KR20120132594A - Cancer gene therapeutic agent through regulation using microRNA - Google Patents

Abstract

PURPOSE: A cancer-specific gene therapeutic agent using microRNA is provided to regulate expression of an expression vector during post-transcription and to reduce side effects. CONSTITUTION: An expression vector contains a promoter, a trans-splicing ribozyme coding DNA which is operatively linked with the promoter and acts in a cancer-specific gene; and a microRNA target sequence coding DNA. The expression vector additionally contains a therapeutic gene or reporter gene. The cancer-specific gene is hTERT(human telomerase reverse transcriptase). The ribozyme is trans-splicing group I intron ribozyme which specifically targets hTERT mRNA. The reporter gene is firefly luciferase gene or renillar luciferase. The promoter is a promoter of PEPCK(phosphoenolpyruvate carboxykinase) gene. The expression vector contains a base sequence selected from sequence numbers 4-9. A pharmaceutical composition for anti-cancer contains the expression vector as an active ingredient.

Description

Cancer gene therapeutic agent through regulation using microRNA

The present invention relates to a gene therapeutic agent having cancer-specific anticancer and diagnostic effects by controlling the expression of expression vectors in the post-transcriptional process using microRNA.

Most of the cancer treatments to date have been performed using surgery (surgery) and radiation therapy, or chemotherapy if systemic treatment is needed. However, these therapies do not specifically kill cancer cells but also damage normal cells, causing various side effects such as secondary infection and risk of bleeding. Therefore, in recent years, therapies that are different from these therapies have been studied. Among them, gene therapies have been actively studied.

Gene therapy refers to a method of genetically treating a congenital or acquired gene abnormality that is difficult to treat by conventional methods. Specifically, gene therapy may be performed by expressing therapeutic proteins by administering genetic material such as DNA and RNA in the human body to treat and prevent chronic diseases such as congenital or acquired genetic defects, viral diseases, cancer or cardiovascular diseases. As a treatment method to suppress the expression of a specific protein, it is expected to overcome the incurable disease as well as to replace the existing medical methods, since the cause of the disease can be interpreted at the genetic level.

Many gene therapies have been attempted to induce cancer cell death by finding and removing cancer cell specific target genes or by expressing toxic substances using cancer promoters, but each has its limitations and disadvantages.

Specifically, a method of using a tissue-specific promoter instead of CMV or RSV has been considered, but the disadvantage of decreasing gene expression function by about 50 to 300 times instead of increasing specificity (Kuhnnel et al., Cancer Gene Therapy 11 : 28-40, 2004) and the use of tissue specific promoters may lose their specificity when present in a transgenic viral vector (Gene Ther. 1996; 3: 1094, Trends Mol. Med. 2003; 9: 421).

On the other hand, Tetrahymena Thermo pillar (Tetrahymena It has been reported that the group I intron ribozyme from Thermophila can perform trans-splicing reactions not only in vitro but also in bacteria and further in human cells, thereby linking two separate transcripts to each other (Been, M. et Jones, JT, et al., 1996, Nat Med. 2: 643-648).

Thus, by trans-splicing ribozymes based on group I introns, specific RNAs that are not expressed in disease-related gene transcripts or normal cells but specifically expressed in diseased cells are targeted to the RNA. It can be a very disease specific and safe gene therapy technique by causing the reprogramming to be corrected with normal RNA or replaced with a new therapeutic gene transcript. In particular, since the target RNA is expressed in the cell and replaced with a desired gene product, the amount of gene expression to be introduced can be controlled. In addition, trans-splicing ribozymes can induce expression of therapeutic gene products we desire while eliminating disease specific RNA, thus doubling the therapeutic effect.

Human Telomerase reverse transcriptase (hTERT) is one of the most important enzymes that regulates cancer cell's immortality and proliferation ability, and this telomerase is found in endlessly replicating germ cells, hematopoietic cells and cancer cells. To telomerase activity, but normal cells around cancer cells do not have that activity (Bryan, TM et al., 1999, Curr. Opin. Cell Biol. 11; 318-324). Attempts have recently been made to inhibit the proliferation of cancer cells by developing telomerase inhibitors involved in cell growth using this property of telomerase (Bryan, TM et al, 1995, Embo J. 14; 4240). -4248; Artandi, SE et al., 2000, Nat. Med. 6; 852-855).

The inventors have repeatedly inserted the target sequence for a specific microRNA not expressed in cancer cells into the 3 'UTR region of the ribozyme so that expression of the expression vector is regulated in the post-transcriptional process. Significantly reduce the side effects that appear and can further enhance cancer specificity compared to the prior art, it was confirmed that the excellent therapeutic efficacy, based on this, the present invention was completed.

The present invention is a promoter; A trans-splicing ribozyme coding DNA that acts on a cancer specific gene, operably linked to said promoter; And a microRNA target sequence coding DNA contained in the 3 ′ UTR corresponding site of the ribozyme, wherein the microRNA is not expressed in cancer cells.

In addition, the present invention is to provide an anticancer pharmaceutical composition and cancer diagnostic composition comprising the expression vector as an active ingredient.

In addition, the present invention comprises the steps of introducing the expression vector to cancer cells; And to provide a method for providing information for the diagnosis of cancer comprising the step of detecting the reporter protein in cancer cells.

In addition, the present invention includes the steps of operatively linking a trans-splicing ribozyme coding DNA to a promoter that acts on a cancer specific gene; And including a microRNA target sequence coding DNA in the 3′UTR corresponding site of the ribozyme, wherein the microRNA is not expressed in cancer cells.

In one aspect, the invention provides a promoter; A trans-splicing ribozyme coding DNA that acts on a cancer specific gene, operably linked to said promoter; And a microRNA target sequence coding DNA contained in the 3 ′ UTR corresponding site of the ribozyme, wherein the microRNA is not expressed in cancer cells.

In the present invention, by repeatedly inserting the target sequence for a specific microRNA (microRNA, miRNA) not expressed in cancer cells into the 3 'UTR region of the ribozyme, expression of the expression vector is controlled in the post-transcriptional process. The microRNA target sequence may be an antisense sequence of the microRNA, and the microRNA target sequence may include one or more, preferably two to three. That is, in non-cancer cells, microRNAs are expressed so that the intracellular microRNAs bind to the microRNA target sequences, thereby inhibiting and inactivating the expression of trans-splicing ribozymes acting on cancer-specific genes. In non-expressing cancer cells, the expression and function of trans-splicing ribozymes that act on cancer-specific genes are activated to further emphasize cancer-specific effects.

That is, in a trans-splicing ribozyme acting on a cancer specific gene, the cancer specific gene may also be present in normal cells rather than cancer cells (e.g., the telomerase activity of hTERT is associated with hematopoietic stem cells and normal cells). May also appear in cells); In a method of controlling cancer cell-specific expression at the transcriptional level using a tissue-specific promoter, the tissue-specific promoter may lose its specificity when present in a transgenic virus vector (Gene Ther. 1996; 3: 1094). , Trends Mol. Med. 2003; 9: 421). The strategy for the expression of the expression vector to be regulated in the post-transcriptional process by repeatedly inserting a target sequence for a specific microRNA not expressed in cancer cells of the present invention into the 3 'UTR region of the ribozyme is a cell in normal cells. Significantly reduce the side effects of toxicity and further enhance cancer specificity.

In the present invention, the microRNA is a single-stranded RNA molecule of 19-25 nt length, endogenous hairpin-shaped transcript (Bartel, DP, Cell 116: 281-297, 2004; Kim, VN, Mol. It acts to inhibit target genes by inducing translation inhibition and mRNA destabilization. miRNAs are known to play an important role in various processes such as development, differentiation, proliferation, apoptosis and metabolism, and little miRNAs are expressed in cancer cells.

In a specific embodiment of the present invention by using the blood cell-specific miR-181a and normal hepatocyte-specific miR-122 as a specific microRNA inhibits the induction of non-specific cell death in blood cells and normal hepatocytes by the activity of ribozyme, Liver cancer specific expression of the expression vector was induced. In the case of the ribozyme including the target sequence (miR-181aT) for miR181a, which is specifically expressed in blood cells, it was confirmed that nonspecific activity in blood cells is suppressed and cancer cell treatment is induced through specific activity in liver cancer cells. In addition, it was confirmed that the ribozyme including the target sequence of miR122a (miR-122aT) that is specifically expressed in hepatocytes inhibits nonspecific activity in normal hepatocytes and induces cancer cell treatment through specific activity in hepatic cancer cells.

The expression vector of the present invention may further comprise a therapeutic gene or reporter gene, linked to the 3 'side exon corresponding site of the ribozyme.

In the present invention, an "expression vector" refers to a gene construct that is capable of expressing a target protein or target RNA in a suitable host cell, and includes a gene regulatory element operably linked to express the gene insert. The expression vector may preferably be a viral vector. More preferably, they may be adenovirus vectors with high efficiency of gene transfer, the ability to transfer genes into undifferentiated cells, and the ease of preparing high titers of viral storage. Adenovirus vectors delete a series of genes essential for replication and induce high expression of the therapeutic protein in vivo with a cytomegalovirus (CMV) or loose sarcoma virus (RSV) promoter with high levels of promoter activity. can do.

As used herein, "promoter" refers to a nucleic acid sequence that regulates the expression of another nucleic acid sequence operably linked in a suitable host cell, and in the present invention "operably linked" refers to nucleic acid expression to perform a general function. It refers to a functional linkage between a regulatory sequence and a nucleic acid sequence encoding a protein or RNA of interest. For example, a promoter and a nucleic acid sequence encoding a protein or RNA may be operably linked to affect expression of the coding sequence. Operative linkage with expression vectors can be prepared using genetic recombination techniques well known in the art, and site-specific DNA cleavage and ligation employs enzymes and the like generally known in the art.

The promoter may be constitutive or inducible, preferably may be specifically activated in specific tissues, and more preferably may be a promoter that is specifically activated for cancer cells. Typically, liver tissue specific phosphoenolpyruvate carboxykinase (PEPCK) gene, apolipoprotein E gene, serum albumin gene; Liver cancer specific AFP (alphafetoprotein) gene; Colorectal cancer specific carcinoembryonic antigen (CEA) gene; Or a promoter of prostate-specific antigen (PSA) gene, but is not limited thereto. Most preferably, a promoter of the PEPCK gene that exhibits tissue specificity in which expression in the liver is most evident can be used.

Trans-splicing ribozymes that act on the cancer specific genes perform a trans-splicing reaction by targeting specific cancer specific genes expressed in cells. The ribozyme is to inactivate the cancer specific gene by performing a trans-splicing reaction by recognizing the mRNA of the cancer specific gene, and the therapeutic or reporter gene is added to the 3'-side exon corresponding site of the ribozyme. When linked, the ribozyme may act to link the therapeutic gene or reporter gene to the cancer specific gene by performing a trans-splicing reaction by recognizing the mRNA of the cancer specific gene. Through this action, cancer cells can selectively inactivate cancer progression and abnormal proliferation of cells, and cancer cells can be selectively induced to treat cancer, and cancer cells can be selectively diagnosed.

In this case, the cancer-specific gene refers to a gene specifically expressed in cancer cells, typically, human telomerase reverse transcriptase (hTERT), alphafetoprotein (AFP), carcinoembryonic antigen (CEA), prostate-specific antigen (PSA), or Cytoskeleton-associated protein 2 (CKAP2) may be used, but the present invention is not limited thereto, and preferably hTERT.

The ribozyme of the present invention can be used as long as it links a new therapeutic gene (or reporter gene) to a cancer specific gene by performing a trans-splicing reaction by targeting a gene specific to cancer. Representatives include hTERT target trans-splicing Group I intron ribozymes, which have demonstrated the ability to specifically recognize and trans-splice the mRNA of hTERT (human telomerase reverse transcriptase), a cancer-specific RNA transcript In a specific embodiment of the present invention, tetrahimena I was used that group I intron See Lai of Thermo pillar (Tetrahymena Thermophila).

The "therapeutic gene" of the present invention refers to a nucleotide sequence that is expressed in cancer cells to exhibit a therapeutic effect. For example, drug susceptibility genes, apoptosis genes, cytostatic genes, cytotoxic genes, tumor suppressor genes, antigenic genes, antiangiogenic genes, cytokine genes, and the like, are not limited thereto.

The drug-sensitive gene (drug-sensitizing gene) is also called a suicide gene because a cell into which the gene is introduced is killed as a gene for an enzyme that converts a non-toxic precursor (prodrug) into a toxic substance. In other words, when a non-toxic precursor is administered systemically to a normal cell, the precursor is converted into a toxic metabolite only to cancer cells, thereby destroying cancer cells by changing sensitivity to drugs. Typically, HSV-tk (Herpes simplex virus-thymidine kinase) gene, ganciclovir, E. coli cytosine deaminase (CD) gene and 5-fluorocytosine (5-FC) Is possible.

The proapoptotic gene refers to a nucleotide sequence that is expressed to induce programmed cell death. Apoptosis genes known to those skilled in the art, encoding p53, adenovirus E3-11.6K (from Ad2 and Ad5) or adenovirus E3-10.5K (from Ad), adenovirus E4 gene, p53 pathway gene and caspase Genes are included.

The cytostatic gene refers to a nucleotide sequence that is expressed in a cell and stops the cell cycle during the cell cycle. Typically p21, retinoblastoma gene, E2F-Rb fusion protein gene, genes encoding cyclin-dependent kinase inhibitors (eg p16, p15, p18 and p19), growth arrest specific homeobox , GAX) genes (WO 97/16459 and WO 96/30385).

The cytotoxic gene refers to a nucleotide sequence that is expressed in a cell and exhibits a toxic effect. For example, there are nucleotide sequences encoding Pseudomonas exotoxin, lysine toxin, diphtheria toxin, and the like.

The tumor suppressor gene refers to a nucleotide sequence that can be expressed in a target cell to suppress a tumor phenotype or induce apoptosis. Tumor necrosis factor-α (TNF-α), p53 gene, APC gene, DPC-4 / Smad4 gene, BRCA-1 gene, BRCA-2 gene, WT-1 gene, retinoblastoma gene (Lee) et al., Nature, 329,642, 1987), MMAC-1 gene, adenomatous polyposis coil protein (Albertsen et al. US Pat. No. 5,783,666), missing colon tumor (DCC) gene, MMSC-2 gene, NF-1 gene, nasopharyngeal tumor suppressor gene located on chromosome 3p21.3 (Cheng et al. Proc. Nat. Acad. Sci., 95,3042-3047, 1998), MTS1 gene, CDK4 gene , NF-1 gene, NF-2 gene and VHL gene.

