KR20120139430A - Composition containing microrna - Google Patents

Composition containing microrna Download PDF

Info

Publication number
KR20120139430A
KR20120139430A KR1020110059227A KR20110059227A KR20120139430A KR 20120139430 A KR20120139430 A KR 20120139430A KR 1020110059227 A KR1020110059227 A KR 1020110059227A KR 20110059227 A KR20110059227 A KR 20110059227A KR 20120139430 A KR20120139430 A KR 20120139430A
Authority
KR
South Korea
Prior art keywords
composition
expression
mirna
seq
gene expression
Prior art date
Application number
KR1020110059227A
Other languages
Korean (ko)
Inventor
김규한
신동욱
이태룡
심중현
최현정
Original Assignee
(주)아모레퍼시픽
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by (주)아모레퍼시픽 filed Critical (주)아모레퍼시픽
Priority to KR1020110059227A priority Critical patent/KR20120139430A/en
Publication of KR20120139430A publication Critical patent/KR20120139430A/en

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C12N15/1137—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against enzymes
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/70—Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7088—Compounds having three or more nucleosides or nucleotides
    • A61K31/7105—Natural ribonucleic acids, i.e. containing only riboses attached to adenine, guanine, cytosine or uracil and having 3'-5' phosphodiester links
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K8/00—Cosmetics or similar toiletry preparations
    • A61K8/18—Cosmetics or similar toiletry preparations characterised by the composition
    • A61K8/30—Cosmetics or similar toiletry preparations characterised by the composition containing organic compounds
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61Q—SPECIFIC USE OF COSMETICS OR SIMILAR TOILETRY PREPARATIONS
    • A61Q19/00—Preparations for care of the skin
    • A61Q19/02—Preparations for care of the skin for chemically bleaching or whitening the skin
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61Q—SPECIFIC USE OF COSMETICS OR SIMILAR TOILETRY PREPARATIONS
    • A61Q5/00—Preparations for care of the hair
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/5005—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/10—Type of nucleic acid
    • C12N2310/14—Type of nucleic acid interfering N.A.
    • C12N2310/141—MicroRNAs, miRNAs

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Molecular Biology (AREA)
  • Biomedical Technology (AREA)
  • Genetics & Genomics (AREA)
  • Veterinary Medicine (AREA)
  • Public Health (AREA)
  • Animal Behavior & Ethology (AREA)
  • Biochemistry (AREA)
  • Immunology (AREA)
  • Biotechnology (AREA)
  • Epidemiology (AREA)
  • Physics & Mathematics (AREA)
  • Organic Chemistry (AREA)
  • Medicinal Chemistry (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • Hematology (AREA)
  • Microbiology (AREA)
  • Urology & Nephrology (AREA)
  • Cell Biology (AREA)
  • Virology (AREA)
  • Food Science & Technology (AREA)
  • Biophysics (AREA)
  • Birds (AREA)
  • Plant Pathology (AREA)
  • Pathology (AREA)
  • General Physics & Mathematics (AREA)
  • Tropical Medicine & Parasitology (AREA)
  • Analytical Chemistry (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Dermatology (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)

Abstract

PURPOSE: A composition containing miRNA for controlling pigmentation gene expression is provided to suppress tyrosinase, tyrosinase-related proteins, and melan-A expression. CONSTITUTION: A composition for controlling pigmentation gene expression contains miRNA containing a base of sequence number 1 as an active ingredient. The miRNA has continuous 27 bases containing ccuucuu of sequence number 1 and a base which suppresses pigmentation gene expression. The pigmentation gene is tyrosinase, tyrosinase-related protein 1, or melan-A gene. The miRNA targets 909-915th nucleic acids of melan A mRNA 3'-UTR. The composition is a cosmetic or pharmaceutical composition for skin whitening. A composition for controlling pigmentation gene expression contains a complementary base with miRNA of sequence number 1. [Reference numerals] (AA) Relative TYR/GAPDH mRNA expression level; (BB) Comparative embodiment 1; (CC) Comparative embodiment 2; (DD) Embodiment 1

Description

마이크로 ＲＮＡ를 포함하는 조성물{Composition containing microRNA}Composition containing micro RNA {Composition containing microRNA}

본 발명은 마이크로 RNA(microRNA; 이하 ‘miRNA’라 함)인 miRNA-1248 및 이를 함유하는 조성물에 관한 것으로서, 보다 구체적으로는 미백효과 또는 진피세포 재생 기능의 miRNA-1248의 모방체, 또는 백모 방지 또는 흑모 생성 효능을 가지는 miRNA-1248의 저해제, 또는 이를 함유하는 조성물에 관한 것이다.
The present invention relates to miRNA-1248, which is a microRNA (hereinafter referred to as 'miRNA'), and a composition containing the same, more specifically, to mimic miRNA-1248 having a whitening effect or dermal cell regeneration function, or to prevent white hair. Or an inhibitor of miRNA-1248 having a biotide producing effect, or a composition containing the same.

miRNA는 세포 내에 존재하는 20~25핵산(nucleotide) 길이의 작은 RNA(endogenous small RNA)의 일종으로서 단백질을 합성하지 않는 DNA에서 유래된 헤어핀-구조 전사체(hairpin-shaped transcript)로부터 생성된다. miRNA는 표적 mRNA의 3'-UTR(untranslated region)의 상보적인 염기서열에 결합하여 그 mRNA의 번역 억제 또는 불안정화를 유도하고, 궁극적으로 그 표적 mRNA의 단백질 합성을 억제하는 리프레서(repressor) 역할을 하게 된다. 하나의 miRNA는 여러 개의 mRNA를 타겟팅하며, mRNA 역시 여러 개의 miRNA에 의해 조절될 수 있다고 알려져 있다.miRNAs are a type of endogenous small RNA of 20-25 nucleotides in the cell and are produced from hairpin-shaped transcripts derived from DNA that does not synthesize proteins. miRNA binds to the complementary nucleotide sequence of the 3'-UTR (untranslated region) of the target mRNA, induces translation inhibition or destabilization of the mRNA, and ultimately serves as a repressor to inhibit protein synthesis of the target mRNA. Done. One miRNA targets several mRNAs, and mRNA is also known to be regulated by several miRNAs.

현재 miRNA는 발달 시기, 세포사멸사, 지방 신진대사 및 조혈 세포 분화의 조절을 포함하는 여러 생물학적 과정에서 매우 중요한 역할을 하는 것으로 알려짐에 따라 생명과학분야에서 매우 큰 관심을 받고 있다. 하지만 암 등의 질병이나 발생 과정에서의 miRNA의 기능연구는 상당히 진행된 것에 비해 상대적으로 피부과학에서의 miRNA 역할에 대한 연구는 비교적 적은 상태이다. 최근 miR-203이 각질형성세포(keratinocyte)에서 p63 mRNA를 타겟팅함으로써 분화능력을 억제한다는 보고와 miR-125b가 피부줄기세포의 분화를 억제하며 각질형성세포의 분열을 억제한다는 보고는 있지만, 그 외의 피부관련 특이적 miRNA와 기능에 대해선 거의 알려져 있지 않다. 하지만 miR-203과 miR-125b 외에도 여러 특정 miRNA가 피부에서도 생물학적으로 중요한 역할을 담당할 것으로 충분히 예측이 된다. 또한 miRNA는 생물학적 마커 및 소재 등 다양한 분야에서 응용이 가능하기 때문에 피부에서 miRNA의 연구는 화장품 및 의약산업 등에 다양한 적용이 가능할 것으로 판단된다.Currently, miRNAs are of great interest in the life sciences, as they are known to play an important role in many biological processes, including control of developmental time, apoptosis, fat metabolism and hematopoietic cell differentiation. However, studies on the function of miRNAs in diseases such as cancer and development have progressed considerably, while studies on the role of miRNAs in dermatology have been relatively rare. Recently, miR-203 suppresses the differentiation ability by targeting p63 mRNA in keratinocytes and miR-125b inhibits the differentiation of skin stem cells and inhibits the division of keratinocytes. Little is known about skin-specific miRNAs and functions. However, in addition to miR-203 and miR-125b, it is predicted that several specific miRNAs will play a biologically important role in the skin. In addition, since miRNA can be applied in various fields such as biological markers and materials, it is expected that the research of miRNA in the skin can be applied to cosmetics and pharmaceutical industries.

한편, 피부는 크게 표피층(epidermis)과 진피층(dermis)으로 나뉜다. 표피층에는 색소형성세포(melanocyte)가 존재하며, 색소형성세포는 색소(melanin)를 합성하여 피부 고유의 색을 나타나게 한다. 피부 색소를 조절하는 생물학적 인자들은 크게 색소형성세포에서 멜라노솜(melanosome)을 만드는 요소와 멜라노솜(melanosome)을 운반하는 요소로 크게 나뉠 수 있다. 멜라노솜(melanosome)을 만드는 요소에서 가장 잘 알려진 인자는 티로시나아제(tyrosinase, TYR), 티로시나아제 관련 단백질 1(tyrosinase-related protein 1, TYRP1), 도파크롬 타토모라제(dopachrome tautomerase, DCT) 및 멜란-A(melan-A; T 세포에 의해 인식되는 멜라노마 항원) 등이 있으며, 멜라노솜(melanosome) 운반에 관여하는 요소로는 Rab27a 등이 알려져 있으며, 최근엔 PAX3, MITF 등의 전사인자들도 색소조절 과정에 참여하는 것으로 알려져 있다. 따라서 이들 색소조절 인자들은 피부미백, 흑모색성 그리고 백모방지 등의 중요한 타겟이 된다.On the other hand, the skin is largely divided into epidermis (epidermis) and dermis (dermis). Pigmentation cells (melanocytes) are present in the epidermal layer, and the pigmentation cells synthesize a pigment (melanin) to show the unique color of the skin. Biological factors that control skin pigments can be broadly divided into elements that make melanosomes and those that carry melanosomes in pigmented cells. The most well-known factors in making melanosomes are tyrosinase (TYR), tyrosinase-related protein 1 (TYRP1), and dopachrome tautomerase (DCT). And melan-A (melanoma antigen recognized by T cells), Rab27a, and the like, which are involved in the melanosome transport, are known, and recently, transcription factors such as PAX3 and MITF. It is also known to participate in the pigment control process. Therefore, these pigment control factors are important targets such as skin whitening, darkening and anti-whitening.

또한, 진피층은 섬유아세포(fibroblast)에서 만들어지는 콜라겐(collagen)으로 채워져 있다. 섬유아세포는 피부에 상처가 났을 때 분열과 그 이동성이 크게 증가되고 세포외 기질(extracellular matrix)을 재합성하게 된다. 이러한 세포재생은 매우 복잡한 과정을 통해 이뤄지게 되는데, 최근 miR-21이 폐(lung)의 섬유아세포의 이러한 세포재생에 관여한다는 논문이 발표되기도 하였다.
The dermal layer is also filled with collagen made from fibroblasts. When fibroblasts are wounded on the skin, fission and mobility are greatly increased and the extracellular matrix is resynthesized. This cell regeneration is a very complex process. Recently, a paper has been published that miR-21 is involved in the regeneration of lung fibroblasts.

본 발명자는 피부의 표피층 및 진피층에서 색소형성, 진피세포 재생 등에 관여하는 마이크로 RNA를 찾는 연구를 진행하였고, 그 결과 hsa-miR-1248이 색소형성에 관련된 유전자 및 섬유아세포의 이동성 및 세포이동성과 관련된 유전자의 발현을 조절함을 밝혔다.The present inventors conducted a study to find micro RNAs involved in pigmentation, dermal cell regeneration, etc. in the epidermal and dermal layers of the skin. It regulates the expression of genes.

따라서, 본 발명은 miRNA-1248 기능의 모방체(mimic)를 포함하여 미백효과를 가지는 조성물을 제공하는 것을 목적으로 한다.Accordingly, an object of the present invention is to provide a composition having a whitening effect including a mimic of miRNA-1248 function.

또한, 본 발명은 miRNA-1248 기능의 저해제(inhibitor)를 포함하여 백모 방지 또는 흑모 생성 촉진 효과를 가지는 조성물을 제공하는 것을 목적으로 한다.In addition, an object of the present invention is to provide a composition having an inhibitory effect of miRNA-1248 function (inhibitor) having a white hair prevention or black hair production promoting effect.

또한, 본 발명은 miRNA-1248 기능의 모방체(mimic)를 포함하여 진피세포 재생 효과를 가지는 조성물을 제공하는 것을 목적으로 한다.
In addition, an object of the present invention is to provide a composition having a dermal cell regeneration effect, including mimic mimi-1248 function (mimic).

상기한 목적을 달성하기 위하여, 본 발명은 서열번호 1의 miRNA를 유효성분으로 함유하는 색소형성 유전자 발현 조절용 조성물을 제공한다.In order to achieve the above object, the present invention provides a composition for controlling pigmentation gene expression containing miRNA of SEQ ID NO: 1 as an active ingredient.

또한, 본 발명은 서열번호 1의 miRNA에 상보적인 염기서열을 갖고, 상기 miRNA에 하이브리드될 수 있는 서열번호 2의 안티센스 핵산 분자를 유효성분으로 함유하는 색소형성 유전자 발현 조절용 조성물을 제공한다.The present invention also has a nucleotide sequence complementary to the miRNA of SEQ ID NO: 1, and provides a composition for controlling pigmentation gene expression containing an antisense nucleic acid molecule of SEQ ID NO: 2 that can be hybridized to the miRNA as an active ingredient.

또한, 본 발명은 서열번호 1의 miRNA를 유효성분으로 함유하는 진피세포 재생 관련 유전자 발현 조절용 조성물을 제공한다.The present invention also provides a composition for regulating dermal cell regeneration-related gene expression containing the miRNA of SEQ ID NO: 1 as an active ingredient.

또한, 본 발명은 (a) 서열번호 1의 miRNA 또는 서열번호 2의 안티센스 핵산 분자를 세포에 트랜스펙션시키는 단계; (b) 상기 세포에 시험 물질을 처리하는 단계; 및 (c) 상기 시험물질이 색소형성 유전자의 발현을 촉진하는지 또는 억제하는지 여부를 확인하는 단계;를 포함하는 색소형성 유전자 발현을 조절하는 물질을 스크리닝하는 방법을 제공한다.In addition, the present invention comprises the steps of (a) transfecting a cell with a miRNA of SEQ ID NO: 1 or an antisense nucleic acid molecule of SEQ ID NO: 2; (b) treating the cell with the test substance; And (c) confirming whether the test substance promotes or inhibits the expression of the pigmentation gene. It provides a method for screening a substance that controls the expression of the pigmentation gene.

