer have therapeutic agents, Concerns about tolerance are increasing.

특히 식용으로 사육되는 가축류 및 가금류의 경우, 내성균에 감염된 동물을 재료로 한 식육 가공품에 대한 문제성이 날로 심각해지고 있다.Especially, in the case of livestock and poultry raised for food, problems with processed meat products made from animals infected with resistant bacteria are increasingly becoming serious.

전 세계적으로 광범위한 항생제 남용, 부정확한 진단 및 불필요한 항생제 처방 등의 항생제 과다 사용으로 인한 항생제 내성 미생물 발생으로 인해 유럽에서는 2006년에 우리나라는 2012년에 항생제 사료혼합을 전면금지 하기로 하였다.Due to the antibiotic-resistant microbes caused by overuse of antibiotics worldwide, such as extensive antibiotic abuse, inaccurate diagnosis and unnecessary antibiotic prescription, Korea decided to ban antibiotic feed mixing in 2012 in Europe in 2006.

이러한 항생제의 대체제로서 효소제, 허브추출 에센셜 오일, 유기산, 젖산(lactic acid) 및 프로폴리스(propolis) 등에 관해 다양하게 연구가 이루어지고 있으나, 대체로 항생제에 비해 증체 효과 및 면역기능 증강의 면에서 효능이 떨어지고 경제성이 적어 사용이 어렵다는 문제가 있다.Although various studies have been carried out on the substitution of antibiotics for enzymatic agents, herbal extract essential oils, organic acids, lactic acid and propolis, the efficacy is generally higher than antibiotics in terms of the growth effect and the immune function enhancement There is a problem that it is difficult to use because it is low in economical efficiency.

이에 본 발명은 상기와 같은 문제점을 해결하기 위해 안출된 것으로서, 생체에 투여할 경우 체중 증가율이 월등히 증가하고, 각종 질병의 예방 및 치료를 할 수 있으며 면역기능을 향상시키는 봉독조성물을 제공하는 것을 목적으로 한다.Accordingly, it is an object of the present invention to provide a bee keeping composition which can significantly increase the weight gain rate when administered to a living body, prevent and treat various diseases, and improve immune function .

또한, 본 발명은 기존의 항생제 대체제에 비해 경제성 및 효능이 우수한 봉독조성물을 제공하는 것을 목적으로 한다.It is another object of the present invention to provide a bee keeping composition which is more economical and effective than conventional antibiotic substitutes.

상기한 목적을 달성하기 위하여 본 발명에 따른 봉독조성물은 봉독을 유효성분으로 포함하는 것을 특징으로 한다.To achieve the above object, the present invention provides a bee venom composition comprising bee venom as an active ingredient.

또한, 본 발명에 따른 봉독조성물에 있어서 봉독은 상기 봉독조성물 100 중량부에 대하여 0.01~4 중량부인 것을 특징으로 한다.In the bee keeping composition according to the present invention, the beeing is characterized by being 0.01 to 4 parts by weight based on 100 parts by weight of the bee keeping composition.

또한, 본 발명에 따른 봉독조성물은 사포닌 및/또는 알파-파이넨을 더욱 포함하는 것을 특징으로 한다.The starch composition according to the present invention is further characterized by further comprising saponin and / or alpha-pinene.

또한, 본 발명에 따른 봉독조성물에 있어서 상기 사포닌은 0.01~5 중량부이고, 상기 알파-파이넨은 0.01~1 중량부인 것을 특징으로 한다.In the bee keeping composition according to the present invention, the saponin is 0.01 to 5 parts by weight, and the alpha-pinene is 0.01 to 1 part by weight.

또한, 본 발명에 따른 봉독조성물은 프로필렌글리콜, 에탄올, 소르빈산 중에서 선택되는 어느 하나 또는 둘 이상이 더욱 포함되는 것을 특징으로 한다.The starch composition according to the present invention is further characterized by containing one or more selected from propylene glycol, ethanol and sorbic acid.

또한, 본 발명에 따른 봉독조성물은 상기 프로필렌글리콜은 0.01~2 중량부이고, 상기 에탄올은 0.01~2 중량부이며, 상기 소르빈산은 0.001~0.1 중량부인 것을 특징으로 한다.The starch composition according to the present invention is characterized in that the propylene glycol is 0.01 to 2 parts by weight, the ethanol is 0.01 to 2 parts by weight, and the sorbic acid is 0.001 to 0.1 parts by weight.

이상과 같은 구성의 본 발명에 따른 봉독조성물에 의하면 생체에 대한 증체율을 현저히 높이고, 각종 질병에 대한 예방 및 치료 효과가 있다.According to the bee keeping composition of the present invention having the above-described constitution, the growth rate against the living body is remarkably increased, and there is an effect of preventing and treating various diseases.

또한, 본 발명에 따른 봉독조성물에 의하면 항생제에서 발생하는 내성이 없고, 장기간 사용하더라도 안정성을 확보할 수 있는 효과가 있다.Further, according to the bee keeping composition of the present invention, there is no antimicrobial resistance, and stability can be ensured even after long-term use.

또한, 본 발명에 따른 봉독조성물에 의하면 기존 항생제 대체제에 비해 질병 예방 및 치료효과가 우수하고 경제적인 효과가 있다.In addition, according to the bee keeping composition of the present invention, the effect of preventing and treating diseases is superior to that of existing antibiotic substitute agents, and it is economically effective.

도 1은 본 발명에 따른 봉독조성물에 있어서, 생봉독과 건조봉독의 분석과정을 도시하는 순서도이다.
도 2는 본 발명에 따른 봉독조성물을 SDS-PAGE하여 분리된 단백질들의 이미지이다.
도 3은 본 발명에 따른 봉독조성물의 이차원 전기 영동하여 분리된 단백질들의 이미지이다.
도 4는 본 발명에 따른 봉독조성물에 있어서, 2D gels에서 분리된 봉독의 단백질 성분을 요약한 데이터이다.
도 5는 본 발명에 따른 봉독조성물에 있어서, SDS-PAGE gels에서 분리된 봉독의 단백질 성분을 요약한 데이터이다.
도 6은 본 발명에 따른 봉독조성물에 있어서, 봉독과 그 용매 분획의 추출공정을 나타내는 개략도이다.
도 7은 본 발명에 따른 봉독조성물이 육계의 체중 증가에 미치는 영향을 나타내는 그래프이다.
도 8은 본 발명에 따른 봉독조성물이 육계의 비장 무게 변화에 미치는 영향을 나타내는 그래프이다.
도 9는 본 발명에 따른 봉독조성물의 육계의 림프구 증식능에 미치는 영향을 나타내는 그래프이다.
도 10(a) 및 (b)는 육계의 비장에서 분리한 림프구에서 B cell과 T cell의 비율을 나타내는 그래프이다.
도 11(a), (b) 및 (c)는 육계의 비장에서 분리한 림프구(help T cell)에서의 CD4+:CD8+비율을 나타내는 그래프이다.
도 12는 본 발명에 따른 봉독조성물이 육계의 혈중 lysozyme의 활성에 미치는 영향을 나타내는 그래프이다.
도 13(a), (b) 및 (c)는 본 발명에 따른 봉독조성물을 투여한 육계의 비장에서 m-RNA를 추출하여 사이토카인 (IL-4, IL-18 그리고 IFN-gamma)의 발현능에 미치는 영향을 나타내는 그래프이다.
도 14는 본 발명에 따른 봉독조성물이 정제봉독의 시험관 내에서의 항균 효과를 나타내는 사진이다.
BRIEF DESCRIPTION OF THE DRAWINGS FIG. 1 is a flow chart showing an analysis process of live bee venom and dry bee venom in the preservative composition according to the present invention. FIG.
2 is an image of proteins separated by SDS-PAGE of the bee venom composition according to the present invention.
FIG. 3 is an image of proteins separated by two-dimensional electrophoresis of the bee's poison composition according to the present invention.
4 is data summarizing the protein components of bee venom isolated from 2D gels in the bee venom composition according to the present invention.
FIG. 5 is a summary data of protein components of bee venom isolated from SDS-PAGE gels in the bee venom composition according to the present invention.
Fig. 6 is a schematic view showing the bee venom and its solvent fraction extraction process in the bee keeping composition according to the present invention. Fig.
7 is a graph showing the effect of the bee keeping composition according to the present invention on the weight gain of broiler chickens.
8 is a graph showing the effect of the bee venom composition according to the present invention on the spleen weight change of broiler chickens.
FIG. 9 is a graph showing the effect of the bee venom composition according to the present invention on the lymphocyte proliferative ability of broiler chickens.
10 (a) and 10 (b) are graphs showing the ratio of B cell to T cell in lymphocytes isolated from the spleen of broiler chickens.
Figures 11 (a), (b) and (c) are graphs showing the CD4 + : CD8 + ratio in lymphocytes (help T cells) isolated from the spleen of broiler chickens.
12 is a graph showing the effect of the bee venom composition according to the present invention on the activity of lysozyme in the blood of broiler chickens.
13 (a), (b) and (c) show the expression of cytokines (IL-4, IL-18 and IFN-gamma) by extracting mRNA from the spleen of broiler chickens This is a graph showing the effect on performance.
14 is a photograph showing antimicrobial effect of the bee venom composition according to the present invention in a test tube of tablet bee venom.

