KR20130000038A - Composition for regulating expression of pigmentation-related genes containing microrna - Google Patents

Abstract

PURPOSE: A composition containing miRNA or antisense nucleic acid molecules for preventing grey hair or improving a skin whitening effect is provided to regulate the expression of genes expressing tyrosinase, tyrosinase-related proteins, and melan-A. CONSTITUTION: A composition for regulating the expression of pigmentation-related genes contains miRNA of sequence number 1 as an active ingredient. The miRNA is selected among base sequences of sequence number 1, and contains 15-22 continuous base sequences including ugaaaug. The pigmentation-related genes express tyrosinase, tyrosinase-related protein 1, or melan-A. A method for screening a material which regulates the expression of the pigmentation-related genes among test materials comprises: a step of transfectioning the miRNA of sequence number 1 or antisense nucleic acid molecules of sequence number 2 into cells; a step of treating the test materials to the cells; and a step of identifying if the test materials promote or suppress the expression of the pigmentation-related genes. [Reference numerals] (AA) Relative mRNA expression of TYRP1/GAPDH; (BB) Comparative embodiment 1; (CC) Comparative embodiment 2; (DD) Embodiment 1

Description

Composition for regulating expression of pigmentation genes containing microRNA {Composition for regulating expression of pigmentation-related genes containing microRNA}

The present invention relates to a cosmetic for preventing or treating hair loss, comprising a miRNA of hsa-miR-203 (hereinafter referred to as miR-203), which is a microRNA (microRNA; miRNA) that regulates the expression of a pigment gene. The present invention relates to a cosmetic or pharmaceutical composition for skin whitening comprising a pharmaceutical composition and an inhibitor of miR-203.

The skin is largely divided into epidermis and dermis. Pigment-forming cells (melanocytes) present in the epidermis are synthesized with pigments (melanin) to give a unique color of the skin. Melanosomes (melanosome) is present in a large number in the black vesicles, the intracellular organelles containing melanin dark expression in the epidermal tissue of the skin and hair is dark expression is controlled by melanin. Therefore, biological factors that regulate skin pigments are largely divided into elements that make melanocytes and those that carry melanocytes in pigmented cells. The most well known factors in the melanocyte-forming factor are tyrosinase (TYR), tyrosinase-related protein 1 (TYRP1), dopachrome tautomerase (DCT) and melan- A (Melan-A) and the like, Rab27a is known as a factor involved in the transport of melanocytes, and recently, transcription factors such as PAX3 and MITF are known to participate in the pigment regulation process. Therefore, these pigment control factors are important targets such as skin whitening, black hair formation and white hair prevention.

miRNA is a type of endogenous small RNA of 20-25 nucleotides in the cell and is derived from hairpin-shaped transcripts derived from non-synthetic DNA. . miRNAs generally bind to the complementary sequence of the 3'-UTR of the target mRNA and induce translation inhibition or destabilization of the mRNA, ultimately acting as a repressor to inhibit protein synthesis of the target mRNA. One miRNA targets several mRNAs, and mRNA is also known to be regulated by several miRNAs.

Currently, miRNAs are of great interest in the life sciences, as they are known to play an important role in many biological processes, including control of developmental time, apoptosis, fat metabolism and hematopoietic cell differentiation. However, research on miRNA's function in disease and development of cancer, etc. has progressed considerably, but relatively little research on miRNA's role in dermatology. Recently, miR-203 suppresses the differentiation ability by targeting p63 mRNA in keratinocytes and miR-125b inhibits the differentiation of skin stem cells and inhibits the division of keratinocytes. Little is known about skin-specific miRNAs and functions.

The present inventors have focused on the fact that certain miRNAs such as miR-203 and miR-125b will play a biologically important role in skin and hair.

The present inventors have searched for miRNAs involved in pigmentation in WM266-4 and WM115 melanoma cells of the skin. As a result, hsa-miR-203 is a pigment regulator, tyrosinase, tyrosinase-related protein 1, It has been found to increase the expression of genes expressing Melan-A and the like. Accordingly, an object of the present invention is to provide a cosmetic or pharmaceutical composition for skin whitening comprising a cosmetic or pharmaceutical composition for preventing or treating hair loss comprising a mimic of miR-203 and an inhibitor of miR-203. It is done.