또한 본 발명은 (a) 서열번호 1의 miRNA를 세포에 트랜스펙션시키는 단계; (b) 상기 세포에 시험 물질을 처리하는 단계; 및 (c) 상기 시험물질이 진피세포의 이동성 조절 관련 유전자의 발현을 촉진하는지 또는 억제하는지 여부를 확인하는 단계;를 포함하는 진피세포의 재생을 촉진하는 물질을 스크리닝하는 방법을 제공한다.
In another aspect, the present invention (a) transfecting a cell with a miRNA of SEQ ID NO: 1; (b) treating the cell with a test substance; And (c) confirming whether the test substance promotes or inhibits expression of genes related to mobility control of dermal cells. It provides a method for screening a substance for promoting regeneration of dermal cells.

본 발명이 제공하는 miRNA는 has-miR-1248 발현의 촉진제 또는 저해제로서 사용되어, 색소형성 유전자인 티로시아나제, 티로시나아제 관련 단백질 1, 멜란-A 및 진피세포의 이동성 관련 유전자인 트로포미오신 3과 아그레칸의 발현을 조절함으로써 우수한 미백효과, 백모 방지 또는 흑모 생성효과, 및 진피세포 재생 효과를 제공할 수 있다.
The miRNA provided by the present invention is used as an accelerator or inhibitor of has-miR-1248 expression, and is a pigmentation gene tyrosianase, tyrosinase-related protein 1, melan-A and tropomyosin, a gene related to mobility of dermal cells. By regulating the expression of 3 and aggrecan, it is possible to provide an excellent whitening effect, prevention of white hair or formation of black hair, and dermal cell regeneration.

도 1은 hsa-miR-1248과 동일한 서열을 갖는 올리고핵산(oligonucleotide)을 세포 내로 주입하여 hsa-miR-1248의 과발현 현상(overexpression)을 유도하고, 실시간(real-time) PCR을 수행하여 티로시나아제 mRNA의 발현량을 확인한 결과를 나타낸 것이다(TYR: 티로시나아제).
도 2는 hsa-miR-1248과 동일한 서열을 갖는 올리고핵산(oligonucleotide)을 세포 내로 주입하여 hsa-miR-1248의 과발현 현상(overexpression)을 유도하고, 웨스턴 블럿을 수행하여 티로시나아제 단백질의 발현량을 확인한 결과를 나타낸 것이다(TYR: 티로시나아제).
도 3은 hsa-miR-1248과 동일한 서열을 갖는 올리고핵산(oligonucleotide)을 세포 내로 주입하여 hsa-miR-1248의 과발현 현상(overexpression)을 유도하고, 실시간(real-time) PCR을 수행하여 티로시나아제 관련 단백질 1 mRNA의 발현량을 확인한 결과를 나타낸 것이다(TYRP1: 티로시나아제 관련 단백질 1).
도 4는 hsa-miR-1248과 동일한 서열을 갖는 올리고핵산(oligonucleotide)을 세포 내로 주입하여 hsa-miR-1248의 과발현 현상(overexpression)을 유도하고, 실시간(real-time) PCR을 수행하여 멜란-A mRNA의 발현량을 확인한 결과를 나타낸 것이다.
도 5는 targetScan(www.targetscan.org) 사이트를 이용하여 hsa-miR-1248의 멜란-A에 대한 결합 가능성을 확인하고, hsa-miR-1248이 멜란-A mRNA 3'-UTR에 결합할 수 있는 부위를 박스로 표시하였다.
도 6은 hsa-miR-1248과 동일한 서열을 갖는 올리고핵산(oligonucleotide)을 세포 내로 주입하여 hsa-miR-1248의 과발현 현상(overexpression)을 유도하고, 상처 치유 분석법(wound-healing assay)을 통하여 상처에 세포들이 재생을 유도하는지를 현미경으로 관찰한 결과를 나타낸 것이다.
도 7은 hsa-miR-1248과 동일한 서열을 갖는 올리고핵산(oligonucleotide)을 세포 내로 주입하여 hsa-miR-1248의 과발현 현상(overexpression)을 유도하고, 실시간(real-time) PCR을 수행하여 트로포미오신(tropomyosin) 3 mRNA의 발현량을 확인한 결과를 나타낸 것이다(TPM3: 트로포미오신 3).
도 8은 hsa-miR-1248과 동일한 서열을 갖는 올리고핵산(oligonucleotide)을 세포 내로 주입하여 hsa-miR-1248의 과발현 현상(overexpression)을 유도하고, 실시간(real-time) PCR을 수행하여 아그레칸 mRNA의 발현량을 확인한 결과를 나타낸 것이다(ACAN: 아그레칸).
도 9는 targetScan(www.targetscan.org) 사이트를 이용하여 hsa-miR-1248의 트로포미오신 3 mRNA에 대한 결합 가능성을 확인하고, hsa-miR-1248이 트로포미오신 3 mRNA 3'-UTR에 결합할 수 있는 부위를 표시하였다(TPM3: 트로포미오신 3).
도 10은 targetSca(www.targetscan.org) 사이트를 이용하여 hsa-miR-1248의 아그레칸(aggrecan) mRNA에 대한 결합 가능성을 확인하고, hsa-miR-1248이 아그레칸 mRNA 3'-UTR에 결합할 수 있는 부위를 박스로 표시하였다.Figure 1 shows the injection of oligonucleotides having the same sequence as hsa-miR-1248 into cells to induce overexpression of hsa-miR-1248 and perform real-time PCR to perform tyrosina It shows the result of confirming the expression level of the kinase mRNA (TYR: tyrosinase).
Figure 2 is injected into the cell oligonucleotide having the same sequence as hsa-miR-1248 to induce overexpression of hsa-miR-1248, Western blot to perform the expression of tyrosinase protein expression It shows the result of confirming (TYR: tyrosinase).
FIG. 3 shows an overexpression of hsa-miR-1248 by injecting an oligonucleotide having the same sequence as hsa-miR-1248 into cells, and performing real-time PCR to perform tyrosina The result of confirming the expression level of the azeoprotein 1 mRNA is shown (TYRP1: tyrosinase-related protein 1).
Figure 4 is injected into the cell oligonucleotide having the same sequence as hsa-miR-1248 to induce overexpression of hsa-miR-1248, by performing real-time PCR to Melan- The result of confirming the expression level of A mRNA is shown.
5 shows the possibility of binding hsa-miR-1248 to melan-A using the targetScan (www.targetscan.org) site, and hsa-miR-1248 can bind to melan-A mRNA 3′-UTR. The site in question is marked with a box.
FIG. 6 shows an overexpression of hsa-miR-1248 by injecting an oligonucleotide having the same sequence as hsa-miR-1248 into a cell and wounding through a wound-healing assay. Microscopic observations show whether cells induce regeneration.
FIG. 7 induces overexpression of hsa-miR-1248 by injecting oligonucleotides having the same sequence as hsa-miR-1248 into cells, and performing real-time PCR to tropomyosin (tropomyosin) 3 shows the result of confirming the expression level of mRNA (TPM3: tropomyosin 3).
FIG. 8 shows an overexpression of hsa-miR-1248 by injecting an oligonucleotide having the same sequence as hsa-miR-1248 into a cell and performing real-time PCR to perform agre It shows the result of confirming the expression level of the cannes mRNA (ACAN: agrecan).
Figure 9 confirms the binding potential of hsa-miR-1248 to tropomyosin 3 mRNA using the targetScan (www.targetscan.org) site, hsa-miR-1248 to bind to tropomyosin 3 mRNA 3'-UTR Possible sites are indicated (TPM3: tropomyosin 3).
10 shows the possibility of binding to agrecan mRNA of hsa-miR-1248 using targetSca (www.targetscan.org) site, and hsa-miR-1248 is agrecan mRNA 3′-UTR. The sites that can bind to are marked with a box.

본 발명은 하기와 같은 서열번호 1의 hsa-miR-1248 miRNA를 제공하며, 이는 색소형성 유전자의 발현을 조절한다.The present invention provides the hsa-miR-1248 miRNA of SEQ ID NO: 1, which regulates the expression of the pigmentation gene.

5'- accuucuuguauaagcacugugcuaaa -3' (서열번호 1)5'- accuucuuguauaagcacugugcuaaa -3 '(SEQ ID NO: 1)

본 발명에서 사용되는 miRNA는 상기 서열번호 1의 염기서열을 가지며, ccuucuu를 포함하는 27개의 연속적인 염기서열로 이루어지는 올리고핵산 분자이다. 또한, 본 발명에서 사용되는 miRNA는 서열번호 1의 염기서열을 포함하는 서열로서, 색소형성 유전자들의 발현을 조절하는 기능을 수행하는 것들을 포함할 수 있다.The miRNA used in the present invention is an oligonucleic acid molecule having the nucleotide sequence of SEQ ID NO: 1 and consisting of 27 consecutive nucleotide sequences including ccuucuu. In addition, the miRNA used in the present invention is a sequence comprising the nucleotide sequence of SEQ ID NO: 1, and may include those that perform a function of controlling the expression of pigmentation genes.

본 발명의 일 실시예에서, 서열번호 1의 miRNA는 색소형성 유전자의 발현을 조절하며, 특히 티로시나아제(tyrosinase, TYR), 티로시나아제 관련 단백질 1(tyrosinase-related protein 1, TYRP1) 및 멜란-A(melan-A)의 발현을 억제한다. 또한, 상기 miRNA는 멜란-A mRNA의 3'-UTR(untranslated region)에 결합 부위를 가지고, 멜란-A mRNA의 3'-UTR에서 909~915번째 핵산 분자를 표적으로 하여, 멜란-A의 발현을 억제시킬 수 있다.In one embodiment of the invention, the miRNA of SEQ ID NO: 1 regulates the expression of the pigmentation gene, in particular tyrosinase (TYR), tyrosinase-related protein 1 (TYRP1) and melan Inhibits the expression of melan-A. In addition, the miRNA has a binding site in the 3'-UTR (untranslated region) of the melan-A mRNA, targeting the 909-915 nucleic acid molecules in the 3'-UTR of the melan-A mRNA, expression of melan-A Can be suppressed.

본 발명의 일 실시예에서, 서열번호 1의 miRNA를 이용하여 hsa-miR-1248의 모방체(mimic)로서 hsa-miR-1248과 동일한 서열을 갖는 올리고핵산 분자(oligonucleotide)를 제작할 수 있다. 또한, hsa-miR-1248의 모방체(mimic)는 서열번호 1의 서열을 포함하여 상기 hsa-miR-1248의 염기서열과 유사한 서열을 갖는 촉진제(stimulator)로서, 색소형성 유전자들의 발현을 조절하는 기능을 수행하는 것들을 포함할 수 있다.In one embodiment of the present invention, oligonucleotide molecules having the same sequence as hsa-miR-1248 as mimics of hsa-miR-1248 can be prepared using miRNA of SEQ ID NO: 1. In addition, mimic of hsa-miR-1248 is a stimulator having a sequence similar to the nucleotide sequence of hsa-miR-1248 including the sequence of SEQ ID NO: 1, and controls the expression of pigmentation genes. It may include those that perform a function.

또한, 본 발명의 일 실시예는 서열번호 1의 miRNA에 상보적인 염기서열을 갖는 안티 센스 핵산 분자로서, 서열번호 1의 miRNA에 하이브리드될 수 있는 것을 특징으로 하는 하기 서열번호 2의 핵산 분자를 제공한다. 서열번호 2의 안티센스 핵산 분자는 hsa-miR-1248의 저해제(inhibitor)로서 서열번호 1의 miRNA에 하이브리드될 수 있는 것이다. 또한, hsa-miR-1248의 저해제는 하기 서열번호 2의 염기서열을 포함하는 서열로서, 서열번호 1의 miRNA에 하이브리드될 수 있는 것들을 포함할 수 있다.In addition, an embodiment of the present invention is an antisense nucleic acid molecule having a nucleotide sequence complementary to the miRNA of SEQ ID NO: 1, it provides a nucleic acid molecule of SEQ ID NO: 2, characterized in that it can be hybridized to the miRNA of SEQ ID NO: do. The antisense nucleic acid molecule of SEQ ID NO: 2 can be hybridized to the miRNA of SEQ ID NO: 1 as an inhibitor of hsa-miR-1248. In addition, the inhibitor of hsa-miR-1248 as a sequence comprising the nucleotide sequence of SEQ ID NO: 2, may include those that can be hybridized to the miRNA of SEQ ID NO: 1.

5'- uuuagcacagugcuuauacaagaaggu -3'(서열번호 2)5'- uuuagcacagugcuuauacaagaaggu -3 '(SEQ ID NO: 2)

본 발명에서 사용되는 miRNA는 상기 서열번호 2의 염기서열을 가지며, 27개의 연속적인 염기서열로 이루어지는 올리고핵산 분자이다. 또한, 본 발명에서 사용되는 miRNA는 서열번호 2의 염기서열을 포함하는 서열로서, 서열번호 1의 miRNA에 하이브리드될 수 있는 것들을 포함할 수 있으며, 또한 색소형성 유전자들의 발현을 조절, 특히 색소형성 유전자들의 발현을 증가시키는 기능을 수행하는 것들을 포함할 수 있다.The miRNA used in the present invention is an oligonucleic acid molecule having the nucleotide sequence of SEQ ID NO: 2 and consisting of 27 consecutive nucleotide sequences. In addition, the miRNA used in the present invention is a sequence comprising the nucleotide sequence of SEQ ID NO: 2, may include those that can be hybridized to the miRNA of SEQ ID NO: 1, and also regulates the expression of pigmentation genes, in particular pigmentation genes May include those that perform a function of increasing their expression.

또한, 본 발명은 하기와 같은 서열번호 1의 hsa-miR-1248 miRNA를 제공하며, 이는 진피세포 재생 조절 유전자의 발현을 조절한다.In addition, the present invention provides the hsa-miR-1248 miRNA of SEQ ID NO: 1, which regulates the expression of dermal cell regeneration regulatory genes.