The antigenic gene refers to a nucleotide sequence that is expressed in target cells to produce cell surface antigenic proteins that can be recognized by the immune system. Examples of antigenic genes known to those skilled in the art include carcinoembryonic antigens (CEAs) and p53 (Levine, A., WO 94/02167).

The cytokine gene refers to a nucleotide sequence that is expressed in a cell to produce a cytokine. Representatively GM-CSF, interleukin (IL-1, IL-2, IL-4, IL-12, IL-10, IL-19, IL-20), interferon α, β, γ (interferon α-2b) and Fusions such as interferon α-2α-1 and the like.

The anti-angiogenic gene refers to a nucleotide sequence that is expressed to release anti-angiogenic factors out of the cell. Examples include angiostatin, inhibitors of vascular endothelial growth factor (VEGF), endostatin, and the like.

The reporter gene of the present invention is expressed as a reporter protein according to the transcriptional activity of the promoter by conjugation to the cancer specific gene by a trans-splicing ribozyme acting on the cancer specific gene. Cancer cells can be diagnosed by measuring the activity or amount of the reporter protein thus expressed. In this case, the reporter gene may be one known in the art to which the present invention pertains. Preferably, LacZ, chloramphenicol acetyl transferase (CAT), Renila luciferase, and firefly luciferase Genes encoding red fluorescent protein (RFP), green fluorescent protein (GFP), secreted placental alkaline phosphatase (SEAP) or HSV-tk (Herpes simplex virus-thymidine kinase) can be used. .

The activity of these reporter proteins is shown by firefly luciferase (see de Wet J. et al., Mol. Cell Biol., 7, 725-737, 1987) and Renilla luciferase (Lorenz WW et al., PNAS). 88, 4438-42, 1991), chloramphenicol acetyl transferase (see Gorman C. et al., Mol. Cell Biol., 2, 1044-1051, 1982), LacZ (Hall CV et al., J. Mol) Genel., 2,101-109, 1983), human growth hormone (see Selden R. et al., Mol. Cell Biol., 6, 3173-3179, 1986), green fluorescent protein (Chalfie M. et. al., Science, 263, 802-805, 1994) and secretory placental alkaline phosphatase (see Berger, J. et al., Gene, 66, 1-10, 1988). It can be measured using the method. In addition, when thymidine kinase is used as a reporter protein, a positron emission tomography (PET) imaging method may be used.

In one embodiment of the present invention, the expression vector of the present invention may include a nucleotide sequence represented by a base sequence selected from SEQ ID NO: 4 to SEQ ID NO: 9, the promoter is a base represented by SEQ ID NO: 10 or SEQ ID NO: 11 It may have a sequence, the ribozyme coding DNA may have a nucleotide sequence represented by SEQ ID NO: 12 or SEQ ID NO: 16, the therapeutic gene has a nucleotide sequence represented by SEQ ID NO: 13 or SEQ ID NO: 17 The reporter gene may have a nucleotide sequence represented by SEQ ID NO: 14 or SEQ ID NO: 15, and the microRNA target sequence coding DNA may have a nucleotide sequence represented by SEQ ID NO: 1 or 2.

Specifically, SEQ ID NO: 4 is CMV Rib-TK-mir181aT (2x), SEQ ID NO: 5 is PEPCK Rib-TK-mir181aT (2x), SEQ ID NO: 6 is CMV hRib TK-mir122T (3x), and SEQ ID NO: 7 is PEPCK hRib -TK-mir122T (3x), SEQ ID NO: 8 is CMV mRib-TK-mir122T (3x), SEQ ID NO: 9 is the sequence of PEPCK mRib-TK-mir122T (3x). SEQ ID NO: 10 is a CMV promoter, SEQ ID NO: 11 is a PEPCK promoter sequence, SEQ ID NO: 12 is an hTERT targeting ribozyme coding DNA sequence, SEQ ID NO: 16 is an mTERT targeting ribozyme coding DNA sequence, and SEQ ID NOs: 13 and 17 are tk Gene sequence. SEQ ID NO: 14 is a firefly luciferase sequence, and SEQ ID NO: 15 is a lenilla luciferase sequence.

As another aspect, the present invention provides an anticancer pharmaceutical composition comprising the expression vector as an active ingredient, and a method for treating cancer. Specifically, the method may include administering the expression vector of the present invention to a cancer patient. The anticancer pharmaceutical composition does not have cytotoxicity in cells other than cancer cells. Specifically, in non-cancer cells, intracellular microRNA binds to the microRNA target sequence, thereby inactivating the trans-splicing ribozymes acting on cancer specific genes. In a specific embodiment of the present invention, by including a target sequence for microRNA that is tissue specific and not expressed in cancer cells, the activity of ribozyme is inhibited in normal tissues where the microRNA is expressed, and the ribozyme activity in cancer cells is It was specifically increased, and it was confirmed that the induction of cell death of liver cancer cells effectively.

The anticancer pharmaceutical composition of the present invention may be preferably formulated into a pharmaceutical composition including one or more pharmaceutically acceptable carriers in addition to the active ingredients described above for administration.

The pharmaceutically acceptable carrier included in the composition of the present invention is commonly used in the preparation, and the acceptable pharmaceutical carrier in the composition formulated into a liquid solution is sterile and biocompatible, and is saline, sterile water. , Ringer's solution, buffered saline solution, albumin injection solution, dextrose solution, maltodextrin solution, glycerol, ethanol and one or more of these components can be mixed and used as needed, and other conventional additives such as antioxidants, buffers, bacteriostatic agents, etc. Can be added. In addition, diluents, dispersants, surfactants, binders, and lubricants may be additionally added to formulate into injectable formulations, pills, capsules, granules, or tablets, such as aqueous solutions, suspensions, emulsions, and the like, which will act specifically on target organs. Target organ specific antibodies or other ligands can be used in combination with the carriers.

Since the composition of the present invention exhibits antitumor efficacy against various tumor cells, the pharmaceutical composition of the present invention can be used for various diseases or diseases related to tumors such as brain cancer, stomach cancer, lung cancer, breast cancer, ovarian cancer, liver cancer, Can be used for the treatment of cancer of the head and neck, larynx cancer, esophageal cancer, pancreatic cancer, bladder cancer, prostate cancer, colon cancer, colon cancer, osteocarcinoma, skin cancer, thyroid cancer, papillary cancer, ureter cancer and cervical cancer.

The pharmaceutical composition of the present invention is preferably parenteral administration, and may be administered using, for example, intravenous administration, intraperitoneal administration, intratumoral administration, intramuscular administration, subcutaneous administration, or topical administration, but is not limited thereto. . For example, intraperitoneal administration in ovarian cancer and in the portal vein in liver cancer can be administered by infusion method, in the case of breast cancer and head and neck cancer can be administered by injection directly into the tumor mass, in the case of colon cancer It can be administered by injection directly into the enema, in the case of bladder cancer can be administered by injection directly into the catheter.

The dosage of the anticancer pharmaceutical composition of the present invention may be determined by the type of the disease, the severity of the disease, the type and amount of the active ingredient and other ingredients contained in the composition, the type of the dosage form, and the age, weight, general state of health, sex and diet of the patient. It can be adjusted according to various factors including the time of administration, the route of administration and the rate of secretion of the composition, the duration of treatment, and the drugs used simultaneously.

The pharmaceutical composition of the present invention can be used alone or in combination with adjuvant treatment methods such as surgical surgery. Chemotherapeutic agents that can be used with the compositions of the invention include cisplatin, carboplatin carboplatin, procarbazine, mechlorethamine, cyclophosphamide ), Ifosfamide, melphalan, chlorambucil, bisulfan, nitrosourea, diactinomycin, daunorubicin, doxorubicin, doxorubicin (doxorubicin), bleomycin, blecomycin, plicomycin, mitomycin, etoposide, tamoxifen, taxol, transplatinum, 5- 5-fluorouracil, vincristin, vinblastin, methotrexate, and the like.

Radiation therapy that can be used with the composition of the present invention is X-ray irradiation, γ-ray irradiation, and the like. It is preferably used in combination with ganciclovir.

As another aspect, the present invention provides a composition for diagnosing cancer comprising the expression vector including the reporter gene as an active ingredient, and a method for providing information for diagnosing cancer. Specifically, the method comprises the steps of introducing the expression vector of the present invention comprising the reporter gene into cancer cells; And detecting the reporter protein in cancer cells.

The reporter gene of the present invention is expressed as a reporter protein according to the transcriptional activity of the promoter by conjugation to the cancer specific gene by trans-splicing ribozymes acting on the cancer specific gene only in cancer cells that do not express the microRNA. Only cancer cells can be selectively diagnosed by measuring the activity or amount of the expressed reporter protein. Determination of the activity or amount of the reporter protein may use methods known in the art described above.

The cancer or tumor that can be diagnosed by the present invention is not particularly limited, and preferably, gastric cancer, lung cancer, breast cancer, ovarian cancer, liver cancer, bronchial cancer, nasopharyngeal cancer, laryngeal cancer, pancreatic cancer, bladder cancer, colon cancer, colon cancer, uterus Cervical cancer, brain cancer, prostate cancer, bone cancer, skin cancer, thyroid cancer, parathyroid cancer or ureter cancer, most preferably liver cancer.

According to a specific embodiment of the present invention, all of the reporter activity in miR181a + cells was significantly reduced by up to 60% or more, while in miR181a-in cells, all of the reporter activities were significantly increased than in miR181a + cells (FIGS. 2 and 3). In addition, when 122aT was inserted into the 3'-UTR of the reporter construct, it was confirmed that miR-122a significantly reduced the expression of the reporter gene, and when the control group 16T was inserted, it was confirmed that it was not. These results show that the expression vector of the present invention can be used for diagnosis of cancer cells in vivo.

In another aspect, the present invention provides a method of activating a trans-splicing ribozyme coding DNA that acts on a cancer specific gene with a promoter; And including the microRNA target sequence coding DNA in the 3′UTR corresponding site of the ribozyme, wherein the microRNA is not expressed in cancer cells. The method may further comprise linking a therapeutic or reporter gene to the 3 'side exon corresponding site of the ribozyme.

Using the present invention, by repeatedly including the target sequence for a particular microRNA that is not expressed in cancer cells in the 3 'UTR region of the ribozyme, the expression of the expression vector is regulated in the post-transcriptional process, thereby preventing cytotoxicity in normal cells. Significantly reduce side effects and reinforce the cancer specificity compared to the prior art, there is an advantage of excellent cancer treatment efficacy by introducing a therapeutic gene specifically for cancer cells. In addition, it can be used as a diagnostic agent and an in vivo imaging agent that can diagnose cancer progress specifically cancer.

1 shows a construct in which the miR-181aT sequence is repeatedly inserted two or three times in a XhoI region into a 3′-UTR region of Rib21AS, and a scrambled construct as a negative control.
Figure 2 is a graph comparing the reporter activity by CRF-181aT (CMV Rib-F.luc-miR181aT) in Jurkat, TF-1a, HeLa cells miR181a +.
3 is a graph comparing reporter activity by CRF-181aT in Hep3B, HepG2, and MCF7 cells, miR181a-.
Figure 4 shows a structure in which the miR-181aT sequence was repeatedly inserted two or three times in a 3st-UTR region of Rib21AS tagged with the TK gene and inserted into the BstBI region.
5 is a graph comparing cell death induction activity by CRT (x2) (CMV Rib-TK-miR181aT (x2)), CRT (x3) (CMV Rib-TK-miR181aT (x3)) in TF-1a cells with miR181a + to be.
Figure 6 is a graph comparing the cell death induced activity by CRT-181aT in Hep3B, HepG2 cells miR181a-.
FIG. 7 shows miR-181a, a hematopoietic cell precursor specific microRNA at the 3′-UTR region of a TK gene tagged ribozyme (a trans-splicing ribozyme capable of specifically replacing hTERT) Adenovirus (Ad CMV Rib-TK-miR181aT (2x), capable of expressing a construct in which the antisense sequence (miR-181aT, 5'-ACTCAGCGACAGCGTTGAATGTT-3 ') was repeatedly inserted two or three times under the CMV promoter, Ad CMV Rib-TK-miR181aT (3x)) and control adenovirus (viral vector expressing TK tagged ribozyme under CMV promoter; Ad CMV Rib-TK, viral vector expressing TK gene under CMV promoter; Ad CMV- It is a schematic diagram of TK).
FIG. 8 shows miR-181a, a hematopoietic cell precursor specific microRNA at the 3′-UTR site of a ribozyme tagged with TK gene (a trans-splicing ribozyme capable of specifically replacing hTERT) Adenovirus (Ad PEPCK Rib-TK-miR181aT (2x), capable of expressing a construct in which the antisense sequence (miR-181aT, 5'-ACTCAGCGACAGCGTTGAATGTT-3 ') was repeatedly inserted two or three times under the PEPCK promoter, Viral vectors expressing Ad CMV Rib-TK-miR181aT (3x) and control adenovirus (TK tagged ribozymes under PEPCK promoter; viral vectors expressing TK gene under Ad PEPCK Rib-TK, PEPCK promoter; Ad PEPCK- It is a schematic diagram of the structure constructed with TK).
9 is a graph comparing cell death induction activity by CRT (Ad CMV Rib-TK) in Hep3B, HepG2, and Hela cells of miR181a-.
Figure 10 shows the result of RT-PCR 48 hours after 50MOI infection of each adenovirus to Hep3B cells.
FIG. 11 shows PRTs (Ad PEPCK Rib-TK), PRT-miR181 (Ad PEPCK Rib-TK-miR181aT (2 ×) in tumors transplanted into the spleen with Hep3B cells (liver cancer) in the amount of 3 × 10 6 cells )) (1 × 109 vp) is injected, and the control group is a graph showing tumor weight after injection of PBS, PT (Ad PEPCK-TK) (1 × 109 vp) virus.
Figure 12 shows injection of normal mice without tumors in amounts of 1.0 × 10 9 pfu of PT (Ad PEPCK-TK), PRT (Ad PEPCK Rib-TK), PRT-miR181 (Ad PEPCK Rib-TK-miR181aT (2x)) After the injection of GCV for 10 days after the measurement of the shape of the liver and the amount of enzyme coming out of the liver is a graph.
Fig. 13 is a photograph of liver tissue extracted from a mouse.
14 is a picture of the liver of the mouse observed under a microscope.
15 is a schematic diagram and mouse of the construct (TK-R.luc-miR122aT / TK-R.luc-Let 7a_control) in which the miR-122aT sequence was inserted three times into the 3'-UTR of the reporter gene (Renillar luciferase) This is a graph comparing miR-122a effect in liver cancer cells.
FIG. 16 shows a construct with the U6 promoter, a human pre122a (hsa-pre-miR122a) followed by a 7SL promoter, a mouse pre122a (mmu-pre-122a), and a reporter gene (Renilla Luciferase) having a 122aT, 16T, MCS site at 3'UTR. Shows the structure of.
FIG. 17 is a graph depicting microRNA effects associated with the U6 promoter and the 7SL promoter with and without miR-122 in mouse and human HCC cell lines (Hepa 1-6, HepG2).
18 is a graph showing the schematic diagram and the degree of expression of each of the variants 122at series structure for use as a control.
19 is a graph of reporter analysis in human and mouse HCC cell lines HepG2 and Hepa 1-6.
20 shows miR-122aT or mut miR-122aT sequences at the 3′-UTR sites of human TERT targeting T / S ribozyme (hTERT +21) and mouse TERT targeting T / S ribozyme (hTERT +67), respectively. It is a schematic diagram of an expression vector capable of expressing the construct inserted three times in succession under the CMV promoter.
Figure 21 shows the PEPCK-hRib-TK-122T, PEPCK-hRib-TK-mut122T, PEPCK-h prepared by inserting hRibTK-122aT, hRibTK-mut122aT, mRibTK-122aT, mRibTK-mut122aT after the PEPCK promoter expressing hepatocyte-specific It is a schematic diagram of mRib-TK-122T and PEPCK-mRib-TK-mut122T.
22 shows RT-PCR and sequencing results of mCRT (CMV mRib-TK-122T (3 ×)) in Hepa 1-6 and NIH 3T3 cells, mouse cells (mTERT +).
FIG. 23 depicts RT-PCR and sequencing results of hCRT-122at (CMV hRib-TK-122T (3 ×)) in Huh7 cells, human cells (hTERT +).
FIG. 24 shows TK of wild (CMV-mRibTK) or CMV mRib-TK-mut 122T (3x) and miR122a that do not have a target site when transfected with CMV mRib-TK-122T (3x) in Huh7 cells that are hTERT + and miR122a + It is a photograph comparing expression.
25 is also a graph showing inhibition of TK expression by CMV mRib-TK-122T (3x) when treated with AntimiR-122a (Anti 122a).
Figure 26 is a graph confirming the expression of the TK gene by CMV mRib-TK-122T (3x) by treatment of mmu-pre122a and mmu-mut-pre122a in Hepa 1-6 (mTERT +, miR122a-), mouse HCC cells .
FIG. 27 shows recombination of Hepa1-6 cells (liver cancer) into tumors implanted into the spleen in an amount of 3 × 10 6 cells (in situ multiple liver cancer model) to demonstrate the potential of Mir-122aT-containing liver cancer specific ribozyme as a cancer cell therapy. Tumor weight after injection of Ad-CMV mRib-TK-122T (3x) and Ad-CMV mRib-TK-mut 122T (3x) (1 × 108 vp), a sieve adenovirus.
Figure 28 shows Ad-CMV mRib-TK-122T (3x), Ad-CMV mRib-TK-122T (3x), Ad-CMV mRib-TK- in an amount of 1.0 x 108 VP to determine whether Ad-CMV mRib-TK-122T (3x) is toxic to normal cells. After injecting mut 122T (3x), PBS into normal tumor-free mice, GCV was injected for 10 days and the shape of the liver and the level of enzymes from the liver were measured.
29 is a photograph showing liver tissue extracted from a mouse.