The present invention provides a skin whitening cosmetic or pharmaceutical composition comprising the miRNA of SEQ ID NO: 1 as an active ingredient.

In another aspect, the present invention provides a white hair prevention or black hair producing efficacy cosmetic or pharmaceutical composition having a base sequence complementary to the miRNA of SEQ ID NO: 1, comprising an antisense nucleic acid molecule of SEQ ID NO: 2 that can be hybridized to the miRNA as an active ingredient. .

In another aspect, the present invention provides a method for screening a substance for regulating pigmentation gene expression for a test substance, comprising: transfecting a cell with a miRNA of SEQ ID NO: 1 or an antisense nucleic acid molecule of SEQ ID NO: 2; Treating the cell with a test substance; And confirming whether the test substance promotes or inhibits expression of a pigment forming gene.

The composition comprising the miRNA of SEQ ID NO: 1 or the antisense nucleic acid molecule of SEQ ID NO: 2 of the present invention regulates the expression of pigmentation genes that express the pigment regulators tyrosinase, tyrosinase related protein 1, melan-A. It is possible to provide a composition having anti-hair growth or black hair formation and skin lightening effect.

FIG. 1 shows an overexpression of hsa-miR-203 by injecting oligonucleotides having the same sequence as hsa-miR-203 into cells and performing real-time PCR to perform tyrosinase-related proteins. 1 shows the result of confirming the amount of mRNA expression.
Figure 2 is injected into the cell oligonucleotide having the same sequence as hsa-miR-203 to induce overexpression of hsa-miR-203, and confirmed the expression of melan-A mRNA by real-time PCR The results are shown.
Figure 3 is injected into the cell oligonucleotide having the same sequence as hsa-miR-203 to induce the overexpression of hsa-miR-203, and confirmed the expression of tyrosinase mRNA by real-time PCR The results are shown.

Hereinafter, the present invention will be described in detail.

The present invention provides a composition for controlling pigmentation, comprising an oligonucleotide comprising a miRNA of SEQ ID NO: 1 or an antisense nucleic acid molecule of SEQ ID NO: 2, or a nucleotide sequence of SEQ ID NO: 1 or 2 as an active ingredient.

The pigmentation gene is a gene expressing tyrosinase, tyrosinase related protein 1, melan-A.

5'- gugaaauguuuaggaccacuag -3 '(SEQ ID NO: 1)

The miRNA has an nucleotide sequence of SEQ ID NO: 1 and is an oligonucleic acid molecule consisting of 22 consecutive nucleotide sequences including ugaaaug. In addition, the miRNA used in the present invention is an oligonucleic acid molecule containing 15-22 consecutive nucleotide sequences including ugaaaug of nucleotide sequence 1, and may include those which perform a function of increasing expression of pigmentation genes. .

The miRNA may promote expression of genes involved in pigmentation.

Using the miRNA of SEQ ID NO: 1 of the present invention, an oligonucleotide molecule having the same sequence as miR-203 can be prepared by mimic mimi-203. In addition, mimic mimi (mimic) is a sequence comprising the nucleotide sequence of the hsa-miR-203, may include those that perform the function of increasing the expression of pigmentation genes.

The antisense nucleic acid molecule of SEQ ID NO: 2 has a base sequence complementary to the miRNA of SEQ ID NO: 1, and acts as an inhibitor of miR-203 that can hybridize to the miRNA. As an inhibitor of hsa-miR-203, a sequence including the nucleotide sequence of SEQ ID NO: 2 may include those that can be hybridized to the miRNA.

5'- cuagugguccuaaacauuucac -3 '(SEQ ID NO: 2)

The composition for preventing and hair follicle of the present invention is selected from oligonucleic acid molecules consisting of 15-22 consecutive base sequences including ugaaaug as oligonucleic acid comprising the miRNA of SEQ ID NO: 1 or the nucleotide sequence of SEQ ID NO: 1 It is contained as an active ingredient. In addition, the sequence comprising the nucleotide sequence of SEQ ID NO: 1 may contain as an active ingredient selected from oligonucleic acid molecules that increase the expression of tyrosinase-related protein 1, melan-A.