5'- accuucuuguauaagcacugugcuaaa -3' (서열번호 1)5'- accuucuuguauaagcacugugcuaaa -3 '(SEQ ID NO: 1)

본 발명에서 사용되는 miRNA는 상기 서열번호 1의 염기서열을 가지며, ccuucuu를 포함하는 27개의 연속적인 염기서열로 이루어지는 올리고핵산 분자이다. 또한, 본 발명에서 사용되는 miRNA는 서열번호 1의 염기서열을 포함하는 서열로서, 진피세포 재생과 관련된 섬유아세포의 이동성을 조절하는 기능을 수행하는 것들을 포함할 수 있다. The miRNA used in the present invention is an oligonucleic acid molecule having the nucleotide sequence of SEQ ID NO: 1 and consisting of 27 consecutive nucleotide sequences including ccuucuu. In addition, the miRNA used in the present invention is a sequence comprising the nucleotide sequence of SEQ ID NO: 1, may include those that perform the function of controlling the mobility of fibroblasts associated with dermal cell regeneration.

본 발명의 일 실시예에서, 서열번호 1의 miRNA는 섬유아세포의 진피세포 재생을 증가시킬 수 있으며, 특히 이동성 관련 유전자인 트로포미오신 3(tropomyosin 3)과 아그레칸(aggrecan)의 발현을 억제한다. In one embodiment of the present invention, the miRNA of SEQ ID NO: 1 may increase dermal cell regeneration of fibroblasts, and in particular inhibits the expression of tropomyosin 3 and agrecan, mobility-related genes .

또한, 상기 miRNA는 트로포미오신 3 mRNA의 3'-UTR(untranslated region)에 결합 부위를 가지고, 트로포미오신 3 mRNA의 3'-UTR에서 239~245 번째 핵산 분자를 표적으로 하여, 트로포미오신 3의 발현을 억제시킬 수 있다. 또한, 상기 miRNA는 아그레칸 mRNA의 3'-UTR(untranslated region)에 결합 부위를 가지고, 아그레칸 mRNA의 3'-UTR에서 118~124번째 핵산 분자를 표적으로 하여, 아그레칸의 발현을 억제시킬 수 있다.In addition, the miRNA has a binding site in the 3'-UTR (untranslated region) of the tropomyosin 3 mRNA, targeting the 239-245 nucleic acid molecules in the 3'-UTR of the tropomyosin 3 mRNA, expression of tropomyocin 3 Can be suppressed. In addition, the miRNA has a binding site in the 3'-UTR (untranslated region) of the aggrecan mRNA, targeting the 118th to 124th nucleic acid molecule in the 3'-UTR of the aggrecan mRNA, expression of aggrecan Can be suppressed.

본 발명의 일 실시예에서, 서열번호 1의 miRNA를 이용하여 hsa-miR-1248의 모방체(mimic)로서 hsa-miR-1248과 동일한 서열을 갖는 올리고핵산 분자(oligonucleotide)를 제작할 수 있다. 또한, hsa-miR-1248의 모방체(mimic)는 서열번호 1의 서열을 포함하여 상기 hsa-miR-1248의 염기서열과 유사한 서열을 갖는 촉진제(stimulator)로서, 진피세포 재생을 촉진하는 기능을 수행하는 것들을 포함할 수 있다.In one embodiment of the present invention, oligonucleotide molecules having the same sequence as hsa-miR-1248 as mimics of hsa-miR-1248 can be prepared using miRNA of SEQ ID NO: 1. In addition, mimic of hsa-miR-1248 is a stimulator having a sequence similar to that of hsa-miR-1248 including the sequence of SEQ ID NO: 1, and has a function of promoting dermal cell regeneration. It may include those that perform.

본 발명은 서열번호 1의 miRNA, 서열번호 2의 안티센스 핵산 분자, 또는 서열번호 1 또는 2의 염기서열을 포함하는 올리고핵산을 유효성분으로 함유하는 조성물을 제공한다. 상기 조성물은 색소형성 유전자들의 발현을 조절할 수 있으며, 또한 진피세포 재생을 촉진할 수 있다.The present invention provides a composition containing an oligonucleotide comprising the miRNA of SEQ ID NO: 1, the antisense nucleic acid molecule of SEQ ID NO: 2, or the nucleotide sequence of SEQ ID NO: 1 or 2 as an active ingredient. The composition can regulate the expression of pigmentation genes and can also promote dermal cell regeneration.

본 발명에 있어서, 사용되는 miRNA, 안티센스 핵산 분자 또는 올리고핵산은 조성물 총 중량에 대하여 0.00001~30.0중량%의 양으로 사용될 수 있다.In the present invention, the miRNA, antisense nucleic acid molecule or oligonucleic acid to be used may be used in an amount of 0.00001 to 30.0% by weight based on the total weight of the composition.

구체적으로, 서열번호 1의 miRNA 또는 서열번호 1의 염기서열을 포함하는 올리고핵산을 포함하는 조성물은 색소형성 유전자, 특히 티로시나아제, 티로시나아제 관련 단백질 1 및 멜란-A의 발현을 억제함으로써 피부 미백 효과를 제공할 수 있다. Specifically, a composition comprising an oligonucleic acid comprising a miRNA of SEQ ID NO: 1 or a nucleotide sequence of SEQ ID NO: 1 may inhibit skin expression by inhibiting the expression of pigmentation genes, in particular tyrosinase, tyrosinase related protein 1 and melan-A. It can provide a whitening effect.

또한 서열번호 2의 miRNA 또는 서열번호 2의 염기서열을 포함하는 올리고핵산을 포함하는 조성물은 색소형성 유전자, 특히 티로시나아제, 티로시나아제 관련 단백질 1 및 멜란-A의 발현을 촉진함으로써 백모 방지 또는 흑모 생성 효과를 제공할 수 있다.In addition, a composition comprising an oligonucleic acid comprising a miRNA of SEQ ID NO: 2 or a nucleotide sequence of SEQ ID NO: 2 may be used to prevent white hair by promoting expression of pigmentation genes, in particular tyrosinase, tyrosinase-related protein 1 and melan-A. It can provide a black hair generating effect.

또한, 서열번호 1의 miRNA 또는 서열번호 1의 염기서열을 포함하는 올리고핵산을 포함하는 조성물은 진피세포 재생과 관련된 유전자, 특히 트로포미오신 3과 아그레칸의 발현을 억제함으로써 진피세포 재생을 촉진할 수 있다.In addition, a composition comprising an oligonucleic acid comprising a miRNA of SEQ ID NO: 1 or a nucleotide sequence of SEQ ID NO: 1 may promote dermal cell regeneration by inhibiting expression of genes related to dermal cell regeneration, particularly tropomyocin 3 and agrecan. Can be.

본 발명의 조성물은 제형 형태가 특별히 한정되지 않지만, 바람직하게는 화장료 조성물 또는 약학 조성물 등의 형태로 제형화될 수 있다.The composition of the present invention is not particularly limited in the form of a formulation, but may be preferably formulated in the form of a cosmetic composition or a pharmaceutical composition.

본 발명의 일 실시예에서, 본 발명의 조성물이 화장료 조성물인 경우에는 화장품학적으로 허용가능한 매질 또는 기제를 함유한다. 이는 국소적용에 적합한 모든 제형으로, 예를 들면 용액, 겔, 고체 또는 반죽 무수 생성물, 수상에 유상을 분산시켜 얻은 에멀젼, 현탁액, 마이크로에멀젼, 마이크로캡슐, 미세과립구 또는 이온형(리포좀) 및/또는 비이온형의 소낭 분산제의 형태로, 또는 크림, 스킨, 로션, 파우더, 연고, 스프레이 또는 콘실 스틱의 형태로 제공될 수 있다. 이들 조성물은 당해 분야의 통상적 방법에 따라 제조될 수 있다.In one embodiment of the present invention, when the composition of the present invention is a cosmetic composition, it contains a cosmetically acceptable medium or base. It may be in any form suitable for topical application, for example as a solution, a gel, a solid or a paste anhydrous product, an emulsion obtained by dispersing an oil phase in water, a suspension, a microemulsion, a microcapsule, a microgranule or an ionic form (liposome) and / In the form of a non-ionic follicle dispersing agent, or in the form of creams, skins, lotions, powders, ointments, sprays or conical sticks. These compositions may be prepared according to conventional methods in the art.

본 발명의 일 실시예에서, 본 발명의 조성물이 약학 조성물인 경우에는 서열번호 1의 miRNA 또는 서열번호 2인 안티센스 핵산 분자, 또는 서열번호 1 또는 2의 염기서열을 포함하는 올리고핵산을 유효성분으로 하고 상용되는 무기 또는 유기의 담체를 가하여 고체, 반고체 또는 액상의 형태인 주사, 경피 투여 또는 외용 도포용의 비경구 투여제로 제형화할 수 있다. 비경구 투여를 위한 제재로는 국소 주사용 제제, 연고, 로션, 스프레이, 현탁제 등이 포함된다.In one embodiment of the present invention, when the composition of the present invention is a pharmaceutical composition, the oligonucleotide comprising the miRNA of SEQ ID NO: 1 or the antisense nucleic acid molecule of SEQ ID NO: 2, or the nucleotide sequence of SEQ ID NO: 1 or 2 as an active ingredient And a commercially available inorganic or organic carrier may be added and formulated into a parenteral dosage form for injection, transdermal administration or external application in solid, semisolid or liquid form. Preparations for parenteral administration include topical injection preparations, ointments, lotions, sprays, suspensions and the like.

본 발명의 일 실시예에 따른 조성물의 유효성분을 제제화하기 위해서는 통상의 방법에 따라서 실시하면 용이하게 제제화할 수 있으며 계면활성제, 부형제, 착색료, 향신료, 보존료, 안정제, 완충제, 현탁제, 기타 상용하는 보조제를 적당히 사용할 수 있다.In order to formulate the active ingredient of the composition according to an embodiment of the present invention can be easily formulated according to a conventional method, surfactants, excipients, coloring agents, spices, preservatives, stabilizers, buffers, suspensions, other commercial Adjuvants may be used as appropriate.

본 발명의 일 실시예에 따른 miRNA의 투여량은 치료 받을 대상의 연령, 성별, 체중과, 치료할 특정 질환 또는 병리 상태, 질환 또는 병리 상태의 심각도, 투여경로 및 처방자의 판단에 따라 달라질 것이다. 이러한 인자에 기초한 투여량 결정은 당업자의 수준 내에 있으며, 주사제를 제외한 제재에 대해서는 도포가 필요한 부위(즉, 미백 효과, 백모 방지 또는 흑모 생성 효과, 또는 진피세포 재생 효과를 제공하고자 하는 부위)에 외용 도포하는 식으로 당업자의 수준에서 적용할 수 있고, 주사제의 경우에는 투여가 필요한 피부 부위에 국소적으로 주사할 수 있다. The dosage of miRNA according to an embodiment of the present invention will vary depending on the age, sex, and weight of the subject to be treated, the specific disease or pathology to be treated, the severity of the disease or pathology, the route of administration, and the judgment of the prescriber. Dosage determination based on these factors is within the level of one of ordinary skill in the art and externally applied to the site where application is required for the formulations other than injections (i.e., to provide a whitening effect, prevention of white hair or black hair formation, or dermal cell regeneration). It can be applied at the level of those skilled in the art by application, and in the case of injection, it can be injected locally to the skin area in need of administration.

본 발명의 miRNA는, 변형된 핵산 분자로 이루어질 수도 있다. 예컨대, 2'-O-알킬(예: 메틸, 에틸), 2'-O-알릴, 2'-O-알릴과 같은 2'-치환된 라이보스를 포함하는 핵산 분자를 부분적으로 또는 전체적으로 포함할 수 있다. 또한, 치환된 염기를 갖는 핵산 분자를 부분적으로 또는 전체적으로 포함할 수도 있다.The miRNA of the present invention may be composed of modified nucleic acid molecules. Partially or wholly comprise a nucleic acid molecule comprising 2'-substituted ribose such as, for example, 2'-0-alkyl (e.g. methyl, ethyl), 2'-0-allyl, 2'-0-allyl. Can be. It may also comprise partially or wholly nucleic acid molecules with substituted bases.

본 발명의 일 실시예는, 시험물질에 대한 색소형성 유전자의 발현을 조절하는 물질을 스크리닝하는 방법으로서, (a) 서열번호 1의 miRNA를 세포에 트랜스펙션시키는 단계; (b) 상기 세포에 시험 물질을 처리하는 단계; 및 (c) 상기 시험물질이 색소형성 유전자의 발현을 증가시키는지 또는 억제하는지 여부를 확인하는 단계;를 포함하는 것을 특징으로 하는 색소형성 유전자의 발현 조절 물질 스크리닝 방법을 제공한다.An embodiment of the present invention, a method for screening a substance for controlling the expression of the pigmentation gene for a test substance, comprising the steps of: (a) transfecting a cell with a miRNA of SEQ ID NO: 1; (b) treating the cell with the test substance; And (c) confirming whether the test substance increases or inhibits expression of the pigmentation gene. It provides a method for screening an expression control substance of a pigmentation gene comprising a.

상기 서열번호 1의 miRNA를 세포에 트랜스펙션시키는 단계에 있어서, 상기 트랜스펙션은 미세 주입법, 칼슘 포스페이트 공동-침전법, 전기 천공법 또는 리포좀 이용법 등을 이용하여 실시할 수 있으나, 이에 한정되는 것은 아니다.In the step of transfecting the miRNA of SEQ ID NO: 1 into the cell, the transfection may be performed using a micro-injection method, calcium phosphate co-precipitation method, electroporation method or liposome method, but is not limited thereto. It is not.

본 발명의 일 실시예에 따른 색소형성 유전자의 발현 조절 물질의 스크리닝 방법에 있어서, 상기 색소형성 유전자의 발현을 조절하는지 여부는 당업계에 널리 공지된 방법인 RT-PCR 또는 ELISA 및 웨스턴블럿(면역블럿(immuno blot))을 이용하여 결정될 수 있다.In the method for screening a pigment-forming gene expression control material according to an embodiment of the present invention, whether to regulate the expression of the pigment-forming gene is well known in the art RT-PCR or ELISA and Western blot (immunity) Can be determined using an immuno blot.

본 발명의 일 실시예에 따른 색소형성 유전자의 발현 정도를 이용한 발현 조절 물질 스크리닝은 시험 물질이 색소형성 유전자 을 촉진 혹은 억제하는지를 면역검정법(예를 들어 ELISA 또는 면역블럿)으로 확인하는 방법으로 수행될 수 있다.Expression control material screening using the degree of expression of the pigmentation gene according to an embodiment of the present invention can be carried out by a method to confirm whether the test substance promotes or inhibits the pigmentation gene by immunoassay (for example, ELISA or immunoblot). Can be.