이하 본 발명의 바람직한 실시예에 대하여 구체적으로 설명한다.Hereinafter, preferred embodiments of the present invention will be described in detail.

본 발명의 봉독조성물은 봉독을 유효성분으로 포함하는 것이다.The bee keeping composition of the present invention contains bee venom as an active ingredient.

봉독은 꿀벌의 산란관에서 나오는 독액으로서, 생(生)봉독, 건조봉독, 봉독 추출물 및 정제봉독을 포함하는 것이다. Bee venom is a poisonous liquid from honey bee's ovipositor, which includes raw bee venom, bee venom, bee venom extract, and tablets bee venom.

봉독에는 멜리틴(Melittin), 아파민(Apamin), 비반 세포 과립 감소 펩티드 (MCD-Peptide, Mast Cell Degranulation Peptide, Op), 단백효소 억제제(Protease Inhibitor), 세카르핀(Secarpin), 터치아핀(Tertiapin), 프로카민(Procamine) 등 다양한 펩티드(Peptides)를 함유하고 있다.The bee venom contains melittin, apamin, mast cell degranulation peptide (MCD-Peptide), protease inhibitor, Secarpin, Tertiapin, Procamine, and other peptides.

생봉독은 건조 또는 정제과정을 거치지 않은 것으로서, 비중이 1.1 내지 1.3, 산도(pH)가 5.2 내지 5.5 범위이고, 75%는 단백질 또는 펩타이드로 이루어진다.The live bee venom does not undergo a drying or refining process, and has a specific gravity of 1.1 to 1.3, an acidity (pH) of 5.2 to 5.5, and 75% of protein or peptide.

봉독 추출물은 생봉독에서 펩티드 등을 포함하는 유효성분을 분리, 추출하여 얻을 수 있다. Bee venom extract can be obtained by isolating and extracting active ingredients including peptides and the like from live bee venom.

봉독 추출물은 당업계에 공지된 다양한 추출 방법을 이용할 수 있으며, 바람직하게는 물, 탄소수 1~4의 무수 또는 함수 저급 알코올(메탄올, 에탄올, 프로판올, 부탄올 등), 상기 저급 알코올과 물과의 혼합용매, 아세톤, 에틸 아세테이트, 부틸렌글리콜을 추출 용매로 하여 얻을 수 있다.The bee venom extract can be obtained by a variety of extraction methods known in the art, and preferably water, anhydrous or lower alcohol having 1 to 4 carbon atoms (methanol, ethanol, propanol, butanol, etc.) Solvent, acetone, ethyl acetate, and butylene glycol as extraction solvents.

보다 바람직하게는 봉독을 물로 현탁하고, 에틸 아세테이트를 용매로 수회 추출하고, 분리된 수층을 다시 부탄올(butanol)로 추출하며, 각층을 감압 농축하여 분획을 얻는 것이다.More preferably, bee venom is suspended in water, ethyl acetate is extracted several times with a solvent, the separated aqueous layer is extracted again with butanol, and each layer is concentrated under reduced pressure to obtain a fraction.

봉독 1g에 대하여 용매는 50~150ml인 것이 바람직하다.The solvent is preferably 50 to 150 ml per 1 g of bee venom.

정제봉독은 상술한 추출 용매에 의한 추출물 이외에 통상적인 정제 과정을 거쳐 얻거나, 여과막을 이용한 분리, 다양한 크로마토그래피에 의한 분리, 정제방법에 의해 정제된 봉독을 포함하는 것이다.Tablet bee poisoning includes bee poisoning purified by a conventional purification process other than the above-mentioned extraction solvent, separation using a filtration membrane, separation by various chromatography, and purification.

봉독은 봉독조성물 100 중량부에 대하여 0.01~4 중량부인 것이 바람직하고, 더욱 바람직하게는 0.1~1.0인 것이다.Bee venom is preferably 0.01 to 4 parts by weight, more preferably 0.1 to 1.0 part by weight based on 100 parts by weight of the bee venom composition.

그리고 봉독이 0.01 중량부 미만인 경우에는 생체의 증체율 및 면역기능을 향상시키는 효과가 미미하고, 4중량부를 초과하는 경우에는 함량의 증가에 따른 효과의 증가가 미약하다.When the bee venom is less than 0.01 part by weight, the effect of improving the body growth rate and immune function is insignificant. When the bee venom is more than 4 parts by weight, the increase of the effect is insignificant.

본 발명의 조성물은 생체의 증체율 및 면역기능을 향상을 위하여 사포닌 0.01~5 중량부를 더욱 포함하는 것이 바람직하고, 더욱 바람직하게는 0.07~0.4 중량부를 포함하는 것이다.The composition of the present invention preferably further comprises 0.01 to 5 parts by weight, more preferably 0.07 to 0.4 parts by weight, of saponin for the purpose of improving the body growth rate and immune function.

사포닌(saponin)은 식물계에 존재하는 배당체에서 당이 아닌 부분이 여러 고리 화합물로 이루어진 것으로서, 강심제나 이뇨제로서 강한 작용이 있으며, 어느 것이나 세포에 대해서는 표면 활성제로서 작용하여, 세포막에서의 물질의 투과성을 높이기도 한다. Saponin is a glycoside existing in the vegetable field and composed of a plurality of ring compounds, which is not a sugar, and has a strong action as a cardiotonic agent or diuretic. Any of them acts as a surface active agent for cells, It also heightens.

특히 본 발명에서는 점안제의 형태로 본 발명의 봉독조성물을 투여하는 것이 투약의 효과를 향상시킬 수 있고, 이러한 현상은 사포닌을 첨가함으로써 더욱 증대시킬 수 있다.In particular, in the present invention, administration of the bee venom composition of the present invention in the form of eye drops can improve the effect of the dosage, and this phenomenon can be further enhanced by adding saponin.

본 발명의 조성물은 알파-파이넨(α-pinene) 0.01~1 중량부를 더욱 포함하는 것이 바람직하다.The composition of the present invention preferably further comprises 0.01 to 1 part by weight of alpha-pinene.