The composition for skin whitening of the present invention has a base sequence complementary to the miRNA of SEQ ID NO: 1 as the antisense nucleic acid molecule of SEQ ID NO: 2, and acts as an inhibitor of miR-203 that can be hybridized to the miRNA. Contains as an ingredient. As an inhibitor of hsa-miR-203, a sequence comprising the nucleotide sequence of SEQ ID NO: 2, and may be selected as an active ingredient selected from oligonucleic acid molecules which may include those that may be hybridized to the miRNA.

In the present invention, the miRNA, antisense nucleic acid molecule or oligonucleic acid used may be used in an amount of 0.00001 to 30.1% by weight based on the total weight of the composition.

When the composition of the present invention is a cosmetic formulation, it contains a cosmetically acceptable medium or base. These are all formulations suitable for topical application, for example emulsions, suspensions, microemulsions, microcapsules, microgranules, ionic (liposomes) or nonionics obtained by dispersing an oil phase in a solution, gel, solid or pasty anhydrous product, aqueous phase. It may be provided in the form of a vesicle dispersant in the form or in the form of a cream, skin, lotion, powder, ointment, spray or cone stick. These compositions may be prepared according to conventional methods in the art.

When the composition of the present invention is a pharmaceutical formulation, a solid, semi-solid or by adding a commercially available inorganic or organic carrier using the miRNA of SEQ ID NO: 1 or the antisense nucleic acid molecule of SEQ ID NO: 2 according to an embodiment of the present invention as an active ingredient It may be formulated as a parenteral dosage form (injection, transdermal or external application) in liquid form. Formulations for parenteral administration include topical injection preparations, ointments, lotions, sprays, suspensions and the like.

In order to formulate the active ingredient of the composition of the present invention, it can be easily formulated according to a conventional method, and surfactants, excipients, coloring agents, spices, preservatives, stabilizers, buffers, suspensions, and other commonly used auxiliaries can be suitably used. have.

The dosage of the composition of the present invention may vary depending on the age, sex, weight of the subject to be treated, the specific disease or pathology to be treated, the severity of the disease or pathology, the route of administration and the judgment of the prescriber. Dosage determination based on these factors is within the level of those skilled in the art, and can be applied at the level of those skilled in the art by external application to the site that needs to be applied to the formulations other than injections, and in the case of injections, it is topically applied to the site requiring administration. Can be injected.

The miRNA of the present invention may be composed of modified nucleic acid molecules. Partially or wholly comprise a nucleic acid molecule comprising 2'-substituted ribose such as, for example, 2'-0-alkyl (e.g. methyl, ethyl), 2'-0-allyl, 2'-0-allyl. Can be. It may also comprise partially or wholly nucleic acid molecules with substituted bases.

A method for screening a substance for controlling the expression of a pigment forming gene for a test substance of the present invention comprises the steps of: (a) transfecting a cell with a miRNA of SEQ ID NO: 1; (b) treating the cell with the test substance; And (c) confirming whether or not the test substance inhibits the expression of the pigment-forming genes.

The screening method may further include determining that the test substance is an inhibitor of the pigmentation gene when the test substance reduces the expression, activity or function of tyrosinase, tyrosinase related protein 1, melan-A. Can be.

In addition, the screening method further comprises the step of determining the expression promoter of the pigmentation gene when the test substance increases the expression, activity or function of tyrosinase, tyrosinase-related protein 1, melan-A. can do.

In the step of transfecting the miRNA of SEQ ID NO: 1 or the antisense nucleic acid molecule of SEQ ID NO: 2 to the cell, the transfection may be performed using micro-injection, calcium phosphate co-precipitation, electroporation or liposomes. It may be carried out, but is not limited thereto.

In the method of screening a substance for regulating the expression of a pigment forming gene of the present invention, whether to regulate the expression of the pigment forming gene is determined using RT-PCR or ELISA and immunoblot which are well known in the art. Can be.

Expression control material screening using the expression level of the pigmentation genes of the present invention can be carried out by a method to confirm whether the test substance promotes or inhibits the expression of the pigmentation genes by immunoassay (for example, ELISA or Immunoblot).

Hereinafter, the present invention will be described in more detail based on the following Examples and Test Examples. However, these examples and test examples are only for helping the understanding of the present invention, the scope of the present invention is not limited to these examples.

