KR20130000038A - Composition for regulating expression of pigmentation-related genes containing microrna - Google Patents
Composition for regulating expression of pigmentation-related genes containing microrna Download PDFInfo
- Publication number
- KR20130000038A KR20130000038A KR1020110060483A KR20110060483A KR20130000038A KR 20130000038 A KR20130000038 A KR 20130000038A KR 1020110060483 A KR1020110060483 A KR 1020110060483A KR 20110060483 A KR20110060483 A KR 20110060483A KR 20130000038 A KR20130000038 A KR 20130000038A
- Authority
- KR
- South Korea
- Prior art keywords
- expression
- composition
- mirna
- pigment
- seq
- Prior art date
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
- C12N15/1137—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against enzymes
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/70—Carbohydrates; Sugars; Derivatives thereof
- A61K31/7088—Compounds having three or more nucleosides or nucleotides
- A61K31/7105—Natural ribonucleic acids, i.e. containing only riboses attached to adenine, guanine, cytosine or uracil and having 3'-5' phosphodiester links
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K8/00—Cosmetics or similar toiletry preparations
- A61K8/18—Cosmetics or similar toiletry preparations characterised by the composition
- A61K8/30—Cosmetics or similar toiletry preparations characterised by the composition containing organic compounds
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61Q—SPECIFIC USE OF COSMETICS OR SIMILAR TOILETRY PREPARATIONS
- A61Q19/00—Preparations for care of the skin
- A61Q19/02—Preparations for care of the skin for chemically bleaching or whitening the skin
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/5005—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells
- G01N33/5008—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
- C12N2310/11—Antisense
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
- C12N2310/14—Type of nucleic acid interfering N.A.
- C12N2310/141—MicroRNAs, miRNAs
Abstract
Description
본 발명은 색소형성 유전자의 발현을 조절하는 마이크로 RNA(microRNA; 이하 miRNA) 인 hsa-miR-203(이하 miR-203)의 또는 이의 모방체(mimic)를 포함하는 백모 방지 또는 흑모 생성용 화장료 또는 약학 조성물 및 miR-203의 저해제(inhibitor)를 포함하는 피부미백용 화장료 또는 약학 조성물에 관한 것이다.The present invention relates to a cosmetic for preventing or treating hair loss, comprising a miRNA of hsa-miR-203 (hereinafter referred to as miR-203), which is a microRNA (microRNA; miRNA) that regulates the expression of a pigment gene. The present invention relates to a cosmetic or pharmaceutical composition for skin whitening comprising a pharmaceutical composition and an inhibitor of miR-203.
피부는 크게 표피층(epidermis)과 진피층(dermis)으로 나뉘는데, 표피층에 존재하는 색소형성세포(melanocyte)은 색소(melanin)를 합성하여 피부 고유의 색을 나타나게 한다. 멜라닌소체(melanosome)는 흑색소포 내에 다수로 존재하며, 멜라닌을 함유하는 세포내 소기관으로 피부 및 모발의 표피조직 내의 암색 발현은 멜라닌에 의해 암색 발현이 조절되는 것이다. 따라서 피부 색소를 조절하는 생물학적 인자들은 크게 색소형성세포에서 멜라닌소체를 만드는 요소와 멜라닌소체를 운반하는 요소로 크게 나뉜다. 멜라닌소체를 만드는 요소에서 가장 잘 알려진 인자는 티로시나아제(tyrosinase; TYR), 티로시나아제 관련 단백질 1(tyrosinase-related protein 1;TYRP1), 도파크롬 토토머라아제(dopachrome tautomerase; DCT) 그리고 멜란-A(Melan-A) 등이 있으며, 멜라닌소체 운반에 관여하는 요소로는 Rab27a 등이 알려져 있으며, 최근에는 PAX3, MITF 등의 전사인자들도 색소조절 과정에 참여하는 것으로 알려져 있다. 따라서 이들 색소조절 인자들은 피부미백, 흑모생성 그리고 백모방지 등의 중요한 타겟이 된다.The skin is largely divided into epidermis and dermis. Pigment-forming cells (melanocytes) present in the epidermis are synthesized with pigments (melanin) to give a unique color of the skin. Melanosomes (melanosome) is present in a large number in the black vesicles, the intracellular organelles containing melanin dark expression in the epidermal tissue of the skin and hair is dark expression is controlled by melanin. Therefore, biological factors that regulate skin pigments are largely divided into elements that make melanocytes and those that carry melanocytes in pigmented cells. The most well known factors in the melanocyte-forming factor are tyrosinase (TYR), tyrosinase-related protein 1 (TYRP1), dopachrome tautomerase (DCT) and melan- A (Melan-A) and the like, Rab27a is known as a factor involved in the transport of melanocytes, and recently, transcription factors such as PAX3 and MITF are known to participate in the pigment regulation process. Therefore, these pigment control factors are important targets such as skin whitening, black hair formation and white hair prevention.
miRNA는 세포 내에 존재하는 20-25핵산(nucleotide) 길이의 작은 RNA (endogenous small RNA)의 일종으로 단백질을 합성하지 않는 DNA에서 유래되어 헤어핀-구조 전사체(hairpin-shaped transcript) 로 부터 생성이 된다. miRNA는 일반적으로 표적 mRNA의 3'-UTR의 상보적 서열에 결합하여 그 mRNA의 번역 억제 또는 불안정화를 유도하여, 궁극적으로 그 표적 mRNA의 단백질 합성을 억제하는 리프레서(repressor) 역할을 하게 된다. 하나의 miRNA는 여러 개의 mRNA를 타겟팅하며, mRNA 역시 여러 개의 miRNA에 의해 조절될 수 있다고 알려져 있다.miRNA is a type of endogenous small RNA of 20-25 nucleotides in the cell and is derived from hairpin-shaped transcripts derived from non-synthetic DNA. . miRNAs generally bind to the complementary sequence of the 3'-UTR of the target mRNA and induce translation inhibition or destabilization of the mRNA, ultimately acting as a repressor to inhibit protein synthesis of the target mRNA. One miRNA targets several mRNAs, and mRNA is also known to be regulated by several miRNAs.
