KR20120117563A - Novel rna aptamers and the uses thereof - Google Patents

Abstract

PURPOSE: A novel RNA aptamer having anti-cancer effects and a pharmaceutical composition for treating cancers are provided to be used for diagnosing or treating cancers in which proteins are expressed. CONSTITUTION: A novel RNA aptamer combines with Lin28 or Lin28B protein. The RNA aptamer is selected from a group consisting of nucleotide sequence described in the sequence number 1(SEQ ID NO:1)-29. The cancer diagnostic kit includes the RNA aptamer. The cancer diagnostic kit additionally includes a container for performing and analyzing buffer solutions and detection. A pharmaceutical composition for treating cancers includes RNA aptamer as an active ingredient. The pharmaceutical composition for treating cancers additionally includes a pharmaceutically allowed carrier. A screening method of gene fragment which interacts with Lin28 or Lin28B comprises the following steps: withdrawing common base sequence which is included in the RNA aptamer; searching new gene fragment which includes the common sequence; and selecting the gene fragment which interacts with the Lin28 or Lin28B.

Description

Novel RNA aptamers and the Uses

The present invention relates to a novel RNA aptamer and its use, and more particularly, the present invention relates to an RNA aptamer that effectively binds to a Lin28 or Lin28B protein, a kit for cancer diagnosis comprising the RNA aptamer, the RNA aptamer The present invention relates to a pharmaceutical composition for treating cancer and a method for screening gene fragments interacting with Lin28 or Lin28B.

Aptamers are small molecule oligonucleotides that bind very tightly and specifically to target molecules. So in oncology, it's a very interesting material for diagnosis and treatment. In general, proteinaceous antibodies are excellent in high affinity, specificity, and wide range of targets, but show long-term blood flow in vivo, resulting in decreased imaging ability and high absorption of target tissues. In addition, the antibody shows incomplete penetration into the target tissue. Therefore, new target materials and clinical protocols are required. Examples include antibody antibody targeting strategies as well as smaller antibody fragments or peptides (Boerman OC, et al. Cancer Res. 1999; 59: 4400-4405). Thus, clinical trials are currently underway for aptamer specific targets in cancer tissue. Aptamers, oligonucleotide ligands, are compared by specificity and affinity in typical protein target molecules such as antibodies. Aptamers have a molecular weight of 8-15 kDa and are peptides (1-5 kDa) (Wu AM, et al. Immunotechnology. 1996; 2: 21-36; Lister-James J, et al., QJ Nucl. Med., 1996; 40; : 221-233) and the antibody (150 kDa) are medium in size and smaller than the single chain variant fragment antibody (scFve, 25 kDa). Aptamers, polyanions, are very different from scFve. Synthetic molecules, aptamers, support site-specific denaturation, which is readily structured and active. Therefore, it can be used in connection with polyethylene glycol (PEG) polymer and biocombination, diagnostic and therapeutic agent. It can also be aptamer pharmacokinetically modified (Watson SR et al., Antisense Nucleic Acid Drug Dev. 2000; 10: 6375).

Lin28 and Lin28B are evolutionarily well-conserved genes that have a large effect on early differentiation and were initially found in the nematode Caenorhabditis elegans (Moss, EG et al, Cell. (1997) 88: 637646). Lin28 or Lin28B is a 25kDa, 28kDa RNA binding protein consisting of one cold shock domain (CSD) and two retroviral zinc finger motifs (ZFM). CSD and ZFM are similar but differ in the amino acids of N-term and C-term. The domain parts of the two proteins are similar to each other, but the N-term and C-term parts of the protein are less similar to each other. It is expressed in embryonic stem cells in humans and rats, and rapidly decreases as expression progresses (Darr, H. et al. Stem Cells. (2009) 27: 35262.) It is known to be expressed in tissues in which stem cells exist, as in testis, and also expressed in advanced liver cancer cells (Assou, S. et al., BMC Genomics, (2009) doi: 10.1186 / 1471-2164-10- 10 .; Yingqiu, G. et al., Gene. (2006) 384: 5161.). And Lin28 is known to promote translation by binding to mRNA such as IGF2, MYOD1, and inhibit the step of pre-miRNA in the let7 family pri-miRNA (Srinivas, R. et al., Science. (2008) 320: 97-100), reducing the amount of mature let7 by inhibiting the process of pre-miRNA to mature miRNA (Inha, H. et al., (2008) 32: 276-84.). Lin28 recognizes and binds GGAG, a specific sequence in the loop of pre-let7 (Martin, A. et al., RNA. (2008) 14: 1539-1549.), And TUT4 binds to pre- Polyuridylation was performed at the 3 'end of let7 (Inha, H. et al., Molecular Cell. (2008) 32: 276284.) (FIG. 1)