[Test Example 1] Tyrosinase-related protein 1 mRNA increase by mimic of hsa-miR-203

We used mimetics of hsa-miR-203 for gain-of-functional study of hsa-miR-203, which mimics hsa-miR-203. As an oligonucleotide having a sequence, liposomes can be formed using RNAiMAX reagent (invitrogen) and injected into cells to induce overexpression of hsa-miR-203.

Mimetics of hsa-miR-203 in melanoma cell line WM266-4 (trade name: C-300562-03-0005, miRIDIAN Mimic, Human hsa-miR-203 MIMAT0000264 / MI0000283 (hsa-miR-203), 5 nmol, Dharmacon, Inc.) is transfected with liposomes to a concentration of 20 uM and transferred into cells (Example 1). The control group contains a sample without any oligonucleotide (Comparative Example 1) and an oligonucleic acid (trade name: CN-001000-01-05, miRIDIAN microRNA Mimic Negative Control # 1, Dharmacon, Inc.) which does not overlap at all with the miRNA sequence of the present invention. Product) (Comparative Example 2) was used. After transfection, the cells were incubated in a 37 ° C. 5% CO ₂ incubator for about 60 hours and RNA was isolated using 1 ml of Trizol reagent. After dissolving the cells using Trizol, the supernatant was separated using a centrifuge, 0.35ml of isopropanol was added to form a pellet of nucleic acid, washed with 70% EtOH, and the pellet was dissolved in water to separate RNA. About 1 ug of RNA was prepared using c-DNA using oligo dT and reverse transcripase, and then a primer specific for tyrosinase-related protein 1 mRNA (assay ID: Hs00167051_m1) was used by Applied Biosystems, Inc. The real time PCR was performed for 10 minutes at 95 ° C., followed by 10 seconds at 95 ° C. and 1 minute reaction at 60 ° C. for about 45 times. The tyrosinase-related protein 1 mRNA expression level was normalized to mRNA expression level (GAS ID: 4333764F) of GAPDH, which is a housekeeping gene, and the results are shown in FIG. 1.

As a result, when the miR-203 mimetics were injected into cells (Example 1), it can be seen that the mRNA expression level of tyrosinase-related protein 1 was significantly increased compared to Comparative Examples 1 and 2 (FIG. 1).

[Test Example 2] melan-A mRNA increase by mimic of hsa-miR-203

Mimic of hsa-miR-203 in melanoma cell line WM266-4 (brand name: C-300562-03-0005, miRIDIAN Mimic, Human hsa-miR-203 MIMAT0000264 / MI0000283 (hsa-miR-203), 5 nmol, Dharmacon, Inc.) is transfected with liposomes to a concentration of 20 uM and transferred into cells (Example 2). The control group is a sample without any oligonucleotide (Comparative Example 3) and an oligonucleic acid (trade name: CN-001000-01-05, miRIDIAN microRNA Mimic Negative Control # 1, Dharmacon, Inc.) which does not overlap at all with the miRNA sequence of the present invention. Product) (Comparative Example 4) was used. After transfection, the cells were incubated in a 37 ° C. 5% CO ₂ incubator for about 60 hours and RNA was isolated using 1 ml of Trizol reagent. After dissolving the cells using Trizol, the supernatant was separated using a centrifuge, 0.35ml of isopropanol was added to form a pellet of nucleic acid, washed with 70% EtOH, and the pellet was dissolved in water to separate RNA. About 1ug of RNA was prepared using c-DNA using oligo dT and reverse transcripase, and then a primer specific for melan-A mRNA (assay ID: Hs00194133_m1) was used to achieve the taqman method of Applied biosystems. The time PCR was performed at 95 ° C. for 10 minutes, followed by 10 seconds at 95 ° C. and 1 minute reaction at 60 ° C. for about 45 times. Melan-A mRNA expression level was normalized (assay ID: 4333764F) of GAPDH mRNA, which is a housekeeping gene, and the results are shown in FIG. 2.

As a result, it can be seen that the mRNA expression level of melan-A is significantly increased in comparison with Comparative Examples 3 and 4 when miR-203 mimetics are transfected (Example 2).