현재 miRNA는 발달 시기, 세포사멸사, 지방 신진대사 및 조혈 세포 분화의 조절을 포함하는 여러 생물학적 과정에서 매우 중요한 역할을 하는 것으로 알려짐에 따라 생명과학분야에서 매우 큰 관심을 받고 있다. 하지만 암 등의 질병이나 발생 과정에서의 miRNA의 기능연구는 상당히 진행된 것에 비해 상대적으로 피부과학에서의 miRNA 역할에 대한 연구는 비교적 적은 상태이다. 최근 miR-203이 각질형성세포(keratinocyte)에서 p63 mRNA를 타겟팅함으로써 분화능력을 억제한다는 보고와 miR-125b가 피부줄기세포의 분화를 억제하며 각질형성세포의 분열을 억제한다는 보고는 있지만, 그 외의 피부관련 특이적 miRNA와 기능에 대해선 거의 알려져 있지 않다.
Currently, miRNAs are of great interest in the life sciences, as they are known to play an important role in many biological processes, including control of developmental time, apoptosis, fat metabolism and hematopoietic cell differentiation. However, research on miRNA's function in disease and development of cancer, etc. has progressed considerably, but relatively little research on miRNA's role in dermatology. Recently, miR-203 suppresses the differentiation ability by targeting p63 mRNA in keratinocytes and miR-125b inhibits the differentiation of skin stem cells and inhibits the division of keratinocytes. Little is known about skin-specific miRNAs and functions.
이에 본 발명자들은 miR-203와 miR-125b 등의 특정 miRNA가 피부 및 모발에서도 생물학적으로 중요한 역할을 담당할 것이라는 점에 착안하였다. The present inventors have focused on the fact that certain miRNAs such as miR-203 and miR-125b will play a biologically important role in skin and hair.
본 발명자들은 피부의 WM266-4 와 WM115 흑색종 세포에서 색소형성에 관여하는 miRNA을 찾는 연구를 진행하였고, 그 결과 hsa-miR-203이 색소조절인자인 티로시나아제, 티로시나아제 관련 단백질 1, 멜란-A 등을 발현하는 유전자의 발현을 증가시킴을 밝혀내었다. 따라서 본 발명은 miR-203의 모방체(mimic)를 포함하는 백모 방지 또는 흑모 생성용 화장료 또는 약학 조성물 및 miR-203의 저해제(inhibitor)를 포함하는 피부미백용 화장료 또는 약학 조성물을 제공하는 것을 목적으로 한다.
The present inventors have searched for miRNAs involved in pigmentation in WM266-4 and WM115 melanoma cells of the skin. As a result, hsa-miR-203 is a pigment regulator, tyrosinase, tyrosinase-
본 발명은 서열번호 1의 miRNA를 유효성분으로 포함하는 피부미백효능 화장료 또는 약학 조성물을 제공한다.The present invention provides a skin whitening cosmetic or pharmaceutical composition comprising the miRNA of SEQ ID NO: 1 as an active ingredient.
또한 본 발명은 서열번호 1의 miRNA에 상보적인 염기서열을 갖고, 상기 miRNA에 하이브리드될 수 있는 서열번호 2의 안티센스 핵산 분자를 유효성분으로 포함하는 백모방지 또는 흑모생성 효능 화장료 또는 약학 조성물을 제공한다. In another aspect, the present invention provides a white hair prevention or black hair producing efficacy cosmetic or pharmaceutical composition having a base sequence complementary to the miRNA of SEQ ID NO: 1, comprising an antisense nucleic acid molecule of SEQ ID NO: 2 that can be hybridized to the miRNA as an active ingredient. .
또한 본 발명은 시험물질에 대한 색소형성 유전자 발현 조절하는 물질을 스크리닝하는 방법으로서, 서열번호 1의 miRNA 또는 서열번호 2의 안티센스 핵산 분자를 세포에 트랜스펙션시키는 단계; 상기 세포에 시험 물질을 처리하는 단계; 및 상기 시험물질이 색소형성 유전자의 발현을 촉진하는지 또는 억제하는지 여부를 확인하는 단계;를 포함하는 색소형성 유전자들의 발현조절물질 스크리닝 방법을 제공한다.In another aspect, the present invention provides a method for screening a substance for regulating pigmentation gene expression for a test substance, comprising: transfecting a cell with a miRNA of SEQ ID NO: 1 or an antisense nucleic acid molecule of SEQ ID NO: 2; Treating the cell with a test substance; And confirming whether the test substance promotes or inhibits expression of a pigment forming gene.
본 발명의 서열번호 1의 miRNA 또는 서열번호 2의 안티센스 핵산 분자를 포함하는 조성물은 색소조절인자인 티로시나아제, 티로시나아제 관련 단백질 1, 멜란-A를 발현시키는 색소형성 유전자의 발현을 조절하여 백모방지 또는 흑모생성 및 피부미백효능을 가진 조성물을 제공할 수 있다. The composition comprising the miRNA of SEQ ID NO: 1 or the antisense nucleic acid molecule of SEQ ID NO: 2 of the present invention regulates the expression of pigmentation genes that express the pigment regulators tyrosinase, tyrosinase
도 1은 hsa-miR-203와 동일한 서열을 갖는 올리고핵산(oligonucleotide)을 세포 내로 주입하여 hsa-miR-203의 과발현 현상(overexpression)을 유도하고, real-time PCR을 수행하여 티로시나아제 관련 단백질 1 mRNA 발현량을 확인한 결과를 나타낸 것이다.
도 2는 hsa-miR-203와 동일한 서열을 갖는 올리고핵산(oligonucleotide)을 세포 내로 주입하여 hsa-miR-203의 과발현 현상을 유도하고, real-time PCR을 수행하여 멜란-A mRNA 발현량을 확인한 결과를 나타낸 것이다.
도 3은 hsa-miR-203와 동일한 서열을 갖는 올리고핵산(oligonucleotide)을 세포 내로 주입하여 hsa-miR-203의 과발현 현상을 유도하고, real-time PCR을 수행하여 티로시나아제 mRNA 발현량을 확인한 결과를 나타낸 것이다.FIG. 1 shows an overexpression of hsa-miR-203 by injecting oligonucleotides having the same sequence as hsa-miR-203 into cells and performing real-time PCR to perform tyrosinase-related proteins. 1 shows the result of confirming the amount of mRNA expression.
Figure 2 is injected into the cell oligonucleotide having the same sequence as hsa-miR-203 to induce overexpression of hsa-miR-203, and confirmed the expression of melan-A mRNA by real-time PCR The results are shown.
Figure 3 is injected into the cell oligonucleotide having the same sequence as hsa-miR-203 to induce the overexpression of hsa-miR-203, and confirmed the expression of tyrosinase mRNA by real-time PCR The results are shown.