알파-파이넨은 소나무, 약쑥, 쑥갓, 후추 등에서 추출할 수 있으며, 테르펜(terpene) 계열의 화합물로 (IR, 5R)-(-)-alpha-pinene과 (ISR, 5S)-(-)-alpha-pinene) 두 가지 이성질체 구조를 가지고 있다.(IR, 5R) - (-) - alpha-pinene and (ISR, 5S) - (-) - alpha-pinene as compounds of the terpene series which can be extracted from pine, alpha-pinene) are two isomeric structures.

알파-파이넨은 항균 효과, 항진균 효과, 진정 효과, 항스트레스 효과가 있고, 면역관련 질병에 특히 효과가 있으며, 특히 호염증성 사이토카인의 생산에 중요한 역할을 한다.Alpha-phyinene has antimicrobial, antifungal, sedative, and anti-stress effects and is particularly effective against immune-related diseases, particularly in the production of inflammatory cytokines.

사포닌 및 알파-파이넨은 공지된 추출방법을 다양하게 이용할 수 있고, 수증기증류법, 압착법 또는 용제추출법을 이용해 추출할 수 있다.Saponins and alpha-phyinne can be used in various ways and can be extracted by steam distillation, compression, or solvent extraction.

본 발명의 조성물은 프로필렌글리콜 0.01~2 중량부, 에탄올 0.01~2 중량부 및 소르빈산 0.001~0.1 중량부를 더욱 포함할 수 있다.The composition of the present invention may further comprise 0.01 to 2 parts by weight of propylene glycol, 0.01 to 2 parts by weight of ethanol, and 0.001 to 0.1 part by weight of sorbic acid.

상기 프로필렌글리콜, 에탄올, 소르빈산은 봉독의 유효성분을 장기간 보관할 수 있도록 첨가될 수 있다.The propylene glycol, ethanol, and sorbic acid may be added so that the active ingredient of bee venom can be stored for a long period of time.

프로필렌글리콜은 화학식 C3H8O2이고, 비중은 1.036~1.04이며, 끓는점은 185~189℃이다. 프로필렌글리콜은 용해력이 우수하고, 곰팡이의 번식을 방지하며, 발효되지 않는 특성으로 인해 본 발명의 조성물을 장시간 보관할 수 있도록 해준다.Propylene glycol has the formula C 3 H 8 O 2 , specific gravity is 1.036 to 1.04, boiling point is 185 to 189 ° C. Propylene glycol has excellent dissolving power, prevents the propagation of fungi, and does not ferment, so that the composition of the present invention can be stored for a long time.

소르빈산은 화학식 C6H8O2이고, 녹는점은 134.5℃정도로서, 사상균, 효모, 호기성 세균 등의 미생물 발육을 저해한다.Sorbic acid has the formula C 6 H 8 O 2 and its melting point is about 134.5 ° C, which inhibits the growth of microorganisms such as filamentous bacteria, yeast and aerobic bacteria.

에탄올은 분자식이 C2H5OH이고, 마취성이 있어 동물의 중추신경에 대한 영향력과 봉독을 장기간 보관하기 위해 첨가할 수 있다.Ethanol has a molecular formula of C 2 H 5 OH and is narcotic, which can be added to the animal's central nervous system and for long-term storage of bee venom.

본 발명의 조성물은 점안제 또는 접안제 및 피하 주사제로 제조하여, 이를 생체에 접종할 수 있고, 점안제나 주사제의 제조에 통상적으로 사용하는 적절한 담체, 부형제 및 희석제를 더 포함할 수 있다.The composition of the present invention may further comprise an appropriate carrier, excipient, and diluent which can be prepared into eye drops or eyedrops and subcutaneous injections, inoculated into a living body and routinely used in the preparation of eye drops or injections.

본 발명에 따른 조성물은 산제, 과립제, 정제, 캡슐제, 현탁액, 에멀젼, 에어로졸 등의 경구형 제형, 외용제 및 주사용액의 형태로 제형화하여 사용할 수 있으며, 생체 즉, 인간, 가축류, 가금류, 어류 등에 사용될 수 있다.The composition according to the present invention can be formulated into oral formulations such as powders, granules, tablets, capsules, suspensions, emulsions and aerosols, external preparations and injection solutions, and can be used in the form of living bodies such as humans, livestock, poultry, And the like.

본 발명에 따른 조성물을 제제화할 경우에는 보통 사용하는 충진제, 증량제, 결합제, 습윤제, 붕해제, 계면활성제 등의 희석제 또는 부형제를 사용하여 조제된다. 또한 단순희석제인 물, 리퀴드 파라핀 이외에 여러 가지 부형제와 멸균된 수용액, 비수성용제, 현탁제, 유제, 동결건조 제제 등이 포함된다. 비수성용제, 현탁제로는 상기 프로필렌글리콜, 폴리에틸렌 글리콜, 에틸올레이트와 같은 주사 가능한 에스테르 및 올리브 오일과 같은 식물성 기름이 사용될 수 있다.
When the composition according to the present invention is formulated, it is prepared using diluents or excipients such as fillers, extenders, binders, humectants, disintegrants, surfactants and the like which are usually used. In addition to water and liquid paraffin which are simple diluents, various excipients and sterilized aqueous solutions, non-aqueous solvents, suspensions, emulsions, freeze-dried preparations and the like are included. As the non-aqueous solvent, suspensions, injectable esters such as propylene glycol, polyethylene glycol, ethyl oleate, and vegetable oils such as olive oil may be used.

이하, 본 발명을 실시예 및 실험예에 의해 보다 상세히 설명한다.Hereinafter, the present invention will be described in more detail with reference to Examples and Experimental Examples.

먼저, 생봉독과 건조봉독의 성분을 비교 분석하기 위해 프로테오믹스(proteomics)기법에 의해 특정 단백질을 분석하였다.First, specific proteins were analyzed by proteomics to compare the components of live bee venom and dry bee venom.

동일 양의 생봉독과 건조봉독을 2차원 전기 영동법을 통해 분리하여 생봉독 또는 건조봉독에 특이적으로 존재하는 단백질을 확인하였다.The same amount of live bee venom and dry bee venom were separated by two - dimensional electrophoresis to identify proteins specifically present in live bean gum or dry bee venom.

도 1은 본 발명에 따른 봉독조성물에 있어서, 생봉독과 건조봉독의 분석과정을 도시하는 순서도이고, 도 2는 생봉독과 건조봉독의 SDS-PAGE하여 분리된 단백질들의 이미지로서, 도시된 바와 같이 겔 영동 장치인 SDS-PAGE(Sodium Dodecyl Sulfate Poluacrylamide Gel Electrophoresis)에 의해 단백질을 분리하였다.FIG. 1 is a flow chart showing the analysis of live bee venom and dry bee venom in the bee keeping composition according to the present invention. FIG. 2 is an image of proteins separated by SDS-PAGE of live bee venom and dry bee venom, Proteins were separated by SDS-PAGE (Sodium Dodecyl Sulfate Poluacrylamide Gel Electrophoresis).

그리고, 도 3은 건조봉독과 생봉독의 이차원 전기 영동에 의해 분리된 단백질의 특이 스팟을 표시한 이미지로써, 생봉독 특이 스팟 15개(분홍색 표시)와 생봉독과 건조봉독 공통스팟 7개(푸른색 표시)를 찾아냈다.FIG. 3 is an image showing a specific spot of protein separated by two-dimensional electrophoresis of the dry bee venom and the live bee venom. The image shows 15 speckles specific to the bee venom (pink), seven common speacial bee venom and dry bee venom Color display).

그리고 이를 오려내어 트립신으로 단백질을 가수분해하여 폴리펩티드 조각들을 제조하였다.Then, the protein was hydrolyzed with trypsin to prepare polypeptide fragments.