Test Example 3 Increasing Tyrosinase mRNA by Mimic of hsa-miR-203

Mimic of hsa-miR-203 in melanoma cell line WM115 (trade name: C-300562-03-0005, miRIDIAN Mimic, Human hsa-miR-203 MIMAT0000264 / MI0000283 (hsa-miR-203), 5 nmol, Dharmacon, Inc.) is transfected with liposomes to a concentration of 20 uM and transferred into cells (Example 3). The control group is a sample without any oligonucleotide (Comparative Example 5) and an oligonucleic acid (trade name: CN-001000-01-05, miRIDIAN microRNA Mimic Negative Control # 1, Dharmacon, Inc.) which does not overlap at all with the miRNA sequence of the present invention. Product) (Comparative Example 6) was used. After transfection, the cells were incubated in a 37 ° C. 5% CO ₂ incubator for about 60 hours and RNA was isolated using 1 ml of Trizol reagent. After dissolving the cells using Trizol, the supernatant was separated using a centrifuge, 0.35ml of isopropanol was added to form a pellet of nucleic acid, washed with 70% EtOH, and the pellet was dissolved in water to separate RNA. About 1 ug of RNA was prepared using c-DNA using oligo dT and reverse transcripase, and then a primer specific for tyrosinase mRNA (assay ID: Hs01099965_m1) was used by Applied Biosystems's taqman method real. The time PCR was performed at 95 ° C. for 10 minutes, followed by 10 seconds at 95 ° C. and 1 minute reaction at 60 ° C. for about 45 times. Tyrosinase mRNA expression level was normalized (assay ID: 4333764F) of GAPDH mRNA, which is a housekeeping gene, and the results are shown in FIG. 3.

As a result, when the miR-203 mimetics were injected into the cells (Example 3), it can be seen that the expression levels of tyrosinase mRNA were significantly increased compared to Comparative Examples 5 and 6 (Fig. 3).

The composition for preventing hair loss and hair growth promoting hair containing miRNA of SEQ ID NO: 1 according to the present invention as an active ingredient may be prepared as in the following formulation example, but is not limited thereto.

 [Formulation Example 1] Hair Shampoo

According to the composition shown in Table 1 it can be prepared a hair shampoo in a conventional manner.

Raw material name Content (% by weight) Sodium Lauryl Sulfate Solution (30%) 20.0 Palm oil fatty acid diethanolamide 5.0 Polyquaternium-10 0.3 Propylene glycol 2.0 MiRNA of SEQ ID NO: 1 0.1 Pyrrothonol amine 0.5 Yellow 203 Suitable amount Paraoxybenzoic Acid Ester 0.2 Combination incense Suitable amount Citric acid Suitable amount Purified water Balance

Formulation Example 2 Hair Conditioning

Hair conditioning can be prepared by conventional methods according to the compositions set forth in Table 2 below.

Raw material name Content (% by weight) Cetyltrimethylammonium chloride (29%) 7.0 Distearyl dimethylammonium chloride (75%) 4.0 Cetostearyl alcohol 3.5 Polyoxyethylene stearyl ether 1.0 Liquid paraffin 2.0 Propylene glycol 1.5 MiRNA of SEQ ID NO: 1 0.1 Combination incense Suitable amount Citric acid Suitable amount Purified water Balance

[Formulation Example 3] Scalp Hair Tonic

The scalp hair tonic may be prepared by a conventional method according to the composition described in Table 3 below.

Raw material name Content (% by weight) menthol 0.1 D-panthenol 0.6 Salicylic acid 0.05 glycerin 1.0 Polyoxyethylene Cured Castor Oil 0.8 Tocopherol Acetate 0.03 Combination incense Suitable amount MiRNA of SEQ ID NO: 1 0.1 ethanol 30.0 Purified water Balance

Formulation Example 4 Scalp Essence

The scalp essence can be prepared by a conventional method according to the composition described in Table 4.

Raw material name Content (% by weight) ethanol 30.0 Polysorbate 60 1.5 glycerin 3.0 Carboxyvinyl polymer 0.1 Triethanolamine 0.2 MiRNA of SEQ ID NO: 1 0.1 antiseptic Suitable amount Spices and Colors Suitable amount Purified water Balance

Formulation Example 5 Injection

Injectables can be prepared by conventional methods according to the compositions set forth in Table 5 below.

Raw material name Weight ratio (per 1 ml) Sodium chloride 9mg Sodium carboxymethylcellulose 30.0mg Tween 20 1.0 mg MiRNA of SEQ ID NO: 1 1mg Distilled water for injection Balance

[Formulation Example 6] ointment

Ointments may be prepared by conventional methods according to the compositions shown in Table 6 below.