Hereinafter, the present invention will be described in more detail with reference to examples. But. These examples are for illustrative purposes only and the scope of the present invention is not limited to these examples.

Experimental Method

(1) Cloning of miR-181aT, miR-122aT containing hTERT targeting ribozymes

MiR-181aT (miR) to 3'-UTR of trans-splicing (T / S) ribozyme (hTERT targeted T / S ribozyme or mTERT targeted T / S ribozyme) using CMV promoter or PEPCK promoter -181a target sequence, ACTCAGCGACAGCGTTGAATGTT: SEQ ID NO: 1) or miR-122aT (miR-122a target sequence, ACAAACACCATTGTCAC ACTCCA: SEQ ID NO: 2) was converted to BstB1 (CMV-T / S ribozyme) or Not1 (PEPCK-T / S lysine) Single cut cloning).

(2) Reporter Analysis (Luciferase Analysis)

Cells transfected into 35 mm dishes were lysed using 1x manual luciferase kit (promega) and 20 μl of supernatant was added to LARII and Stop & Glo Agent Mix (Stop & Glo). F.Luci and R.Luci were measured using a reagent mix; 20 μl of Stop & Glo + 1 ml of Stop & Glo buffer). The delay time was 3 seconds, the integration time was 10 seconds, and the sensitivity level was set to 60% as appropriate for each cell.

(3) TK analysis

Each expression vector construct was co-transfected with a GFP expression vector in a 35 mm dish and treated with GCV (gancyclovir) at 24 h and 72 h, respectively. At 96 h after transfection, the number of cells expressing GFP was measured using a fluorescence microscope. The number of cells measured each was corrected with GFP spots of cells not treated with GCV.

(4) MTS

One day after seeding the cells in 96 well plates (TPP) 10 ⁴ cells, Ad-TK (adenovirus vector expressing the HSVTK gene, a suicide gene), Ad-Rib-TK (targeting 3 'TTER) Trans-splicing ribozyme expressing adenovirus vectors expressing TK with exons, Ad-LacZ (adenovirus vectors expressing LacZ), Ad-Rib-TK-miRT (target TTER and TK to 3 'exons) 3'UTR of trans-splicing ribozyme having a) was infected with an adenovirus vector having a target sequence for micro RNA. The medium containing GCV was changed every other day for 5 days from the day following virus infection. After 5 days, CellTiter 96 ^® AQueous ONE Solution Cell Proliferation assay (Promega) was added to each medium at 20% and treated with 100 μl per well in 96 wells and 490 with Microplate reader model 550 (BioRad). Viability of the cells was observed by measuring at the wavelength of nm.

Example  1. Blood cell specific micro RNA Target sequence for miR -181 aT Containing) Libozyme  Hepatocellular carcinoma specific activity verification

Example  1-1. Blood cell specific micro RNA Target sequence for miR -181 aT Containing) Libozyme  Hepatocellular Cell Specific Reporter Gene Expression Induction Verification

Hematopoietic cell precursor-specific microRNA at the 3'-UTR site of Rib21AS (a trans-splicing ribozyme that can specifically substitute hTERT) for the development of liver cancer-specific but inactive blood cells The antisense sequence (miR-181aT, SEQ ID NO: 1) for miR-181a (PNAS 2007; 104: 2750, Leukemia Res. 2006; 30: 643, Science 2004; 303: 83) was repeated two or three times in succession. A construct was constructed in which the inserted construct and the scrambled sequence (SEQ ID NO: 3: 5'-ACTAGTGAATCCCCCGGGCTGCAGGAATTCGATATCAAGCTTATCGATACCGTCGACCTCGAG-3 ') were inserted as a negative control, and an expression vector capable of expressing the ribozyme construct under the CMV or PEPCK promoter was prepared. CMV-Rib21AS-miRT, PEPCK-Rib21AS-miRT). As a reporter gene, the firefly luciferase gene was inserted (CMV Rib-F.luc-miR181aT (x2), CMV Rib-F.luc-miR181aT (x3), CMV Rib-F.luc-scramble) (Fig. 1). .

 hTERT target trans-splicing ribozyme (CRF-181aT; CMV Rib-F.luc-miR181aT) containing 2 or 3 copies of miR-181aT, a variety of hepatic cancers with HeLa cells and miR181a- Cells and MCF7 cells were transfected to verify whether reporter gene expression was inversely induced with miR-181a expression. Induction after transfection of the original ribozyme (CRF-scramble; CMV Rib-F.luc-scramble) with scramble sequence instead of miRT and luciferase-expressing CMV-Fluc regardless of hTERT expression The reporter activity (firefly luciferase) was compared with each other.

Reporter activity by 2 copies or 3 copies of CRF-181aT (CMV Rib-F.luc-miR181aT) was significantly reduced in Jurkat, TF-1a, and HeLa cells, miR181a +. Up to 60% by CRF-181aT (CMV Rib-F.luc-miR181aT) compared to reporter activity induced by CRF (CMV Rib-F.luc) and CRF-Scramble (CMV Rib-F.luc-scramble) Abnormal reporter activity was reduced (FIG. 2).

On the other hand, CRF-181aT reporter activity in miR181a-in Hep3B, HepG2, and MCF7 cells was significantly increased in both 2 and 3 copies of miR181a + cells. Compared with the reporter activity induced by CRF (CMV Rib-F.luc), each showed 100% reporter activity by CRF-181aT (CMV Rib-F.luc-miR181aT) and the control group CRF-scramble (CMV Rib- F.luc-scramble) vector and original ribozyme vector showed little difference. In addition, the comparison between the CRF-scramble (CMV Rib-F.luc-scramble) vector and the original ribozyme (CMV Rib-F.luc) vector showed no difference, indicating that miR- was not a nonspecific action by additional sequences. It was confirmed that this is a specific result by 181aT (FIG. 3).

This resulted in the development of a new ribozyme vector in which the target sequences for microRNAs that are specifically expressed in blood cells and rarely in liver cancer cells were inserted into trans-splicing ribozyme expression vectors. It was verified that arbitrary expression can be expressed more specifically liver cancer.

Example  1-2. Blood cell specific micro RNA Target sequence for miR -181 aT Containing) Libozyme  Caused by liver cancer cell specific Cell death  Induction verification

Antisense against miR-181a, a hematopoietic cell precursor specific microRNA at the 3'-UTR site of the TK gene tagged ribozyme (trans-splicing ribozyme capable of specifically replacing hTERT, Rib21AS) An expression vector capable of expressing a construct in which the sequence (miR-181aT, SEQ ID NO: 1) was repeatedly inserted two or three times under the CMV or PEPCK promoter was prepared (CMV Rib-TK-miR181aT (x2), CMV). Rib-TK-miR181aT (x3), PEPCK Rib-TK-miR181aT (x2), PEPCK Rib-TK-miR181aT (x3)) (Figure 4).

The ribozyme vector inserted with miR-181aT indeed induces cell death in hepatocellular carcinoma cells expressing hTERT but not miR-181a, and inhibits cell death-inducing activity in vascular cells expressing miR-181a. In order to observe whether or not, we compared with CMV Rib-TK / PEPCK Rib-TK vector. The constructs prepared above were co-transfected with CMV-GFP vectors in TF-1a, HepG2, and Hp3B cells, and the relative amounts of green cells after GCV treatment were observed in comparison with controls not treated with GCV.

Cell death-inducing activity by CRT (x2) (CMV Rib-TK-miR181aT (x2)), CRT (x3) (CMV Rib-TK-miR181aT (x3)) in TF-1a cells with miR181a + is either 2 or 3 copies Significantly reduced. The CRT (CMV Rib-TK) vector showed some degree of cell death-inducing activity compared with the CT (CMV-TK) vector, but the miR-181aT inserted vector was found to significantly inhibit the activity. In the case of the ribozyme expression is induced by the PEPCK promoter it was confirmed that the activity of the promoter itself is inhibited to induce cell death in all structures (Fig. 5).

On the other hand, CRT-181aT induced cell death-inducing activity in both miR181a- and Hep3B and HepG2 cells. As a result of comparing the cell death induction activity of the miR-181aT-inserted ribozyme vector and the activity of the original ribozyme, it was confirmed that very high cell death was induced in both liver cancer cells. In the case of the ribozyme expressed by the PEPCK promoter, it was confirmed that unlike the above vascular cells show very high cell death inducing activity. Therefore, it was confirmed that highly efficient liver cancer cell-specific cell death can be induced by inducing expression of ribozyme using a liver cancer specific promoter and controlling expression of an expression vector by miR-181aT (FIG. 6).

As a result, a new ribozyme vector was prepared by inserting a target sequence for microRNA, which is specifically expressed in blood cells and rarely expressed in liver cancer cells, and was also expressed by a vector induced by expression of a liver cancer specific promoter. It was verified that cell cell death can be specifically induced by liver cancer.

Example  1-3. Mir -181 aT Cancer-specific ribozyme containing of  Expressive Adenova Virus vector manufacturing

1) preparation of an adenoviral vector capable of expressing a TK gene under the CMV promoter and expressing hTERT specific ribozymes containing miR-181aT;

Antisense sequence for miR-181a, a hematopoietic cell precursor specific microRNA at the 3'-UTR site of a ribozyme tagged with the TK gene (a trans-splicing ribozyme capable of specifically replacing hTERT) Adenovirus (Ad CMV Rib-TK-miR181aT (2x), Ad CMV Rib-TK-) capable of expressing a construct in which (miR-181aT, SEQ ID NO: 1) was repeatedly inserted two or three times under the CMV promoter miR181aT (3x)) and a control adenovirus (viral vector expressing TK tagged ribozyme under CMV promoter; Ad CMV Rib-TK, viral vector expressing TK gene under CMV promoter; Ad CMV-TK) were prepared. (FIG. 7).

2) preparation of an adenoviral vector capable of expressing a hTERT specific ribozyme tagged with the TK gene and containing miR-181aT under a liver tissue specific promoter;

Antisense sequence for miR-181a, a hematopoietic cell precursor specific microRNA at the 3'-UTR site of a ribozyme tagged with the TK gene (a trans-splicing ribozyme capable of specifically replacing hTERT) Adenovirus (Ad PEPCK Rib-TK-miR181aT (2x), Ad CMV Rib-TK-) capable of expressing a construct in which (miR-181aT, SEQ ID NO: 1) was repeatedly inserted two or three times under the PEPCK promoter miR181aT (3x)) and a control adenovirus (viral vector expressing TK tagged ribozyme under PEPCK promoter; Ad PEPCK Rib-TK, viral vector expressing TK gene under PEPCK promoter; Ad PEPCK-TK) were prepared. (FIG. 8).

Example  1-4. Mir -181 aT Specific ribozyme containing of  Expressive Adenovirus  Liver cancer cell specific by vector Cell death  observe

CMV-Rib21AS-TK / PEPCK- to observe whether the ribozyme-expressing adenovirus vector inserted with miR-181aT prepared above specifically induced cell death in liver cancer cells expressing hTERT but not miR-181a. Cross comparison with Rib21AS-TK vector. The constructs prepared above were infected with Hep3B, HepG2, and HeLa cells in a MOI dose-dependent manner, followed by MTT analysis after GCV (100 uM) treatment.