도 4는 2D gels에서 분리된 봉독의 단백질 성분 요약한 데이터로서, 파란색으로 표시된 것은 생봉독과 건조봉독에 공통 스팟에 대한 데이터이다. 스팟 번호(Spot No.) 1, 2, 4, 8, 10, 14, 17, 19 에 기재된 단백질 성분은 생봉독에서만 발견된 것으로서, 생봉독과 건조봉독에 포함된 단백질에 차이가 있음을 알 수 있다.Fig. 4 is a summary data of protein components of bee venom isolated from 2D gels. Data shown in blue are data for common spots in live bean gum and dry bee venom. The protein components described in Spot No. 1, 2, 4, 8, 10, 14, 17, and 19 are found only in the living bee venom, and there is a difference in the proteins contained in the live bean poison and the dry bee venom have.

도 5는 SDS-PAGE gels에서 분리된 봉독의 단백질 성분을 요약한 데이터로서, 생봉독 및 건조봉독 각각 melittin 성분이 함유되어 있으나, 스팟 번호 A, B, C, D, E 는 생봉독에만 포함된 단백질임을 확인할 수 있다.
Figure 5 summarizes the protein components of bee venom isolated from SDS-PAGE gels. It contains melittin components of live bee venom and dry bee venom. However, spot numbers A, B, C, D, Protein.

실시예1Example 1 . . 봉독으로부터From Beinok 분획물Fraction  And 봉독조성물의Of the bee venom composition 제조 Produce

도 6은 봉독과 용매 분획의 추출하는 공정을 나타내는 개략도로서, 도시된 바와 같이 봉독 5g을 물 500ml로 현탁하여 separating funnel에 넣었다. FIG. 6 is a schematic view showing a process of extracting bee venom and solvent fractions. As shown in FIG. 6, 5 g of bee venom was suspended in 500 ml of water and placed in a separating funnel.

EtOAc (ethyl acetate)500mL로 3회 추출하였다. 수층을 다시 n-BuOH(butanol) 500ml로 2회 분배 추출하였고, 각층을 감압 농축하여, EtOAc 분획(BVE, 420mg), n-BuOH 분획(BVB, 820mg), H2O 분획(1.2g) 및 잔사 (2.5g)를 얻었다. And extracted three times with 500 mL of EtOAc (ethyl acetate). The aqueous layer was extracted twice with 500 ml of n- BuOH (butanol), and the layers were concentrated under reduced pressure to obtain EtOAc fraction (BVE, 420 mg), n- BuOH fraction (BVB, 820 mg), H 2 O fraction To obtain a residue (2.5 g).

상기 EtOAc 분획 420mg과 n-BuOH 분획 820mg을 혼합하여 정제봉독을 제조하고, 정제봉독을 물과 혼합하여 고농도 (8,400 ug/ml), 중농도 (2,100 ug/ml), 저농도 (420 ug/ml)의 농도별로 본 발명의 봉독조성물을 제조하였으며, 이를 하기 실험예 1 내지 3의 시료로 사용하였다.(8,400 ug / ml), medium concentration (2,100 ug / ml), and low concentration (420 ug / ml) were prepared by mixing 420 mg of the EtOAc fraction and 820 mg of n- BuOH fraction to prepare purified bee venom. The bee venom composition of the present invention was prepared according to the concentration of each test sample.

한편, 얻어진 각 분획에 대하여 TLC(Therapeutic Lifestyle Change)로 성분 profile을 조사하였다. On the other hand, for each fraction obtained, the component profile was examined by TLC (Therapeutic Lifestyle Change).

EtOAc 분획은 약 5종의 주요성분이 존재하는 것으로 나타났으며, UV 흡수가 없고 황산분무 후 가열하였을 때에 황색으로 발색되어 aliphatic 화합물로 추정된다.The EtOAc fraction was found to contain about 5 major components. It was assumed to be an aliphatic compound with no UV absorption and yellow color when heated after spraying with sulfuric acid.

n-BuOH 분획은 fructose 외에 UV 흡수를 보이는 3종의 화합물이 존재하는 것으로 나타났다. The n- BuOH fraction showed the presence of three compounds with UV absorption besides fructose.

물층은 대부분 fructose 이나 n-BuOH 분획과 마찬가지로 UV 흡수를 보이는 3종의 화합물이 존재하는 것으로 나타났다.
Most of the water layer was found to have three kinds of compounds showing UV absorption like fructose and n- BuOH fractions.

실험예1Experimental Example 1 . 실험방법 및 . Experimental methods and 정제봉독의Tablets of beijing 투여 administration

1일령 육계 병아리 (Ross) 101마리를 입사하여, 사료와 물을 자유 급식하며 4주간 사육하였다. One-day-old broiler chicks (Ross) were admitted to the experiment and fed with feed and water for 4 weeks.

정제봉독의 투여 적정 농도를 확인하기 위해 실시예 1에서 제조한 고농도 (8,400 ug/ml), 중농도 (2,100 ug/ml), 저농도 (420 ug/ml) 각각을 육계에 접안(10ul)과 피하(100ul)로 나누어 투여하였다.(8, 400 ug / ml), medium concentration (2,100 ug / ml) and low concentration (420 ug / ml) prepared in Example 1 were added to the broiler chicks (10ul) and subcutaneous (100 ul).

정제봉독의 투여의 적정 횟수를 확인하기 위해 2회 또는 4회 1주일 간격으로 투여를 실시하였다.In order to confirm the appropriate frequency of tablet bee venom administration, administration was performed twice or four times per week.

즉, 2회 투여 군은 입사 후 1일과 8일 후 각각의 농도와 투여 경로에 따라 정제봉독의 접종을 실시하였고, 4회 투여 군은 입사 후 1, 8, 15 그리고 22일에 각각의 농도와 투여 경로에 따라 정제봉독의 접종을 실시하였다.
In other words, the tablet of bee venom was inoculated according to the respective concentration and administration route on the 1st day and the 8th day after entering the second administration group. In the 4th administration group, on the 1st, 8th, 15th and 22nd days, The bee venom was administered according to the route of administration.

도 7 내지 도13의 그래프에 표시된 각 부호의 의미는 다음과 같다.The meanings of the symbols shown in the graphs of FIGS. 7 to 13 are as follows.

** Control : 정제봉독 무투여군.** Control: Tablets without bee venom.

** OL2 : 접안을 통한 저농도(Low Conc.)의 정제봉독 2회 투여군.** OL2: 2 tablets of low concentration (low conc.

** OM4 : 접안을 통한 중농도(Middle Conc.)의 정제봉독 4회 투여군.** OM4: 4 tablets of middle bean concentrate through the eyelids.

** SH4 : 피하조직을 통한 고농도(High Conc.)의 정제봉독 4회 투여군.** SH4: 4 tablets of high concentration (high conc.) Through subcutaneous tissue.

(Control군을 제외하고 모두 12종류의 정제봉독 투여군을 실험함)         (12 kinds of tablet bee-containing groups were tested except for the control group)

** (n=18) : 대조군 육계의 개체 수 18마리** (n = 18): 18 birds of control broiler

** ↗ : 유의성 있게 증가
** ↗: Significantly increased

실험예2Experimental Example 2 . 육계의 . Broiler 증체Weight 효과 비교 Compare effects

정제봉독 투여에 따른 육계의 체중 증가를 비교 분석하기 위해, 4주간 사료와 식수를 자유급여 하였고, 그 결과를 도 7의 그래프에 도시하였다.In order to compare the weight gain of broiler chick according to tablet bee venom administration, feed and drinking water were fed for 4 weeks. The results are shown in the graph of FIG.

도 7에 도시된 바와 같이, 전 개체의 체중을 전자저울로 측정한 결과 Control군 (무투여군: 841 ± 71g)에 비해 정제봉독 투여군 모두에서 유의성 있게 체중이 증가하였다. As shown in FIG. 7, the body weight of all the subjects was measured by electronic scales, and the body weight was significantly increased in all the tablet bee administered group as compared with the control group (841 ± 71g in the no-treatment group).

