KR20120124945A - Primer Set for Discerning Flowering Type in Brassica and Method for Discerning Using the Same - Google Patents

Abstract

PURPOSE: A primer set for determining a flowering type of Brassica sp. plant and a determining method using the same are provided to predict flowering physiology of the plant. CONSTITUTION: A primer set for determining a flowering type of Brassica sp. plant contains a primer of sequence numbers 3 and 4. A method for determining the flowering type of the plant comprises: a step of amplifying DNA isolated from the plant using the primer set; and a step of identifying the size of amplified products. A kit for determining the flowering type contains the primer set. The kit also contains a reaction buffer solution, DNA polymerase, dNTPs, and stabilzing agent. [Reference numerals] (AA) Vernalization type; (BB) Non-vernalization type

Description

Primer Set for Discrimination of Flowering Types of Chinese Cabbage and Discrimination Method Using the Same {Primer Set for Discerning Flowering Type in Brassica and Method for Discerning Using the Same}

The present invention relates to a primer set for identifying the flowering type of a plant of the Chinese cabbage (Brassica) and a method for determining the flowering type of a plant of the Chinese cabbage using the same.

The flowering type of Chinese cabbage is generally known as the spring type that blooms after exposure to low temperature for a certain period of time.However, yellow sarson, which is one of the oilseed rape species, and Komatsuna, which is known as Japanese mustard spinach, are 40 days after sowing without cold treatment. It is recommended after the war. In addition, gat is also known as a plant that needs spring treatment depending on the variety, but there is a case in which it affects the yield by the midsummer.

Flowering conditions and mechanisms of cabbage plants are important factors to ensure small size and yield. In addition, when breeding new varieties through breeding and breeding in various combinations, it is very important to select basic traits necessary for plant cultivation in addition to the target traits and select them early. If you wait until the flowering period to determine the flowering type, the breeding period becomes longer. There is a problem that increases the effort and cost.

The present invention is to develop a marker that distinguishes the flowering type of Chinese cabbage plants into spring and non-spring types to determine the early growth of Chinese cabbage plants and to use them for predicting and selecting cultivation types.

In order to solve the above problems, the present invention provides a primer set for identifying the flowering type of a plant of the Chinese cabbage (Brassica) comprising a primer having a nucleic acid sequence of SEQ ID NO: 3 and SEQ ID NO: 4.

In another aspect, the present invention by using a primer set comprising a primer having a nucleic acid sequence of SEQ ID NO: 3 and SEQ ID NO: 4 Chinese cabbage (Brassica) comprising the step of PCR amplifying DNA extracted from the plant in the Chinese cabbage amplification product It provides a flowering type discrimination method of the genus plant.

In another aspect, the present invention provides a kit for identifying the flowering type of the genus (Brassica) plant comprising a primer set comprising a primer having a nucleic acid sequence of SEQ ID NO: 3 and SEQ ID NO: 4.

According to the present invention, the flowering physiology of the cabbage plant can be predicted at the early stage of growth, and thus it can be usefully used for breeding and breeding of the cabbage plant.

1 shows photographs 85 days after sowing of spring and non-spring cabbages.
Figure 2 shows the result of comparative nucleic acid sequence analysis of BrPRR1b gene between cabbage subspecies. The amplification sites of the primer sets according to the invention are shown in red.
Figure 3 shows the results of PCR analysis of 22 Chinese cabbages using the primer set according to the present invention.
Figure 4 shows the PCR analysis results of 47 kinds of Chinese cabbage plants using the primer set according to the present invention.

The present invention provides a primer set for flowering type determination of plants of the genus Cabras (Brassica) comprising a primer having a nucleic acid sequence of SEQ ID NO: 3 and SEQ ID NO: 4.

The primers having the nucleic acid sequences of SEQ ID NO: 3 and SEQ ID NO: 4 are forward (vernal_marker_L) and reverse (vernal_marker_R) primers for amplifying specific regions of the BrPRR1b gene conserved in the cabbage subspecies, respectively, and the primer set comprises a cabbage subspecies. It can be used as a marker to determine the flowering type of plants of various Chinese cabbage (Brassica).