이하, 본 발명을 상세히 설명한다.Hereinafter, the present invention will be described in detail.
본 발명은 서열번호 1의 miRNA 또는 서열번호 2의 안티센스 핵산 분자, 또는 서열번호 1 또는 2의 염기서열을 포함하는 올리고핵산을 유효성분으로 포함하는 색소형성조절용 조성물을 제공한다.The present invention provides a composition for controlling pigmentation, comprising an oligonucleotide comprising a miRNA of SEQ ID NO: 1 or an antisense nucleic acid molecule of SEQ ID NO: 2, or a nucleotide sequence of SEQ ID NO: 1 or 2 as an active ingredient.
상기 색소형성 유전자는 티로시나아제, 티로시나아제 관련 단백질 1, 멜란-A를 발현시키는 유전자이다. The pigmentation gene is a gene expressing tyrosinase, tyrosinase
5'- gugaaauguuuaggaccacuag -3' (서열번호 1)5'- gugaaauguuuaggaccacuag -3 '(SEQ ID NO: 1)
상기 miRNA는 서열번호 1의 염기서열을 가지며, ugaaaug 를 포함하는 22개의 연속적인 염기서열로 이루어지는 올리고핵산 분자이다. 또한, 본 발명에서 사용되는 miRNA는 염기서열 1의 ugaaaug를 포함하는 15-22개의 연속적인 염기서열을 포함하는 올리고핵산 분자로서, 색소형성 유전자들의 발현을 증가시키는 기능을 수행하는 것들을 포함할 수 있다.The miRNA has an nucleotide sequence of SEQ ID NO: 1 and is an oligonucleic acid molecule consisting of 22 consecutive nucleotide sequences including ugaaaug. In addition, the miRNA used in the present invention is an oligonucleic acid molecule containing 15-22 consecutive nucleotide sequences including ugaaaug of
상기 miRNA는 색소형성에 관여하는 유전자의 발현을 촉진시킬 수 있다. The miRNA may promote expression of genes involved in pigmentation.
본 발명의 서열번호 1의 miRNA를 이용하여 miR-203의 모방체(mimic)로 miR-203와 동일한 서열을 갖는 올리고핵산 분자(oligonucleotide)를 제작할 수 있다. 또한, miR-203의 모방체(mimic)는 상기 hsa-miR-203의 염기서열을 포함하는 서열로서, 색소형성 유전자들의 발현을 증가시키는 기능을 수행하는 것들을 포함할 수 있다.Using the miRNA of SEQ ID NO: 1 of the present invention, an oligonucleotide molecule having the same sequence as miR-203 can be prepared by mimic mimi-203. In addition, mimic mimi (mimic) is a sequence comprising the nucleotide sequence of the hsa-miR-203, may include those that perform the function of increasing the expression of pigmentation genes.
상기 서열번호 2의 안티센스 핵산분자는 서열번호 1의 miRNA에 상보적인 염기서열을 갖고, 상기 miRNA에 하이브리드 될 수 있는 miR-203의 저해제(inhibitor)로서 작용한다. hsa-miR-203의 저해제로 상기 서열번호 2의 염기서열을 포함하는 서열로서, 상기 miRNA에 하이브리드될 수 있는 것들을 포함할 수 있다.The antisense nucleic acid molecule of SEQ ID NO: 2 has a base sequence complementary to the miRNA of SEQ ID NO: 1, and acts as an inhibitor of miR-203 that can hybridize to the miRNA. As an inhibitor of hsa-miR-203, a sequence including the nucleotide sequence of SEQ ID NO: 2 may include those that can be hybridized to the miRNA.
5'- cuagugguccuaaacauuucac -3'(서열번호 2)5'- cuagugguccuaaacauuucac -3 '(SEQ ID NO: 2)
본 발명의 백모방지 및 흑모생성용 조성물은 상기 서열번호 1의 miRNA 또는 서열번호 1의 염기서열을 포함하는 올리고핵산으로서 ugaaaug를 포함하는 15-22개의 연속적인 염기서열로 이루어지는 올리고핵산 분자 중에서 선택되는 것을 유효성분으로 함유한다. 또한, 상기 서열번호 1의 염기서열을 포함하는 서열로서 티로시나아제 관련 단백질 1, 멜란-A 의 발현을 증가시키는 올리고핵산분자 중에서 선택되는 것을 유효성분으로 함유할 수 있다.The composition for preventing and hair follicle of the present invention is selected from oligonucleic acid molecules consisting of 15-22 consecutive base sequences including ugaaaug as oligonucleic acid comprising the miRNA of SEQ ID NO: 1 or the nucleotide sequence of SEQ ID NO: 1 It is contained as an active ingredient. In addition, the sequence comprising the nucleotide sequence of SEQ ID NO: 1 may contain as an active ingredient selected from oligonucleic acid molecules that increase the expression of tyrosinase-
본 발명의 피부미백용 조성물은 상기 서열번호 2의 안티센스 핵산분자로서 서열번호 1의 miRNA에 상보적인 염기서열을 갖고, 상기 miRNA에 하이브리드 될 수 있는 miR-203의 저해제(inhibitor)로서 작용하는 것을 유효성분으로 함유한다. hsa-miR-203의 저해제로 상기 서열번호 2의 염기서열을 포함하는 서열로서, 상기 miRNA에 하이브리드될 수 있는 것들을 포함할 수 있는 올리고핵산분자 중에서 선택되는 것을 유효성분으로 함유할 수 있다.The composition for skin whitening of the present invention has a base sequence complementary to the miRNA of SEQ ID NO: 1 as the antisense nucleic acid molecule of SEQ ID NO: 2, and acts as an inhibitor of miR-203 that can be hybridized to the miRNA. Contains as an ingredient. As an inhibitor of hsa-miR-203, a sequence comprising the nucleotide sequence of SEQ ID NO: 2, and may be selected as an active ingredient selected from oligonucleic acid molecules which may include those that may be hybridized to the miRNA.
본 발명에 있어서, 사용되는 miRNA, 안티센스 핵산분자 또는 올리고핵산은 조성물 총 중량에 대하여 0.00001~30.1 중량%의 양으로 사용될 수 있다.In the present invention, the miRNA, antisense nucleic acid molecule or oligonucleic acid used may be used in an amount of 0.00001 to 30.1% by weight based on the total weight of the composition.