특히 OM4 (접안을 통한 중농도 4회 투여군: 1114 ± 80g)와 OH4 (접안을 통한 고농도의 4회 투여군: 1117 ± 113g)군에서 평균 체중이 가장 많이 증가하였다.
In particular, the highest weight gain was observed in the OM4 group (1114 ± 80g in medium dose group) and OH4 group (1117 ± 113g in high dose group).

실험예3Experimental Example 3 . 육계의 면역 증가 효과 비교. Comparison of immunity increase effect of broiler chickens

3-1. 닭의 비장 무게 변화3-1. Spleen weight change of chicken

정제봉독의 투여가 육계의 면역력 향상에 어떠한 영향을 미치는지 알아보기 위해 육계의 비장의 무게를 측정하였고, 그 결과를 도 8의 그래프에 도시하였다.The weight of the spleen of broiler chickens was measured to see how the administration of bee venom purified the immunity of broiler chickens. The results are shown in the graph of FIG.

도 8에 도시된 바와 같이, 정제봉독 투여에 따른 육계의 면역장기 (비장) 무게를 측정한 결과, Control (무투여군: 0.968 ± 0.115g)에 비해 접안을 통한 4회 투여군들에서 농도 의존적으로 증가하는 경향을 보여주었으며, OH4군 (접안을 통한 고농도의 4회 투여군: 1.268 ± 0.228g)에서 유의적으로 증가하였다.
As shown in FIG. 8, the weight of the immune organs (spleen) of the broiler according to the administration of tablets bee venom was found to be increased in a dose dependent manner in the 4-dose groups through the dorsal rats compared with the control (0.968 ± 0.115 g) , And it was significantly increased in the OH4 group (high dose 4 times administration through the rats: 1.268 ± 0.228g).

3-2. 림프구 3-2. Lymphocyte 증식능Proliferative ability 평가 evaluation

정제봉독 투여에 따른 육계의 림프구 증식능을 비교 분석하기 위해, 각 군의 육계로부터 비장을 채취하였다. To compare the lymphocyte proliferative capacity of broiler chicks with tablets bevacizum, the spleen was collected from the broilers of each group.

채취된 비장은 다시 무균 상태에서 림프구 분리에 사용되었으며, 분리된 림프구를 이용하여 본 실험을 수행하였다. The collected spleen was used for lymphocyte isolation in aseptic condition and this experiment was performed using isolated lymphocytes.

살아있는 림프구의 수는 trypan blue로 염색 후, 현미경하에서 측정 및 그 수를 계산하였고, 최종적으로 1X106 cells/ml의 농도로 RPMI-1640 배지에 희석하였다. The number of viable lymphocytes was counted and counted under a microscope after staining with trypan blue, and finally diluted in RPMI-1640 medium at a concentration of 1 × 10 6 cells / ml.

96-well cell culture plate의 각 well에 100ul씩 희석된 세포를 분주 후, ConA (5ug/ml) 또는 LPS (50ug/ml)가 첨가된 RPMI-1640 배지를 100ul씩 추가로 넣어주거나 또는 mitogen이 무(無)첨가된 배지를 100ul씩 첨가하여 41oC, 5% CO2의 조건으로 48시간 동안 배양하였다.After diluting 100 μl of the cells in each well of a 96-well cell culture plate, add 100 μl of RPMI-1640 medium supplemented with ConA (5 ug / ml) or LPS (50 ug / ml) (100 μl) was added to the culture medium and cultured at 41 ° C and 5% CO 2 for 48 hours.

48시간 동안 배양된 세포의 각 well에 MTT (5mg/ml)용액 20ul씩을 첨가한 후, 다시 41oC, 5% CO2의 조건으로 4시간을 더 배양하였다. Twenty-eight microliters of MTT (5 mg / ml) solution was added to each well of the cultured cells for 48 hours, and further incubated for 4 hours at 41 ° C and 5% CO 2 .

배양 종료 후, 상층액을 모두 제거하고 각 well당 200ul씩의 DMSO를 넣어 모든 세포가 녹은 후, 540nm에서 흡광도를 측정하여 림프구의 증식능을 비교하였고, 그 결과를 도 9의 그래프에 도시하였다.After completion of the incubation, the supernatant was removed, and 200 μl of DMSO was added to each well to dissolve all the cells. The absorbance at 540 nm was measured to compare lymphocyte proliferative capacity. The results are shown in the graph of FIG.

도 9에 도시된 바와 같이, 이 림프구의 증식능은 mitogen 무첨가시, 각 군에서 차이를 보이지 않았으나, LPS (B cell mitogen)와 ConA (T cell mitogen)로 자극시, Control군 (LPS: 0.614 ± 0.02, ConA: 0.601 ± 0.05)에 비해 OM4군 (LPS: 1.030 ± 0.09, ConA: 1.032 ± 0.09)의 증식능이 유의적으로 가장 크게 증가하였다.
As shown in FIG. 9, when the lymphocytes were stimulated with LPS (B cell mitogen) and ConA (T cell mitogen), the control group (LPS: 0.614 ± 0.02 , ConA: 0.601 ± 0.05), the proliferative capacity of OM4 group (LPS: 1.030 ± 0.09, ConA: 1.032 ± 0.09) was significantly increased.

3-3. 비장 내 세포의 비율 비교3-3. Comparison of the proportion of cells in the spleen

비장에서 분리한 림프구의 비율을 유세포 분석기를 이용하여 비교 분석하였다.The ratio of lymphocytes isolated from the spleen was analyzed by flow cytometry.

비장 적출 후 cell strainer를 이용하여 세포를 유리시킨 후, RBC lysis buffer에 10분간 현탁하여 적혈구를 파괴하였다.After splenectomy, the cells were liberated using a cell strainer, and the cells were suspended in RBC lysis buffer for 10 minutes to destroy the red blood cells.

다음으로, 2,500rpm에서 5분간 원심분리 한 후 상층액을 제거하고 PBS로 원심 세척하여 림프구의 수를 5.0×106cell/㎖의 농도로 희석하였다.Next, after centrifugation at 2,500 rpm for 5 minutes, the supernatant was removed, and the number of lymphocytes was diluted to 5.0 × 10 6 cells / ㎖ by centrifugal washing with PBS.

FITC anti-chicken CD3 (total T cell)와 PE anti-chicken BU-1 (B cell)또는 FITC anti-chicken CD4 (help T cell)와 PE anti-chicken CD8 (cytotoxic T cell)의 항체로 암실에서 30분간 반응시켜 염색하였다.FITC anti-CD3 (total T cell) and PE anti-chicken BU-1 (B cell) or FITC anti-chicken CD4 (help T cell) and PE anti-chicken CD8 (cytotoxic T cell) For a minute.

반응 후에 2회 원심 세척하고 PBS 1ml를 분주하여 유세포분석기 (FACSCalibur FACS, BD Biosciences, USA)를 이용하여 비장내 림프구의 비율을 측정하였고, 그 결과를 도 10 내지 도 11의 그래프에 도시하였다.After the reaction, the cells were centrifuged twice, and 1 ml of PBS was dispensed. The proportion of the lymphocytes in the spleen was measured using a flow cytometer (FACSCalibur FACS, BD Biosciences, USA). The results are shown in the graphs of FIGS. 10 to 11.

도 10(a),(b) 내지 도 11(a),(b),(c)에 도시된 바와 같이, B cell과 T cell의 비율에는 군별 큰 변화가 없었다. As shown in Figs. 10 (a), (b) to 11 (a), (b) and (c), there was no significant change in the ratio of B cell to T cell.

help T cell의 비율에 있어 control군 (6.80±2.98 %)에 비해 접안을 통한 4회 투여군들 모두에서 증가하는 경향을 보였으며, 특히 OM4 (19.08 ± 4.00%)의 help T cell 비율이 가장 큰 증가를 보였다. The percentage of help T cells was increased in all 4-dose groups compared with the control group (6.80 ± 2.98%), and the help T cell ratio of OM4 (19.08 ± 4.00%) was the largest increase Respectively.