The present invention was completed by finding that the BrPRR1b genes of BrPRR1a and BrPRR1b, which are the biological clock genes of Chinese cabbage plants, showed mutations in the cabbage subspecies, and flowering types were distinguished according to the above variants. As can be seen through the following examples, the nucleic acid of the BrPRR1b gene of the cabbage subspecies known as the non-aging type that blooms in about 40 days after germination if the spring and long-term conditions require low-temperature treatment for a certain period (about 45 days) for flowering. As a result of comparing the sequences, it was confirmed that there was a deletion region of about 46 bp in the nucleic acid sequence in the BrPRR1b gene in the case of the spring type. As a result of designing a primer set capable of amplifying the defective region, PCR amplification resulted in a short PCR band in the spring type and a relatively long PCR band in the non-spring type. In addition, it was confirmed that the primer set can be applied not only to cabbage subspecies but also to the flowering type discrimination of cabbage, mustard, broccoli and rapeseed belonging to the cabbage family.

Therefore, the present invention uses a primer set comprising a primer having a nucleic acid sequence of SEQ ID NO: 3 and SEQ ID NO: 4 Chinese cabbage (Brassica) comprising the step of PCR amplifying DNA extracted from the plant in the Chinese cabbage amplification product It provides a flowering type discrimination method of the genus plant.

As a result of PCR amplification using the primer set, if only a long PCR band of 451 bp is identified, it is an unspringed plant, and if a short PCR band of 422 bp is identified, it can be determined to be a spring plant.

The method of extracting DNA from the cabbage plants and the method of PCR amplifying the extracted DNA may be performed by conventional methods known in the art, which may be appropriately selected by those skilled in the art.

PCR amplification of the DNA extracted from the plant in the Chinese cabbage to determine the size of the amplification product can also be carried out by a conventional method known in the art, according to an embodiment of the present invention, the size of the PCR amplified DNA product Although confirmed through electrophoresis, it can be appropriately selected by those skilled in the art.

The present invention also provides a kit for identifying the flowering type of a plant of the genus Cabras (Brassica) comprising a primer set comprising a primer having a nucleic acid sequence of SEQ ID NO: 3 and SEQ ID NO: 4.

Kit for determining the flowering type of the cabbage plant according to the present invention is any biological or necessary for determining the flowering type of the cabbage plant in the sample, including the reaction buffer solution, DNA polymerase, dNTPs, stabilizers, etc. in addition to the primer set Chemical reagents, instructions for use, and the like. Other configurations of such kits may be appropriately selected by those skilled in the art.

BEST MODE FOR CARRYING OUT THE INVENTION Hereinafter, the present invention will be described in detail with reference to the following examples. However, the following examples are intended to illustrate the contents of the present invention, but the scope of the present invention is not limited to the following examples. Embodiments of the present invention are provided to more fully describe the present invention to those skilled in the art.

Example  1: plant material and DNA  extraction

As shown in Table 1, 43 species of cabbage subspecies, cabbage plants (broccoli, cabbage, gat, young rapeseed) and Arabidopsis were used in the experiment. Thirty seeds of cabbage subspecies 1 to 30 were seeded by the Center for Genetic Resources, the Netherlands, http://www.cgn.wur.nl/UK , and 34 to 45 were eastern Hannong The seeds were sold at the seedlings, and the seeds 31, 32, 33 and 48 were used by the RDA. For plants that are already known to bloom, the flowering types known in Table 1 are also indicated.