miRNAs are small, non-coding RNAs with bases of ˜22 nucleotides that regulate the expression of genes in the post-transcriptional stage. It is transcribed by RNA polymerase II to make pri-miRNA, and it is cut by RNase III drosha in the nucleus to become pre-miRNA, or spliced intron is processed into mitron like pre-miRNA. The pre-miRNA is transported to the cytoplasm by exportin5 and becomes mature miRNA by RNase III dicer. The mature miRNA binds to RISC and performs its function. The miRNA is bound to the 3'UTR site of the target mRNA and inhibited. The method of inhibiting the gene is a method of digesting the target mRNA, inhibiting the initiation of translation, deadenylation of the mRNA, inhibiting translation elongation, and generating protein. To regulate expression. let7, a type of miRNA, was first discovered in C. elegans and was identified as a small RNA that plays an important role in development (Ingo, B. et al., Trends in Molecular Medicine. (2008) 14: 400-409.). mRNAs targeted by let7 are genes associated with cell cycle or division such as HMGA2, MYC, and RAS. Reduction of let7 targeting these genes may be involved in the development of cancer. Indeed, expression of mature let7 is reduced in lung and liver cancer cells (Yingqiu, G. et al., Gene. (2006) 384: 5161. Takamizawa, J. (2004) Cancer Res. 64: 3753-3756.). In liver cancer, the expression level of Lin28B can be seen to increase in many cases. In this case, the amount of pri-let7 and pre-let7 is not changed, but only the amount of mature let7 can be seen that the increase in the expression of Lin28B inhibits the process of pre-let7, which reduces the amount of mature let7. If the increase of Lin28B leads to the decrease of mature let7, if the function of Lin28B is inhibited, the process of pre-let7 is increased to increase the regulation of the oncogene targeted by let7 due to the increase of mature let7. It is expected to be helpful.

When cancer occurs, the expression of Lin28 or Lin28B increases and the decrease in the amount of mature let7 mRNA inhibits the oncogene control ability, thereby accelerating the progression of the cancer. Thus, the present inventors have developed a highly sensitive RNA aptamer capable of regulating Lin28 or Lin28B. The present invention was confirmed to be effective in suppressing cancer progression by developing the present invention.

It is a primary object of the present invention to provide an RNA aptamer that binds to Lin28 or Lin28.

Another object of the present invention to provide a kit for diagnosing cancer comprising the RNA aptamer.

Still another object of the present invention is to provide a pharmaceutical composition for treating cancer comprising the RNA aptamer as an active ingredient.

Another object of the present invention is to provide a method for screening gene fragments that interact with Lin28 or Lin28B.

As one aspect for achieving the above object, the present invention provides an RNA aptamer binding to Lin28 or Lin28B. At this time, the RNA aptamer is not particularly limited, but is preferably selected from the group consisting of the nucleotide sequence of SEQ ID NO: 1 to 29.

RNA aptamers are easier to select than conventional antibodies, are chemically synthesized, can be expressed in humans using viral or mammalian expression vectors, and when administered to humans, immune responses are known to be weak or non-causing. Using this advantage, we can expect to recover mature let7 which is reduced by increasing Lin28 expression if we can develop RNA aptamers specific for Lin28 or Lin28B. The present invention has been carried out with the understanding that if the specific domains of CSD and ZFM can be inhibited, it can be a good tool for studying the function of each domain.