Cell death-inducing activity of miR181a-in Hep3B, HepG2, and Hela cells by CRT (Ad CMV Rib-TK) was maintained even with miR-181aT 2 copies. The cell death induction activity of the ribozyme-expressing adenovirus vector into which miR-181aT was inserted was compared with the original ribozyme-expressing adenovirus vector, and it was confirmed that very high cell death was induced in liver cancer cells. It was confirmed that PRT (Ad PEPCK Rib-TK) also exhibited very high cell death inducing activity. Therefore, it was confirmed that highly efficient liver cancer cell-specific cell death can be induced by inducing expression of ribozyme using a liver cancer specific promoter and expression expression by miR-181aT (FIGS. 9A to C).

Thus, an adenovirus vector expressing a new ribozyme inserted with a target sequence for microRNA, which is specifically expressed in blood cells and rarely expressed in liver cancer cells, was prepared, and expression was induced by a liver cancer specific promoter. It was verified that the vector can maintain liver cancer cell specific cell death inducing activity.

Each adenovirus was infected with Hep3B cells by 50MOI and RT-PCR was performed 48 hours later. Results It was confirmed at the molecular level that liver cancer specific cell death induction by ribozyme is actually a trans-splicing action (FIG. 10).

Example  1-5. Libozyme on  Anticancer efficacy in animal models

1) Anticancer efficacy of liver cancer specific ribozyme containing Mir-181aT in xenograft mice

① Efficient reduction of cancer tissue with hTERT

hTERT Lai let PRT in the tumor (orthotopic multiple liver cancer model) transplanted into the spleen of Hep3B cells (liver cancer) in an amount of 3 × 10 ⁶ cell to verify the possibility as any cancer therapeutic agent (Ad PEPCK Rib-TK), PRT-miR181 ( Ad PEPCK Rib-TK-miR181aT (2x)) (1 × 10 ⁹ vp) was injected into iv and the results were observed. The control group was injected with PBS, PT (Ad PEPCK-TK) (1 × 10 ⁹ vp) virus. After the virus injection, 50 mg / kg of GCV was injected daily for 10 days for the activity of the TK gene. After 10 days the results are expressed as tumor weight. In the case of tumors injected with PBS, the weight was increased, but the tumors injected with PT, PRT, and PRT (x2) significantly decreased in weight (FIG. 11).

② Confirm that there is no toxicity of liver of adenovirus with ribozyme in mice without tumor

PRTs (Ad PEPCK Rib-TK) and PRT-miR181 (Ad PEPCK Rib-TK-miR181aT (2x)) viruses have similar potential as the positive control PT (Ad PEPCK-TK) virus. However, continuous expression of PT (Ad PEPCK-TK) virus is toxic to normal cells. This would be a disadvantage as a tool for cancer therapy. Experiments were conducted to determine whether PRT (Ad PEPCK Rib-TK) and PRT-miR181 (Ad PEPCK Rib-TK-miR181aT (2x)) viruses are toxic to normal cells. Amounts of 1.0 × 10 ⁹ pfu of PT (Ad PEPCK-TK), PRT (Ad PEPCK Rib-TK), and PRT-miR181 (Ad PEPCK Rib-TK-miR181aT (2x)) virus were injected into normal mice without tumors. After 10 days of injecting GCV was measured the shape of the liver and enzymes from the liver.

As a result, rats injected with PT (Ad PEPCK-TK) showed hepatic cell damage from 2 days later, and hepatic cell death or excessive immune response was observed from 7 to 14 days. This is because PT (Ad PEPCK-TK) is toxic to normal cells without specificity. In contrast, mice injected with PRTs (Ad PEPCK Rib-TK) and PRT-miR181 (Ad PEPCK Rib-TK-miR181aT (2x)) for 14 days showed almost similar changes as the mice injected with PBS. This suggested that no TK gene was produced in normal liver without hTERT. In addition, less GOT / GPT levels were observed compared to mice injected with PBS. However, in rats injected with PT (Ad PEPCK-TK) virus, GOT / GPT levels were increased after 7 and 14 days. This indicates that PRTs (Ad PEPCK Rib-TK) and PRT-miR181 (Ad PEPCK Rib-TK-miR181aT (2x)) viruses show very minimal toxicity in normal livers in amounts of 1.0 × 10 ⁹ pfu (FIG. 12).

(3) Observation of tumors present in livers injected with PRTs (Ad PEPCK Rib-TK) and PRT (x2) (Ad PEPCK Rib-TK-miR181aT (2x)) in xenografted mouse models.

Finally, the day after GCV was injected, all live mice were sacrificed. Afterwards, the livers were replaced with tumors in the control group. In contrast, the livers of rats injected with PRTs (Ad PEPCK Rib-TK) and PRT-miR181 (Ad PEPCK Rib-TK-miR181aT (2x)) showed little tumor formation and were very visible only under a microscope. Small tumors could be observed. This suggests that the efficacy of PRT (Ad PEPCK Rib-TK) and PRT-miR181 (Ad PEPCK Rib-TK-miR181aT (2x)) is excellent as a cancer treatment agent. Figure 13 shows liver tissue extracted from mice. 14 is a picture of the liver observed under a microscope. Liver injected with each virus was extracted, cut and wrapped with paraffin. Thereafter, the liver tissues were thinly sliced with paraffin and H & E stained on the slides. Dark blue represents liver cancer and red represents normal liver tissue. In the picture below, the control group has a lot of dark blue color, so hepatic cancer is widely distributed, and PRTs (Ad PEPCK Rib-TK) and PRT-miR181 (Ad PEPCK Rib-TK-miR181aT (2x)) are almost all stained red. It can be seen that there is little cancer tissue.

Example  2. Normal liver cell specific micro RNA Target sequence for miR -122 aT Containing Libozyme  Hepatocellular carcinoma specific activity verification

Example  2-1. Normal liver cell specific micro RNA Target sequence for miR -122 aT Containing Libozyme  Hepatocellular Cell Specific Reporter Gene Expression Induction Verification

For the development of liver cancer cell-specific ribozymes, the target sequence (miR-122a-T, SEQ ID NO: 2) for miR-122a, which is expressed in normal liver tissue but decreased in expression in liver cancer cells (HCC) A reporter construct inserted continuously and a reporter construct in which mut 122aT was inserted as a negative control were constructed, and the validity of 122aT was verified.

Mouse liver cancer after constructing the construct (TK-R.luc-miR122aT / TK-R.luc-Let 7a_control), in which the miR-122aT sequence was inserted three times into the 3'-UTR of the reporter gene (Renillar luciferase) It was first confirmed that there was no miR-122a effect in the cells (FIG. 15).

In addition, a human pre122a (hsa-pre-miR122a) and a mouse pre122a (mmu-pre-122a) were constructed after the U6 promoter and the 7SL promoter, respectively, and the reporter gene (Renilla Luciferase) having 122aT, 16T, and MCS sites in the 3'UTR was constructed. Was prepared (FIG. 16). As can be seen in FIG. 17, it was confirmed that the microRNA effect appeared only when injecting miR-122 together in mouse and human HCC cell lines (Hepa 1-6, HepG2). Thus, it was confirmed that miR-122a was absent in mouse and human HCC cell lines. A human, mouse pre-122 construct with the U6 promoter was chosen (FIG. 17).

Mutant 122at series was prepared and tested to prepare variant 122at constructs for use as a control. Based on the results, Mut- inserting the Mut seedR target site sequence 3 times into the 3'-UTR of the reporter gene (Renillar luciferase) A 122at structure was produced. In addition, human Mut seedR pre 122a and mouse Mut seedR pre 122a were inserted after the U6 promoter to construct structures (U6-hsa-mut-pre122 and U6-mmu-mut-pre122) (FIG. 18).

Using the structure thus constructed, it was confirmed by performing reporter analysis on human and mouse HCC cell lines HepG2 and Hepa 1-6 (FIGS. 19A and B).

As shown in FIG. 19, when 122aT was inserted into the 3'-UTR of the reporter construct, the expression of the reporter gene was significantly reduced by miR-122a, and when the control group 16T was inserted, it was confirmed that it was not.

This screened and validated target sequences for microRNAs that were specifically expressed in normal liver cells but not in liver cancer cells. The reporter construct inserting these target sites (miR-122a target site, miR-122aT) miR The liver cancer specific action of -122aT was verified.

Example  2-2. Normal liver cell specific micro RNA Target sequence for miR -122 aT Containing Libozyme  Caused by liver cancer cell specific Cell death  Induction verification

3 consecutive contiguous miR-122aT or mut miR-122aT sequences at the 3'-UTR site of human TERT targeting T / S ribozyme (hTERT +21) and mouse TERT targeting T / S ribozyme (hTERT +67), respectively An expression vector capable of expressing the inserted construct repeatedly under the CMV promoter was prepared. TK gene was inserted into 3 'exon of T / S ribozyme (CMV hRib-TK-122T (3x), CMV hRib-TK-mut122T (3x), CMV mRib-TK-122T (3x), CMV mRib- TK-mut122T (3x)) (FIG. 20).

In addition, the hRibTK-122aT, hRibTK-mut122aT, mRibTK-122aT, and mRibTK-mut122aT are inserted after the PEPCK promoter expressing hepatocyte-specific cells as follows. -TK-122T and PEPCK-mRib-TK-mut122T were produced respectively (FIG. 21).

Trans-splicing product in mCRT (CMV mRib-TK-122T (3x)) via RT-PCR in mouse cells (mTERT +) Hepa 1-6 and NIH 3T3 cells to confirm liver cancer cell specific expression Was generated and confirmed by sequencing. In addition, trans-splicing products were generated from hCRT-122at (CMV hRib-TK-122T (3x)) in human Huh7 cells, hTERT +, by RT-PCR and confirmed by sequencing And 23).

As a result, the cancer cell-specific T / S activity was verified and the cleavage and conjugation occurred at the correct target site.

CMV mRib-TK-mut 122T (3x) and apoptosis-inducing activity were compared with each other to verify selective cell death-induced activity by CMV mRib-TK-122T (3x) in Huh7 cells, both hTERT + and miR122a + (Huh7 cells were hTERT + cells But targeted by mouse targeting T / S ribozyme). Sequencing to determine whether the hTERT IGS site (target site) was mutated did not cause mutation at the target site.

When transfected with CMV mRib-TK-122T (3x) in Huh7 cells, which are hTERT + and miR122a +, as shown in FIGS. 24 and 25, in wild (CMV-mRibTK) or CMV mRib-TK-mut 122T (3x) that do not have target sites In contrast, it was confirmed that expression of TK by miR122a was inhibited and thereby cytotoxic induction was inhibited (ie, cell survival rate was increased). The antimiR-122a (Anti 122a) treatment also showed that the inhibition of TK expression by CMV mRib-TK-122T (3x) was restored (i.e., cell survival was reduced). It was.

Hepa 1-6 (mTERT +, miR122a-), mouse HCC cells, were treated with mmu-pre122a and mmu-mut-pre122a, respectively, to confirm the expression of the TK gene by CMV mRib-TK-122T (3x). First, in the absence of pre-122a, cytotoxicity by CMV mRib-TK-122T (3x) increased similarly to wild type (ie CMV-mRibTK). On the other hand, it was confirmed that mmK-pre122a treatment inhibited TK gene expression by CMV mRib-TK-122T (3x), thereby inhibiting cell death-inducing activity (ie, increasing cell survival) (FIG. 26).

This results in a target microRNA (miR-) by a new liver cancer specific trans-splicing ribozyme vector inserted with a target sequence (miR-122aT) for micro RNA that is specifically expressed in normal liver cells but not in liver cancer cells. In cells without 122a), hepatocarcinoma cell death was efficiently induced, whereas in cells with target microRNA (miR-122a), cell death was reduced. That is, it was verified that cell death can be specifically induced by liver cancer by miR-122aT inserted trans-splicing ribozyme.

Example  2-3. Libozyme  Anticancer efficacy in animal models

1. Efficient reduction of cancer tissue with mTERT by liver cancer specific ribozyme containing Mir-122aT in xenografted mice

① Efficient reduction of cancer tissue with mTERT

To demonstrate the potential of Mir-122aT-containing liver cancer-specific ribozyme as a cancer cell therapy, recombinant adenosine in tumors (isotopic multiple liver cancer model) in which Hepa1-6 cells (liver cancer) were transplanted into the spleen in an amount of 3 × 10 ⁶ cells The results were observed after injecting the viruses Ad-CMV mRib-TK-122T (3x) and Ad-CMV mRib-TK-mut 122T (3x) (1 × 10 ⁸ vp). The control group was injected with PBS. After injecting the virus, GCV 50mg / kg was injected daily for 10 days for the activity of the TK gene. After 10 days the result was tumor weight. Tumors injected with PBS increased weight, but tumors injected with Ad-CMV mRib-TK-122T (3x) and Ad-CMV mRib-TK-mut 122T (3x) significantly reduced weight (FIG. 27).

② Confirm that there is no toxicity of liver of adenovirus with ribozyme in mice without tumor.

Ad-CMV mRib-TK-122T (3x) has similar potential to the positive control Ad-CMV mRib-TK-mut 122T (3x). However, continuous expression of Ad-CMV mRib-TK-mut 122T (3x) was toxic to normal cells. This would be a disadvantage as a tool for cancer therapy. In this situation, experiments were conducted to determine whether Ad-CMV mRib-TK-122T (3x) is toxic to normal cells. Ad-CMV mRib-TK-122T (3x), Ad-CMV mRib-TK-mut 122T (3x), and PBS in 1.0 × 10 ⁸ VP amounts were injected into normal mice without tumors. After 10 days of injecting GCV was measured the shape of the liver and enzymes from the liver.

As a result, rats injected with Ad-CMV mRib-TK-mut 122T (3x) significantly observed liver cells die or caused excessive immune responses. This is because PT is toxic to normal cells without specificity. In contrast, mice injected with Ad-CMV mRib-TK-122T (3x) for 14 days showed almost the same changes as mice injected with PBS. This suggested that no TK gene was produced in normal livers. In addition, less GOT / GPT levels were observed compared to mice injected with PBS. However, rats injected with Ad-CMV mRib-TK-mut 122T (3x) increased GOT / GPT levels after 14 days. This indicated that Ad-CMV mRib-TK-122T (3x) virus showed very minimal toxicity in normal livers in the amount of 1.0 × 10 ⁸ VP (FIG. 28).

③ Observation of tumors present in the liver injected with Ad-CMV mRib-TK-122T (3x), Ad-CMV mRib-TK-mut 122T (3x), PBS in xenografted mouse models.