본 발명의 일 실시예에서, 상기 확인 결과, 상기 시험물질이 티로시나아제, 티로시나아제 관련 단백질 1, 멜란-A의 발현, 활성 또는 기능을 감소시키는 경우 색소형성 유전자의 발현 억제제로 판정하는 단계를 더 포함하는 색소형성 유전자의 발현 조절 물질 스크리닝 방법을 제공한다.In one embodiment of the present invention, the identification result, when the test substance reduces the expression, activity or function of tyrosinase, tyrosinase-related protein 1, melan-A step of determining as an inhibitor of the pigmentation gene expression It provides a method for screening the expression regulatory material of the pigment forming gene further comprising.

본 발명의 일 실시예에서, 상기 확인 결과, 상기 시험물질이 티로시나아제, 티로시나아제 관련 단백질 1, 멜란-A의 발현, 활성 또는 기능을 증가시키는 경우 색소형성 유전자의 발현 촉진제로 판정하는 단계를 더 포함하는 색소형성 유전자의 발현 조절 물질 스크리닝 방법을 제공한다.In one embodiment of the present invention, the identification result, when the test substance increases the expression, activity or function of tyrosinase, tyrosinase-related protein 1, melan-A step to determine the expression promoter of the pigmentation gene It provides a method for screening the expression regulatory material of the pigment forming gene further comprising.

또한 본 발명의 일 실시예는, 시험물질에 대한 진피세포의 재생을 촉진하는 물질을 스크리닝하는 방법으로서, (a) 서열번호 1의 miRNA를 세포에 트랜스펙션시키는 단계; (b) 상기 세포에 시험 물질을 처리하는 단계; 및 (c) 상기 시험물질이 진피세포의 이동성을 증가시키는지 또는 억제하는지 여부를 확인하는 단계;를 포함하는 것을 특징으로 하는 진피세포의 재생을 촉진하는 물질을 스크리닝하는 방법을 제공한다.In addition, one embodiment of the present invention, a method for screening a substance that promotes the regeneration of dermal cells with respect to a test substance, comprising the steps of: (a) transfecting the miRNA of SEQ ID NO: 1 to the cell; (b) treating the cell with the test substance; And (c) checking whether the test substance increases or inhibits the mobility of the dermal cells. The method provides a method for screening a substance for promoting regeneration of dermal cells, the method comprising:

상기 서열번호 1의 miRNA를 세포에 트랜스펙션시키는 단계에 있어서, 상기 트랜스펙션은 미세 주입법, 칼슘 포스페이트 공동-침전법, 전기 천공법 또는 리포좀 이용법 등을 이용하여 실시할 수 있으나, 이에 한정되는 것은 아니다.In the step of transfecting the miRNA of SEQ ID NO: 1 into the cell, the transfection may be performed using a micro-injection method, calcium phosphate co-precipitation method, electroporation method or liposome method, but is not limited thereto. It is not.

본 발명의 일 실시예에 따른 진피세포 재생 조절제 스크리닝 방법에 있어서, 상기 진피세포 이동성 조절 여부는 당업계에 널리 공지된 방법인 상처 치유 분석법(wound-healing assay)을 비롯한 이동(migration) 실험법을 이용하여 결정될 수 있다.In the method for screening a dermal cell regeneration regulator according to an embodiment of the present invention, the control of dermal cell mobility is carried out using a migration test method including a wound-healing assay, which is well known in the art. Can be determined.

본 발명의 일 실시예에 따른 세포이동성과 관련있는 유전자들의 발현 정도를 이용한 발현 조절 물질 스크리닝은 시험 물질이 트로포미오신 3과 아그레칸의 발현을 촉진 혹은 억제하는지를 면역검정법(예를 들어 ELISA 또는 면역블럿)으로 확인하는 방법으로 수행될 수 있다.Expression control material screening using the expression level of genes related to cell mobility according to an embodiment of the present invention is immunoassay (eg ELISA or immunoassay) whether the test substance promotes or inhibits the expression of tropomyosin 3 and agrecan Blot).

본 발명의 일 실시예에서, 상기 확인 결과, 상기 시험물질이 섬유아세포의 진피세포 재생을 조절하며 세포이동성과 관련있다고 이미 알려진 트로포미오신 3과 아그레칸의 발현, 활성 또는 기능을 감소시키는 경우 세포재생을 촉진하는 촉진제로 판정하는 단계를 더 포함하는 진피세포 재생 조절 물질 스크리닝 방법을 제공한다.
In one embodiment of the present invention, as a result of the identification, the test substance regulates dermal cell regeneration of fibroblasts and reduces the expression, activity or function of Tropomyocin 3 and agrecan, which are known to be related to cell mobility. It provides a method for screening a dermal cell regeneration regulatory substance further comprising the step of determining the promoter to promote regeneration.

이하 본 발명을 하기 실시예 및 시험예에 의거하여 보다 구체적으로 설명한다. 그러나 이들 시험예는 본 발명에 대한 이해를 돕기 위한 것일 뿐, 본 발명의 범위가 이들 예로 한정되는 것은 아니다.
Hereinafter, the present invention will be described in more detail based on the following Examples and Test Examples. However, these test examples are only for helping the understanding of the present invention, and the scope of the present invention is not limited to these examples.

[시험예 1] hsa-miR-1248의 모방체(mimic)에 의한 티로시나아제 mRNA 감소Test Example 1 Reduction of Tyrosinase mRNA by Mimic of hsa-miR-1248

본 발명자들은 hsa-miR-1248의 획득기능적 연구(gain-of-functional study)를 위하여 hsa-miR-1248의 모방체를 이용하였는데, hsa-miR-1248의 모방체는 hsa-miR-1248과 동일한 서열을 갖는 올리고핵산(oligonucleotide)으로서 이를 세포 내로 주입하여 hsa-miR-1248의 과발현 현상(overexpression)을 유도할 수 있다. We used mimics of hsa-miR-1248 for gain-of-functional studies of hsa-miR-1248, which mimics hsa-miR-1248. Oligonucleotides with sequences can be injected into cells to induce overexpression of hsa-miR-1248.

흑색종 세포주인 WM266-4에 hsa-miR-1248의 모방체(C-301375-00-0005, miRIDIAN Mimic, Human hsa-miR-1248, Dharmacon, Inc. 제품; 실시예 1)를 농도가 20μM가 되도록 리포좀(liposome)을 이용하여 트랜스펙션하여 세포 안으로 이동시켰다. 대조군은 어떠한 올리고핵산도 넣지 않은 샘플(비교예 1)과 본 발명의 miRNA 서열과는 전혀 중복되지 않는 올리고핵산(CN-001000-01-05, miRIDIAN microRNA Mimic Negative Control #1, Dharmacon, Inc. 제품) 20μM을 트랜스펙션시킨 샘플(비교예 2)을 이용하였다. 트랜스펙션 후 세포는 37℃ 5% CO2 인큐베이터에서 약 60시간 정도 배양한 다음 트리졸(Trizol) 시약 1ml를 이용하여 RNA를 분리하였다. 트리졸을 이용하여 세포를 녹인 뒤, 원심분리기를 이용하여 상층액을 분리하고, 이소프로판올 0.35ml를 넣어 핵산의 펠렛을 형성시키고, 70% EtOH로 세척한 후 펠렛을 물에 녹여 RNA를 분리하였다. 약 1μg의 RNA를 올리고 디티(oligo dT) 및 역전사 효소(reverse transcripase)를 이용하여 cDNA를 만든 뒤, 티로시나아제 mRNA에 특이적인 프라이머(assay ID: Hs01099965_m1)를 이용하여 Applied biosystems사의 taqman 방식의 실시간 PCR을 95℃에서 10분 반응시키고, 95℃에서 10초, 60℃에서 1분 반응을 약 45번 반복시켜 수행하였다. 티로시나아제 mRNA 발현양은 하우스키핑(house keeping) 유전자인 GAPDH(glyceraldehyde-3-phosphate dehydrogenase)의 mRNA 발현양(assay ID: 4333764F)으로 정규화(normalization)하였으며, 그 결과는 도 1에 나타내었다.In the melanoma cell line, WM266-4, mimics of hsa-miR-1248 (C-301375-00-0005, miRIDIAN Mimic, Human hsa-miR-1248, manufactured by Dharmacon, Inc .; Example 1) had a concentration of 20 μM. Liposomes were used to transfect and transfer into cells. The control group contains oligonucleic acid (CN-001000-01-05, miRIDIAN microRNA Mimic Negative Control # 1, manufactured by Dharmacon, Inc.) without any oligonucleic acid (Comparative Example 1) and no overlap with the miRNA sequence of the present invention. ) A sample (Comparative Example 2) transfected with 20 μM was used. After transfection, the cells were incubated in a 37 ° C. 5% CO 2 incubator for about 60 hours and RNA was isolated using 1 ml of Trizol reagent. After dissolving cells using Trizol, the supernatant was separated using a centrifuge, 0.35ml of isopropanol was added to form a pellet of nucleic acid, washed with 70% EtOH, and the pellet was dissolved in water to separate RNA. About 1 μg of RNA was used to make cDNA using oligo dT and reverse transcripase, and then using a primer specific for tyrosinase mRNA (assay ID: Hs01099965_m1), a real-time taqman method of Applied biosystems PCR was performed at 95 ° C. for 10 minutes, 10 seconds at 95 ° C., and 1 minute reaction at 60 ° C. for about 45 times. The tyrosinase mRNA expression amount was normalized to the mRNA expression amount of glyceraldehyde-3-phosphate dehydrogenase (GAPDH), a house keeping gene (assay ID: 4333764F), and the results are shown in FIG. 1.

도 1을 보면, 본 발명의 hsa-miR-1248의 모방체를 세포 내로 주입한 경우(실시예 1)에 티로시나아제 mRNA의 발현이 비교예 1 및 2에 비하여 현저하게 억제되었음을 알 수 있다.
1, it can be seen that the expression of tyrosinase mRNA was significantly suppressed compared to Comparative Examples 1 and 2 when the mimic of hsa-miR-1248 of the present invention was injected into cells (Example 1).

[시험예 2] hsa-miR-1248의 모방체(mimic)에 의한 티로시나아제 단백질 감소Test Example 2 Reduction of Tyrosinase Protein by Mimic of hsa-miR-1248

본 발명자들은 hsa-miR-1248의 획득기능적 연구(gain-of-functional study)를 위하여 hsa-miR-1248의 모방체를 이용하였는데, hsa-miR-1248의 모방체는 hsa-miR-1248과 동일한 서열을 갖는 올리고핵산(oligonucleotide)으로서 이를 세포 내로 주입하여 hsa-miR-1248의 과발현 현상(overexpression)을 유도할 수 있다. We used mimics of hsa-miR-1248 for gain-of-functional studies of hsa-miR-1248, which mimics hsa-miR-1248. Oligonucleotides with sequences can be injected into cells to induce overexpression of hsa-miR-1248.

흑색종 세포주인 WM266-4에 hsa-miR-1248의 모방체(C-301375-00-0005, miRIDIAN Mimic, Human hsa-miR-1248, Dharmacon, Inc. 제품; 실시예 2)를 농도가 20μM가 되도록 리포좀(liposome)을 이용하여 트랜스펙션하여 세포 안으로 이동시켰다. 대조군은 어떠한 올리고핵산도 넣지 않은 샘플(비교예 3)과 본 발명의 miRNA 서열과는 전혀 중복되지 않는 올리고핵산(CN-001000-01-05, miRIDIAN microRNA Mimic Negative Control #1, Dharmacon, Inc. 제품) 20μM을 트랜스펙션시킨 샘플(비교예 4)을 이용하였다. 트랜스펙션 후 약 60시간 후 RIPA 완충제를 이용하여 세포막을 깨고 원심분리기를 이용하여 단백질이 포함된 상층액을 추출한 뒤, BCA방식을 이용하여 약 10μg그램의 단백질을 정량하였다. 정량한 단백질로 웨스턴 블럿 실험을 수행하며 이 때 티로시나아제에 특이적인 항체(Upstate사의 05-647)를 이용하여 티로시나아제 단백질의 양을 관찰하였다. 티로시나아제 단백질 발현양은 하우스키핑(house keeping) 유전자인 GAPDH의 단백질 발현양으로 정규화(normalization)하였으며, 그 결과는 도 2에 나타내었다.A mimic of hsa-miR-1248 (C-301375-00-0005, miRIDIAN Mimic, Human hsa-miR-1248, product of Dharmacon, Inc .; Example 2) was added to the melanoma cell line WM266-4. Liposomes were used to transfect and transfer into cells. The control group contains oligonucleic acid (CN-001000-01-05, miRIDIAN microRNA Mimic Negative Control # 1, manufactured by Dharmacon, Inc.) without any oligonucleic acid (Comparative Example 3) and no overlap with the miRNA sequence of the present invention. ) A sample (Comparative Example 4) transfected with 20 μM was used. About 60 hours after transfection, the cell membrane was broken using RIPA buffer, the supernatant containing protein was extracted using a centrifuge, and about 10 μg of protein was quantified by BCA method. Western blot experiments were performed with the quantified protein, and the amount of tyrosinase protein was observed using an antibody specific for tyrosinase (Upstate 05-647). The tyrosinase protein expression amount was normalized to the protein expression amount of housekeeping gene GAPDH, and the results are shown in FIG. 2.

도 2를 보면, 본 발명의 hsa-miR-1248의 모방체를 세포 내로 주입한 경우(실시예 2)에 티로시나아제 단백질의 발현이 비교예 1 및 2에 비하여 현저하게 억제되었음을 알 수 있다.
2, it can be seen that the expression of tyrosinase protein was significantly inhibited compared to Comparative Examples 1 and 2 when the mimic of hsa-miR-1248 of the present invention was injected into cells (Example 2).

[시험예 3] hsa-miR-1248의 모방체(mimic)에 의한 티로시나아제 관련 단백질 1 mRNA 감소Test Example 3 Reduction of Tyrosinase-related Protein 1 mRNA by Mimic of hsa-miR-1248

본 발명자들은 hsa-miR-1248의 획득기능적 연구(gain-of-functional study)를 위하여 hsa-miR-1248의 모방체를 이용하였는데, hsa-miR-1248의 모방체는 hsa-miR-1248과 동일한 서열을 갖는 올리고핵산(oligonucleotide)으로서 이를 세포 내로 주입하여 hsa-miR-1248의 과발현 현상(overexpression)을 유도할 수 있다. We used mimics of hsa-miR-1248 for gain-of-functional studies of hsa-miR-1248, which mimics hsa-miR-1248. Oligonucleotides with sequences can be injected into cells to induce overexpression of hsa-miR-1248.