본 발명의 조성물이 화장품 제형인 경우에는, 화장품학적으로 허용 가능한 매질 또는 기제를 함유한다. 이는 국소적용에 적합한 모든 제형으로, 예를 들면 용액, 겔, 고체 또는 반죽 무수 생성물, 수상에 유상을 분산시켜 얻은 에멀젼, 현탁액, 마이크로에멀젼, 마이크로캡슐, 미세과립구, 이온형(리포좀) 또는 비이온형의 소낭 분산제의 형태로, 또는 크림, 스킨, 로션, 파우더, 연고, 스프레이 또는 콘실 스틱의 형태로 제공될 수 있다. 이들 조성물은 당해 분야의 통상적 방법에 따라 제조될 수 있다.When the composition of the present invention is a cosmetic formulation, it contains a cosmetically acceptable medium or base. These are all formulations suitable for topical application, for example emulsions, suspensions, microemulsions, microcapsules, microgranules, ionic (liposomes) or nonionics obtained by dispersing an oil phase in a solution, gel, solid or pasty anhydrous product, aqueous phase. It may be provided in the form of a vesicle dispersant in the form or in the form of a cream, skin, lotion, powder, ointment, spray or cone stick. These compositions may be prepared according to conventional methods in the art.
본 발명의 조성물이 의약품 제형인 경우에는, 본 발명의 일 실시예에 따른 서열번호 1의 miRNA 또는 서열번호 2인 안티센스 핵산 분자를 유효성분으로 하여 상용되는 무기 또는 유기의 담체를 가하여 고체, 반고체 또는 액상의 형태로 비경구 투여제(주사, 경피 투여 또는 외용도포)로 제제화할 수 있다. 비경구 투여를 위한 제재로는 국소 주사용 제제, 연고, 로션, 스프레이, 현탁제 등을 들 수가 있다.When the composition of the present invention is a pharmaceutical formulation, a solid, semi-solid or by adding a commercially available inorganic or organic carrier using the miRNA of SEQ ID NO: 1 or the antisense nucleic acid molecule of SEQ ID NO: 2 according to an embodiment of the present invention as an active ingredient It may be formulated as a parenteral dosage form (injection, transdermal or external application) in liquid form. Formulations for parenteral administration include topical injection preparations, ointments, lotions, sprays, suspensions and the like.
본 발명의 조성물의 유효성분을 제제화하기 위해서는 통상의 방법에 따라서 실시하면 용이하게 제제화할 수 있으며 계면활성제, 부형제, 착색료, 향신료, 보존료, 안정제, 완충제, 현탁제, 기타 상용하는 보조제를 적당히 사용할 수 있다.In order to formulate the active ingredient of the composition of the present invention, it can be easily formulated according to a conventional method, and surfactants, excipients, coloring agents, spices, preservatives, stabilizers, buffers, suspensions, and other commonly used auxiliaries can be suitably used. have.
본 발명의 조성물의 투여량은 치료 받을 대상의 연령, 성별, 체중과, 치료할 특정 질환 또는 병리 상태, 질환 또는 병리 상태의 심각도, 투여경로 및 처방자의 판단에 따라 달라질 수 있다. 이러한 인자에 기초한 투여량 결정은 당업자의 수준 내에 있으며, 주사제를 제외한 제제에 대해서는 도포가 필요한 부위에 외용 도포하는 식으로 당업자의 수준에서 적용할 수 있고, 주사제의 경우에는 투여가 필요한 부위에 국소적으로 주사할 수 있다. The dosage of the composition of the present invention may vary depending on the age, sex, weight of the subject to be treated, the specific disease or pathology to be treated, the severity of the disease or pathology, the route of administration and the judgment of the prescriber. Dosage determination based on these factors is within the level of those skilled in the art, and can be applied at the level of those skilled in the art by external application to the site that needs to be applied to the formulations other than injections, and in the case of injections, it is topically applied to the site requiring administration. Can be injected.
본 발명의 miRNA는, 변형된 핵산 분자로 이루어질 수도 있다. 예컨대, 2'-O-알킬 (예: 메틸, 에틸), 2'-O-알릴, 2'-O-알릴과 같은 2'-치환된 라이보스를 포함하는 핵산 분자를 부분적으로 또는 전체적으로 포함할 수 있다. 또한, 치환된 염기를 갖는 핵산 분자를 부분적으로 또는 전체적으로 포함할 수도 있다.The miRNA of the present invention may be composed of modified nucleic acid molecules. Partially or wholly comprise a nucleic acid molecule comprising 2'-substituted ribose such as, for example, 2'-0-alkyl (e.g. methyl, ethyl), 2'-0-allyl, 2'-0-allyl. Can be. It may also comprise partially or wholly nucleic acid molecules with substituted bases.
본 발명의 시험물질에 대한 색소형성유전자의 발현을 조절하는 물질을 스크리닝하는 방법은, (a) 서열번호 1의 miRNA를 세포에 트랜스펙션시키는 단계; (b) 상기 세포에 시험 물질을 처리하는 단계; 및 (c) 상기 시험물질이 색소형성유전자들의 발현을 억제하는지 여부를 확인하는 단계;를 포함하는 것을 특징으로 하는 색소형성 유전자의 발현 조절 물질 스크리닝 방법을 제공한다.A method for screening a substance for controlling the expression of a pigment forming gene for a test substance of the present invention comprises the steps of: (a) transfecting a cell with a miRNA of SEQ ID NO: 1; (b) treating the cell with the test substance; And (c) confirming whether or not the test substance inhibits the expression of the pigment-forming genes.
상기 스크리닝 방법은 상기 확인 결과, 상기 시험물질이 티로시나아제, 티로시나아제 관련 단백질 1, 멜란-A 의 발현, 활성 또는 기능을 감소시키는 경우 색소형성 유전자의 발현 억제제로 판정하는 단계를 더 포함할 수 있다.The screening method may further include determining that the test substance is an inhibitor of the pigmentation gene when the test substance reduces the expression, activity or function of tyrosinase, tyrosinase
또한 상기 스크리닝 방법은 상기 확인 결과, 상기 시험물질이 티로시나아제, 티로시나아제 관련 단백질 1, 멜란-A 의 발현, 활성 또는 기능을 증가시키는 경우 색소형성 유전자의 발현 촉진제로 판정하는 단계를 더 포함할 수 있다.In addition, the screening method further comprises the step of determining the expression promoter of the pigmentation gene when the test substance increases the expression, activity or function of tyrosinase, tyrosinase-
상기 서열번호 1의 miRNA 또는 서열번호 2인 안티센스 핵산 분자를 세포에 트랜스펙션시키는 단계에 있어서, 상기 트랜스펙션은 미세 주입법, 칼슘 포스페이트 공동-침전법, 전기 천공법 또는 리포좀 이용법 등을 이용하여 실시할 수 있으나, 이에 한정되는 것은 아니다.In the step of transfecting the miRNA of SEQ ID NO: 1 or the antisense nucleic acid molecule of SEQ ID NO: 2 to the cell, the transfection may be performed using micro-injection, calcium phosphate co-precipitation, electroporation or liposomes. It may be carried out, but is not limited thereto.