According to an embodiment of the present invention, (a) the step of preparing an expression vector for mass production of Lin28 or Lin28B protein; (b) generating an RNA library consisting of a pool of 40 random sequences; And (c) selecting an RNA aptamer that specifically binds to Lin28 or Lin28B protein from the RNA library via a System Evolution of Ligands by Exponential Enrichment (SELEX) method. The RNA aptamer may be prepared by the method of preparing the binding RNA aptamer.

As used herein, the term “aptamer” refers to a small single-stranded oligonucleotide that can specifically recognize a target material with high affinity. In particular, "RNA aptamers" are short single-stranded oligonucleotides that can form three-dimensional structures capable of binding to target proteins or cells with high affinity and specificity. In addition, most RNA aptamers can not only bind specifically to the target protein but also efficiently inhibit its function, and thus can be used to determine the function of the target protein. In the present case it is considered to mean RNA aptamers that bind to Lin28 or Lin28B.

The RNA aptamer may be selected through the Systemic Evolution of Ligands by Exponential Enrichment (SELEX) method, or may be chemically synthesized.

The term "SELEX" of the present invention refers to a method for separating a specific RNA sequence having a specific and high affinity for a target protein in an RNA library having about 10 ²⁴ different kinds in vitro.

In a specific embodiment, the present invention provides a process for (a) preparing an RNA library as a first necessary procedure for screening RNA aptamers, in which method restriction enzymes for cloning and sequencing are identified at both ends (5 'and 3'). A recognition site was arranged, and a 5 'primer and a 3' primer including a DNA template, a T7 RNA polymerase promoter, and a 40 bp random nucleotide sequence were prepared. Next, (b) a SELEX process was performed by reacting with an RNA library and a target material (Lin28 or Lin28B), from which an RNA aptamer binding to Lin28 or Lin28B protein was selected.

Selected RNA aptamers were as follows:

Lin28 Group1

Clone 1

5'-GGGAGAGCGGAAGCGUGCUGGGCCACAUGAUAUCGCCGGCGUUUCCAGUCACCCUUCUGGCUAGCAUAACCCAGAGGUCGAUGGAUCCCCCC-3 '(SEQ ID NO: 1)

Clone 8

5'-GGGAGAGCGGAAGCGUGCUGGGCCGACACAUGAUAUCUUCGCCAACGCUAAUCUCUGUAGCUCAUAACCCAGAGGUCGAUGGAUCCCCCC-3 '(SEQ ID NO: 2)

Clone 13

5'-GGGAGAGCGGAAGCGUGCUGGGCCACAUGAUAUCGCCGGCGUUUCCAGUCACCCUUCUGGUUAGCAUAACCCAGAGGUCGAUGGAUCCCCCC-3 '(SEQ ID NO: 3)

Clone 14

5'-GGGAGAGCGGAAGCGUGCUGGGGCUUGGACUGCACAUGAUAUCGCGUUAACCAAGCUCGGAGUGCAUAACCCAGAGGUCGAUGGAUCCCCCC-3 '(SEQ ID NO: 4)

Clone 15

5'-GGGAGAGCGGAAGCGUGCUGGGGGCCCAAUAGCCACAUGAUAUCGCAUUGGAACCAGCAGUUGUUGCAUAACCCAGAGGUCGAUGGAUCCCCCC-3 '(SEQ ID NO: 5)

Clone 16

5'-GGGAGAGCGGAAGCGUGCUGGGGGUCCAAUAGCCACAUGAUAUCGCAUUGGAACCAGCAAUUGUUGCAUAACCCAGAGGUCGAUGGAUCCCCCC-3 '(SEQ ID NO: 6)

Clone 17

5'-GGGAGAGCGGAAGCGUGCUGGGGCCCAAUAGCCACAUGAUAUCGCAUUGGAACCAGCAGUUGUUGCAUAACCCAGAGGUCGAUGGAUCCCCCC-3 '(SEQ ID NO: 7)

Clone 23

5'-GGGAGAGCGGAAGCGUGCUGGGGCCUGGCGUGUUGACCUGCACAUGAUAUCGCGUUGGAACCAGCAGUUGUUACAUAACCCAGAGGGCGAUGGAUCCCCCC-3 '(SEQ ID NO: 8)