 Finally, the day after GCV was injected, all live mice were sacrificed. Afterwards, the livers were replaced with tumors in the control group. In contrast, the livers of rats injected with Ad-CMV mRib-TK-122T (3x) and Ad-CMV mRib-TK-mut 122T (3x) showed little tumor formation and were very visible only under a microscope. A small tumor could be observed. This suggested that the efficacy of Ad-CMV mRib-TK-122T (3x) and Ad-CMV mRib-TK-mut 122T (3x) was excellent as a cancer treatment agent. 29 shows liver tissue extracted from mice.

We have developed a target specific trans-splicing ribozyme and constructed a new ribozyme-expressable adenovirus vector inserted with the target sequence for microRNA under the CMV, PEPCK promoter. In the animal model of liver cancer, the effective anticancer efficacy by ribozyme was verified and it was observed that in vivo systemic administration of anticancer ribozyme was possible without hepatotoxicity.

<110> Industry-Academic Cooperation Foundation, Dankook University <120> Cancer gene therapeutic agent through regulation using microRNA <130> PA110268 / KR <160> 17 <170> Kopatentin 1.71 <210> 1 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> mir181aT <400> 1 actcagcgac agcgttgaat gtt 23 <210> 2 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> mir122aT <400> 2 acaaacacca ttgtcacact cca 23 <210> 3 <211> 63 <212> DNA <213> Artificial Sequence <220> <223> scramble sequence <400> 3 actagtgaat cccccgggct gcaggaattc gatatcaagc ttatcgatac cgtcgacctc 60 gag 63 <210> 4 <211> 3124 <212> DNA <213> Artificial Sequence <220> <223> CMV-Rib-TK-mir181aT (2x) <400> 4 cgcgttacat aacttacggt aaatggcccg cctggctgac cgcccaacga cccccgccca 60 ttgacgtcaa taatgacgta tgttcccata gtaacgccaa tagggacttt ccattgacgt 120 caatgggtgg agtatttacg gtaaactgcc cacttggcag tacatcaagt gtatcatatg 180 ccaagtccgc cccctattga cgtcaatgac ggtaaatggc ccgcctggca ttatgcccag 240 tacatgacct tacgggactt tcctacttgg cagtacatct acgtattagt catcgctatt 300 accatggtga tgcggttttg gcagtacacc aatgggcgtg gatagcggtt tgactcacgg 360 ggatttccaa gtctccaccc cattgacgtc aatgggagtt tgttttggca ccaaaatcaa 420 cgggactttc caaaatgtcg taataacccc gccccgttga cgcaaatggg cggtaggcgt 480 gtacggtggg aggtctatat aagcagagct cgtttagtga accgtcagat cctcactctc 540 ttccgcatcg ctgtctgcga gggccagctg ttgggctcgc ggttgaggac aaactcttcg 600 cggtctttcc agtactcttg gatcggaaac ccgtcggcct ccgaacggta ctccgccacc 660 gagggacctg agccagtccg catcgaccgg atcggaaaac ctctcgagaa aggcgtctaa 720 ccagtcacag tcgcaaggta ggctgagcac cgtggcgggc ggcagcgggt ggcggtcggg 780 gttgtttctg gcggaggtgc tgctgatgat gtaattaaag taggcggtct tgagccggcg 840 gatggtcgag gtgaggtgtg gcaggcttga gatccagctg ttggggtgag tactccctct 900 caaaagcggg catgacttct gcgctaagat tgtcagtttc caaaaacgag gaggatttga 960 tattcacctg gcccgatctg gccatacact tgagtgacaa tgacatccac tttgcctttc 1020 tctccacagg tgtccactcc caggtccaag tttggaagat ccaaggccag cacgttcttc 1080 gcgccgcgct cgcacagcct ctgcagcact cgggccacca gctccttcag gcaggacacc 1140 tggcggaagg agggggcggc ggggggcggc cgtgcgtccc agggcacgca caccaggcac 1200 tgggccacca gcgcgcggaa agccgccggg tccccgcgct gcaccagccg ccagccctgg 1260 ggccccaggc gccgcacgaa cgtggccagc ggcagcacct cgcggtagtg gctgcgcagc 1320 agggagcgca cggctaggca gcggggagcg cgcggcatcg cgggggtggc cggggccagg 1380 gcttcccaag cttcgttttg cggcaggaaa agttatcagg catgcacctg gtagctagtc 1440 tttaaaccaa tagattgcat cggtttaaaa ggcaagaccg tcaaattgcg ggaaaggggt 1500 caacagccgt tcagtaccaa gtctcagggg aaactttgag atggccttgc aaagggtatg 1560 gtaataagct gacggacatg gtcctaacca cgcagccaag tcctaagtca acagatcttc 1620 tgttgatatg gatgcagttc acagactaaa tgtcggtcgg ggaagatgta ttcttctcat 1680 aagatatagt cggacctctc cttaatggga gctagcggat gaagtgatgc aacactggag 1740 ccgctgggaa ctaatttgta tgcgaaagta tattgattag ttttggagta ctcgcgaaaa 1800 cgcccaccat ggcttcgtac ccctgccatc aacacgcgtc tgcgttcgac caggctgcgc 1860 gttctcgcgg ccatagcaac cgacgtacgg cgttgcgccc tcgccggcag caagaagcca 1920 cggaagtccg cctggagcag aaaatgccca cgctactgcg ggtttatata gacggtcctc 1980 acgggatggg gaaaaccacc accacgcaac tgctggtggc cctgggttcg cgcgacgata 2040 tcgtctacgt acccgagccg atgacttact ggcaggtgct gggggcttcc gagacaatcg 2100 cgaacatcta caccacacaa caccgcctcg accagggtga gatatcggcc ggggacgcgg 2160 cggtggtaat gacaagcgcc cagataacaa tgggcatgcc ttatgccgtg accgacgccg 2220 ttctggctcc tcatgtcggg ggggaggctg ggagttcaca tgccccgccc ccggccctca 2280 ccctcatctt cgaccgccat cccatcgccg ccctcctgtg ctacccggcc gcgcgatacc 2340 ttatgggcag catgaccccc caggccgtgc tggcgttcgt ggccctcatc ccgccgacct 2400 tgcccggcac aaacatcgtg ttgggggccc ttccggagga cagacacatc gaccgcctgg 2460 ccaaacgcca gcgccccggc gagcggcttg acctggctat gctggccgcg attcgccgcg 2520 tttacgggct gcttgccaat acggtgcggt atctgcaggg cggcgggtcg tggtgggagg 2580 attggggaca gctttcgggg acggccgtgc cgccccaggg tgccgagccc cagagcaacg 2640 cgggcccacg accccatatc ggggacacgt tatttaccct gtttcgggcc cccgagttgc 2700 tggcccccaa cggcgacctg tataacgtgt ttgcctgggc cttggacgtc ttggccaaac 2760 gcctccgtcc catgcacgtc tttatcctgg attacgacca atcgcccgcc ggctgccggg 2820 acgccctgct gcaacttacc tccgggatgg tccagaccca cgtcaccacc ccaggctcca 2880 taccgacgat ctgcgacctg gcgcgcacgt ttgcccggga gatgggggag gctaactgat 2940 tcgaaactca gcgacagcgt tgaatgttcg atactcagcg acagcgttga atgttttcga 3000 aagatcccaa cgaaaagaga gaccacatgg tccttcttga gtttgtaaca gctgctggga 3060 ttacacatgg catggatgaa ctgtacaact gaggatcccc cgacctcgac ctctggctaa 3120 taaa 3124 <210> 5 <211> 3791 <212> DNA <213> Artificial Sequence <220> <223> PEPCK-Rib-TK-mir181aT (2x) <400> 5 aagtttattg tgttaggtca gttccaaacc gtgctgacca tggctatgat ccaaaggccg 60 gccccttacg tcagaggcga gcctccaggt ccagctgagg ggcagggctg tcctcccttc 120 tgtatactat ttaaagcgag gagggctagc taccaagcac ggttggcctt ccctctggga 180 acacaccctt ggccaacagg ggaaatccgg cgagacgctc tgagatcctg cgagaaggag 240 gtgcgtcctg ctgcctgccc cggcactctg gctccccagc tcaaggttca ggccttgccc 300 caggccgggc ctctgggtac ctgaggtctt ctcccgctct gtgcccttct cctcacctgg 360 ctgcaatgag tgggggagca cggggcttct gcatgctgaa ggcaccccac tcagccaggc 420 ccttcttctc ctccaggtcc cccacggccc ttcagatcta aggccagcac gttcttcgcg 480 ccgcgctcgc acagcctctg cagcactcgg gccaccagct ccttcaggca ggacacctgg 540 cggaaggagg gggcggcggg gggcggccgt gcgtcccagg gcacgcacac caggcactgg 600 gccaccagcg cgcggaaagc cgccgggtcc ccgcgctgca ccagccgcca gccctggggc 660 cccaggcgcc gcacgaacgt ggccagcggc agcacctcgc ggtagtggct gcgcagcagg 720 gagcgcacgg ctaggcagcg gggagcgcgc ggcatcgcgg gggtggccgg ggccagggct 780 tcccaagctt cgttttgcgg caggaaaagt tatcaggcat gcacctggta gctagtcttt 840 aaaccaatag attgcatcgg tttaaaaggc aagaccgtca aattgcggga aaggggtcaa 900 cagccgttca gtaccaagtc tcaggggaaa ctttgagatg gccttgcaaa gggtatggta 960 ataagctgac ggacatggtc ctaaccacgc agccaagtcc taagtcaaca gatcttctgt 1020 tgatatggat gcagttcaca gactaaatgt cggtcgggga agatgtattc ttctcataag 1080 atatagtcgg acctctcctt aatgggagct agcggatgaa gtgatgcaac actggagccg 1140 ctgggaacta atttgtatgc gaaagtatat tgattagttt tggagtactc gcgaaaacgc 1200 ccaccatggc ttcgtacccc tgccatcaac acgcgtctgc gttcgaccag gctgcgcgtt 1260 ctcgcggcca tagcaaccga cgtacggcgt tgcgccctcg ccggcagcaa gaagccacgg 1320 aagtccgcct ggagcagaaa atgcccacgc tactgcgggt ttatatagac ggtcctcacg 1380 ggatggggaa aaccaccacc acgcaactgc tggtggccct gggttcgcgc gacgatatcg 1440 tctacgtacc cgagccgatg acttactggc aggtgctggg ggcttccgag acaatcgcga 1500 acatctacac cacacaacac cgcctcgacc agggtgagat atcggccggg gacgcggcgg 1560 tggtaatgac aagcgcccag ataacaatgg gcatgcctta tgccgtgacc gacgccgttc 1620 tggctcctca tatcgggggg gaggctggga gctcacatgc cccgcccccg gccctcaccc 1680 tcatcttcga ccgccatccc atcgccgccc tcctgtgcta cccggccgcg cgatacctta 1740 tgggcagcat gaccccccag gccgtgctgg cgttcgtggc cctcatcccg ccgaccttgc 1800 ccggcacaaa catcgtgttg ggggcccttc cggaggacag acacatcgac cgcctggcca 1860 aacgccagcg ccccggcgag cggcttgacc tggctatgct ggccgcgatt cgccgcgttt 1920 acgggctgct tgccaatacg gtgcggtatc tgcagggcgg cgggtcgtgg tgggaggatt 1980 ggggacagct ttcggggacg gccgtgccgc cccagggtgc cgagccccag agcaacgcgg 2040 gcccacgacc ccatatcggg gacacgttat ttaccctgtt tcgggccccc gagttgctgg 2100 cccccaacgg cgacctgtat aacgtgtttg cctgggcctt ggacgtcttg gccaaacgcc 2160 tccgtcccat gcacgtcttt atcctggatt acgaccaatc gcccgccggc tgccgggacg 2220 ccctgctgca acttacctcc gggatggtcc agacccacgt caccacccca ggctccatac 2280 cgacgatctg cgacctggcg cgcacgtttg cccgggagat gggggaggct aactgaagcg 2340 gccgcactca gcgacagcgt tgaatgttcg atactcagcg acagcgttga atgttgcggc 2400 cgcgggtggc atccctgtga cccctcccca gtgcctctcc tggccctgga agttgccact 2460 ccagtgccca ccagccttgt cctaataaaa ttaagttgca tcattttgtc tgactaggtg 2520 tccttctata atattatggg gtggaggggg gtggtatgga gcaaggggca agttgggaag 2580 acaacctgta gggcctgcgg ggtctattgg gaaccaagct ggagtgcagt ggcacaatct 2640 tggctcactg caatctccgc ctcctgggtt caagcgattc tcctgcctca gcctcccgag 2700 ttgttgggat tccaggcatg catgaccagg ctcagctaat ttttgttttt ttggtagaga 2760 cggggtttca ccatattggc caggctggtc tccaactcct aatctcaggt gatctaccca 2820 ccttggcctc ccaaattgct gggattacag gcgtgaacca ctgctccctt ccctgtcctt 2880 ctgattttaa aataactata ccagcaggag gacgtccaga cacagcatag gctacctggc 2940 catgcccaac cggtgggaca tttgagttgc ttgcttggca ctgtcctctc atgcgttggg 3000 tccactcagt agatgcctgc aggctcagag gcacacagga gtttctgggc tcaccctgcc 3060 cccttccaac ccctcagttc ccatcctcca gcagctgttt gtgtgctgcc tctgaagtcc 3120 acactgaaca aacttcagcc tactcatgtc cctaaaatgg gcaaacattg caagcagcaa 3180 acagcaaaca cacagccctc cctgcctgct gaccttggag ctggggcaga ggtcagagac 3240 ctctctgggc ccatgccacc tccaacatcc actcgacccc ttggaatttc ggtggagagg 3300 agcagaggtt gtcctggcgt ggtttaggta gtgtgagagg gtccgggttc aaaaccactt 3360 gctgggtggg gagtcgtcag taagtggcta tgccccgacc ccgaagcctg tttccccatc 3420 tgtacaatgg aaatgataaa gacgcccatc tgatagggtt tttgtggcaa ataaacattt 3480 ggtttttttg ttttgttttg ttttgttttt tgagatggag gtttgctctg tcgcccaggc 3540 tggagtgcag tgacacaatc tcatctcacc acaaccttcc cctgcctcag cctcccaagt 3600 agctgggatt acaagcatgt gccaccacac ctggctaatt ttctattttt agtagagacg 3660 ggtttctcca tgttggtcag cctcagcctc ccaagtaact gggattacag gcctgtgcca 3720 ccacacccgg ctaatttttt ctatttttga cagggacggg gtttcaccat gttggtcagg 3780 ctggtctaga a 3791 <210> 6 <211> 3149 <212> DNA <213> Artificial Sequence <220> <223> CMV-hRib-TK-mir122aT (3x) <400> 6 cgcgttacat aacttacggt aaatggcccg cctggctgac cgcccaacga cccccgccca 60 ttgacgtcaa taatgacgta tgttcccata gtaacgccaa tagggacttt ccattgacgt 120 caatgggtgg agtatttacg gtaaactgcc cacttggcag tacatcaagt gtatcatatg 180 ccaagtccgc cccctattga cgtcaatgac ggtaaatggc ccgcctggca ttatgcccag 240 tacatgacct tacgggactt tcctacttgg cagtacatct acgtattagt catcgctatt 300 accatggtga tgcggttttg gcagtacacc aatgggcgtg gatagcggtt tgactcacgg 360 ggatttccaa gtctccaccc cattgacgtc aatgggagtt tgttttggca ccaaaatcaa 420 cgggactttc caaaatgtcg taataacccc gccccgttga cgcaaatggg cggtaggcgt 480 gtacggtggg aggtctatat aagcagagct cgtttagtga accgtcagat cctcactctc 540 ttccgcatcg ctgtctgcga gggccagctg ttgggctcgc ggttgaggac aaactcttcg 600 cggtctttcc agtactcttg gatcggaaac ccgtcggcct ccgaacggta ctccgccacc 660 gagggacctg agccagtccg catcgaccgg atcggaaaac ctctcgagaa aggcgtctaa 720 ccagtcacag tcgcaaggta ggctgagcac cgtggcgggc ggcagcgggt ggcggtcggg 780 gttgtttctg gcggaggtgc tgctgatgat gtaattaaag taggcggtct tgagccggcg 840 gatggtcgag gtgaggtgtg gcaggcttga gatccagctg ttggggtgag tactccctct 900 caaaagcggg catgacttct gcgctaagat tgtcagtttc caaaaacgag gaggatttga 960 tattcacctg gcccgatctg gccatacact tgagtgacaa tgacatccac tttgcctttc 1020 tctccacagg tgtccactcc caggtccaag tttggaagat ccaaggccag cacgttcttc 1080 gcgccgcgct cgcacagcct ctgcagcact cgggccacca gctccttcag gcaggacacc 1140 tggcggaagg agggggcggc ggggggcggc cgtgcgtccc agggcacgca caccaggcac 1200 tgggccacca gcgcgcggaa agccgccggg tccccgcgct gcaccagccg ccagccctgg 1260 ggccccaggc gccgcacgaa cgtggccagc ggcagcacct cgcggtagtg gctgcgcagc 1320 agggagcgca cggctaggca gcggggagcg cgcggcatcg cgggggtggc cggggccagg 1380 gcttcccaag cttcgttttg cggcaggaaa agttatcagg catgcacctg gtagctagtc 1440 tttaaaccaa tagattgcat cggtttaaaa ggcaagaccg tcaaattgcg ggaaaggggt 1500 caacagccgt tcagtaccaa gtctcagggg aaactttgag atggccttgc aaagggtatg 1560 gtaataagct gacggacatg gtcctaacca cgcagccaag