본 발명의 색소형성 유전자의 발현 조절 물질 스크리닝 방법에 있어서, 상기 색소형성 유전자의 발현을 조절하는지 여부는 당업계에 널리 공지된 방법인 RT-PCR 또는 ELISA 및 웨스턴블럿(immuno blot)을 이용하여 결정될 수 있다.In the method of screening a substance for regulating the expression of a pigment forming gene of the present invention, whether to regulate the expression of the pigment forming gene is determined using RT-PCR or ELISA and immunoblot which are well known in the art. Can be.
본 발명의 색소형성 유전자들의 발현 정도를 이용한 발현 조절 물질 스크리닝은 시험 물질이 색소형성 유전자들의 발현을 촉진 혹은 억제하는지를 면역검정법(예를 들어 ELISA 또는 Immunoblot)으로 확인하는 방법으로 수행될 수 있다.Expression control material screening using the expression level of the pigmentation genes of the present invention can be carried out by a method to confirm whether the test substance promotes or inhibits the expression of the pigmentation genes by immunoassay (for example, ELISA or Immunoblot).
이하 본 발명을 하기 실시예 및 시험예에 의거하여 보다 구체적으로 설명한다. 그러나 이들 실시예 및 시험예는 본 발명에 대한 이해를 돕기 위한 것일 뿐, 본 발명의 범위가 이들 예로 한정되는 것은 아니다.
Hereinafter, the present invention will be described in more detail based on the following Examples and Test Examples. However, these examples and test examples are only for helping the understanding of the present invention, the scope of the present invention is not limited to these examples.
[시험예 1] hsa-miR-203의 모방체(mimic)에 의한 티로시나아제 관련 단백질 1 mRNA 증가[Test Example 1] Tyrosinase-related
본 발명자들은 hsa-miR-203의 획득기능적 연구(gain-of-functional study)를 위하여 hsa-miR-203의 모방체를 이용하였는데, hsa-miR-203의 모방체는 hsa-miR-203와 동일한 서열을 갖는 올리고핵산(oligonucleotide)으로서, 이를 RNAiMAX 시약(invitrogen 제품)을 이용하여 리포좀을 형성하여 세포 내로 주입하여 hsa-miR-203의 과발현 현상(overexpression)을 유도할 수 있다. We used mimetics of hsa-miR-203 for gain-of-functional study of hsa-miR-203, which mimics hsa-miR-203. As an oligonucleotide having a sequence, liposomes can be formed using RNAiMAX reagent (invitrogen) and injected into cells to induce overexpression of hsa-miR-203.
흑색종 세포주인 WM266-4에 hsa-miR-203의 모방체(상품명: C-300562-03-0005, miRIDIAN Mimic, Human hsa-miR-203 MIMAT0000264/MI0000283(hsa-miR-203 ), 5 nmol , Dharmacon, Inc. 제품)를 농도가 20uM가 되도록 리포좀(liposome)을 이용하여 트랜스펙션하여 세포 안으로 이동시킨다(실시예 1). 대조군은 어떠한 올리고핵산도 넣지 않은 샘플(비교예 1)과 본 발명의 miRNA 서열과는 전혀 중복되지 않는 올리고핵산(상품명: CN-001000-01-05, miRIDIAN microRNA Mimic Negative Control #1, Dharmacon, Inc. 제품)을 트랜스펙션시킨 샘플(비교예 2)를 이용하였다. 트랜스펙션 후 세포는 37℃ 5% CO2 인큐베이터에서 약 60 시간 정도 배양한 후 트리졸(Trizol) 시약 1ml를 이용하여 RNA를 분리하였다. 트리졸을 이용하여 세포를 녹인뒤, 원심분리기를 이용하여 상층액을 분리, 이소프로판올을 0.35ml 넣어 핵산의 펠렛을 형성시키고 70% EtOH로 세척한 후, 펠렛을 물에 녹여 RNA를 분리하였다. 약 1ug의 RNA를 올리고 디티(oligo dT) 및 역전사 효소(reverse transcripase)를 이용하여 cDNA를 만든 뒤, 티로시나아제 관련 단백질 1 mRNA에 특이적인 프라이머 (assay ID: Hs00167051_m1) 를 이용하여 Applied biosystems사의 taqman 방식의 real time PCR 을 95℃ 에서 10분 반응한 뒤, 95℃에서 10초, 60℃에서 1분 반응을 약 45번 반복시켜 수행하였다. 티로시나아제 관련 단백질 1 mRNA 발현량은 하우스키핑(housekeeping) 유전자인 GAPDH의 mRNA 발현량 (assay ID: 4333764F) 으로 정규화(normalization) 하였으며, 그 결과를 도 1에 나타내었다.Mimetics of hsa-miR-203 in melanoma cell line WM266-4 (trade name: C-300562-03-0005, miRIDIAN Mimic, Human hsa-miR-203 MIMAT0000264 / MI0000283 (hsa-miR-203), 5 nmol, Dharmacon, Inc.) is transfected with liposomes to a concentration of 20 uM and transferred into cells (Example 1). The control group contains a sample without any oligonucleotide (Comparative Example 1) and an oligonucleic acid (trade name: CN-001000-01-05, miRIDIAN microRNA Mimic
이 결과, miR-203 모방체를 세포 내로 주입한 경우에(실시예 1) 티로시나아제 관련 단백질 1의 mRNA 발현량이 비교예 1 및 2에 비해 현저히 증가함을 알 수 있다(도 1).