흑색종 세포주인 WM266-4에 hsa-miR-1248의 모방체(C-301375-00-0005, miRIDIAN Mimic, Human hsa-miR-1248, Dharmacon, Inc. 제품; 실시예 3)를 농도가 20μM가 되도록 리포좀(liposome)을 이용하여 트랜스펙션하여 세포 안으로 이동시켰다. 대조군은 어떠한 올리고핵산도 넣지 않은 샘플(비교예 5)과 본 발명의 miRNA 서열과는 전혀 중복되지 않는 올리고핵산(CN-001000-01-05, miRIDIAN microRNA Mimic Negative Control #1, Dharmacon, Inc. 제품) 20μM을 트랜스펙션시킨 샘플(비교예 6)을 이용하였다. 트랜스펙션 후 세포는 37℃ 5% CO2 인큐베이터에서 약 60시간 정도 배양한 다음 트리졸(Trizol) 시약 1ml를 이용하여 RNA를 분리하였다. 트리졸을 이용하여 세포를 녹인 뒤, 원심분리기를 이용하여 상층액을 분리하고, 이소프로판올 0.35ml를 넣어 핵산의 펠렛을 형성시키고, 70% EtOH로 세척한 후 펠렛을 물에 녹여 RNA를 분리하였다. 약 1μg의 RNA를 올리고 디티(oligo dT) 및 역전사 효소(reverse transcripase)를 이용하여 cDNA를 만든 뒤, 티로시나아제 관련 단백질 1 mRNA에 특이적인 프라이머(assay ID: Hs00167051_m1)를 이용하여 Applied biosystems사의 taqman 방식의 실시간 PCR을 95℃에서 10분 반응시키고, 95℃에서 10초, 60℃에서 1분 반응을 약 45번 반복시켜 수행하였다. 티로시나아제 관련 단백질 1 mRNA 발현양은 하우스키핑(house keeping) 유전자인 GAPDH(glyceraldehyde-3-phosphate dehydrogenase)의 mRNA 발현양(assay ID: 4333764F)으로 정규화(normalization)하였으며, 그 결과는 도 3에 나타내었다.In the melanoma cell line, WM266-4, mimics of hsa-miR-1248 (C-301375-00-0005, miRIDIAN Mimic, Human hsa-miR-1248, manufactured by Dharmacon, Inc .; Example 3) had a concentration of 20 μM. Liposomes were used to transfect and transfer into cells. The control group contains oligonucleic acid (CN-001000-01-05, miRIDIAN microRNA Mimic Negative Control # 1, manufactured by Dharmacon, Inc.) without any oligonucleic acid (Comparative Example 5) and no overlap with the miRNA sequence of the present invention. ) A sample (Comparative Example 6) transfected with 20 μM was used. After transfection, the cells were incubated in a 37 ° C. 5% CO 2 incubator for about 60 hours and RNA was isolated using 1 ml of Trizol reagent. After dissolving cells using Trizol, the supernatant was separated using a centrifuge, 0.35ml of isopropanol was added to form a pellet of nucleic acid, washed with 70% EtOH, and the pellet was dissolved in water to separate RNA. CDNA was prepared using oligo dT and reverse transcripase, followed by primers specific for tyrosinase-related protein 1 mRNA (assay ID: Hs00167051_m1) using taqman from Applied biosystems. Real-time PCR of the scheme was performed by repeating the reaction at 95 ° C. for 10 minutes, repeating the reaction for 10 minutes at 95 ° C., and 1 minute at 60 ° C. for about 45 times. The expression level of tyrosinase-related protein 1 mRNA was normalized to the amount of mRNA expression of glyceraldehyde-3-phosphate dehydrogenase (GAPDH), which is a housekeeping gene (assay ID: 4333764F), and the results are shown in FIG. 3. It was.

도 3을 보면, 본 발명의 hsa-miR-1248의 모방체를 세포 내로 주입한 경우에 티로시나아제 관련 단백질 1 mRNA의 발현이 현저하게 억제되었음을 알 수 있다.
3, it can be seen that the expression of tyrosinase-related protein 1 mRNA was significantly suppressed when the mimic of hsa-miR-1248 of the present invention was injected into cells.

[시험예 4] hsa-miR-1248의 모방체(mimic)에 의한 멜란-A mRNA 감소Test Example 4 Reduction of Melan-A mRNA by Mimic of hsa-miR-1248

본 발명자들은 hsa-miR-1248의 획득기능적 연구(gain-of-functional study)를 위하여 hsa-miR-1248의 모방체를 이용하였는데, hsa-miR-1248의 모방체는 hsa-miR-1248과 동일한 서열을 갖는 올리고핵산(oligonucleotide)으로서 이를 세포 내로 주입하여 hsa-miR-1248의 과발현 현상(overexpression)을 유도할 수 있다. We used mimics of hsa-miR-1248 for gain-of-functional studies of hsa-miR-1248, which mimics hsa-miR-1248. Oligonucleotides with sequences can be injected into cells to induce overexpression of hsa-miR-1248.

흑색종 세포주인 WM266-4에 hsa-miR-1248의 모방체(C-301375-00-0005, miRIDIAN Mimic, Human hsa-miR-1248, Dharmacon, Inc. 제품; 실시예 4)를 농도가 20μM가 되도록 리포좀(liposome)을 이용하여 트랜스펙션하여 세포 안으로 이동시켰다. 대조군은 어떠한 올리고핵산도 넣지 않은 샘플(비교예 7)과 본 발명의 miRNA 서열과는 전혀 중복되지 않는 올리고핵산(CN-001000-01-05, miRIDIAN microRNA Mimic Negative Control #1, Dharmacon, Inc. 제품) 20μM을 트랜스펙션시킨 샘플(비교예 8)을 이용하였다. 트랜스펙션 후 세포는 37℃ 5% CO2 인큐베이터에서 약 60시간 정도 배양한 다음 트리졸(Trizol) 시약 1ml를 이용하여 RNA를 분리하였다. 트리졸을 이용하여 세포를 녹인 뒤, 원심분리기를 이용하여 상층액을 분리하고, 이소프로판올 0.35ml를 넣어 핵산의 펠렛을 형성시키고, 70% EtOH로 세척한 후 펠렛을 물에 녹여 RNA를 분리하였다. 약 1μg의 RNA를 올리고 디티(oligo dT) 및 역전사 효소(reverse transcripase)를 이용하여 cDNA를 만든 뒤, 멜란-A mRNA에 특이적인 프라이머(assay ID: Hs00194133_m1)를 이용하여 Applied biosystems사의 taqman 방식의 실시간 PCR을 95℃에서 10분 반응시키고, 95℃에서 10초, 60℃에서 1분 반응을 약 45번 반복시켜 수행하였다. 티로시나아제 관련 단백질 1 mRNA 발현양은 하우스키핑(house keeping) 유전자인 GAPDH(glyceraldehyde-3-phosphate dehydrogenase)의 mRNA 발현양(assay ID: 4333764F)으로 정규화(normalization)하였으며, 그 결과는 도 4에 나타내었다.In the melanoma cell line, WM266-4, mimics of hsa-miR-1248 (C-301375-00-0005, miRIDIAN Mimic, Human hsa-miR-1248, manufactured by Dharmacon, Inc .; Example 4) had a concentration of 20 μM. Liposomes were used to transfect and transfer into cells. The control group contains oligonucleic acid (CN-001000-01-05, miRIDIAN microRNA Mimic Negative Control # 1, manufactured by Dharmacon, Inc.) without any oligonucleic acid (Comparative Example 7) and no overlap with the miRNA sequence of the present invention. ) A sample (Comparative Example 8) transfected with 20 μM was used. After transfection, the cells were incubated in a 37 ° C. 5% CO 2 incubator for about 60 hours and RNA was isolated using 1 ml of Trizol reagent. After dissolving cells using Trizol, the supernatant was separated using a centrifuge, 0.35ml of isopropanol was added to form a pellet of nucleic acid, washed with 70% EtOH, and the pellet was dissolved in water to separate RNA. About 1 μg of RNA was used to make cDNA using oligo dT and reverse transcripase, and then using a primer specific for melan-A mRNA (assay ID: Hs00194133_m1), a real-time taqman method of Applied biosystems PCR was performed at 95 ° C. for 10 minutes, 10 seconds at 95 ° C., and 1 minute reaction at 60 ° C. for about 45 times. The expression level of tyrosinase-related protein 1 mRNA was normalized to mRNA expression amount of glyceraldehyde-3-phosphate dehydrogenase (GAPDH), which is a house keeping gene (assay ID: 4333764F), and the results are shown in FIG. 4. It was.

도 4를 보면, 본 발명의 hsa-miR-1248의 모방체를 세포 내로 주입한 경우에 멜란-A mRNA의 발현이 현저하게 억제되었음을 알 수 있다.
4, it can be seen that the expression of melan-A mRNA was significantly suppressed when the mimic of hsa-miR-1248 of the present invention was injected into cells.

[시험예 5] miR-1248에 의한 멜란-A 타겟팅 바이오인포매틱 분석[Test Example 5] Melan-A targeting bioinformatics analysis by miR-1248

멜란-A mRNA의 3'-UTR에 상보적으로 결합하는 miRNA를 선택하기 위해 바이오인포매틱 툴을 이용하였다. TargetScan(www.targetscan.org)에서 hsa-miR-1248이 타겟팅할 수 있을 것이라고 예측한 후보들 중에서 hsa-miR-1248는 멜란-A를 타겟팅할 수 있을 거라고 예측하였다. hsa-miR-1248는 성숙한 형태(mature form)의 5'으로부터 2번째에서 7번째까지 서열이 멜란-A mRNA 3'-UTR과 정확히 일치하는 ‘7-mer’의 결합 형태를 가지는 것으로 추측하였다. 이 결과는 도 5에 나타내었다.
Bioinformatics tools were used to select miRNAs that complementarily bind to the 3'-UTR of melan-A mRNA. Of the candidates predicted by hsa-miR-1248 in TargetScan (www.targetscan.org), we predicted that hsa-miR-1248 might target Melan-A. hsa-miR-1248 was assumed to have a binding form of '7-mer' in which the sequence from 5 'to 2 to 7 of the mature form exactly matches the Melan-A mRNA 3'-UTR. This result is shown in FIG.

[시험예 6] hsa-miR-1248의 모방체(mimic)에 의한 진피세포 재생 촉진[Test Example 6] Promotion of dermal cell regeneration by mimic of hsa-miR-1248

본 발명자들은 hsa-miR-1248의 획득기능적 연구(gain-of-functional study)를 위하여 hsa-miR-1248의 모방체를 이용하였는데, hsa-miR-1248의 모방체는 hsa-miR-1248과 동일한 서열을 갖는 올리고핵산(oligonucleotide)으로서 이를 세포 내로 주입하여 hsa-miR-1248의 과발현 현상(overexpression)을 유도할 수 있다. We used mimics of hsa-miR-1248 for gain-of-functional studies of hsa-miR-1248, which mimics hsa-miR-1248. Oligonucleotides with sequences can be injected into cells to induce overexpression of hsa-miR-1248.

피부 섬유아세포(dermal fibroblast)에 hsa-miR-1248 모방체(C-301375-00-0005, miRIDIAN Mimic, Human hsa-miR-1248, Dharmacon, Inc. 제품; 실시예 5)를 농도가 20μM가 되도록 리포좀(liposome)을 이용하여 트랜스펙션(transfection)하여 세포 안으로 이동시켰다. 대조군은 어떠한 올리고핵산도 넣지 않은 샘플(비교예 9)과 본 발명의 miRNA 서열과는 전혀 중복되지 않는 올리고핵산(CN-001000-01-05, miRIDIAN microRNA Mimic Negative Control #1, Dharmacon, Inc. 제품) 20μM을 트랜스펙션시킨 샘플(비교예 10)을 이용하였다. 트랜스펙션 후 약 48시간 후 세포가 100% 컨플루언스(confluence)로 자란 후 상처 치유 분석법을 진행하였다. 상처 치유 분석법은 황색 팁(yellow tip)으로 세포 컬쳐 플레이트를 긁어 상처(wound)를 발생시킨 뒤, 세척액(PBS. Welgene 사의 Dulbecco's phosphate buffered saline Cat# LB001-01)으로 세척한 후 다시 세포 배지를 갈아주는 것으로 수행하였다. 상처를 주고 약 48시간 뒤, 상처가 얼마나 좁혀졌는지 현미경으로 관찰하였으며, 그 결과는 도 6에 나타내었다. Hsa-miR-1248 mimetic (C-301375-00-0005, miRIDIAN Mimic, Human hsa-miR-1248, Dharmacon, Inc .; Example 5) was added to dermal fibroblasts to a concentration of 20 μM. Liposomes were used to transfect and transfer into cells. The control group contains oligonucleic acid (CN-001000-01-05, miRIDIAN microRNA Mimic Negative Control # 1, manufactured by Dharmacon, Inc.), which does not overlap any oligonucleic acid sample (Comparative Example 9) with the miRNA sequence of the present invention. ) A sample transfected with 20 μM (Comparative Example 10) was used. About 48 hours after transfection, cells were grown to 100% confluence and then wound healing assay was performed. Wound healing assays involve scratching the cell culture plate with a yellow tip, creating a wound, washing with wash solution (PBS. Dulbecco's phosphate buffered saline Cat # LB001-01 from Welgene) and grinding the cell medium again. It was done by giving. About 48 hours after the injury, the microscope observed how narrowed the wound was, and the result is shown in FIG. 6.

도 6을 보면, 본 발명의 hsa-miR-1248의 모방체를 세포 내로 주입한 경우에 상처 간격이 훨씬 더 좁게 나타나 진피세포의 재생이 촉진되었음을 알 수 있다.
Referring to Figure 6, when the mimic of hsa-miR-1248 of the present invention is injected into the cells it can be seen that the wound gap is much narrower to promote the regeneration of dermal cells.

[시험예 7] hsa-miR-1248의 모방체(mimic)에 의한 트로포미오신 3 mRNA 감소Test 7 Reduction of Tropomyocin 3 mRNA by Mimic of hsa-miR-1248

본 발명자들은 hsa-miR-1248의 획득기능적 연구(gain-of-functional study)를 위하여 hsa-miR-1248의 모방체를 이용하였는데, hsa-miR-1248의 모방체는 hsa-miR-1248과 동일한 서열을 갖는 올리고핵산(oligonucleotide)으로서 이를 세포 내로 주입하여 hsa-miR-1248의 과발현 현상(overexpression)을 유도할 수 있다. We used mimics of hsa-miR-1248 for gain-of-functional studies of hsa-miR-1248, which mimics hsa-miR-1248. Oligonucleotides with sequences can be injected into cells to induce overexpression of hsa-miR-1248.