tcctaagtca acagatcttc 1620 tgttgatatg gatgcagttc acagactaaa tgtcggtcgg ggaagatgta ttcttctcat 1680 aagatatagt cggacctctc cttaatggga gctagcggat gaagtgatgc aacactggag 1740 ccgctgggaa ctaatttgta tgcgaaagta tattgattag ttttggagta ctcgaaaacg 1800 cccaccatgg cttcgtaccc ctgccatcaa cacgcgtctg cgttcgacca ggctgcgcgt 1860 tctcgcggcc atagcaaccg acgtacggcg ttgcgccctc gccggcagca agaagccacg 1920 gaagtccgcc tggagcagaa aatgcccacg ctactgcggg tttatataga cggtcctcac 1980 gggatgggga aaaccaccac cacgcaactg ctggtggccc tgggttcgcg cgacgatatc 2040 gtctacgtac ccgagccgat gacttactgg caggtgctgg gggcttccga gacaatcgcg 2100 aacatctaca ccacacaaca ccgcctcgac cagggtgaga tatcggccgg ggacgcggcg 2160 gtggtaatga caagcgccca gataacaatg ggcatgcctt atgccgtgac cgacgccgtt 2220 ctggctcctc atgtcggggg ggaggctggg agttcacatg ccccgccccc ggccctcacc 2280 ctcatcttcg accgccatcc catcgccgcc ctcctgtgct acccggccgc gcgatacctt 2340 atgggcagca tgacccccca ggccgtgctg gcgttcgtgg ccctcatccc gccgaccttg 2400 cccggcacaa acatcgtgtt gggggccctt ccggaggaca gacacatcga ccgcctggcc 2460 aaacgccagc gccccggcga gcggcttgac ctggctatgc tggccgcgat tcgccgcgtt 2520 tacgggctgc ttgccaatac ggtgcggtat ctgcagggcg gcgggtcgtg gtgggaggat 2580 tggggacagc tttcggggac ggccgtgccg ccccagggtg ccgagcccca gagcaacgcg 2640 ggcccacgac cccatatcgg ggacacgtta tttaccctgt ttcgggcccc cgagttgctg 2700 gcccccaacg gcgacctgta taacgtgttt gcctgggcct tggacgtctt ggccaaacgc 2760 ctccgtccca tgcacgtctt tatcctggat tacgaccaat cgcccgccgg ctgccgggac 2820 gccctgctgc aacttacctc cgggatggtc cagacccacg tcaccacccc aggctccata 2880 ccgacgatct gcgacctggc gcgcacgttt gcccgggaga tgggggaggc taactgattc 2940 gaaacaaaca ccattgtcac actccacgat acaaacacca ttgtcacact ccacgataca 3000 aacaccattg tcacactcca ttcgaaagat cccaacgaaa agagagacca catggtcctt 3060 cttgagtttg taacagctgc tgggattaca catggcatgg atgaactgta caactgagga 3120 tcccccgacc tcgacctctg gctaataaa 3149 <210> 7 <211> 3822 <212> DNA <213> Artificial Sequence <220> <223> PEPCK-hRib-TK-mir122aT (3x) <400> 7 aagtttattg tgttaggtca gttccaaacc gtgctgacca tggctatgat ccaaaggccg 60 gccccttacg tcagaggcga gcctccaggt ccagctgagg ggcagggctg tcctcccttc 120 tgtatactat ttaaagcgag gagggctagc taccaagcac ggttggcctt ccctctggga 180 acacaccctt ggccaacagg ggaaatccgg cgagacgctc tgagatcctg cgagaaggag 240 gtgcgtcctg ctgcctgccc cggcactctg gctccccagc tcaaggttca ggccttgccc 300 caggccgggc ctctgggtac ctgaggtctt ctcccgctct gtgcccttct cctcacctgg 360 ctgcaatgag tgggggagca cggggcttct gcatgctgaa ggcaccccac tcagccaggc 420 ccttcttctc ctccaggbam htcccccacg gcccttcaga tctaaggcca gcacgttctt 480 cgcgccgcgc tcgcacagcc tctgcagcac tcgggccacc agctccttca ggcaggacac 540 ctggcggaag gagggggcgg cggggggcgg ccgtgcgtcc cagggcacgc acaccaggca 600 ctgggccacc agcgcgcgga aagccgccgg gtccccgcgc tgcaccagcc gccagccctg 660 gggccccagg cgccgcacga acgtggccag cggcagcacc tcgcggtagt ggctgcgcag 720 cagggagcgc acggctaggc agcggggagc gcgcggcatc gcgggggtgg ccggggccag 780 ggcttcccaa gcttcgtttt gcggcaggaa aagttatcag gcatgcacct ggtagctagt 840 ctttaaacca atagattgca tcggtttaaa aggcaagacc gtcaaattgc gggaaagggg 900 tcaacagccg ttcagtacca agtctcaggg gaaactttga gatggccttg caaagggtat 960 ggtaataagc tgacggacat ggtcctaacc acgcagccaa gtcctaagtc aacagatctt 1020 ctgttgatat ggatgcagtt cacagactaa atgtcggtcg gggaagatgt attcttctca 1080 taagatatag tcggacctct ccttaatggg agctagcgga tgaagtgatg caacactgga 1140 gccgctggga actaatttgt atgcgaaagt atattgatta gttttggagt actcgcgaaa 1200 acgcccacca tggcttcgta cccctgccat caacacgcgt ctgcgttcga ccaggctgcg 1260 cgttctcgcg gccatagcaa ccgacgtacg gcgttgcgcc ctcgccggca gcaagaagcc 1320 acggaagtcc gcctggagca gaaaatgccc acgctactgc gggtttatat agacggtcct 1380 cacgggatgg ggaaaaccac caccacgcaa ctgctggtgg ccctgggttc gcgcgacgat 1440 atcgtctacg tacccgagcc gatgacttac tggcaggtgc tgggggcttc cgagacaatc 1500 gcgaacatct acaccacaca acaccgcctc gaccagggtg agatatcggc cggggacgcg 1560 gcggtggtaa tgacaagcgc ccagataaca atgggcatgc cttatgccgt gaccgacgcc 1620 gttctggctc ctcatatcgg gggggaggct gggagctcac atgccccgcc cccggccctc 1680 accctcatct tcgaccgcca tcccatcgcc gccctcctgt gctacccggc cgcgcgatac 1740 cttatgggca gcatgacccc ccaggccgtg ctggcgttcg tggccctcat cccgccgacc 1800 ttgcccggca caaacatcgt gttgggggcc cttccggagg acagacacat cgaccgcctg 1860 gccaaacgcc agcgccccgg cgagcggctt gacctggcta tgctggccgc gattcgccgc 1920 gtttacgggc tgcttgccaa tacggtgcgg tatctgcagg gcggcgggtc gtggtgggag 1980 gattggggac agctttcggg gacggccgtg ccgccccagg gtgccgagcc ccagagcaac 2040 gcgggcccac gaccccatat cggggacacg ttatttaccc tgtttcgggc ccccgagttg 2100 ctggccccca acggcgacct gtataacgtg tttgcctggg ccttggacgt cttggccaaa 2160 cgcctccgtc ccatgcacgt ctttatcctg gattacgacc aatcgcccgc cggctgccgg 2220 gacgccctgc tgcaacttac ctccgggatg gtccagaccc acgtcaccac cccaggctcc 2280 ataccgacga tctgcgacct ggcgcgcacg tttgcccggg agatggggga ggctaactga 2340 agcggccgca caaacaccat tgtcacactc cacgatacaa acaccattgt cacactccac 2400 gatacaaaca ccattgtcac actccagcgg ccgcgggtgg catccctgtg acccctcccc 2460 agtgcctctc ctggccctgg aagttgccac tccagtgccc accagccttg tcctaataaa 2520 attaagttgc atcattttgt ctgactaggt gtccttctat aatattatgg ggtggagggg 2580 ggtggtatgg agcaaggggc aagttgggaa gacaacctgt agggcctgcg gggtctattg 2640 ggaaccaagc tggagtgcag tggcacaatc ttggctcact gcaatctccg cctcctgggt 2700 tcaagcgatt ctcctgcctc agcctcccga gttgttggga ttccaggcat gcatgaccag 2760 gctcagctaa tttttgtttt tttggtagag acggggtttc accatattgg ccaggctggt 2820 ctccaactcc taatctcagg tgatctaccc accttggcct cccaaattgc tgggattaca 2880 ggcgtgaacc actgctccct tccctgtcct tctgatttta aaataactat accagcagga 2940 ggacgtccag acacagcata ggctacctgg ccatgcccaa ccggtgggac atttgagttg 3000 cttgcttggc actgtcctct catgcgttgg gtccactcag tagatgcctg caggctcaga 3060 ggcacacagg agtttctggg ctcaccctgc ccccttccaa cccctcagtt cccatcctcc 3120 agcagctgtt tgtgtgctgc ctctgaagtc cacactgaac aaacttcagc ctactcatgt 3180 ccctaaaatg ggcaaacatt gcaagcagca aacagcaaac acacagccct ccctgcctgc 3240 tgaccttgga gctggggcag aggtcagaga cctctctggg cccatgccac ctccaacatc 3300 cactcgaccc cttggaattt cggtggagag gagcagaggt tgtcctggcg tggtttaggt 3360 agtgtgagag ggtccgggtt caaaaccact tgctgggtgg ggagtcgtca gtaagtggct 3420 atgccccgac cccgaagcct gtttccccat ctgtacaatg gaaatgataa agacgcccat 3480 ctgatagggt ttttgtggca aataaacatt tggttttttt gttttgtttt gttttgtttt 3540 ttgagatgga ggtttgctct gtcgcccagg ctggagtgca gtgacacaat ctcatctcac 3600 cacaaccttc ccctgcctca gcctcccaag tagctgggat tacaagcatg tgccaccaca 3660 cctggctaat tttctatttt tagtagagac gggtttctcc atgttggtca gcctcagcct 3720 cccaagtaac tgggattaca ggcctgtgcc accacacccg gctaattttt tctatttttg 3780 acagggacgg ggtttcacca tgttggtcag gctggtctag aa 3822 <210> 8 <211> 2924 <212> DNA <213> Artificial Sequence <220> CMV-mRib-TK-mir122aT (3x) <400> 8 cgcgttacat aacttacggt aaatggcccg cctggctgac cgcccaacga cccccgccca 60 ttgacgtcaa taatgacgta tgttcccata gtaacgccaa tagggacttt ccattgacgt 120 caatgggtgg agtatttacg gtaaactgcc cacttggcag tacatcaagt gtatcatatg 180 ccaagtccgc cccctattga cgtcaatgac ggtaaatggc ccgcctggca ttatgcccag 240 tacatgacct tacgggactt tcctacttgg cagtacatct acgtattagt catcgctatt 300 accatggtga tgcggttttg gcagtacacc aatgggcgtg gatagcggtt tgactcacgg 360 ggatttccaa gtctccaccc cattgacgtc aatgggagtt tgttttggca ccaaaatcaa 420 cgggactttc caaaatgtcg taataacccc gccccgttga cgcaaatggg cggtaggcgt 480 gtacggtggg aggtctatat aagcagagct cgtttagtga accgtcagat cctcactctc 540 ttccgcatcg ctgtctgcga gggccagctg ttgggctcgc ggttgaggac aaactcttcg 600 cggtctttcc agtactcttg gatcggaaac ccgtcggcct ccgaacggta ctccgccacc 660 gagggacctg agccagtccg catcgaccgg atcggaaaac ctctcgagaa aggcgtctaa 720 ccagtcacag tcgcaaggta ggctgagcac cgtggcgggc ggcagcgggt ggcggtcggg 780 gttgtttctg gcggaggtgc tgctgatgat gtaattaaag taggcggtct tgagccggcg 840 gatggtcgag gtgaggtgtg gcaggcttga gatccagctg ttggggtgag tactccctct 900 caaaagcggg catgacttct gcgctaagat tgtcagtttc caaaaacgag gaggatttga 960 tattcacctg gcccgatctg gccatacact tgagtgacaa tgacatccac tttgcctttc 1020 tctccacagg tgtccactcc caggtccaag tttggaagat cctctagagt gcggtagatc 1080 ttcgggtccc cgggttgcac aagccgcctg ccctcgggcc ccaggcgccg cacaaaggtt 1140 gccagcggcc acacctcccg gtatcggcgc tagagccgag cggagagaaa agttatcagg 1200 catgcacctg gtagctagtc tttaaaccaa tagattgcat cggtttaaaa ggcaagaccg 1260 tcaaattgcg ggaaaggggt caacagccgt tcagtaccaa gtctcagggg aaactttgag 1320 atggccttgc aaagggtatg gtaataagct gacggacatg gtcctaacca cgcagccaag 1380 tcctaagtca acagatcttc tgttgatatg gatgcagttc acagactaaa tgtcggtcgg 1440 ggaagatgta ttcttctcat aagatatagt cggacctctc cttaatggga gctagcggat 1500 gaagtgatgc aacactggag ccgctgggaa ctaatttgta tgcgaaagta tattgattag 1560 ttttggagta ctcgcgcggc cgccgcttcg tacccctgcc atcaacacgc gtctgcgttc 1620 gaccaggctg cgcgttctcg cggccatagc aaccgacgta cggcgttgcg ccctcgccgg 1680 cagcaagaag ccacggaagt ccgcctggag cagaaaatgc ccacgctact gcgggtttat 1740 atagacggtc ctcacgggat ggggaaaacc accaccacgc aactgctggt ggccctgggt 1800 tcgcgcgacg atatcgtcta cgtacccgag ccgatgactt actggcaggt gctgggggct 1860 tccgagacaa tcgcgaacat ctacaccaca caacaccgcc tcgaccaggg tgagatatcg 1920 gccggggacg cggcggtggt aatgacaagc gcccagataa caatgggcat gccttatgcc 1980 gtgaccgacg ccgttctggc tcctcatgtc gggggggagg ctgggagttc acatgccccg 2040 cccccggccc tcaccctcat cttcgaccgc catcccatcg ccgccctcct gtgctacccg 2100 gccgcgcgat accttatggg cagcatgacc ccccaggccg tgctggcgtt cgtggccctc 2160 atcccgccga ccttgcccgg cacaaacatc gtgttggggg cccttccgga ggacagacac 2220 atcgaccgcc tggccaaacg ccagcgcccc ggcgagcggc ttgacctggc tatgctggcc 2280 gcgattcgcc gcgtttacgg gctgcttgcc aatacggtgc ggtatctgca gggcggcggg 2340 tcgtggtggg aggattgggg acagctttcg gggacggccg tgccgcccca gggtgccgag 2400 ccccagagca acgcgggccc acgaccccat atcggggaca cgttatttac cctgtttcgg 2460 gcccccgagt tgctggcccc caacggcgac ctgtataacg tgtttgcctg ggccttggac 2520 gtcttggcca aacgcctccg tcccatgcac gtctttatcc tggattacga ccaatcgccc 2580 gccggctgcc gggacgccct gctgcaactt acctccggga tggtccagac ccacgtcacc 2640 accccaggct ccataccgac gatctgcgac ctggcgcgca cgtttgcccg ggagatgggg 2700 gaggctaact gattcgaaac aaacaccatt gtcacactcc acgatacaaa caccattgtc 2760 acactccacg atacaaacac cattgtcaca ctccattcga aagatcccaa cgaaaagaga 2820 gaccacatgg tccttcttga gtttgtaaca gctgctggga ttacacatgg catggatgaa 2880 ctgtacaact gaggatcccc cgacctcgac ctctggctaa taaa 2924 <210> 9 <211> 3585 <212> DNA <213> Artificial Sequence <220> <223> PEPCK-mRib-TK-mir122aT (3x) <400> 9 aagtttattg tgttaggtca gttccaaacc gtgctgacca tggctatgat ccaaaggccg 60 gccccttacg tcagaggcga gcctccaggt ccagctgagg ggcagggctg tcctcccttc 120 tgtatactat ttaaagcgag gagggctagc taccaagcac ggttggcctt ccctctggga 180 acacaccctt ggccaacagg ggaaatccgg cgagacgctc tgagatcctg cgagaaggag 240 gtgcgtcctg ctgcctgccc cggcactctg gctccccagc tcaaggttca ggccttgccc 300 caggccgggc ctctgggtac ctgaggtctt ctcccgctct gtgcccttct cctcacctgg 360 ctgcaatgag tgggggagca cggggcttct gcatgctgaa ggcaccccac tcagccaggc 420 ccttcttctc ctccaggtcc cccacggccc ttcagatccg tgcggtagat cttcgggtcc 480 ccgggttgca caagccgcct gccctcgggc cccaggcgcc gcacaaaggt tgccagcggc 540 cacacctccc ggtatcggcg ctagagccga gcggagagaa aagttatcag gcatgcacct 600 ggtagctagt ctttaaacca atagattgca tcggtttaaa aggcaagacc gtcaaattgc 660 gggaaagggg tcaacagccg ttcagtacca agtctcaggg gaaactttga gatggccttg 720 caaagggtat ggtaataagc tgacggacat ggtcctaacc acgcagccaa gtcctaagtc 780 aacagatctt ctgttgatat ggatgcagtt cacagactaa atgtcggtcg gggaagatgt 840 attcttctca taagatatag tcggacctct ccttaatggg agctagcgga tgaagtgatg 900 caacactgga gccgctggga actaatttgt atgcgaaagt atattgatta gttttggagt 960 actcgcgcgg ccgccgcttc gtacccctgc catcaacacg cgtctgcgtt cgaccaggct 1020 gcgcgttctc gcggccatag caaccgacgt acggcgttgc gccctcgccg gcagcaagaa 1080 gccacggaag tccgcctgga gcagaaaatg cccacgctac tgcgggttta tatagacggt 1140 cctcacggga tggggaaaac caccaccacg caactgctgg tggccctggg ttcgcgcgac 1200 gatatcgtct acgtacccga gccgatgact tactggcagg tgctgggggc ttccgagaca 1260 atcgcgaaca tctacaccac acaacaccgc ctcgaccagg gtgagatatc ggccggggac 1320 gcggcggtgg taatgacaag cgcccagata acaatgggca tgccttatgc cgtgaccgac 1380 gccgttctgg ctcctcatgt cgggggggag gctgggagtt cacatgcccc gcccccggcc 1440 ctcaccctca tcttcgaccg ccatcccatc gccgccctcc tgtgctaccc ggccgcgcga 1500 taccttatgg