Clone 34

5'-GGGAGAGcGGAAGCGUGCUGGGCCACAUGAUAUCGCCGGCGUUUCCAGUCACCCUUCUGGUU G GCAUAACCCAGAGGUCGAUGGAUCCCCCC-3 '(SEQ ID NO: 9)

Clone 39

5'-GGGAGAGCGGAAGCGUGCUGGGCCACAUGAUAUCGCCGGCGUUUCCAGUCACCCUUCUGGUUAACAUAACCCAGAGGUCGAUGGAUCCCCCC-3 '(SEQ ID NO: 10)

Clone 41

5'-GGGAGAGCGGAAGCGUGCUGGGGCCCAAUAGCCACAUGAUAUCGCCGGCGUUUCCAGUCACCCUUCUGUGUAUAGCAUAACCCAGAGGUCGAUGGAUCCCCCC-3 '(SEQ ID NO: 11)

Clone 48

5'-GGGAGAGCGGAAGCAUGCUGGGGUCUGGCGUGUUGACCUGCACAUGAUAUCGCGUUCAACUAUGUCAUAACCCAGAGGUCGAUGGAUCCCCCC-3 '(SEQ ID NO: 12)

Lin28 Group2

Clone 5

5'-GGGAGAGCGGAAGCGUGCUGGGCCUAGGACAGUUCGUCCUCAUUGCAUCGCUGCCUAACACAUCCAUAACCCAGAGGUCGAUGGAUCCCCCC-3 '(SEQ ID NO: 13)

Clone 27

5'-GGGAGAGCGGAAGCGUGCUGGGCCUAGGACAGUUCGUCCUCAUUACAUCGCCGCCUAACACAUCCAUAACCCAGAGGUCGAUGGAUCCCCCC-3 '(SEQ ID NO: 14)

Lin28 Group3

Clone 6

5'-GGGAGAGCGGAAGCGUGCUGGGCCGAACGAAUCCGAUGUGUGAUGUUUCCGGAUUCGCGUGAUCCAUAACCCAGAGGUCGAUGGAUCCCCCC-3 '(SEQ ID NO: 15)

Clone 19

5'-GGGAGAGCGGAAGCGUGCUGGGCCGAACGAAUCCGAUGUGUGAUGUUUCCGGAUUCGCGUGUUCCAUAACCCAGAGGUCGAUGGAUCCCCCC-3 '(SEQ ID NO: 16)

Clone 29

5'-GGGAGAGCGGAAGCGUGCUGGGCCGAACGAAUCCGAUGUGUGAUGUUUCCGGAUUCGCGUGAGUCAUAACCCAGAGGUCGAUGGAUCCCCCC-3 '(SEQ ID NO: 17)

Lin28b Group1

Clone 2

5'-GGGAGAGCGGAAGCGUGCUGGGCCACAUGAUAUCGCCGGCGUUUCCAGUCACCCUUCUGGCUAGCAUAACCCAGAGGUCGAUGGAUCCCCCC-3 '(SEQ ID NO: 18)

Clone 3

5'-GGGAGAGCGGAAGCGUGCUGGGCCACAUGAUAUCGCCGGCGUUUCCAGUCACCCUUCUGGUUAGCAUAACCCAGAGGUCGAUGGAUCCCCCC-3 '(SEQ ID NO: 19)

Clone 5

5'-GGGAGAGCGGAAGCGUGCUGGGCCACAUGAUAUCGCCGGCGUUUCCAGUCACCCUUCUGGUCAACAUAACCCAGAGGUCGAUGGAUCCCCCC-3 '(SEQ ID NO: 20)

Clone 13

5'-GGGAGAGCGGAAGCGUGCUGGGCCACAUGACAUCGCCGGCGUUUCCAGUCACCCUUCUGGUUAGCAUAACCCAGAGGUCGAUGGAUCCCCCC-3 '(SEQ ID NO: 21)