The seeds of the plants were sown and leaves and stems were collected when the main leaves were about 3-5 sheets. After grinding the collected leaves and stems, Kim et al. 2006. A sequence-tagged linkage map of Brassica rapa. Genomic DNA was extracted by the method disclosed in Genetics 174: 29-39 and the concentration was diluted to 50 ng / ml.

number designation Assertion  number TAG2005 Blooming number designation Assertion  number TAG2005 Blooming One WB04 L58 Non-spring type 25 LP08 CGN06835 YS-033 Non-spring type 2 WB05 CGN07211 PC-078 26 LP09 CGN06836 SO-034 Non-spring type 3 WB06 OCRI1757 OR-210 27 LP10 CGN06840 SO-038 Non-spring type 4 WB09 CGN17280 TG-129 Spring flower 28 LP21 CGN13924 PC-099 5 WB11 CGN06818 WO-024 Non-spring type 29 LP23 CGN15184 PC-107 6 WB12 CGN07222 WO-085 30 LP30 R-O-18 0 Non-spring type 7 WB13 CGN15202 KOM-118 Spring flower 31 chapter CC-01 Spring flower 8 WB14 FIL500 YS-143 Non-spring type 32 Mother-in-law CC-02 Spring flower 9 WB15 CGN06841 SO-039 Non-spring type 33 cog CC-03 Spring flower 10 WB16 CGN06842 SO-040 Non-spring type 34 D01_Comment A L58-01 Spring flower 11 WB17 CGN06790 MIZ-019 Spring flower 35 D02_Sound B L58-02 Non-spring type 12 WB18 CGN17279 MIZ-128 Spring flower 36 D03_Chil1 Chil-01 13 WB20-1 CGN15171 PC-105 37 D03_Chil2 Chil-02 14 WB20-2 CGN15171 PC-105 38 D03_Chil3 Chil-03 15 WB21 CGN06828 BRO-029 39 D06_hiro1 Hiro-01 16 WB22 CGN06829 BRO-030 40 D07_ Cheonggyeongchae PC-01 Spring flower 17 WB23 CGN17278 BRO-127 41 D10_Baek Kyungchae PC-02 18 WB24 CGN15199 VT-115 Spring flower 42 D11_ Turnip VT-01 Spring flower 19 WB25 CGN06720 VT-012 Spring flower 43 D12_Reinforced turnip VT-02 Spring flower 20 WB26 CGN06709 VT-006 Spring flower 44 D08_Broccoli out-01 Spring flower 21 WB27 CGN06859 VT-044 Spring flower 45 D09_ Cabbage out-02 Spring flower 22 LP04 CGN06718 VT-110 Spring flower 46 lampshade out-03 Spring flower 23 LP06 CGN06825 BRO-027 47 Youngsan Rapeseed out-04 Spring flower 24 LP07 CGN06834 SO-032 48 Baby pole out-05

Example  2: Chinese cabbage 22 subspecies  Selection and flowering days investigation

Of the 43 cabbage subspecies, 22 species of known flowering physiology were selected and classified into two groups. After planting 22 species of Chinese cabbage, the spring-type group was subjected to spring treatment for 2 days after sowing at low temperature (4 ° C.) for 45 days, and the non-spring type was grown in a 25 ° C. greenhouse. For each of the 22 Chinese cabbage subspecies, the number of days from seeding to flowering was measured and shown in Table 2 below (the individual indicated by NS did not observe flowering due to problems during the experimental process).

Non-spring type Spring flower Assertion Number designation Days Assertion Number designation Days WB04_L58 Rapid cycling 38 WB13_KOM Komatsuna NS WB11_WO Winter turnip rape 37 WB17_Miz Mizuna 90 WB14_YS Yellow sarson 48 WB18_Miz Mizuna NS WB15_SO Spring turnip rape 37 WB24_VT Vegetable turnip 105 WB16_SO Spring turnip rape NS WB25_VT Vegetable turnip 90 LP07_SO Spring turnip rape 48 WB09_TG turnip green 99 LP08_YS Yellow sarson 38 WB26_VT Vegetable turnip 105 LP09_SO Spring turnip rape 37 WB27_VT Vegetable turnip 110 LP30 41 LP04_VT Vegetable turnip 105 KwenshinB Chinese cabbage 41 KwenshinA Chinese cabbage 82 JW_Male / Female Chinese cabbage 95 Chiifu Chinese cabbage 95

Example  3: cabbage subspecies BrPRR1b  Exploring Gene Mutations

In order to search for variation of BrPRR1b gene for flowering type identification of cabbage plants, among the BrPRR1a and BrPRR1b genes registered with the Gene Bank (NCBI) using primer3 (http://frodo.wi.mit.edu/primer3/) Primers were designed that can separate BrPRR1b regions that are distinct from BrPRR1a (Table 3).