As a result, when the miR-203 mimetics were injected into cells (Example 1), it can be seen that the mRNA expression level of tyrosinase-related
[시험예 2] hsa-miR-203의 모방체 (mimic)에 의한 멜란-A mRNA 증가[Test Example 2] melan-A mRNA increase by mimic of hsa-miR-203
흑색종 세포주인 WM266-4에 hsa-miR-203의 모방체(상품명: C-300562-03-0005, miRIDIAN Mimic, Human hsa-miR-203 MIMAT0000264/MI0000283(hsa-miR-203), 5 nmol, Dharmacon, Inc. 제품)를 농도가 20uM가 되도록 리포좀(liposome)을 이용하여 트랜스펙션하여 세포 안으로 이동시킨다(실시예 2). 대조군은 어떠한 올리고핵산도 넣지 않은 샘플(비교예 3)과 본 발명의 miRNA 서열과는 전혀 중복되지 않는 올리고핵산(상품명: CN-001000-01-05, miRIDIAN microRNA Mimic Negative Control #1, Dharmacon, Inc. 제품)을 트랜스펙션시킨 샘플(비교예 4)를 이용하였다. 트랜스펙션 후 세포는 37℃ 5% CO2 인큐베이터에서 약 60 시간 정도 배양한 후 트리졸(Trizol) 시약 1ml를 이용하여 RNA를 분리하였다. 트리졸을 이용하여 세포를 녹인뒤, 원심분리기를 이용하여 상층액을 분리, 이소프로판올을 0.35ml 넣어 핵산의 펠렛을 형성시키고 70% EtOH로 세척한 후, 펠렛을 물에 녹여 RNA를 분리하였다. 약 1ug의 RNA를 올리고 디티(oligo dT) 및 역전사 효소(reverse transcripase)를 이용하여 cDNA를 만든 뒤, 멜란-A mRNA에 특이적인 프라이머(assay ID: Hs00194133_m1) 를 이용하여 Applied biosystems사의 taqman 방식의 real time PCR 을 95℃ 에서 10분 반응한 뒤, 95℃에서 10초, 60℃에서 1분 반응을 약 45번 반복시켜 수행하였다. 멜란-A mRNA 발현량은 하우스키핑(housekeeping) 유전자인 GAPDH의 mRNA 발현량(assay ID: 4333764F) 으로 정규화(normalization) 하여 결과를 도 2에 나타내었다.Mimic of hsa-miR-203 in melanoma cell line WM266-4 (brand name: C-300562-03-0005, miRIDIAN Mimic, Human hsa-miR-203 MIMAT0000264 / MI0000283 (hsa-miR-203), 5 nmol, Dharmacon, Inc.) is transfected with liposomes to a concentration of 20 uM and transferred into cells (Example 2). The control group is a sample without any oligonucleotide (Comparative Example 3) and an oligonucleic acid (trade name: CN-001000-01-05, miRIDIAN microRNA Mimic
이 결과, miR-203 모방체를 트랜스펙션 한 경우에(실시예 2) 멜란-A의 mRNA 발현량이 비교예 3 및 4에 비해 현저히 증가함을 알 수 있다(도 2).
As a result, it can be seen that the mRNA expression level of melan-A is significantly increased in comparison with Comparative Examples 3 and 4 when miR-203 mimetics are transfected (Example 2).
[시험예 3] hsa-miR-203의 모방체 (mimic)에 의한 티로시나아제 mRNA 증가Test Example 3 Increasing Tyrosinase mRNA by Mimic of hsa-miR-203
흑색종 세포주인 WM115에 hsa-miR-203의 모방체(상품명: C-300562-03-0005, miRIDIAN Mimic, Human hsa-miR-203 MIMAT0000264/MI0000283(hsa-miR-203), 5 nmol, Dharmacon, Inc. 제품)를 농도가 20uM가 되도록 리포좀(liposome)을 이용하여 트랜스펙션하여 세포 안으로 이동시킨다(실시예 3). 대조군은 어떠한 올리고핵산도 넣지 않은 샘플(비교예 5)과 본 발명의 miRNA 서열과는 전혀 중복되지 않는 올리고핵산(상품명: CN-001000-01-05, miRIDIAN microRNA Mimic Negative Control #1, Dharmacon, Inc. 제품)을 트랜스펙션시킨 샘플(비교예 6)를 이용하였다. 트랜스펙션 후 세포는 37℃ 5% CO2 인큐베이터에서 약 60 시간 정도 배양한 후 트리졸(Trizol) 시약 1ml를 이용하여 RNA를 분리하였다. 트리졸을 이용하여 세포를 녹인뒤, 원심분리기를 이용하여 상층액을 분리, 이소프로판올을 0.35ml 넣어 핵산의 펠렛을 형성시키고 70% EtOH로 세척한 후, 펠렛을 물에 녹여 RNA를 분리하였다. 약 1ug의 RNA를 올리고 디티(oligo dT) 및 역전사 효소(reverse transcripase)를 이용하여 cDNA를 만든 뒤, 티로시나아제 mRNA에 특이적인 프라이머 (assay ID: Hs01099965_m1) 를 이용하여 Applied biosystems사의 taqman 방식의 real time PCR 을 95℃ 에서 10분 반응한뒤, 95℃에서 10초, 60℃에서 1분 반응을 약 45번 반복시켜 수행하였다. 티로시나아제 mRNA 발현량은 하우스키핑(housekeeping) 유전자인 GAPDH의 mRNA 발현량 (assay ID: 4333764F) 으로 정규화(normalization) 하였으며, 그 결과를 도 3에 나타내었다.Mimic of hsa-miR-203 in melanoma cell line WM115 (trade name: C-300562-03-0005, miRIDIAN Mimic, Human hsa-miR-203 MIMAT0000264 / MI0000283 (hsa-miR-203), 5 nmol, Dharmacon, Inc.) is transfected with liposomes to a concentration of 20 uM and transferred into cells (Example 3). The control group is a sample without any oligonucleotide (Comparative Example 5) and an oligonucleic acid (trade name: CN-001000-01-05, miRIDIAN microRNA Mimic
이 결과, miR-203 모방체를 세포 내로 주입한 경우에(실시예 3) 티로시나아제 mRNA 발현량이 비교예 5 및 6에 비해 현저히 증가함을 알 수 있다(도 3).
As a result, when the miR-203 mimetics were injected into the cells (Example 3), it can be seen that the expression levels of tyrosinase mRNA were significantly increased compared to Comparative Examples 5 and 6 (Fig. 3).
본 발명에 의한 서열번호 1의 miRNA를 유효성분으로 함유하는 백모방지 및 흑모 생성 촉진용 모발용 조성물은 하기의 제형예와 같이 제조될 수 있으나, 이에 한정되는 것은 아니다.The composition for preventing hair loss and hair growth promoting hair containing miRNA of SEQ ID NO: 1 according to the present invention as an active ingredient may be prepared as in the following formulation example, but is not limited thereto.