Clone 19

5'-GGGAGAGCGGAAGCGUGCUGGGCCACAUGAUAUCGCCGGCGUUUCCAGUCACCCUUCUGGUUAACAUAACCCAGAGGUCGAUGGAUCCCCCC-3 '(SEQ ID NO: 22)

Lin28b Group2

Clone 11

5'-GGGAGAGCGGAAGCGUGCUGGGCCAGUUUACUGUAUUACACUCUAGCCCAUAACAGUGUUGAUCCAUAACCCAGAGGUCGAUGGAUCCCCCC-3 '(SEQ ID NO: 23)

Clone 18

5'-GGGAGAGCGGAAGCGUGCUGGGCCAGUUUACUGUAUUACACUCUAGCCCAUAACAGUGUUG G UCCAUAACCCAGAGGUCGAUGGAUCCCCCC-3 '(SEQ ID NO: 24)

Lin28b Group3

Clone 1

5'-GGGAGAGCGGAAGCGUGCUGGGCCUGCUACAUCGUGUGUGUCAUGCGUCUGCCUUACCAUUCUCAUAACCCAGAGGUCGAUGGAUCCCCCC-3 "(SEQ ID NO: 25)

Clone 15

5'-AUUCUAUACGACUCUAGGGAGAGCGGAAGCGUGCUGGGCCUGUUACAUCGUGUGUGUCAUGCGUCUGCCUUACCAUUCUCAUAACCCAGAGGUCGAUGGAUCCCCCC-3 '(SEQ ID NO: 26)

Clone 33

5'-GGGAGAGCGGAAGCGUGCUGGGCCUGCUACAUCGUGUGUGUCAUGCGUCUGCCUUACCAUUCCCAUAACCCAGAGGUCGAUGGAUCCCCCC-3 '(SEQ ID NO: 27)

Lin28b Group4

Clone 9

5'-GGGAGAGCGGAAGCGUGCUGGGCCAUGGGGGCGUUAGCGAAAGGCCGUUAACCUGUGAUAGAACCAUAACCCAGAGGUCGAUGGAUCCCCCC-3 '(SEQ ID NO: 28)

Clone 16

5'-GGGAGAGCGGAAGCGUGCUGGGCCAUGGGGGCGUUAGCGAAAGGCUGCUAACCUGUGAUAGAACCAUAACCCAGAGGUCGAUGGAUCCCCCC-3 '(SEQ ID NO: 29)

The SELEX method used in the present invention is a method for selecting an aptamer specifically binding to a specific compound or protein, and specifically comprises the following steps. 1) attach the RNA library to the protein surface, 2) remove the weak binding molecule, 3) isolate only the strong binding RNA from the protein surface, and 4) convert the obtained RNA molecule to DNA 5) Amplify it again and 6) Regenerate DNA into RNA to get the selected RNA molecule. This series of steps is repeated to select RNA molecules with strong binding to Lin28 or Lin28B proteins (Figure 5).

According to another embodiment of the present invention, the present invention provides a kit for diagnosing cancer comprising an RNA aptamer that binds to Lin28 or Lin28B protein which is increased during liver cancer progression.

As used herein, the term "Lin28 or Lin28B protein" refers to a protein that is present in advanced cancers and converts normal cells into cancerous cells. Lin28 protein, which is abundant in embryonic stem cells, provides a new target for diagnosing cancer progression. Lin28 protein modulates microRNAs (microRNAs) that inhibit tumors known as let-7, and thus can be used in the development of pharmaceutical compositions for treating cancer.

According to an embodiment of the present invention, the present inventors measured the binding force between aptamer and pre-let7a to test the binding force between Lin28 or Lin28B and aptamer, and confirmed high binding force, and also through a competition assay. It was confirmed that Lin28 or Lin28B and aptamer are specific binding, and also confirmed that binding of isotopically labeled Lin28 and aptamer binds 6 times more than the control, so that Lin28 or Lin28B can be detected using RNA aptamer. It was confirmed.