피부 섬유아세포(dermal fibroblast)에 hsa-miR-1248의 모방체(C-301375-00-0005, miRIDIAN Mimic, Human hsa-miR-1248, Dharmacon, Inc. 제품; 실시예 6)를 농도가 20μM가 되도록 리포좀(liposome)을 이용하여 트랜스펙션하여 세포 안으로 이동시켰다. 대조군은 어떠한 올리고핵산도 넣지 않은 샘플(비교예 11)과 본 발명의 miRNA 서열과는 전혀 중복되지 않는 올리고핵산(CN-001000-01-05, miRIDIAN microRNA Mimic Negative Control #1, Dharmacon, Inc. 제품) 20μM을 트랜스펙션시킨 샘플(비교예 12)을 이용하였다. 트랜스펙션 후 세포는 37℃ 5% CO2 인큐베이터에서 약 60시간 정도 배양한 다음 트리졸(Trizol) 시약 1ml를 이용하여 RNA를 분리하였다. 트리졸을 이용하여 세포를 녹인 뒤, 원심분리기를 이용하여 상층액을 분리하고, 이소프로판올 0.35ml를 넣어 핵산의 펠렛을 형성시키고, 70% EtOH로 세척한 후 펠렛을 물에 녹여 RNA를 분리하였다. 약 1μg의 RNA를 올리고 디티(oligo dT) 및 역전사 효소(reverse transcripase)를 이용하여 cDNA를 만든 뒤, 트로포미오신 3 mRNA에 특이적인 프라이머(assay ID: Hs00383595_m1)를 이용하여 Applied biosystems사의 taqman 방식의 실시간 PCR을 95℃에서 10분 반응시키고, 95℃에서 10초, 60℃에서 1분 반응을 약 45번 반복시켜 수행하였다. 티로시나아제 관련 단백질 1 mRNA 발현양은 하우스키핑(house keeping) 유전자인 GAPDH(glyceraldehyde-3-phosphate dehydrogenase)의 mRNA 발현양(assay ID: 4333764F)으로 정규화(normalization)하였으며, 그 결과는 도 7에 나타내었다.20 μM of hsa-miR-1248 mimetic (C-301375-00-0005, miRIDIAN Mimic, Human hsa-miR-1248, Dharmacon, Inc .; Example 6) was added to dermal fibroblasts. Liposomes were used to transfect and transfer into cells. The control group contains oligonucleic acid (CN-001000-01-05, miRIDIAN microRNA Mimic Negative Control # 1, manufactured by Dharmacon, Inc.) that does not overlap any sample without any oligonucleotide (Comparative Example 11) and the miRNA sequence of the present invention. ) A sample (Comparative Example 12) transfected with 20 μM was used. After transfection, the cells were incubated in a 37 ° C. 5% CO 2 incubator for about 60 hours and RNA was isolated using 1 ml of Trizol reagent. After dissolving cells using Trizol, the supernatant was separated using a centrifuge, 0.35ml of isopropanol was added to form a pellet of nucleic acid, washed with 70% EtOH, and the pellet was dissolved in water to separate RNA. About 1 μg of RNA was used to make cDNA using oligo dT and reverse transcripase, followed by the real-time taqman method of Applied biosystems using primers specific to tropomyosin 3 mRNA (assay ID: Hs00383595_m1). PCR was performed at 95 ° C. for 10 minutes, 10 seconds at 95 ° C., and 1 minute reaction at 60 ° C. for about 45 times. The expression level of tyrosinase-related protein 1 mRNA was normalized to the amount of mRNA expression of glyceraldehyde-3-phosphate dehydrogenase (GAPDH), a house keeping gene (assay ID: 4333764F), and the results are shown in FIG. 7. It was.

도 7을 보면, 본 발명의 hsa-miR-1248의 모방체를 세포 내로 주입한 경우에 트로포미오신 3 mRNA의 발현이 현저하게 억제되었음을 알 수 있다.
Referring to Figure 7, it can be seen that the expression of tropomyosin 3 mRNA was significantly suppressed when the mimic of hsa-miR-1248 of the present invention was injected into cells.

[시험예 8] hsa-miR-1248의 모방체(mimic)에 의한 아그레칸 mRNA 감소Test Example 8 Aggrecan mRNA Reduction by Mimic of hsa-miR-1248

본 발명자들은 hsa-miR-1248의 획득기능적 연구(gain-of-functional study)를 위하여 hsa-miR-1248의 모방체를 이용하였는데, hsa-miR-1248의 모방체는 hsa-miR-1248과 동일한 서열을 갖는 올리고핵산(oligonucleotide)으로서 이를 세포 내로 주입하여 hsa-miR-1248의 과발현 현상(overexpression) 을 유도할 수 있다. We used mimics of hsa-miR-1248 for gain-of-functional studies of hsa-miR-1248, which mimics hsa-miR-1248. As an oligonucleotide having a sequence, it can be injected into cells to induce overexpression of hsa-miR-1248.

피부 섬유아세포(dermal fibroblast)에 hsa-miR-1248의 모방체(C-301375-00-0005, miRIDIAN Mimic, Human hsa-miR-1248, Dharmacon, Inc. 제품; 실시예 7)를 농도가 20μM가 되도록 리포좀(liposome)을 이용하여 트랜스펙션하여 세포 안으로 이동시켰다. 대조군은 어떠한 올리고핵산도 넣지 않은 샘플(비교예 13)과 본 발명의 miRNA 서열과는 전혀 중복되지 않는 올리고핵산(CN-001000-01-05, miRIDIAN microRNA Mimic Negative Control #1, Dharmacon, Inc. 제품) 20μM을 트랜스펙션시킨 샘플(비교예 14)을 이용하였다. 트랜스펙션 후 세포는 37℃ 5% CO2 인큐베이터에서 약 60시간 정도 배양한 다음 트리졸(Trizol) 시약 1ml를 이용하여 RNA를 분리하였다. 트리졸을 이용하여 세포를 녹인 뒤, 원심분리기를 이용하여 상층액을 분리하고, 이소프로판올 0.35ml를 넣어 핵산의 펠렛을 형성시키고, 70% EtOH로 세척한 후 펠렛을 물에 녹여 RNA를 분리하였다. 약 1μg의 RNA를 올리고 디티(oligo dT) 및 역전사 효소(reverse transcripase)를 이용하여 cDNA를 만든 뒤, 아그레칸 mRNA에 특이적인 프라이머(assay ID: Hs00153936_m1*)를 이용하여 Applied biosystems사의 taqman 방식의 실시간 PCR을 95℃에서 10분 반응시키고, 95℃에서 10초, 60℃에서 1분 반응을 약 45번 반복시켜 수행하였다. 티로시나아제 관련 단백질 1 mRNA 발현양은 하우스키핑(house keeping) 유전자인 GAPDH(glyceraldehyde-3-phosphate dehydrogenase)의 mRNA 발현양(assay ID: 4333764F)으로 정규화(normalization)하였으며, 그 결과는 도 8에 나타내었다.20 μM of hsa-miR-1248 mimetic (C-301375-00-0005, miRIDIAN Mimic, Human hsa-miR-1248, product of Dharmacon, Inc .; Example 7) was found in dermal fibroblasts. Liposomes were used to transfect and transfer into cells. The control group was prepared without any oligonucleic acid (Comparative Example 13) and oligonucleic acid (CN-001000-01-05, miRIDIAN microRNA Mimic Negative Control # 1, manufactured by Dharmacon, Inc.) without any overlap with the miRNA sequence of the present invention. ) A sample (Comparative Example 14) transfected with 20 μM was used. After transfection, the cells were incubated in a 37 ° C. 5% CO 2 incubator for about 60 hours and RNA was isolated using 1 ml of Trizol reagent. After dissolving cells using Trizol, the supernatant was separated using a centrifuge, 0.35ml of isopropanol was added to form a pellet of nucleic acid, washed with 70% EtOH, and the pellet was dissolved in water to separate RNA. About 1 μg of RNA was used to make cDNA using oligo dT and reverse transcripase, and then using a primer specific for agrecan mRNA (assay ID: Hs00153936_m1 *), which was applied by the taqman method of Applied biosystems. Real-time PCR was performed for 10 minutes at 95 ° C, repeated 10 minutes at 95 ° C, and 1 minute at 60 ° C for about 45 times. The expression level of tyrosinase-related protein 1 mRNA was normalized to the amount of mRNA expression of glyceraldehyde-3-phosphate dehydrogenase (GAPDH), a house keeping gene (assay ID: 4333764F), and the results are shown in FIG. 8. It was.

도 8을 보면, 본 발명의 hsa-miR-1248의 모방체를 세포 내로 주입한 경우에 아그레칸 mRNA의 발현이 현저하게 억제되었음을 알 수 있다.
Referring to FIG. 8, it can be seen that expression of agrecan mRNA was significantly suppressed when the mimic of hsa-miR-1248 of the present invention was injected into cells.

[시험예 9] miR-1248에 의한 트로포미오신 3 타겟팅 바이오인포매틱 분석Test Example 9 Tropomyosin 3 Targeting Bioinformatics Analysis by miR-1248

트로포미오신 3 mRNA의 3'-UTR에 상보적으로 결합하는 miRNA를 선택하기 위해 바이오인포매틱 툴을 이용하였다. TargetScan(www.targetscan.org)에서 hsa-miR-1248이 타겟팅할 수 있을 것이라고 예측한 후보들 중에서 hsa-miR-1248은 트로포미오신 3을 타겟팅할 수 있을 거라고 예측하였다. hsa-miR-1248는 성숙한 형태(mature form)의 5'으로부터 2번째에서 7번째까지 서열이 트로포미오신 3 mRNA 3'-UTR과 정확히 일치하는 ‘7-mer’의 결합 형태를 가지는 것으로 추측하였다. 이 결과는 도 9에 나타내었다.
Bioinformatics tools were used to select miRNAs that complementarily bind to the 3'-UTR of tropomyosin 3 mRNA. Of the candidates predicted by hsa-miR-1248 in TargetScan (www.targetscan.org), hsa-miR-1248 predicted that it could target tropomyosin 3. hsa-miR-1248 was assumed to have a binding form of '7-mer' in which the sequence from 5 'to 2 to 7 of the mature form exactly matches the tropomyosin 3 mRNA 3'-UTR. This result is shown in FIG.

[시험예 10] miR-1248에 의한 아그레칸 타겟팅 바이오인포매틱 분석Test Example 10 Aggrecan Targeting Bioinformatics Analysis by miR-1248

아그레칸 mRNA의 3'-UTR에 상보적으로 결합하는 miRNA를 선택하기 위해 바이오인포매틱 툴을 이용하였다. TargetScan(www.targetscan.org)에서 hsa-miR-1248이 타겟팅할 수 있을 것이라고 예측한 후보들 중에서 hsa-miR-1248는 아그레칸을 타겟팅할 수 있을 거라고 예측하였다. hsa-miR-1248는 성숙한 형태(mature form)의 5'으로부터 2번째에서 7번째까지 서열이 아그레칸 mRNA 3'-UTR과 정확히 일치하는 ‘7-mer’의 결합 형태를 가지는 것으로 추측하였다. 이 결과는 도 10에 나타내었다.
Bioinformatics tools were used to select miRNAs that complementarily bind to the 3'-UTR of agrecan mRNA. Of the candidates predicted by hsa-miR-1248 in TargetScan (www.targetscan.org), hsa-miR-1248 predicted that it could target Agrecan. hsa-miR-1248 was assumed to have a binding form of '7-mer' in which the sequence from 5 'to 2 to 7 of the mature form exactly matches the Agrecan mRNA 3'-UTR. This result is shown in FIG.

본 발명에 의한 서열번호 1의 miRNA를 유효성분으로 함유하는 피부 미백용 또는 진피세포 재생 촉진용 조성물은 하기의 제형예와 같이 제조될 수 있으나, 이에 한정되는 것은 아니다.
Skin whitening or dermal cell regeneration promoting composition comprising the miRNA of SEQ ID NO: 1 as an active ingredient according to the present invention may be prepared as in the following formulation example, but is not limited thereto.

[제형예 1] 영양화장수Formulation Example 1 Nutritional Cosmetics

하기 표 1에 기재된 조성에 따라 통상적인 방법으로 영양화장수를 제조할 수 있다.Nutrition lotion can be prepared by a conventional method according to the composition shown in Table 1 below.

원료명Raw material name 함량(중량 %)Content (% by weight) 글리세린glycerin 8.08.0 부틸렌글리콜Butylene glycol 4.04.0 히알루론산 추출물Hyaluronic acid extract 5.05.0 베타글루칸Beta Glucan 7.07.0 카보머Carbomer 0.10.1 서열번호 1의 miRNAMiRNA of SEQ ID NO: 1 0.10.1 카프릴릭/카프릭 트리글리세라이드Caprylic / Capric Triglycerides 8.08.0 스쿠알란Squalane 5.05.0 세테아릴 글루코사이드Cetearyl Glucoside 1.51.5 소르비탄 스테아레이트Sorbitan stearate 0.40.4 세테아릴 알코올Cetearyl Alcohol 1.01.0 방부제antiseptic 적량Suitable amount 향incense 적량Suitable amount 색소Pigment 적량Suitable amount 트리에탄올아민Triethanolamine 0.10.1 정제수Purified water 잔량Balance

[제형예 2] 영양로션[Formulation Example 2] Nutrition lotion

하기 표 2에 기재된 조성에 따라 통상적인 방법으로 영양로션을 제조할 수 있다.Nutrition lotions can be prepared in a conventional manner according to the composition shown in Table 2 below.

원료명Raw material name 함량(중량 %)Content (% by weight) 정제수Purified water 잔량Balance 글리세린glycerin 3.03.0 부틸렌글리콜Butylene glycol 3.03.0 유동파라핀Liquid paraffin 5.05.0 베타글루칸Beta Glucan 7.07.0 카보머Carbomer 0.10.1 서열번호 1의 miRNAMiRNA of SEQ ID NO: 1 3.03.0 카프릴릭/카프릭 트리글리세라이드Caprylic / Capric Triglycerides 3.03.0 스쿠알란Squalane 5.05.0 세테아릴 글루코사이드Cetearyl Glucoside 1.51.5 소르비탄 스테아레이트Sorbitan stearate 0.40.4 폴리솔베이트 60Polysorbate 60 1.51.5 방부제antiseptic 적량Suitable amount 향incense 적량Suitable amount 색소Pigment 적량Suitable amount 트리에탄올아민Triethanolamine 0.10.1

[제형예 3] 영양크림[Formulation Example 3] Nourishing cream

하기 표 3에 기재된 조성에 따라 통상적인 방법으로 영양크림을 제조할 수 있다.Nutrition creams can be prepared in a conventional manner according to the composition shown in Table 3 below.