SEQ ID NO: Name of the primer Sequence (5'-3 ') One BrPRR1b_L TTTGCCATGAAAGTTGGAAG 2 BrPRR1b_R TGAGTGAACATGATCAAACACATC

Using this primer set, PCR amplification of BrPRR1b regions of 16 cabbage subspecies already known to be flowering. PCR conditions were denatured at 95 ° C for 5 minutes using 200ng of DNA template isolated in Example 1, followed by 35 cycles of denaturation at 95 ° C for 45 minutes, annealing at 58 ° C for 45 minutes, and elongation at 75 ° C for 1 minute and 30 seconds. 10 minutes extension was applied. The amplified PCR bands were separated and analyzed for nucleic acid sequences, followed by multi-alignment using DNASTAR Lasergene7, and then searched for mutant regions.

As a result, as shown in FIG. 2, it was confirmed that a deletion region of about 33 bp was present in the nucleic acid sequence of the spring Chinese cabbage subspecies.

Example  4: flowering type discrimination primer  Making of sets

A primer set capable of separating the defective region in the BrPRR1b gene identified in Example 3 was designed as follows (Table 4).

SEQ ID NO: Name of the primer Sequence (5'-3 ') 3 vernal_marker_L GAAGAAAGCTGAGGACTCTCCA 4 vernal_marker_R TCCAAGTGATCCAAACACAAA

Experimental Example  1: for flowering type discrimination primer  Set of As a marker  Check availability

PCR amplification was performed for 22 cabbage subspecies of Example 2 using the primer set. PCR conditions were applied in the same manner as in Example 3. In order to clearly see the difference between the bands, agarose was found in 2.5%.

As a result, as shown in FIG. 3, the bands were divided into two sizes, in which only 451 bp of long bands appeared in the non-spring plant, whereas 422 bp of short bands appeared in the spring plant. This also coincided with the flowering information of each plant identified in. In addition, in Table 1, both bands were observed in the case of the ultra-large giants (WB24, WB27, and LP04) having more than 100 days of flowering. If a short band is formed, it can be judged as a spring-type plant.

In addition, PCR amplification was performed on 43 kinds of Chinese cabbage subspecies of Example 1 and other cabbage plants (broccoli, cabbage, mustard, young rapeseed) using the primer set. PCR conditions were applied in the same manner as in Example 3.

As a result, as shown in Figure 4 it was confirmed that the size of the band of the product is different in two ways. In sum of the results of the previous embodiment, it can be seen that plants with only a long band of 451 bp are non-spring type, plants with a short band of 422 bp are spring type plants.

<110> REPUBLIC OF KOREA <120> Primer Set for Discerning Flowering Type in Brassica and Method          for Discerning Using the Same <130> P110226 <160> 4 <170> Kopatentin 1.71 <210> 1 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> BrPRR1b_L forward primer <400> 1 tttgccatga aagttggaag 20 <210> 2 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> BrPRR1b_R reverse primer <400> 2 tgagtgaaca tgatcaaaca catc 24 <210> 3 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> vernal_marker_L forward primer <400> 3 gaagaaagct gaggactctc ca 22 <210> 4 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> vernal_marker_R reverse primer <400> 4 tccaagtgat ccaaacacaa a 21

Claims (3)

A primer set for identifying the flowering type of a plant of the genus Cabras, comprising a primer having a nucleic acid sequence of SEQ ID NO: 3 and SEQ ID NO: 4. Flowering of plants of the genus Cabras (Brassica) comprising the step of PCR amplifying the DNA extracted from the plant in the Chinese cabbage using a primer set comprising a primer having a nucleic acid sequence of SEQ ID NO: 3 and SEQ ID NO: 4 Type determination method. Kit for identifying the flowering type of the plant of the genus Cabras (Brassica) comprising a primer set comprising a primer having a nucleic acid sequence of SEQ ID NO: 3 and SEQ ID NO: 4.

Images