뿐만 아니라, cytotoxic T cell의 비율 또한 control군 (54.83 ± 11.10 %)에 비해 OM4 (41.41 ± 4.19%)의 비율이 현저히 줄어든 것을 확인할 수 있었다.In addition, the proportion of cytotoxic T cells was significantly reduced in OM4 (41.41 ± 4.19%) compared to control (54.83 ± 11.10%).

따라서 CD4+:CD8+ ratio를 분석하여 보면, 도 11에 도시된 바와 같이 control군 (0.13 ± 0.08)에 비해 OM4군 (0.47 ± 0.14)에서 가장 큰 증가를 보였다.
Analysis of the CD4 + : CD8 + ratio showed the greatest increase in the OM4 group (0.47 ± 0.14) as compared to the control group (0.13 ± 0.08) as shown in FIG.

3-4. 혈중 3-4. Blood 리소자임Lysozyme (( lysozymelysozyme ) 활성 비교) Active comparison

Crystral lysozyme의 세균에 대한 분해 정도를 Strandard curve로 사용하여, 대조군과 정제봉독 투여군들의 혈청 lysozyme 농도를 비교 측정함으로써 대식 세포의 활성을 평가하였다.The activity of macrophages was evaluated by comparing serum lysozyme concentrations of control and purified bee venom with crystalloid lysozyme as a strand curve.

혈청 중 lysozyme 활성을 측정하기 위해 crystalline lysozyme을 0.5, 1, 2, 3, 4, 5ug/ml의 농도로 녹여서 standard로 준비하였다. To measure the lysozyme activity in serum, crystalline lysozyme was dissolved at the concentrations of 0.5, 1, 2, 3, 4, and 5 ug / ml and prepared as a standard.

96-well plate의 각 well에 200ul씩의 M. lysodeikticus용액을 넣었고, 미리 준비한 standard lysozyme또는 혈청 20ul씩 첨가하였다. 200 μl of M. lysodeikticus solution was added to each well of a 96-well plate, and 20 l of a standard lysozyme prepared beforehand or serum was added.

41℃에서 1시간 동안 배양하며 15분 간격으로 흡광도를 측정하였다 (540nm). The incubation was carried out at 41 ° C for 1 hour and the absorbance was measured at intervals of 15 minutes (540 nm).

시료의 lysozyme 활성 측정은 standard curve에 시료의 시간에 따른 흡광도의 변화를 대입하여 구하였고, 그 결과를 도 12의 그래프에 도시하였다.The lysozyme activity of the sample was determined by substituting the standard curve for the change of the absorbance with time of the sample, and the result is shown in the graph of FIG.

도 12에 도시된 바와 같이, 비록 통계적 유의성은 없었으나, Control군에 비해 12군의 정제봉독 투여군 모두에서 평균 lysozyme 활성이 증가하는 경향을 보인다는 것을 확인할 수 있었다.
As shown in FIG. 12, although there was no statistical significance, it was confirmed that the average lysozyme activity tended to increase in all of the 12 groups of tablets bee administered, compared with the control group.

3-5. 사이토카인 3-5. Cytokine mRNAmRNA 발현 정도의 비교 Comparison of degree of expression

Control군(대조군)과 정제봉독 투여군들의 비장으로부터 m-RNA를 추출하여 Real-time PCR을 이용하여 사이토카인 (IL-4, IL-18 그리고 IFN-gamma)의 발현능을 측정하였고, 그 결과는 도 13 내지 표 1에 정리하였다.M-RNA was extracted from the spleen of the control and purified bee venom groups and the expression of cytokines (IL-4, IL-18 and IFN-gamma) was measured using real-time PCR. 13 to Table 1.

도 13(a),(b),(c) 내지 표 1에 나타난 바와 같이, 사이토카인 발현 정도에 있어서 Control군(대조군)과 정제봉독 투여군들 간의 유의적인 차이는 없었다.
As shown in Figs. 13 (a), (b), (c) to Table 1, there was no significant difference in the degree of cytokine expression between the control group (control group) and the tablet bee venom administration group.

TargetTarget Accession no.Accession no. Nucleeotide sequence(5'→3')Nucleotide sequence (5 'to 3') GAPDH ForwardGAPDH Forward
NM_204305

NM_204305
CCTAGGATACACAGAGGACCAGGTTCCTAGGATACACAGAGGACCAGGTT
GAPDH ReverseGAPDH Reverse GGTGGAGGAATGGCTGTCAGGTGGAGGAATGGCTGTCA IL-4 ForwardIL-4 Forward
NM_001007079

NM_001007079
GCTCTCAGTGCCGCTGATGGCTCTCAGTGCCGCTGATG
IL-4 ReverseIL-4 Reverse GAAACCTCTCCCTGGATGTCATGAAACCTCTCCCTGGATGTCAT IL-18 ForwardIL-18 Forward
NM_204608

NM_204608
AGGTGAAATCTGGCAGTGGAATAGGTGAAATCTGGCAGTGGAAT
IL-18 ReverseIL-18 Reverse TGAAGGCGCGGTGGTTTTGAAGGCGCGGTGGTTT IFN-gamma ForwardIFN-gamma Forward
NM_205149

NM_205149
GCTCCCGATGAACGACTTGAGCTCCCGATGAACGACTTGA
IFN-gamma ReverseIFN-gamma Reverse TGTAAGATGCTGAAGAGTTCATTCGTGTAAGATGCTGAAGAGTTCATTCG

3-6. 3-6. 정제봉독의Tablets of beijing 시험관 내( In vitro inin vitrovitro )에서의 항균효과 비교) Compared with the antimicrobial effect

정제봉독의 시험관 내에서(in vitro)의 항균 효과를 알아보기 위해 Salmonella Gallinarum (SG3001)을 대상으로 실시하였다. To investigate the antibacterial effect of tablets bee venom (in vitro) on Salmonella gallinarum (SG3001).

양성 대조군으로 Sigma사의 Bee venom (V3375)을 농도 별로 (1,000 ug/ml, 500ug/ml, 250ug/ml)로 사용하였고, 실험군으로는 닭의 면역실험에서 사용한 정제봉독을 농도별로 [고농도 (8,400 ug/ml), 중농도 (2,100 ug/ml), 저농도 (420 ug/ml)] 사용하였으며, 음성 대조군으로는 정제봉독의 용제인 3차 증류수를 사용하였다. 그 결과는 도 14의 사진에 나타난 바와 같이 고농도 정제봉독에서 세균 성장 억제대를 확인할 수 있었다.
As a positive control, bee venom (V3375) from Sigma was used at concentrations of 1,000 ug / ml, 500 ug / ml and 250 ug / ml, and the experimental group received bee venom in a concentration of 8,400 ug / ml), medium concentration (2,100 ug / ml) and low concentration (420 ug / ml)] were used as a negative control, and tertiary distilled water, a solvent for tablets bee venom, was used. As a result, as shown in the photograph of FIG. 14, the bacterial growth inhibition band was confirmed in the high-concentration tablets bee venom.

4. 결론4. Conclusion

봉독의 분무 방식과 접안투여 방식의 결과를 비교 분석하여 적정투여 농도 결정, 안정성 평가, 증체율에 미치는 영향 평가, 면역력 증강 효과(대식세포활성, 면역 세포 증식능, 비장에서의 T 림프구 분포 측정, T 림프구 중 CD4+:CD8+ 비율, 사이토카인 발현측정 등) 등을 확인한 결과, 봉독이 육계(닭)의 증체율과 면역력 향상에 구체적으로 관여하는 것을 확인할 수 있었다.We evaluated the effect of bee venom spraying method and eyedrop administration method on the determination of proper dose concentration, stability evaluation, evaluation of effect on growth rate, immunity enhancement effect (macrophage activity, immune cell proliferation ability, measurement of T lymphocyte distribution in spleen, (CD4 + : CD8 + ratio, measurement of cytokine expression, etc.). As a result, it was confirmed that bee venom is specifically involved in improving the growth rate and immunity of broiler chickens.