Raw material name Content (% by weight) Caprine / Capryl Triglycerides 10 Liquid paraffin 10 Sorbitan sesquioleate 6 Octyldodeceth-25 9 3,7 hexanoate 10 Squalane One Salicylic acid One glycerin 15 Sorbitol One MiRNA of SEQ ID NO: 1 0.1 Preservative, coloring, fragrance Suitable amount Purified water Balance

[Formulation Example 7] Lotion

The lotion may be prepared by a conventional method according to the composition described in Table 7.

Raw material name Content (% by weight) MiRNA of SEQ ID NO: 1 0.1 Wax 4.0 Polysorbate 60 1.5 Sorbitan sesquioleate 1.5 Liquid paraffin 0.5 Caprylic / capric triglyceride 5.0 glycerin 3.0 Butylene glycol 3.0 Propylene glycol 3.0 Carboxyvinyl polymer 0.1 Triethanolamine 0.2 Preservatives, Colors and Flavors Suitable amount Purified water Balance

Formulation Example 8 Spray

Sprays may be prepared by conventional methods according to the compositions set forth in Table 8 below.

Raw material name Content (% by weight) MiRNA of SEQ ID NO: 1 0.1 ethanol 80 Tween 80 5 glycerin 5 Tocopherol Acetate One Preservatives, Colors and Flavors Suitable amount Purified water Balance

The composition for skin whitening containing miRNA of SEQ ID NO: 2 according to the present invention as an active ingredient may be prepared as in the following formulation example, but is not limited thereto.

Formulation Example 9 Nutritional Cosmetics

According to the composition shown in Table 9 it can be prepared by the conventional method.

Raw material name Content (% by weight) glycerin 8.0 Butylene glycol 4.0 Hyaluronic acid extract 5.0 Beta Glucan 7.0 Carbomer 0.1 MiRNA of SEQ ID NO: 2 0.1 Caprylic / Capric Triglycerides 8.0 Squalane 5.0 Cetearyl Glucoside 1.5 Sorbitan stearate 0.4 Cetearyl Alcohol 1.0 antiseptic Suitable amount incense Suitable amount Pigment Suitable amount Triethanolamine 0.1 Purified water Balance

Formulation Example 10 Nutrition Lotion

Nutritional lotion may be prepared according to the composition described in Table 10 below in a conventional manner.

Raw material name Content (% by weight) Purified water Balance glycerin 3.0 Butylene glycol 3.0 Liquid paraffin 5.0 Beta Glucan 7.0 Carbomer 0.1 MiRNA of SEQ ID NO: 2 3.0 Caprylic / Capric Triglycerides 3.0 Squalane 5.0 Cetearyl Glucoside 1.5 Sorbitan stearate 0.4 Polysorbate 60 1.5 antiseptic Suitable amount incense Suitable amount Pigment Suitable amount Triethanolamine 0.1

Formulation Example 11 Nutrition Cream

Nutritional creams may be prepared by conventional methods according to the compositions shown in Table 11.

Raw material name Content (% by weight) glycerin 3.0 Butylene glycol 3.0 Liquid paraffin 7.0 Beta Glucan 7.0 Carbomer 0.1 MiRNA of SEQ ID NO: 2 3.0 Caprylic / Capric Triglycerides 3.0 Squalane 5.0 Cetearyl Glucoside 1.5 Sorbitan stearate 0.4 Polysorbate 60 1.2 antiseptic Suitable amount incense Suitable amount Pigment Suitable amount Triethanolamine 0.1 Purified water Balance

Formulation Example 12 Massage Cream

Massage creams may be prepared in a conventional manner according to the composition described in Table 12 below.

Raw material name Content (% by weight) glycerin 8.0 Butylene glycol 4.0 Liquid paraffin 45.0 Beta Glucan 7.0 Carbomer 0.1 MiRNA of SEQ ID NO: 2 1.0 Caprylic / Capric Triglycerides 3.0 Wax 4.0 Cetearyl Glucoside 1.5 Sesqui oleic acid sorbitan 0.9 Vaseline 3.0 antiseptic Suitable amount incense Suitable amount Pigment Suitable amount paraffin 1.5 Purified water Balance

Formulation Example 13 Pack

Packs may be prepared by conventional methods according to the compositions set forth in Table 13 below.