원료명Raw material name 함량(중량 %)Content (% by weight) 글리세린glycerin 3.03.0 부틸렌글리콜Butylene glycol 3.03.0 유동파라핀Liquid paraffin 7.07.0 베타글루칸Beta Glucan 7.07.0 카보머Carbomer 0.10.1 서열번호 1의 miRNAMiRNA of SEQ ID NO: 1 3.03.0 카프릴릭/카프릭 트리글리세라이드Caprylic / Capric Triglycerides 3.03.0 스쿠알란Squalane 5.05.0 세테아릴 글루코사이드Cetearyl Glucoside 1.51.5 소르비탄 스테아레이트Sorbitan stearate 0.40.4 폴리솔베이트 60Polysorbate 60 1.21.2 방부제antiseptic 적량Suitable amount 향incense 적량Suitable amount 색소Pigment 적량Suitable amount 트리에탄올아민Triethanolamine 0.10.1 정제수Purified water 잔량Balance

[제형예 4] 마사지 크림[Formulation Example 4] Massage cream

하기 표 4에 기재된 조성에 따라 통상적인 방법으로 마사지 크림을 제조할 수 있다.Massage creams may be prepared by conventional methods according to the compositions described in Table 4 below.

원료명Raw material name 함량(중량 %)Content (% by weight) 글리세린glycerin 8.08.0 부틸렌글리콜Butylene glycol 4.04.0 유동파라핀Liquid paraffin 45.045.0 베타글루칸Beta Glucan 7.07.0 카보머Carbomer 0.10.1 서열번호 1의 miRNAMiRNA of SEQ ID NO: 1 1.01.0 카프릴릭/카프릭 트리글리세라이드Caprylic / Capric Triglycerides 3.03.0 밀납Wax 4.04.0 세테아릴 글루코사이드Cetearyl Glucoside 1.51.5 세스퀴 올레인산 소르비탄Sesqui oleic acid sorbitan 0.90.9 바세린Vaseline 3.03.0 방부제antiseptic 적량Suitable amount 향incense 적량Suitable amount 색소Pigment 적량Suitable amount 파라핀paraffin 1.51.5 정제수Purified water 잔량Balance

[제형예 5] 팩[Formulation Example 5] Pack

하기 표 5에 기재된 조성에 따라 통상적인 방법으로 팩을 제조할 수 있다.The pack may be prepared by conventional methods according to the compositions described in Table 5 below.

원료명Raw material name 함량(중량 %)Content (% by weight) 글리세린glycerin 4.04.0 폴리비닐알콜Polyvinyl alcohol 15.015.0 히알루론산 추출물Hyaluronic acid extract 5.05.0 베타글루칸Beta Glucan 7.07.0 알란토인Allantoin 0.10.1 서열번호 1의 miRNAMiRNA of SEQ ID NO: 1 0.50.5 노닐 페닐에테르Nonyl Phenyl Ether 0.40.4 폴리솔베이트 60Polysorbate 60 1.21.2 방부제antiseptic 적량Suitable amount 향incense 적량Suitable amount 색소Pigment 적량Suitable amount 에탄올ethanol 6.06.0 정제수Purified water 잔량Balance

[제형예 6] 연고[Formulation Example 6] ointment

하기 표 6에 기재된 조성에 따라 통상적인 방법으로 연고를 제조할 수 있다.Ointments may be prepared by conventional methods according to the compositions shown in Table 6 below.

원료명Raw material name 함량(중량 %)Content (% by weight) 글리세린glycerin 8.08.0 부틸렌글리콜Butylene glycol 4.04.0 유동파라핀Liquid paraffin 15.015.0 베타글루칸Beta Glucan 7.07.0 카보머Carbomer 0.10.1 서열번호 1의 miRNAMiRNA of SEQ ID NO: 1 1.01.0 카프릴릭/카프릭 트리글리세라이드Caprylic / Capric Triglycerides 3.03.0 스쿠알란Squalane 1.01.0 세테아릴 글루코사이드Cetearyl Glucoside 1.51.5 소르비탄 스테아레이트Sorbitan stearate 0.40.4 세테아릴 알코올Cetearyl Alcohol 1.01.0 방부제antiseptic 적량Suitable amount 향incense 적량Suitable amount 색소Pigment 적량Suitable amount 밀납Wax 4.04.0 정제수Purified water 잔량Balance

본 발명에 의한 서열번호 2의 miRNA를 유효성분으로 함유하는 백모방지 및 흑모 생성 촉진용 모발용 조성물은 하기의 제형예와 같이 제조될 수 있으나, 이에 한정되는 것은 아니다.
The composition for preventing hair loss and hair growth promoting hair containing miRNA of SEQ ID NO: 2 according to the present invention as an active ingredient may be prepared as in the following formulation example, but is not limited thereto.

[제형예 7] 모발 샴푸Formulation Example 7 Hair Shampoo

하기 표 7에 기재된 조성에 따라 통상적인 방법으로 모발 샴푸를 제조할 수 있다.According to the composition described in Table 7 it can be prepared a hair shampoo in a conventional manner.

원료명Raw material name 함량(중량 %)Content (% by weight) 라우릴황산나트륨액(30%)Sodium Lauryl Sulfate Solution (30%) 20.020.0 야자유지방산디에탄올아미드Palm oil fatty acid diethanolamide 5.05.0 폴리쿼터늄-10Polyquaternium-10 0.30.3 프로필렌글리콜Propylene glycol 2.02.0 서열번호 2의 miRNAMiRNA of SEQ ID NO: 2 0.10.1 피록톤올아민Pyrrothonol amine 0.50.5 황색203호Yellow 203 적량Suitable amount 파라옥시안식향산에스테르Paraoxybenzoic Acid Ester 0.20.2 조합향Combination incense 적량Suitable amount 구연산Citric acid 적량Suitable amount 정제수Purified water 잔량Balance

[제형예 8] 모발 컨디셔닝Formulation Example 8 Hair Conditioning

하기 표 8에 기재된 조성에 따라 통상적인 방법으로 모발 컨디셔닝을 제조할 수 있다.Hair conditioning can be prepared by conventional methods according to the compositions described in Table 8 below.

원료명Raw material name 함량(중량 %)Content (% by weight) 염화세틸트리메틸암모늄(29%)Cetyltrimethylammonium chloride (29%) 7.07.0 염화디스테아릴디메틸암모늄(75%)Distearyl dimethylammonium chloride (75%) 4.04.0 세토스테아릴알콜Cetostearyl alcohol 3.53.5 폴리옥시에틸렌스테아릴에테르Polyoxyethylene stearyl ether 1.01.0 유동파라핀Liquid paraffin 2.02.0 프로필렌글리콜Propylene glycol 1.51.5 서열번호 2의 miRNAMiRNA of SEQ ID NO: 2 0.10.1 조합향Combination incense 적량Suitable amount 구연산Citric acid 적량Suitable amount 정제수Purified water 잔량Balance

[제형예 9] 두피 헤어토닉Formulation Example 9 Scalp Hair Tonic

하기 표 9에 기재된 조성에 따라 통상적인 방법으로 두피 헤어토닉을 제조할 수 있다.The scalp hair tonic may be prepared by a conventional method according to the composition described in Table 9.

원료명Raw material name 함량(중량 %)Content (% by weight) 멘톨menthol 0.10.1 D-판테놀D-panthenol 0.60.6 살리실산Salicylic acid 0.050.05 글리세린glycerin 1.01.0 폴리옥시에틸렌경화피마자유Polyoxyethylene Cured Castor Oil 0.80.8 초산토코페롤Tocopherol Acetate 0.030.03 조합향Combination incense 적량Suitable amount 서열번호 2의 miRNAMiRNA of SEQ ID NO: 2 0.10.1 에탄올ethanol 30.030.0 정제수Purified water 잔량Balance

[제형예 10] 두피 에센스Formulation Example 10 Scalp Essence

하기 표 10에 기재된 조성에 따라 통상적인 방법으로 두피 에센스를 제조할 수 있다.The scalp essence can be prepared by conventional methods according to the composition described in Table 10 below.

원료명Raw material name 함량(중량 %)Content (% by weight) 에탄올ethanol 30.030.0 폴리솔베이트 60Polysorbate 60 1.51.5 글리세린glycerin 3.03.0 카르복시비닐폴리머Carboxyvinyl polymer 0.10.1 트리에탄올아민Triethanolamine 0.20.2 서열번호 2의 miRNAMiRNA of SEQ ID NO: 2 0.10.1 방부제antiseptic 적량Suitable amount 향료 및 색소Spices and Colors 적량Suitable amount 정제수Purified water 잔량Balance

[제형예 11] 주사제Formulation Example 11 Injection

하기 표 11에 기재된 조성에 따라 통상적인 방법으로 주사제를 제조할 수 있다.Injections can be prepared by conventional methods according to the compositions set forth in Table 11 below.

원료명Raw material name 중량비(1ml 당)Weight ratio (per 1 ml) 염화나트륨Sodium chloride 9mg9mg 소듐 카르복시메틸셀룰로오즈Sodium carboxymethylcellulose 30.0mg30.0mg Tween 20Tween 20 1.0mg1.0 mg 서열번호 2의 miRNAMiRNA of SEQ ID NO: 2 1mg1mg 주사용 증류수Distilled water for injection 잔량Balance

[제형예 12] 연고Formulation Example 12 Ointment

하기 표 12에 기재된 조성에 따라 통상적인 방법으로 연고를 제조할 수 있다.Ointments can be prepared by conventional methods according to the compositions set forth in Table 12 below.

원료명Raw material name 함량(중량 %)Content (% by weight) 카프린/카프릴 트리글리세리드Caprine / Capryl Triglycerides 1010 액상파라핀Liquid paraffin 1010 솔비탄세스퀴올리에이트Sorbitan sesquioleate 66 옥틸도데세스-25Octyldodeceth-25 99 세칠에칠헥사노에이트3,7 hexanoate 1010 스쿠알란Squalane 1One 살리실산Salicylic acid 1One 글리세린glycerin 1515 솔비톨Sorbitol 1One 서열번호 2의 miRNAMiRNA of SEQ ID NO: 2 0.10.1 방부제, 색소, 향료Preservative, coloring, fragrance 적량Suitable amount 정제수Purified water 잔량Balance

[제형예 13] 로션Formulation Example 13 Lotion

하기 표 13에 기재된 조성에 따라 통상적인 방법으로 로션을 제조할 수 있다.The lotion may be prepared by conventional methods according to the compositions described in Table 13 below.

원료명Raw material name 함량(중량 %)Content (% by weight) 서열번호 2의 miRNAMiRNA of SEQ ID NO: 2 0.10.1 밀납Wax 4.04.0 폴리솔베이트 60Polysorbate 60 1.51.5 솔비탄세스퀴올레이트Sorbitan sesquioleate 1.51.5 유동파라핀Liquid paraffin 0.50.5 카프릴릭/카프릭트리글리세라이드Caprylic / capric triglyceride 5.05.0 글리세린glycerin 3.03.0 부틸렌글리콜Butylene glycol 3.03.0 프로필렌글리콜Propylene glycol 3.03.0 카르복시비닐폴리머Carboxyvinyl polymer 0.10.1 트리에탄올아민Triethanolamine 0.20.2 방부제, 색소 및 향료Preservatives, Colors and Flavors 적량Suitable amount 정제수Purified water 잔량Balance

[제형예 14] 스프레이Formulation Example 14 Spray

하기 표 14에 기재된 조성에 따라 통상적인 방법으로 스프레이를 제조할 수 있다.Sprays may be prepared by conventional methods according to the compositions set forth in Table 14 below.

원료명Raw material name 함량(중량 %)Content (% by weight) 서열번호 2의 miRNAMiRNA of SEQ ID NO: 2 0.10.1 에탄올ethanol 8080 Tween 80Tween 80 55 글리세린glycerin 55 초산토코페롤Tocopherol Acetate 1One 방부제, 색소 및 향료Preservatives, Colors and Flavors 적량Suitable amount 정제수Purified water 잔량Balance

<110> AMOREPACIFIC <120> Composition containing microRNA <130> YPD201104-0047 <160> 2 <170> KopatentIn 2.0 <210> 1 <211> 27 <212> RNA <213> Artificial Sequence <220> <223> hsa-miR-1248 miRNA <400> 1 accuucuugu auaagcacug ugcuaaa 27 <210> 2 <211> 27 <212> RNA <213> Artificial Sequence <220> <223> hsa-miR-1248 miRNA <400> 2 uuuagcacag ugcuuauaca agaaggu 27 <110> AMOREPACIFIC <120> Composition containing microRNA <130> YPD201104-0047 <160> 2 <170> Kopatentin 2.0 <210> 1 <211> 27 <212> RNA <213> Artificial Sequence <220> H223-miR-1248 miRNA <400> 1 accuucuugu auaagcacug ugcuaaa 27 <210> 2 <211> 27 <212> RNA <213> Artificial Sequence <220> H223-miR-1248 miRNA <400> 2 uuuagcacag ugcuuauaca agaaggu 27

Claims (25)