[제형예 1] 모발 샴푸 [Formulation Example 1] Hair Shampoo
하기 표 1에 기재된 조성에 따라 통상적인 방법으로 모발 샴푸를 제조할 수 있다.According to the composition shown in Table 1 it can be prepared a hair shampoo in a conventional manner.
[제형예 2] 모발 컨디셔닝Formulation Example 2 Hair Conditioning
하기 표 2에 기재된 조성에 따라 통상적인 방법으로 모발 컨디셔닝을 제조할 수 있다.Hair conditioning can be prepared by conventional methods according to the compositions set forth in Table 2 below.
[제형예 3] 두피 헤어토닉[Formulation Example 3] Scalp Hair Tonic
하기 표 3에 기재된 조성에 따라 통상적인 방법으로 두피 헤어토닉을 제조할 수 있다.The scalp hair tonic may be prepared by a conventional method according to the composition described in Table 3 below.
[제형예 4] 두피 에센스Formulation Example 4 Scalp Essence
하기 표 4에 기재된 조성에 따라 통상적인 방법으로 두피 에센스를 제조할 수 있다.The scalp essence can be prepared by a conventional method according to the composition described in Table 4.
[제형예 5] 주사제Formulation Example 5 Injection
하기 표 5에 기재된 조성에 따라 통상적인 방법으로 주사제를 제조할 수 있다.Injectables can be prepared by conventional methods according to the compositions set forth in Table 5 below.
[제형예 6] 연고[Formulation Example 6] ointment
하기 표 6에 기재된 조성에 따라 통상적인 방법으로 연고를 제조할 수 있다.Ointments may be prepared by conventional methods according to the compositions shown in Table 6 below.
[제형예 7] 로션[Formulation Example 7] Lotion
하기 표 7에 기재된 조성에 따라 통상적인 방법으로 로션을 제조할 수 있다.The lotion may be prepared by a conventional method according to the composition described in Table 7.
[제형예 8] 스프레이Formulation Example 8 Spray
하기 표 8에 기재된 조성에 따라 통상적인 방법으로 스프레이를 제조할 수 있다.Sprays may be prepared by conventional methods according to the compositions set forth in Table 8 below.
본 발명에 의한 서열번호 2 의 miRNA를 유효성분으로 함유하는 피부 미백용 조성물은 하기의 제형예와 같이 제조될 수 있으나, 이에 한정되는 것은 아니다.The composition for skin whitening containing miRNA of SEQ ID NO: 2 according to the present invention as an active ingredient may be prepared as in the following formulation example, but is not limited thereto.
[제형예 9] 영양화장수Formulation Example 9 Nutritional Cosmetics
하기 표 9에 기재된 조성에 따라 통상적인 방법으로 영양화장수를 제조할 수 있다.According to the composition shown in Table 9 it can be prepared by the conventional method.
[제형예 10] 영양로션Formulation Example 10 Nutrition Lotion
하기 표 10에 기재된 조성에 따라 통상적인 방법으로 영양로션을 제조할 수 있다.Nutritional lotion may be prepared according to the composition described in Table 10 below in a conventional manner.
[제형예 11] 영양크림Formulation Example 11 Nutrition Cream
하기 표 11에 기재된 조성에 따라 통상적인 방법으로 영양크림을 제조할 수 있다.Nutritional creams may be prepared by conventional methods according to the compositions shown in Table 11.
[제형예 12] 마사지 크림Formulation Example 12 Massage Cream
하기 표 12에 기재된 조성에 따라 통상적인 방법으로 마사지 크림을 제조할 수 있다.Massage creams may be prepared in a conventional manner according to the composition described in Table 12 below.
[제형예 13] 팩Formulation Example 13 Pack
하기 표 13에 기재된 조성에 따라 통상적인 방법으로 팩을 제조할 수 있다.Packs may be prepared by conventional methods according to the compositions set forth in Table 13 below.
[제형예 14] 연고Formulation Example 14 Ointment
하기 표 14에 기재된 조성에 따라 통상적인 방법으로 연고를 제조할 수 있다.Ointments can be prepared according to the compositions described in Table 14 below in a conventional manner.
<110> AMOREPACIFIC CORPORATION <120> Composition for regulating expression of pigmentation-related genes containing microRNA <130> YPD201104-0049 <160> 2 <170> KopatentIn 2.0 <210> 1 <211> 22 <212> RNA <213> Artificial Sequence <220> <223> hsa-mir-203 <400> 1 gugaaauguu uaggaccacu ag 22 <210> 2 <211> 22 <212> RNA <213> Artificial Sequence <220> <223> hsa-mir-203 <400> 2 cuaguggucc uaaacauuuc ac 22 <110> AMOREPACIFIC CORPORATION <120> Composition for regulating expression of pigmentation-related genes containing microRNA <130> YPD201104-0049 <160> 2 <170> Kopatentin 2.0 <210> 1 <211> 22 <212> RNA <213> Artificial Sequence <220> <223> hsa-mir-203 <400> 1 gugaaauguu uaggaccacu ag 22 <210> 2 <211> 22 <212> RNA <213> Artificial Sequence <220> <223> hsa-mir-203 <400> 2 cuaguggucc uaaacauuuc ac 22
Claims (12)
According to claim 1, wherein the miRNA is selected from the nucleotide sequence of SEQ ID NO: 1, Pigment-forming gene expression control composition, characterized in that selected from oligonucleic acid molecules consisting of 15 to 22 consecutive nucleotide sequences including ugaaaug.
(a) 서열번호 1의 miRNA 또는 서열번호 2의 안티센스 핵산 분자를 세포에 트랜스펙션시키는 단계;
(b) 상기 세포에 시험 물질을 처리하는 단계; 및
(c) 상기 시험물질이 색소형성유전자의 발현을 촉진하는지 또는 억제하는지 여부를 확인하는 단계;
를 포함하는 것을 특징으로 하는 색소형성유전자의 발현조절물질 스크리닝 방법.As a method of screening for expression control substances of pigment forming genes for a test substance,
(a) transfecting a cell with a miRNA of SEQ ID NO: 1 or an antisense nucleic acid molecule of SEQ ID NO: 2;
(b) treating the cell with a test substance; And
(c) confirming whether the test substance promotes or inhibits expression of the pigment forming gene;
Expression control material screening method of the pigment-forming gene comprising a.