gcagcatgac cccccaggcc gtgctggcgt tcgtggccct catcccgccg 1560 accttgcccg gcacaaacat cgtgttgggg gcccttccgg aggacagaca catcgaccgc 1620 ctggccaaac gccagcgccc cggcgagcgg cttgacctgg ctatgctggc cgcgattcgc 1680 cgcgtttacg ggctgcttgc caatacggtg cggtatctgc agggcggcgg gtcgtggtgg 1740 gaggattggg gacagctttc ggggacggcc gtgccgcccc agggtgccga gccccagagc 1800 aacgcgggcc cacgacccca tatcggggac acgttattta ccctgtttcg ggcccccgag 1860 ttgctggccc ccaacggcga cctgtataac gtgtttgcct gggccttgga cgtcttggcc 1920 aaacgcctcc gtcccatgca cgtctttatc ctggattacg accaatcgcc cgccggctgc 1980 cgggacgccc tgctgcaact tacctccggg atggtccaga cccacgtcac caccccaggc 2040 tccataccga cgatctgcga cctggcgcgc acgtttgccc gggagatggg ggaggctaac 2100 tgaagcggcc gcacaaacac cattgtcaca ctccacgata caaacaccat tgtcacactc 2160 cacgatacaa acaccattgt cacactccag cggccgcggg tggcatccct gtgacccctc 2220 cccagtgcct ctcctggccc tggaagttgc cactccagtg cccaccagcc ttgtcctaat 2280 aaaattaagt tgcatcattt tgtctgacta ggtgtccttc tataatatta tggggtggag 2340 gggggtggta tggagcaagg ggcaagttgg gaagacaacc tgtagggcct gcggggtcta 2400 ttgggaacca agctggagtg cagtggcaca atcttggctc actgcaatct ccgcctcctg 2460 ggttcaagcg attctcctgc ctcagcctcc cgagttgttg ggattccagg catgcatgac 2520 caggctcagc taatttttgt ttttttggta gagacggggt ttcaccatat tggccaggct 2580 ggtctccaac tcctaatctc aggtgatcta cccaccttgg cctcccaaat tgctgggatt 2640 acaggcgtga accactgctc ccttccctgt ccttctgatt ttaaaataac tataccagca 2700 ggaggacgtc cagacacagc ataggctacc tggccatgcc caaccggtgg gacatttgag 2760 ttgcttgctt ggcactgtcc tctcatgcgt tgggtccact cagtagatgc ctgcaggctc 2820 agaggcacac aggagtttct gggctcaccc tgcccccttc caacccctca gttcccatcc 2880 tccagcagct gtttgtgtgc tgcctctgaa gtccacactg aacaaacttc agcctactca 2940 tgtccctaaa atgggcaaac attgcaagca gcaaacagca aacacacagc cctccctgcc 3000 tgctgacctt ggagctgggg cagaggtcag agacctctct gggcccatgc cacctccaac 3060 atccactcga ccccttggaa tttcggtgga gaggagcaga ggttgtcctg gcgtggttta 3120 ggtagtgtga gagggtccgg gttcaaaacc acttgctggg tggggagtcg tcagtaagtg 3180 gctatgcccc gaccccgaag cctgtttccc catctgtaca atggaaatga taaagacgcc 3240 catctgatag ggtttttgtg gcaaataaac atttggtttt tttgttttgt tttgttttgt 3300 tttttgagat ggaggtttgc tctgtcgccc aggctggagt gcagtgacac aatctcatct 3360 caccacaacc ttcccctgcc tcagcctccc aagtagctgg gattacaagc atgtgccacc 3420 acacctggct aattttctat ttttagtaga gacgggtttc tccatgttgg tcagcctcag 3480 cctcccaagt aactgggatt acaggcctgt gccaccacac ccggctaatt ttttctattt 3540 ttgacaggga cggggtttca ccatgttggt caggctggtc tagaa 3585 <210> 10 <211> 1062 <212> DNA <213> Artificial Sequence <220> <223> CMV promoter <400> 10 cgcgttacat aacttacggt aaatggcccg cctggctgac cgcccaacga cccccgccca 60 ttgacgtcaa taatgacgta tgttcccata gtaacgccaa tagggacttt ccattgacgt 120 caatgggtgg agtatttacg gtaaactgcc cacttggcag tacatcaagt gtatcatatg 180 ccaagtccgc cccctattga cgtcaatgac ggtaaatggc ccgcctggca ttatgcccag 240 tacatgacct tacgggactt tcctacttgg cagtacatct acgtattagt catcgctatt 300 accatggtga tgcggttttg gcagtacacc aatgggcgtg gatagcggtt tgactcacgg 360 ggatttccaa gtctccaccc cattgacgtc aatgggagtt tgttttggca ccaaaatcaa 420 cgggactttc caaaatgtcg taataacccc gccccgttga cgcaaatggg cggtaggcgt 480 gtacggtggg aggtctatat aagcagagct cgtttagtga accgtcagat cctcactctc 540 ttccgcatcg ctgtctgcga gggccagctg ttgggctcgc ggttgaggac aaactcttcg 600 cggtctttcc agtactcttg gatcggaaac ccgtcggcct ccgaacggta ctccgccacc 660 gagggacctg agccagtccg catcgaccgg atcggaaaac ctctcgagaa aggcgtctaa 720 ccagtcacag tcgcaaggta ggctgagcac cgtggcgggc ggcagcgggt ggcggtcggg 780 gttgtttctg gcggaggtgc tgctgatgat gtaattaaag taggcggtct tgagccggcg 840 gatggtcgag gtgaggtgtg gcaggcttga gatccagctg ttggggtgag tactccctct 900 caaaagcggg catgacttct gcgctaagat tgtcagtttc caaaaacgag gaggatttga 960 tattcacctg gcccgatctg gccatacact tgagtgacaa tgacatccac tttgcctttc 1020 tctccacagg tgtccactcc caggtccaag tttggaagat cc 1062 <210> 11 <211> 227 <212> DNA <213> Artificial Sequence <220> <223> PEPCK promoter <400> 11 aagtttattg tgttaggtca gttccaaacc gtgctgacca tggctatgat ccaaaggccg 60 gccccttacg tcagaggcga gcctccaggt ccagctgagg ggcagggctg tcctcccttc 120 tgtatactat ttaaagcgag gagggctagc taccaagcac ggttggcctt ccctctggga 180 acacaccctt ggccaacagg ggaaatccgg cgagacgctc tgagatc 227 <210> 12 <211> 746 <212> DNA <213> Artificial Sequence <220> <223> hTERT targeting ribozyme <400> 12 aaggccagca cgttcttcgc gccgcgctcg cacagcctct gcagcactcg ggccaccagc 60 tccttcaggc aggacacctg gcggaaggag ggggcggcgg ggggcggccg tgcgtcccag 120 ggcacgcaca ccaggcactg ggccaccagc gcgcggaaag ccgccgggtc cccgcgctgc 180 accagccgcc agccctgggg ccccaggcgc cgcacgaacg tggccagcgg cagcacctcg 240 cggtagtggc tgcgcagcag ggagcgcacg gctaggcagc ggggagcgcg cggcatcgcg 300 ggggtggccg gggccagggc ttcccaagct tcgttttgcg gcaggaaaag ttatcaggca 360 tgcacctggt agctagtctt taaaccaata gattgcatcg gtttaaaagg caagaccgtc 420 aaattgcggg aaaggggtca acagccgttc agtaccaagt ctcaggggaa actttgagat 480 ggccttgcaa agggtatggt aataagctga cggacatggt cctaaccacg cagccaagtc 540 ctaagtcaac agatcttctg ttgatatgga tgcagttcac agactaaatg tcggtcgggg 600 aagatgtatt cttctcataa gatatagtcg gacctctcct taatgggagc tagcggatga 660 agtgatgcaa cactggagcc gctgggaact aatttgtatg cgaaagtata ttgattagtt 720 ttggagtact cgcgaaaacg cccacc 746 <210> 13 <211> 1131 <212> DNA <213> Artificial Sequence <220> <223> tk gene <400> 13 atggcttcgt acccctgcca tcaacacgcg tctgcgttcg accaggctgc gcgttctcgc 60 ggccatagca accgacgtac ggcgttgcgc cctcgccggc agcaagaagc cacggaagtc 120 cgcctggagc agaaaatgcc cacgctactg cgggtttata tagacggtcc tcacgggatg 180 gggaaaacca ccaccacgca actgctggtg gccctgggtt cgcgcgacga tatcgtctac 240 gtacccgagc cgatgactta ctggcaggtg ctgggggctt ccgagacaat cgcgaacatc 300 tacaccacac aacaccgcct cgaccagggt gagatatcgg ccggggacgc ggcggtggta 360 atgacaagcg cccagataac aatgggcatg ccttatgccg tgaccgacgc cgttctggct 420 cctcatgtcg ggggggaggc tgggagttca catgccccgc ccccggccct caccctcatc 480 ttcgaccgcc atcccatcgc cgccctcctg tgctacccgg ccgcgcgata ccttatgggc 540 agcatgaccc cccaggccgt gctggcgttc gtggccctca tcccgccgac cttgcccggc 600 acaaacatcg tgttgggggc ccttccggag gacagacaca tcgaccgcct ggccaaacgc 660 cagcgccccg gcgagcggct tgacctggct atgctggccg cgattcgccg cgtttacggg 720 ctgcttgcca atacggtgcg gtatctgcag ggcggcgggt cgtggtggga ggattgggga 780 cagctttcgg ggacggccgt gccgccccag ggtgccgagc cccagagcaa cgcgggccca 840 cgaccccata tcggggacac gttatttacc ctgtttcggg cccccgagtt gctggccccc 900 aacggcgacc tgtataacgt gtttgcctgg gccttggacg tcttggccaa acgcctccgt 960 cccatgcacg tctttatcct ggattacgac caatcgcccg ccggctgccg ggacgccctg 1020 ctgcaactta cctccgggat ggtccagacc cacgtcacca ccccaggctc cataccgacg 1080 atctgcgacc tggcgcgcac gtttgcccgg gagatggggg aggctaactg a 1131 <210> 14 <211> 1653 <212> DNA <213> Artificial Sequence <220> <223> firefly luciferase <400> 14 atggaagacg ccaaaaacat aaagaaaggc ccggcgccat tctatcctct agaggatgga 60 accgctggag agcaactgca taaggctatg aagagatacg ccctggttcc tggaacaatt 120 gcttttacag atgcacatat cgaggtgaac atcacgtacg cggaatactt cgaaatgtcc 180 gttcggttgg cagaagctat gaaacgatat gggctgaata caaatcacag aatcgtcgta 240 tgcagtgaaa actctcttca attctttatg ccggtgttgg gcgcgttatt tatcggagtt 300 gcagttgcgc ccgcgaacga catttataat gaacgtgaat tgctcaacag tatgaacatt 360 tcgcagccta ccgtagtgtt tgtttccaaa aaggggttgc aaaaaatttt gaacgtgcaa 420 aaaaaattac caataatcca gaaaattatt atcatggatt ctaaaacgga ttaccaggga 480 tttcagtcga tgtacacgtt cgtcacatct catctacctc ccggttttaa tgaatacgat 540 tttgtaccag agtcctttga tcgtgacaaa acaattgcac tgataatgaa ttcctctgga 600 tctactgggt tacctaaggg tgtggccctt ccgcatagaa ctgcctgcgt cagattctcg 660 catgccagag atcctatttt tggcaatcaa atcattccgg atactgcgat tttaagtgtt 720 gttccattcc atcacggttt tggaatgttt actacactcg gatatttgat atgtggattt 780 cgagtcgtct taatgtatag atttgaagaa gagctgtttt tacgatccct tcaggattac 840 aaaattcaaa gtgcgttgct agtaccaacc ctattttcat tcttcgccaa aagcactctg 900 attgacaaat acgatttatc taatttacac gaaattgctt ctgggggcgc acctctttcg 960 aaagaagtcg gggaagcggt tgcaaaacgc ttccatcttc cagggatacg acaaggatat 1020 gggctcactg agactacatc agctattctg attacacccg agggggatga taaaccgggc 1080 gcggtcggta aagttgttcc attttttgaa gcgaaggttg tggatctgga taccgggaaa 1140 acgctgggcg ttaatcagag aggcgaatta tgtgtcagag gacctatgat tatgtccggt 1200 tatgtaaaca atccggaagc gaccaacgcc ttgattgaca aggatggatg gctacattct 1260 ggagacatag cttactggga cgaagacgaa cacttcttca tagttgaccg cttgaagtct 1320 ttaattaaat acaaaggata tcaggtggcc cccgctgaat tggaatcgat attgttacaa 1380 caccccaaca tcttcgacgc gggcgtggca ggtcttcccg acgatgacgc cggtgaactt 1440 cccgccgccg ttgttgtttt ggagcacgga aagacgatga cggaaaaaga gatcgtggat 1500 tacgtggcca gtcaagtaac aaccgcgaaa aagttgcgcg gaggagttgt gtttgtggac 1560 gaagtaccga aaggtcttac cggaaaactc gacgcaagaa aaatcagaga gatcctcata 1620 aaggccaaga agggcggaaa gtccaaattg taa 1653 <210> 15 <211> 936 <212> DNA <213> Artificial Sequence <220> <223> renillar luciferase <400> 15 atgacttcga aagtttatga tccagaacaa aggaaacgga tgataactgg tccgcagtgg 60 tgggccagat gtaaacaaat gaatgttctt gattcattta ttaattatta tgattcagaa 120 aaacatgcag aaaatgctgt tattttttta catggtaacg cggcctcttc ttatttatgg 180 cgacatgttg tgccacatat tgagccagta gcgcggtgta ttataccaga ccttattggt 240 atgggcaaat caggcaaatc tggtaatggt tcttataggt tacttgatca ttacaaatat 300 cttactgcat ggtttgaact tcttaattta ccaaagaaga tcatttttgt cggccatgat 360 tggggtgctt gtttggcatt tcattatagc tatgagcatc aagataagat caaagcaata 420 gttcacgctg aaagtgtagt agatgtgatt gaatcatggg atgaatggcc tgatattgaa 480 gaagatattg cgttgatcaa atctgaagaa ggagaaaaaa tggttttgga gaataacttc 540 ttcgtggaaa ccatgttgcc atcaaaaatc atgagaaagt tagaaccaga agaatttgca 600 gcatatcttg aaccattcaa agagaaaggt gaagttcgtc gtccaacatt atcatggcct 660 cgtgaaatcc cgttagtaaa aggtggtaaa cctgacgttg tacaaattgt taggaattat 720 aatgcttatc tacgtgcaag tgatgattta ccaaaaatgt ttattgaatc ggacccagga 780 ttcttttcca atgctattgt tgaaggtgcc aagaagtttc ctaatactga atttgtcaaa 840 gtaaaaggtc ttcatttttc gcaagaagat gcacctgatg aaatgggaaa atatatcaaa 900 tcgttcgttg agcgagttct caaaaatgaa caataa 936 <210> 16 <211> 506 <212> DNA <213> Artificial Sequence <220> <223> mTERT targeting ribozyme <400> 16 gtgcggtaga tcttcgggtc cccgggttgc acaagccgcc tgccctcggg ccccaggcgc 60 cgcacaaagg ttgccagcgg ccacacctcc cggtatcggc gctagagccg agcggagaga 120 aaagttatca ggcatgcacc tggtagctag tctttaaacc aatagattgc atcggtttaa 180 aaggcaagac cgtcaaattg cgggaaaggg gtcaacagcc gttcagtacc aagtctcagg 240 ggaaactttg agatggcctt gcaaagggta tggtaataag ctgacggaca tggtcctaac 300 cacgcagcca agtcctaagt caacagatct tctgttgata tggatgcagt tcacagacta 360 aatgtcggtc ggggaagatg tattcttctc ataagatata gtcggacctc tccttaatgg 420 gagctagcgg atgaagtgat gcaacactgg agccgctggg aactaatttg tatgcgaaag 480 tatattgatt agttttggag tactcg 506 <210> 17 <211> 1138 <212> DNA <213> Artificial Sequence <220> <223> tk gene <400> 17 cgcggccgcc gcttcgtacc cctgccatca acacgcgtct gcgttcgacc aggctgcgcg 60 ttctcgcggc catagcaacc gacgtacggc gttgcgccct cgccggcagc aagaagccac 120 ggaagtccgc ctggagcaga aaatgcccac gctactgcgg gtttatatag acggtcctca 180 cgggatgggg aaaaccacca ccacgcaact gctggtggcc ctgggttcgc gcgacgatat 240 cgtctacgta cccgagccga tgacttactg gcaggtgctg ggggcttccg agacaatcgc 300 gaacatctac accacacaac accgcctcga ccagggtgag atatcggccg gggacgcggc 360 ggtggtaatg acaagcgccc agataacaat gggcatgcct tatgccgtga ccgacgccgt 420 tctggctcct catgtcgggg gggaggctgg gagttcacat gccccgcccc cggccctcac 480 cctcatcttc gaccgccatc ccatcgccgc cctcctgtgc tacccggccg cgcgatacct 540 tatgggcagc atgacccccc aggccgtgct ggcgttcgtg gccctcatcc cgccgacctt 600 gcccggcaca aacatcgtgt tgggggccct tccggaggac agacacatcg accgcctggc 660 caaacgccag cgccccggcg agcggcttga cctggctatg ctggccgcga ttcgccgcgt 720 ttacgggctg cttgccaata cggtgcggta tctgcagggc ggcgggtcgt ggtgggagga 780 ttggggacag ctttcgggga cggccgtgcc gccccagggt gccgagcccc agagcaacgc 840 gggcccacga ccccatatcg gggacacgtt atttaccctg tttcgggccc ccgagttgct 900 ggcccccaac ggcgacctgt ataacgtgtt tgcctgggcc ttggacgtct tggccaaacg 960 cctccgtccc atgcacgtct ttatcctgga ttacgaccaa tcgcccgccg gctgccggga 1020 cgccctgctg caacttacct ccgggatggt ccagacccac gtcaccaccc caggctccat 1080 accgacgatc tgcgacctgg cgcgcacgtt tgcccgggag atgggggagg ctaactga 1138