서열번호 1의 염기서열을 포함하는 miRNA를 유효성분으로 함유하는 색소형성 유전자 발현 조절용 조성물.Pigment forming gene expression control composition containing miRNA comprising the nucleotide sequence of SEQ ID NO: 1 as an active ingredient. 제1항에 있어서, 상기 miRNA는 서열번호 1의 ccuucuu를 포함하는 27개의 연속적인 염기서열을 포함하고, 색소형성 유전자들의 발현을 억제하는 기능을 수행하는 염기서열을 더 포함함을 특징으로 하는 색소형성 유전자 발현 조절용 조성물.The dye according to claim 1, wherein the miRNA comprises 27 consecutive nucleotide sequences including ccuucuu of SEQ ID NO: 1, and further comprises a nucleotide sequence which performs a function of inhibiting the expression of pigmentation genes. Formation gene expression control composition. 제1항 또는 제2항에 있어서, 상기 색소형성 유전자는 티로시나아제, 티로시나아제 관련 단백질 1 및 멜란-A로 이루어진 군에서 선택된 1종 이상의 유전자임을 특징으로 하는 색소형성 유전자 발현 조절용 조성물.The method of claim 1 or 2, wherein the pigmentation gene is a composition for regulating pigmentation gene expression, characterized in that at least one gene selected from the group consisting of tyrosinase, tyrosinase-related protein 1 and melan-A. 제1항 또는 제2항에 있어서, 상기 miRNA는 멜란-A mRNA에 결합하여 멜란-A의 발현을 감소시키는 것을 특징으로 하는 색소형성 유전자 발현 조절용 조성물.The composition of claim 1 or 2, wherein the miRNA binds to melan-A mRNA to reduce the expression of melan-A. 제1항 또는 제2항에 있어서, 상기 miRNA는 멜란-A mRNA 3'-UTR의 909~915번째 핵산 분자를 표적으로 함을 특징으로 하는 색소형성 유전자 발현 조절용 조성물.The composition of claim 1 or 2, wherein the miRNA targets the nucleic acid molecules 909 to 915 of the melan-A mRNA 3'-UTR. 제1항 또는 제2항에 있어서, 상기 조성물은 피부 미백용 화장료 조성물인 것을 특징으로 하는 색소형성 유전자 발현 조절용 조성물.According to claim 1 or claim 2, wherein the composition is a composition for controlling pigmentation gene expression, characterized in that the cosmetic composition for skin whitening. 제1항 또는 제2항에 있어서, 상기 조성물은 피부 미백용 약학 조성물인 것을 특징으로 하는 색소형성 유전자 발현 조절용 조성물.According to claim 1 or 2, wherein the composition is a composition for controlling pigmentation gene expression, characterized in that the pharmaceutical composition for skin whitening. 서열번호 1의 miRNA에 상보적인 염기서열을 갖고, 상기 miRNA에 하이브리드될 수 있는 서열번호 2의 안티센스 핵산 분자를 유효성분으로 함유하는 색소형성 유전자 발현 조절용 조성물.Pigment forming gene expression control composition having a base sequence complementary to the miRNA of SEQ ID NO: 1, containing the antisense nucleic acid molecule of SEQ ID NO: 2 that can be hybridized to the miRNA as an active ingredient. 제8항에 있어서, 상기 안티센스 핵산 분자는 서열번호 2의 27개의 연속적인 염기서열을 포함하고, 색소형성 유전자들의 발현을 증가시키는 기능을 수행하는 염기서열을 더 포함함을 특징으로 하는 색소형성 유전자 발현 조절용 조성물.According to claim 8, wherein the antisense nucleic acid molecule comprises a 27 consecutive nucleotide sequence of SEQ ID NO: 2, the pigmentation gene, characterized in that further comprises a base sequence for performing a function to increase the expression of the pigmentation genes Composition for controlling expression. 제8항 또는 제9항에 있어서, 상기 색소형성 유전자는 티로시나아제, 티로시나아제 관련 단백질 1 및 멜란-A로 이루어진 군에서 선택된 1종 이상의 유전자임을 특징으로 하는 색소형성 유전자 발현 조절용 조성물.The composition for controlling pigmentation gene expression according to claim 8 or 9, wherein the pigmentation gene is at least one gene selected from the group consisting of tyrosinase, tyrosinase-related protein 1 and melan-A. 제8항 또는 제9항에 있어서, 상기 조성물은 백모 방지 또는 흑모 생성 촉진용 화장료 조성물인 것을 특징으로 하는 색소형성 유전자 발현 조절용 조성물.The composition for controlling pigmentation gene expression according to claim 8 or 9, wherein the composition is a cosmetic composition for preventing white hair or promoting hair growth. 제8항 또는 제9항에 있어서, 상기 조성물은 백모 방지 또는 흑모 생성 촉진용 약학 조성물인 것을 특징으로 하는 색소형성 유전자 발현 조절용 조성물.The method of claim 8 or 9, wherein the composition is a composition for controlling pigmentation gene expression, characterized in that the pharmaceutical composition for preventing white hair or promoting the production of black hair. 서열번호 1의 miRNA를 유효성분으로 함유하는 진피세포 재생 관련 유전자 발현 조절용 조성물.Composition for regulating dermal cell regeneration related gene expression containing miRNA of SEQ ID NO: 1 as an active ingredient. 제13항에 있어서, 상기 miRNA는 서열번호 1의 ccuucuu를 포함하는 27개의 연속적인 염기서열을 포함하고, 진시세포 재생 관련 유전자의 발현을 조절하는 기능을 수행하는 염기서열을 더 포함함을 특징으로 하는 진피세포 재생 관련 유전자 발현 조절용 조성물.The method according to claim 13, wherein the miRNA comprises 27 consecutive nucleotide sequences comprising the ccuucuu of SEQ ID NO: 1, and further comprises a nucleotide sequence for performing the function of regulating the expression of genes involved in cell regeneration Composition for regulating dermal cell regeneration-related gene expression. 제13항 또는 제14항에 있어서, 상기 진피세포 재생 관련 유전자는 트로포미오신 3 및 아그레칸 중 1종 이상의 유전자임을 특징으로 하는 진피세포 재생 관련 유전자 발현 조절용 조성물.The method of claim 13 or claim 14, wherein the dermal cell regeneration-related gene is a composition for regulating dermal cell regeneration-related gene expression, characterized in that one or more genes of tropomyosin 3 and agrecan. 제13항 또는 제14항에 있어서, 상기 miRNA는 트로포미오신 3 mRNA에 결합하여 트로포미오신 3의 발현을 감소시키는 것을 특징으로 하는 진피세포 재생 관련 유전자 발현 조절용 조성물.15. The method of claim 13 or 14, wherein the miRNA binds to tropomyosin 3 mRNA, the composition for regulating dermal cell regeneration-related gene expression, characterized in that to reduce the expression of tropomyosin 3. 제13항 또는 제14항에 있어서, 상기 miRNA는 트로포미오신 3 mRNA 3'-UTR의 239~245번째 핵산 분자를 표적으로 하는 진피세포 재생 관련 유전자 발현 조절용 조성물.The method of claim 13 or 14, wherein the miRNA is a composition for regulating dermal cell regeneration-related gene expression targeting the 239-245th nucleic acid molecule of tropomyosin 3 mRNA 3'-UTR. 제13항 또는 제14항에 있어서, 상기 조성물은 진피세포의 이동성 조절 관련 유전자의 발현을 감소시키는 화장료 조성물인 것을 특징으로 하는 진피세포 재생 관련 유전자 발현 조절용 조성물.15. The method of claim 13 or claim 14, wherein the composition is a composition for controlling gene expression related to dermal cell regeneration, characterized in that the cosmetic composition for reducing the expression of genes related to mobility control of the dermal cells. 제13항 또는 제14항에 있어서, 상기 조성물은 진피세포의 이동성 조절 관련 유전자의 발현을 감소시키는 약학 조성물인 것을 특징으로 하는 진피세포 재생 관련 유전자 발현 조절용 조성물.The method of claim 13 or 14, wherein the composition is a pharmaceutical composition for regulating dermal cell regeneration-related gene expression, characterized in that the pharmaceutical composition for reducing the expression of genes related to the regulation of mobility of dermal cells. (a) 서열번호 1의 miRNA 또는 서열번호 2의 안티센스 핵산 분자를 세포에 트랜스펙션시키는 단계;
(b) 상기 세포에 시험 물질을 처리하는 단계; 및
(c) 상기 시험물질이 색소형성 유전자의 발현을 촉진하는지 또는 억제하는지 여부를 확인하는 단계;
를 포함하는 색소형성 유전자 발현을 조절하는 물질을 스크리닝하는 방법.(a) transfecting a cell with a miRNA of SEQ ID NO: 1 or an antisense nucleic acid molecule of SEQ ID NO: 2;
(b) treating the cell with a test substance; And
(c) confirming whether the test substance promotes or inhibits expression of the pigmentation gene;
Method for screening a substance that controls the pigmentation gene expression comprising a. 제20항에 있어서, 상기 (c) 단계의 확인 결과, 상기 시험물질이 색소형성 유전자의 발현, 활성 또는 기능을 증가시키는 경우는 색소형성 유전자의 촉진제로 판정하는 단계를 더 포함하는 것을 특징으로 하는 색소형성 유전자 발현을 조절하는 물질을 스크리닝 하는 방법.21. The method of claim 20, wherein as a result of confirming the step (c), when the test substance increases the expression, activity or function of the pigment forming gene, the method further comprises determining as a promoter of the pigment forming gene. A method for screening a substance that controls pigmentation gene expression. 제20항에 있어서, 상기 (c) 단계의 확인 결과, 상기 시험물질이 색소형성 유전자의 발현, 활성 또는 기능을 감소시키는 경우는 색소형성 유전자의 저해제로 판정하는 단계를 더 포함하는 것을 특징으로 하는 색소형성 유전자 발현을 조절하는 물질을 스크리닝 하는 방법.21. The method of claim 20, wherein as a result of confirming the step (c), when the test substance decreases the expression, activity or function of the pigment forming gene, the method further comprises determining as an inhibitor of the pigment forming gene. A method for screening a substance that controls pigmentation gene expression. (a) 서열번호 1의 miRNA를 세포에 트랜스펙션시키는 단계;
(b) 상기 세포에 시험 물질을 처리하는 단계; 및
(c) 상기 시험물질이 진피세포의 이동성 조절 관련 유전자의 발현을 촉진하는지 또는 억제하는지 여부를 확인하는 단계;
를 포함하는 진피세포의 재생을 촉진하는 물질을 스크리닝하는 방법.(a) transfecting the cell with the miRNA of SEQ ID NO: 1;
(b) treating the cell with a test substance; And
(c) confirming whether the test substance promotes or inhibits expression of genes related to mobility control of dermal cells;
Method for screening a substance for promoting regeneration of dermal cells comprising a. 제23항에 있어서, 상기 (c) 단계의 확인 결과, 상기 시험물질이 진피세포의 이동성 조절 관련 유전자의 발현, 활성 또는 기능을 증가시키는 경우는 진피세포의 이동성 조절 관련 유전자의 촉진제로 판정하는 단계를 더 포함하는 것을 특징으로 하는 진피세포의 재생을 촉진하는 물질을 스크리닝하는 방법.24. The method of claim 23, wherein as a result of confirming the step (c), when the test substance increases the expression, activity, or function of the genes related to the regulation of mobility of dermal cells, determining the promoter of the genes related to the regulation of mobility of dermal cells Method for screening a substance for promoting regeneration of dermal cells further comprising. 제23항에 있어서, 상기 (c) 단계의 확인 결과, 상기 시험물질이 진피세포의 이동성 조절 관련 유전자의 발현, 활성 또는 기능을 감소시키는 경우는 진피세포의 이동성 조절 관련 유전자의 저해제로 판정하는 단계를 더 포함하는 것을 특징으로 하는 진피세포의 재생을 촉진하는 물질을 스크리닝 하는 방법.24. The method of claim 23, wherein as a result of confirming the step (c), when the test substance decreases the expression, activity or function of the genes related to mobility control of dermal cells, determining the inhibitors of genes related to mobility control of dermal cells Method for screening a substance for promoting the regeneration of dermal cells further comprising.
KR1020110059227A 2011-06-17 2011-06-17 Composition containing microrna KR20120139430A (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
KR1020110059227A KR20120139430A (en) 2011-06-17 2011-06-17 Composition containing microrna

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
KR1020110059227A KR20120139430A (en) 2011-06-17 2011-06-17 Composition containing microrna

Related Child Applications (1)

Application Number Title Priority Date Filing Date
KR1020170098819A Division KR101871920B1 (en) 2017-08-04 2017-08-04 Composition containing microRNA

Publications (1)

Publication Number Publication Date
KR20120139430A true KR20120139430A (en) 2012-12-27

Family

ID=47905912

Family Applications (1)

Application Number Title Priority Date Filing Date
KR1020110059227A KR20120139430A (en) 2011-06-17 2011-06-17 Composition containing microrna

Country Status (1)

Country Link
KR (1) KR20120139430A (en)

Similar Documents

Publication Publication Date Title
KR101938548B1 (en) Composition for regulating expression of pigmentation-related genes containing microRNA
CN104622704B (en) With the method for Microrna modulators for treatment skin
KR101849102B1 (en) Composition for regulating expression of pigmentation-related genes containing microRNA
WO2019017356A1 (en) Method for screening anti-aging substances
Zhao et al. Suppression of FGF5 and FGF18 expression by cholesterol-modified siRNAs promotes hair growth in mice
EP3656850A1 (en) Mesenchymal-stem-cell induction agent
KR102692717B1 (en) A composition for skin brightening comprising TNFRSF14 inhibiting materials and a method for screening TNFRSF14 inhibiting materials
KR101032271B1 (en) Composition of regenerating skin cell, method of manufacturing the same, method of regenerating skin cell and cosmetic composition
KR101871920B1 (en) Composition containing microRNA
US9295631B2 (en) Skin lightening composition
JP6230545B2 (en) Use of microRNA molecules that affect skin pigmentation
KR102682748B1 (en) A composition for skin brightening comprising SH3BP4 inhibiting materials and a method for screening SH3BP4 inhibiting materials
KR20170063263A (en) Composition for inhibiting melanoma metastasis comprising miRNA
Zhang et al. Use of small RNA as antiaging cosmeceuticals
KR102187371B1 (en) adipose-derived stem cell overexpressing FoxQ1 and uses thereof
JP6324597B1 (en) Melanin production inhibitor, whitening agent, gene expression inhibitor, cosmetic composition for inhibiting melanin production, and cosmetic composition for whitening
KR20120139430A (en) Composition containing microrna
KR101800243B1 (en) Composition for regulating expression of pigmentation-related genes containing microRNA
KR101893339B1 (en) Composition comprising GDF11 and uses thereof
KR101841713B1 (en) Oligonucleotides down-regulating the expression of TSLP and the composites for cosmetic or pharmaceutical
KR102027451B1 (en) Micro RNA, and screening method using the micro RNA
KR20160016475A (en) Oligonucleotides down-regulating the expression of TSLP and the composites for cosmetic or pharmaceutical
KR102011826B1 (en) Skin external composition interleukin 13
KR102674715B1 (en) Method for extending telomere length of stem cell
KR101852440B1 (en) Composition for control of skin cell differentiation comprising DUOX 2 miRNA

Legal Events

Date Code Title Description
A201 Request for examination
E902 Notification of reason for refusal
A107 Divisional application of patent
E601 Decision to refuse application