Raw material name Content (% by weight) glycerin 4.0 Polyvinyl alcohol 15.0 Hyaluronic acid extract 5.0 Beta Glucan 7.0 Allantoin 0.1 MiRNA of SEQ ID NO: 2 0.5 Nonyl Phenyl Ether 0.4 Polysorbate 60 1.2 antiseptic Suitable amount incense Suitable amount Pigment Suitable amount ethanol 6.0 Purified water Balance

Formulation Example 14 Ointment

Ointments can be prepared according to the compositions described in Table 14 below in a conventional manner.

Raw material name Content (% by weight) glycerin 8.0 Butylene glycol 4.0 Liquid paraffin 15.0 Beta Glucan 7.0 Carbomer 0.1 MiRNA of SEQ ID NO: 2 1.0 Caprylic / Capric Triglycerides 3.0 Squalane 1.0 Cetearyl Glucoside 1.5 Sorbitan stearate 0.4 Cetearyl Alcohol 1.0 antiseptic Suitable amount incense Suitable amount Pigment Suitable amount Wax 4.0 Purified water Balance

<110> AMOREPACIFIC CORPORATION <120> Composition for regulating expression of pigmentation-related          genes containing microRNA <130> YPD201104-0049 <160> 2 <170> Kopatentin 2.0 <210> 1 <211> 22 <212> RNA <213> Artificial Sequence <220> <223> hsa-mir-203 <400> 1 gugaaauguu uaggaccacu ag 22 <210> 2 <211> 22 <212> RNA <213> Artificial Sequence <220> <223> hsa-mir-203 <400> 2 cuaguggucc uaaacauuuc ac 22

Claims (12)

Pigment forming gene expression control composition comprising miRNA of SEQ ID NO: 1 as an active ingredient. According to claim 1, wherein the miRNA is selected from the nucleotide sequence of SEQ ID NO: 1, Pigment-forming gene expression control composition, characterized in that selected from oligonucleic acid molecules consisting of 15 to 22 consecutive nucleotide sequences including ugaaaug.
The method of claim 1 or claim 2, wherein the pigment-forming gene composition for controlling the expression of the pigment-forming gene, characterized in that selected from the group consisting of tyrosinase, tyrosinase-related protein 1 and the gene expressing melan-A. The method of claim 1 or claim 2, wherein the composition is a composition for controlling the expression of pigment formation genes, characterized in that the cosmetic composition for producing black hair or preventing white hair. The composition of claim 1 or 2, wherein the composition is a pharmaceutical composition for producing black hair or preventing white hair. Pigment forming gene expression control composition having a base sequence complementary to the miRNA of SEQ ID NO: 1, comprising an antisense nucleic acid molecule of SEQ ID NO: 2 that can be hybridized to the miRNA as an active ingredient. The method according to claim 6, wherein the antisense nucleic acid molecule is selected from oligonucleic acid molecules consisting of 15 to 22 consecutive nucleotide sequences selected from the nucleotide sequence of SEQ ID NO: 2, characterized in that the pigmentation can be hybridized to the miRNA Gene expression control composition. The skin whitening composition according to claim 6 or 7, wherein the pigmentation gene is selected from the group consisting of tyrosinase, tyrosinase-related protein 1 and melan-A. The method of claim 6 or 7, wherein the composition is a composition for controlling the expression of pigment formation genes, characterized in that the cosmetic composition for skin whitening. As a method of screening for expression control substances of pigment forming genes for a test substance,
(a) transfecting a cell with a miRNA of SEQ ID NO: 1 or an antisense nucleic acid molecule of SEQ ID NO: 2;
(b) treating the cell with a test substance; And
(c) confirming whether the test substance promotes or inhibits expression of the pigment forming gene;
Expression control material screening method of the pigment-forming gene comprising a. The method of claim 10,
As a result of the check, when the test substance increases the expression, activity or function of the pigment forming gene, the method of screening for expression regulators of the pigment forming gene, characterized in that it further comprises the step of determining the promoter of the pigment forming gene. The method of claim 10,
As a result of the check, when the test substance reduces the expression, activity or function of the pigment forming gene, the method of screening for expression regulators of the pigment forming gene, characterized in that it further comprises the step of determining the expression inhibitor of the pigment forming gene.

Images