표 2는 실험예 2 내지 실험예3(3-1 ~ 3-6)에서 가장 육계의 증체효과 및 면역기능 향상효과가 우수한 실험군을 나타내었다. Table 2 shows the experimental group which is the most effective in enhancing the broodstock effect and immune function in Experimental Examples 2 to 3 (3-1 to 3-6).

그 결과 증체율 및 면역기능면에서 봉독의 유용성분에 대하여 농도의존적으로 유의성있게 증가한다는 것을 확인할 수 있다.
As a result, it can be confirmed that the beneficial components of bee venom are significantly increased in terms of the concentration and immune function in a concentration-dependent manner.


실험예2
Experimental Example 2
실험예3Experimental Example 3
3-13-1 3-23-2 3-33-3 3-43-4 3-53-5 3-63-6 실험예에서 우수한 효과를 나타내는 실험군In the experimental group, OH4군
OM4군
OH4 group
OM4 group

OH4군

OH4 group

OM4군

OM4 group

OM4군

OM4 group
12개 모든 군All 12 groups 유의성 없음No significance
고농도군

High concentration group

도 15는 육계의 증체율에 따른 항생제 대체제로서의 효과를 나타내는 그래프로서, 도시된 바와 같이 항생제, 생균제, 유기산 및 효소 등을 사용한 경우에 비하여 본 발명의 조성물은 육계의 증체율이 현저히 높다는 것을 확인할 수 있다. FIG. 15 is a graph showing an effect as an antibiotic substitute agent according to the growth rate of broilers. As shown in FIG. 15, it can be seen that the composition of the present invention has significantly higher broiler growth rate than antibiotics, probiotics, organic acids and enzymes.

또한, 임상실험결과 정제봉독 조성물을 안구를 통해 접종(접안투여)한 닭에서 체중증가(대조군 대비 20%이상) 및 비특이적인 면역증강효과(CD4+/CD8+ ratio 증가, 대조군 0.13±0.08, 중농도 투여군 0.47±0.14)가 확인되었다. As a result of the clinical test, the weight gain (more than 20% of the control) and nonspecific immunity enhancement effect (increase of CD4 + / CD8 + ratio, control group 0.13 ± 0.08, 0.47 ± 0.14) was also observed.

따라서 양계농장에서 접안 분무백신을 투여할 때 봉독조성물을 함께 사용하면 편리하고 효과적으로 닭의 면역반응을 증가시킬 수 있어 항생제 대체제 뿐만 아니라 양질의 축산물을 개발할 수 있다.
Therefore, when the ophthalmic spray vaccine is administered in a poultry farm, the use of the bee venom composition can conveniently and effectively increase the immune response of the chicken, so that not only an antibiotic substitute but also high quality livestock products can be developed.

이하 본 발명에 따른 봉독조성물에 있어서, 생봉독 성분의 안정성을 개선시키기 위한 단백질분해효소와 유용물질을 분리시키는 방법을 상세하게 설명한다.Hereinafter, a method for separating a proteolytic enzyme and a useful substance from each other to improve the stability of a live bee venom ingredient in the bee keeping composition according to the present invention will be described in detail.

도 4 내지 도 5에 도시된 바와 같이, 봉독은 단백질 분해효소를 포함하고 있으므로 봉독의 건조 및 정제과정에서 단백질의 가수분해가 나타나 유용 단백질의 절편화 또는 불활성화가 일어날 수 있다.As shown in FIGS. 4 to 5, since bee venom contains a protease, hydrolysis of the protein occurs during drying and purification of the bee venom, resulting in fragmentation or inactivation of the useful protein.

도 16(a), (b)는 나노구조체를 이용한 단백질 분해효소와 유용물질의 분리방법에 대한 개념도로서, 도 16(a)에 도시된 바와 같이 수용액 상태에서는 단백질 분해효소가 펩티드 내지는 단백질 등의 유용물질을 분해시키게 되나, 도 16(b)와 같이 나노구조체를 이용함으로써 단백질 분해효소 및 단백질이 나노구조체에 포집되면 유용물질이 분해되지 않게 된다.16 (a) and 16 (b) are conceptual diagrams showing a method for separating a protease and a useful substance using a nanostructure. As shown in FIG. 16 (a), in the aqueous solution state, The useful substance is decomposed. However, when the protease and the protein are captured in the nanostructure by using the nanostructure as shown in FIG. 16 (b), the useful substance is not decomposed.

구체적으로는, 상기한 문제점을 해결하기 위하여 단백질 분해효소로 잘 알려진 트립신을 이용하고 이의 기질로서 알부민을 사용하여 나노구조체와 섞은 후 배양하여 단백질의 가수분해가 억제되는지를 확인하는 모델시스템을 이용할 수 있다.Specifically, in order to solve the above problem, a model system can be used to confirm whether proteolytic degradation is suppressed by using trypsin, which is well known as a protease, mixing with a nanostructure using albumin as a substrate thereof, and then culturing have.

또한, 생봉독의 유용성분인 펩티드 내지 단백질은 PLGA 등의 나노입자로 캡슐화(encapsulation)하여 안정성을 높일 뿐만 아니라, 지속적인 방출(sustained release)이 이루어지도록 가축용 제제(점안제, 또는 분무제)로 제형화함으로써 그 효능을 증강시킬 수 있다.In addition, peptide or protein, which is a useful component of live bee venom, is encapsulated with nanoparticles such as PLGA to increase stability and also to be formulated into a livestock preparation (eyedrops or spray) so as to achieve sustained release. The effect can be enhanced.

그리고 날로 심각해지는 축산업계의 항생제 과다 사용의 문제점을 천연물질인 봉독의 유용성분을 규격화하여 재구성함으로써 이 봉독조성물은 항생제 대체물질로서의 역할을 할 수 있다.
And the problem of overuse of antibiotics in the livestock industry which is getting worse day by day is reconstructed by standardizing the useful ingredient of bee venom, which is a natural substance, and this bean poison composition can act as an antibiotic substitute material.

이상에서 설명된 본 발명은 예시적인 것에 불과하며, 본 발명이 속한 기술분야의 통상의 지식을 가진 자라면 이로부터 다양한 변형 및 균등한 타 실시예가 가능하다는 점을 잘 알 수 있을 것이다. 그러므로 본 발명은 상기의 상세한 설명에서 언급되는 형태로만 한정되는 것은 아님을 잘 이해할 수 있을 것이다. 따라서 본 발명의 진정한 기술적 보호 범위는 첨부된 특허청구범위의 기술적 사상에 의해 정해져야 할 것이다. 또한, 본 발명은 첨부된 청구범위에 의해 정의되는 본 발명의 정신과 그 범위 내에 있는 모든 변형물과 균등물 및 대체물을 포함하는 것으로 이해되어야 한다. While the present invention has been particularly shown and described with reference to exemplary embodiments thereof, it is to be understood that the invention is not limited to the disclosed exemplary embodiments, but, on the contrary, is intended to cover various modifications and equivalent arrangements included within the spirit and scope of the invention. Therefore, it is to be understood that the present invention is not limited to the above-described embodiments. Accordingly, the true scope of the present invention should be determined by the technical idea of the appended claims. It is also to be understood that the invention includes all modifications, equivalents, and alternatives falling within the spirit and scope of the invention as defined by the appended claims.