Claims (25)

Promoter;
A trans-splicing ribozyme coding DNA that acts on a cancer specific gene, operably linked to said promoter; And
A microRNA target sequence coding DNA contained in the 3 ′ UTR corresponding site of the ribozyme,
The microRNA is not expressed in cancer cells. The method of claim 1, wherein the expression vector
An expression vector further comprising a therapeutic gene or a reporter gene linked to the 3'-side exon corresponding site of the ribozyme. The expression vector of claim 1, wherein the cancer specific gene is hTERT (human Telomerase Reverse Transcriptase). The expression vector of claim 1, wherein the ribozyme is a trans-splicing group I intron ribozyme that specifically targets a human Telomerase Reverse Transcriptase (hTERT) mRNA. The expression vector of claim 2, wherein the therapeutic gene is a Herpes simplex virus-thymidine kinase (HSV-tk) gene. The expression vector of claim 2, wherein the reporter gene is a firefly luciferase gene or a renillar luciferase. The expression vector of claim 1, wherein the promoter is a promoter that is specifically activated for cancer cells. The expression vector of claim 1, wherein the promoter is a promoter of a phosphoenolpyruvate carboxykinase (PEPCK) gene. The expression vector of claim 1, wherein the microRNA target sequence is an antisense sequence of the microRNA. The expression vector of claim 1, wherein the microRNA target sequence coding DNA is included in at least one. The expression vector according to claim 1, wherein the expression vector comprises a nucleotide sequence selected from SEQ ID NO: 4 to SEQ ID NO: 9. According to claim 1, wherein the promoter is an expression vector having a nucleotide sequence represented by SEQ ID NO: 10 or SEQ ID NO: 11. The expression vector according to claim 1, wherein the ribozyme coding DNA has a nucleotide sequence represented by SEQ ID NO: 12 or SEQ ID NO: 16. According to claim 2, wherein the therapeutic gene is an expression vector having a nucleotide sequence represented by SEQ ID NO: 13 or SEQ ID NO: 17. The expression vector according to claim 2, wherein the reporter gene has a nucleotide sequence represented by SEQ ID NO: 14 or SEQ ID NO: 15. The expression vector according to claim 1, wherein the microRNA target sequence coding DNA has a nucleotide sequence represented by SEQ ID NO: 1 or SEQ ID NO: 2. The expression vector according to claim 2, wherein the ribozyme functions to link the therapeutic gene or the reporter gene to the cancer specific gene by performing a trans-splicing reaction by recognizing the mRNA of the cancer specific gene. The expression vector according to claim 1 or 2, wherein the ribozyme acts to inactivate the cancer specific gene by recognizing the mRNA of the cancer specific gene and performing a trans-splicing reaction. An anticancer pharmaceutical composition comprising the expression vector according to any one of claims 1 to 18 as an active ingredient. The composition of claim 19, wherein the anticancer pharmaceutical composition does not have cytotoxicity in cells other than cancer cells. The composition of claim 20, wherein in cells other than cancer cells, intracellular microRNA binds to the microRNA target sequence such that trans-splicing ribozymes that act on cancer specific genes are inactivated. Cancer diagnostic composition comprising the expression vector according to claim 2 as an active ingredient. Introducing the expression vector according to claim 2 into cancer cells; And
An information providing method for diagnosing cancer, the method comprising detecting a reporter protein in cancer cells. Operatively linking a trans-splicing ribozyme coding DNA that acts on a cancer specific gene with a promoter; And
Including the microRNA target sequence coding DNA in the 3′UTR corresponding site of the ribozyme,
The microRNA is not expressed in cancer cells, cancer expression expression vector manufacturing method. 25. The method of claim 24,
Linking a therapeutic or reporter gene to the 3'-side exon corresponding site of the ribozyme.

Images