상기 확인 결과, 상기 시험물질이 색소형성 유전자의 발현, 활성 또는 기능을 증가시키는 경우 색소형성 유전자의 촉진제로 판정하는 단계를 더 포함하는 것을 특징으로 하는 색소형성유전자의 발현조절물질 스크리닝 방법.The method of claim 10,
As a result of the check, when the test substance increases the expression, activity or function of the pigment forming gene, the method of screening for expression regulators of the pigment forming gene, characterized in that it further comprises the step of determining the promoter of the pigment forming gene.
상기 확인 결과, 상기 시험물질이 색소형성 유전자의 발현, 활성 또는 기능을 감소시키는 경우 색소형성 유전자의 발현 억제제로 판정하는 단계를 더 포함하는 것을 특징으로 하는 색소형성유전자의 발현조절물질 스크리닝 방법.
The method of claim 10,
As a result of the check, when the test substance reduces the expression, activity or function of the pigment forming gene, the method of screening for expression regulators of the pigment forming gene, characterized in that it further comprises the step of determining the expression inhibitor of the pigment forming gene.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
KR1020110060483A KR101849102B1 (en) | 2011-06-22 | 2011-06-22 | Composition for regulating expression of pigmentation-related genes containing microRNA |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
KR1020110060483A KR101849102B1 (en) | 2011-06-22 | 2011-06-22 | Composition for regulating expression of pigmentation-related genes containing microRNA |
Publications (2)
Publication Number | Publication Date |
---|---|
KR20130000038A true KR20130000038A (en) | 2013-01-02 |
KR101849102B1 KR101849102B1 (en) | 2018-04-17 |
Family
ID=47833692
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
KR1020110060483A KR101849102B1 (en) | 2011-06-22 | 2011-06-22 | Composition for regulating expression of pigmentation-related genes containing microRNA |
Country Status (1)
Country | Link |
---|---|
KR (1) | KR101849102B1 (en) |
Cited By (3)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO2015030078A1 (en) * | 2013-08-28 | 2015-03-05 | 千寿製薬株式会社 | Therapeutic agent for ectocornea injury |
US11648326B2 (en) | 2016-02-04 | 2023-05-16 | Xenex Disinfection Services Inc. | Cabinets for disinfecting objects |
US11690927B2 (en) | 2016-02-04 | 2023-07-04 | Xenex Disinfection Services Inc. | Systems, cabinets and methods for disinfecting objects |
Families Citing this family (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
KR20220027342A (en) | 2020-08-26 | 2022-03-08 | (주)아모레퍼시픽 | Composition for controlling melanin production comprising plant-derived oligonucleotides |
Family Cites Families (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US20080274908A1 (en) | 2007-05-04 | 2008-11-06 | Dermtech International | Diagnosis of melanoma by nucleic acid analysis |
-
2011
- 2011-06-22 KR KR1020110060483A patent/KR101849102B1/en active IP Right Grant
Cited By (5)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO2015030078A1 (en) * | 2013-08-28 | 2015-03-05 | 千寿製薬株式会社 | Therapeutic agent for ectocornea injury |
US9562231B2 (en) | 2013-08-28 | 2017-02-07 | Senju Pharmaceutical Co., Ltd. | Therapeutic agent for corneal epithelial disorder |
JPWO2015030078A1 (en) * | 2013-08-28 | 2017-03-02 | 千寿製薬株式会社 | Treatment for corneal epithelial disorder |
US11648326B2 (en) | 2016-02-04 | 2023-05-16 | Xenex Disinfection Services Inc. | Cabinets for disinfecting objects |
US11690927B2 (en) | 2016-02-04 | 2023-07-04 | Xenex Disinfection Services Inc. | Systems, cabinets and methods for disinfecting objects |
Also Published As
Publication number | Publication date |
---|---|
KR101849102B1 (en) | 2018-04-17 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
KR101938548B1 (en) | Composition for regulating expression of pigmentation-related genes containing microRNA | |
US8455518B2 (en) | Method of treating skin with microRNA modulators | |
JP2003521929A (en) | Use of novel oligonucleotides and oligonucleotides that regulate the expression of enzymes involved in melanin synthesis as depigmenting agents | |
KR101849102B1 (en) | Composition for regulating expression of pigmentation-related genes containing microRNA | |
US10508140B2 (en) | Peptide having hair growth-promoting activity and/or melanin generation-promoting activity, and use thereof | |
CN105264075B (en) | Inhibit the aptamer of the enzymatic activity of tyrosinase | |
KR102152637B1 (en) | Composition for skin whitening containing a chemokine | |
EP2793798B1 (en) | Use of microrna molecules in influencing pigmentation of the skin | |
KR101800243B1 (en) | Composition for regulating expression of pigmentation-related genes containing microRNA | |
KR101871920B1 (en) | Composition containing microRNA | |
US9295631B2 (en) | Skin lightening composition | |
KR102027451B1 (en) | Micro RNA, and screening method using the micro RNA | |
JP6324597B1 (en) | Melanin production inhibitor, whitening agent, gene expression inhibitor, cosmetic composition for inhibiting melanin production, and cosmetic composition for whitening | |
KR102011826B1 (en) | Skin external composition interleukin 13 | |
KR20120139430A (en) | Composition containing microrna | |
KR100889460B1 (en) | Composition for enhancing melanogenesis in hair containing gdnf, method for enhancing melanogenesis in hair using gdnf, and method for screening hair-melanogenesis enhancer using gdnf expression level | |
KR102010950B1 (en) | Skin external composition interleukin 16 | |
FR2864540A1 (en) | New oligonucleotides that hybridize to the tyrosinase-related protein-1 gene, useful for cosmetic or therapeutic depigmentation and whitening of skin and hair | |
KR102300364B1 (en) | Composition for promoting hair growth and/or restoration containing psoralidin | |
KR101852440B1 (en) | Composition for control of skin cell differentiation comprising DUOX 2 miRNA | |
EP4046635A9 (en) | Composition, comprising rip kinase inhibitor, for preventing hair loss or promoting hair regrowth | |
KR102010951B1 (en) | Skin external composition interleukin 27 | |
KR101309335B1 (en) | Composition for regulating collagen |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
A201 | Request for examination | ||
E902 | Notification of reason for refusal | ||
E701 | Decision to grant or registration of patent right | ||
GRNT | Written decision to grant |