Claims (6)

봉독을 유효성분으로 포함하되,
상기 봉독에 프로필렌글리콜, 에탄올, 소르빈산 중에서 선택되는 어느 하나 또는 둘 이상이 더욱 포함되고,
상기 프로필렌글리콜은 0.01~2 중량부이고, 상기 에탄올은 0.01~2 중량부이며, 상기 소르빈산은 0.001~0.1 중량부인 것을 특징으로 하는 증체율 및 면역기능이 향상된 봉독조성물.
Bee venom as an active ingredient,
The bee venom further contains one or two or more selected from propylene glycol, ethanol and sorbic acid,
Wherein the propylene glycol is 0.01 to 2 parts by weight, the ethanol is 0.01 to 2 parts by weight, and the sorbic acid is 0.001 to 0.1 part by weight.
제1항에 있어서,
상기 봉독은 상기 봉독조성물 100 중량부에 대하여 0.01~4 중량부인 것을 특징으로 하는 증체율 및 면역기능이 향상된 봉독조성물.
The method according to claim 1,
Wherein the bee venom is 0.01 to 4 parts by weight based on 100 parts by weight of the bee keeping composition.
제2항에 있어서,
사포닌 또는 알파-파이넨을 더욱 포함하는 것을 특징으로 하는 증체율 및 면역기능이 향상된 봉독조성물.
3. The method of claim 2,
Saponin or alpha- phyene. The bee-keeping composition according to claim 1,
제3항에 있어서,
상기 사포닌은 0.01~5 중량부이고, 상기 알파-파이넨은 0.01~1 중량부인 것을 특징으로 하는 증체율 및 면역기능이 향상된 봉독조성물.
The method of claim 3,
Wherein the saponin is 0.01 to 5 parts by weight and the alpha-pinene is 0.01 to 1 part by weight.
삭제delete 삭제delete
KR1020100130671A 2010-12-20 2010-12-20 Bee venom composition having improved growth rate and immune function KR101391911B1 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
KR1020100130671A KR101391911B1 (en) 2010-12-20 2010-12-20 Bee venom composition having improved growth rate and immune function

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
KR1020100130671A KR101391911B1 (en) 2010-12-20 2010-12-20 Bee venom composition having improved growth rate and immune function

Publications (2)

Publication Number Publication Date
KR20120069221A KR20120069221A (en) 2012-06-28
KR101391911B1 true KR101391911B1 (en) 2014-05-07

Family

ID=46687520

Family Applications (1)

Application Number Title Priority Date Filing Date
KR1020100130671A KR101391911B1 (en) 2010-12-20 2010-12-20 Bee venom composition having improved growth rate and immune function

Country Status (1)

Country Link
KR (1) KR101391911B1 (en)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20190033151A (en) 2017-09-21 2019-03-29 주식회사이-글벳 Detergent composition comprising bee venom for pet animals

Families Citing this family (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR101418881B1 (en) * 2011-09-21 2014-07-17 (주)비센 Lipid water soluble bee venom extracts for improving immunity and for curing inflammation and for curing pain and composition for parenteral medicines and manufacturing method of the same
KR101425018B1 (en) * 2012-11-26 2014-08-01 (주)비센 Cosmetic composition for anti-aging comprising lipid soluble fraction of bee venom and method for manufacturing the same
WO2015061755A1 (en) 2013-10-25 2015-04-30 Phibro Animal Health Corporation Combination and/or composition comprising bacillus, and yucca, quillaja or both and a method for making and using
WO2015155293A1 (en) * 2014-04-09 2015-10-15 Biomar Group A/S Compound or composition for use in the prevention and/or treatment of an ectoparasitic copepod infestation or infection in fish

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR100873946B1 (en) * 2007-06-11 2008-12-12 바이오스펙트럼 주식회사 Agents for improving wrinkles on skin comprising alpha-pinene as an active ingredient

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR100873946B1 (en) * 2007-06-11 2008-12-12 바이오스펙트럼 주식회사 Agents for improving wrinkles on skin comprising alpha-pinene as an active ingredient

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20190033151A (en) 2017-09-21 2019-03-29 주식회사이-글벳 Detergent composition comprising bee venom for pet animals

Also Published As

Publication number Publication date
KR20120069221A (en) 2012-06-28

Similar Documents

Publication Publication Date Title
Wang et al. Black garlic (Allium sativum) extracts enhance the immune system
RU2370532C2 (en) Method of plant material fermentation and bacteria cultivation, extract of fermented plant material, powder of fermented plant material extract, and their application
KR101061257B1 (en) Natural antibiotics using bee venom and herbal extracts as an active ingredient and preparation method thereof
KR101391911B1 (en) Bee venom composition having improved growth rate and immune function
EP3416501A1 (en) Nutritional support for animals via administration of an algal derived supplement
Shin et al. Immunostimulatory effects of cordycepin‐enriched WIB‐801CE from Cordyceps militaris in splenocytes and cyclophosphamide‐induced immunosuppressed mice
KR20190133639A (en) Lactobacillus Crispatus KBL693 and Use Thereof
Hassan et al. Influence of oyster mushroom waste on growth performance, immunity and intestinal morphology compared with antibiotics in broiler chickens
US8097288B1 (en) Composition and method for providing nutritional immunology for production animals
KR102041615B1 (en) A method of using propolis mixed with other origins and a composition for health functional foods containing propolis
TWI614020B (en) Composition of antrodia cinnamomea solid cultured mycelium and water/alcohol extract of fruiting body, and the use thereof in preparing healthy foods
EP1525887A1 (en) Drugs including anticancer agents and immunopotentiators and health foods and drinks
KR101418881B1 (en) Lipid water soluble bee venom extracts for improving immunity and for curing inflammation and for curing pain and composition for parenteral medicines and manufacturing method of the same
Dacasin et al. The potential use of virgin coconut oil as an adjunctive treatment for COVID-19: A review
WO2022111551A1 (en) Composition of niedzwetzky's apple and prunus cerasifera, and application thereof in lowering blood lipid
KR20190069797A (en) Composition for preventing, ameliorating or treating autism spectrum disorder comprising Agathobaculum sp. strain as effective component
KR20220069727A (en) Antibacterial composition containing starfish extract and cinnamon extract as active ingredients
KR20220020147A (en) Method for preparing Phellinus linteus mycelia extract or Phellinus linteus mycelia extract powder and composition for enhancing immunity comprising them as an active ingredient
CN112043730A (en) Traditional Chinese medicine biological preparation for preventing and treating animal epidemic diseases
CN107349376B (en) Anti-coccidiosis probiotic medicine and preparation method and application thereof
KR102642230B1 (en) Composition for the treatment of asthma, comprising purified fractions of fermented black rice bran as an active ingredient
US20220110977A1 (en) Compositions and methods for treating and preventing viral infections
KR102470357B1 (en) Composition for enhancing immunity comprising of lactococcus lactis Q1
KR102642232B1 (en) Composition for the treatment of asthma, comprising purified fractions of fermented bellflower as an active ingredient
US11806378B1 (en) Therapeutic composition including phenolic compounds derived from Opuntia littoralis

Legal Events

Date Code Title Description
A201 Request for examination
E902 Notification of reason for refusal
AMND Amendment
E601 Decision to refuse application
AMND Amendment
E801 Decision on dismissal of amendment
J201 Request for trial against refusal decision
J301 Trial decision

Free format text: TRIAL DECISION FOR APPEAL AGAINST DECISION TO DECLINE REFUSAL REQUESTED 20130425

Effective date: 20140221

S901 Examination by remand of revocation
GRNO Decision to grant (after opposition)
GRNT Written decision to grant
FPAY Annual fee payment

Payment date: 20180410

Year of fee payment: 5

FPAY Annual fee payment

Payment date: 20190429

Year of fee payment: 6