The cancer diagnostic kit of the present invention may further include a buffer solution and containers for performing and analyzing the detection, if necessary, such as a bottle, a tub, a small sachet, an envelope, a tube, an ampoule. may take the form of ampoules and the like and they may be formed, in part or in whole, from plastic, glass, paper, foil, wax, and the like. The container may be equipped with a fully or partially separable stopper that may initially be part of the container or attached to the container by mechanical, adhesive, or other means. The container may also be equipped with a stopper, which may be accessible to the contents by a needle. The kit may include an external package, which may include instructions for use of the components.

According to another embodiment of the present invention, the present invention provides a pharmaceutical composition for treating cancer comprising the above-described RNA aptamer capable of binding to Lin28 or Lin28B as an active ingredient.

When the cancer progresses severely, the expression level of Lin28 or Lin28B increases in the body, and the amount of pri-let7 and pre-let7 remains unchanged, but only the amount of mature let7 decreases. When the expression level of Lin28 or Lin28B is increased, It is known that the amount of mature let7 is reduced by inhibiting the processing of pre-let7. At this time, by inhibiting the expression of Lin28 or Lin28B or inactivating the function of Lin28 or Lin28B already expressed, thereby increasing the amount of mature let7, and as a result can show cancer therapeutic activity (Fig. 1).

The pharmaceutical composition for treating cancer comprising the RNA aptamer of the present invention as an active ingredient may include the RNA aptamer of the present invention in an amount of 10 to 95% by weight based on the total weight of the composition. In addition, the pharmaceutical composition for treating cancer of the present invention may further contain one or more active ingredients exhibiting the same or similar functions in addition to the active ingredient.

The pharmaceutical composition for treating cancer of the present invention may be preferably formulated into a pharmaceutical composition including one or more pharmaceutically acceptable carriers in addition to the active ingredients described above for administration. Acceptable pharmaceutical carriers in compositions formulated as liquid solutions are sterile and physiologically compatible, including saline, sterile water, Ringer's solution, buffered saline, albumin injectable solutions, dextrose solution, maltodextrin solution, glycerol, ethanol and One or more of these components may be mixed and used, and other conventional additives such as antioxidants, buffers and bacteriostatic agents may be added as necessary.

In addition, diluents, dispersants, surfactants, binders, and lubricants may be additionally added to formulate into injectable formulations, pills, capsules, granules, or tablets, such as aqueous solutions, suspensions, emulsions, and the like, which will act specifically on target organs. Target organ specific antibodies or other ligands can be used in combination with the carriers.

Pharmaceutical formulation forms of the pharmaceutical compositions for cancer treatment of the present invention are granules, powders, coated tablets, tablets, capsules, suppositories, syrups, juices, suspensions, emulsions, drops or injectable solutions and sustained release formulations of the active compounds. And so on.

The pharmaceutical composition for treating cancer of the present invention can be administered to mammals including humans by various routes. For example, conventional methods are possible via intravenous, intraarterial, intraperitoneal, intramuscular, intraperitoneal, sternum, transdermal, nasal, inhalation, topical, rectal, oral, intraocular or subcutaneous routes. At this time, the administration method is not particularly limited, but parenteral administration is preferred.

The dosage of the pharmaceutical composition for treating cancer of the present invention may include the type of disease, the severity of the disease, the type and amount of the active ingredient and other ingredients contained in the composition, the type of the dosage form and the age, weight, general state of health, sex and diet of the patient. It can be adjusted according to various factors including the time of administration, the route of administration and the rate of secretion of the composition, the duration of treatment, and the drugs used simultaneously. However, for the desired effect, the effective amount of the RNA aptamer of the therapeutic agent of the present invention is such that the intracellular concentration is 1 nM to 1000 nM, preferably 100 nM to 500 nM. In this case, the administration may be administered once a day, may be divided into several times.

According to another embodiment of the invention, the invention provides a method for screening gene fragments that interact with Lin28 or Lin28B.

Method for screening gene fragments interacting with Lin28 or Lin28B of the present invention comprises the steps of deriving a common sequence included in the selected RNA aptamer; Searching the derived common base sequence in a DNA / RNA database and searching for a new gene fragment including the common sequence; And selecting the gene fragment interacting with Lin28 or Lin28B by measuring the interaction activity with Lin28 or Lin28B of the retrieved gene fragment.

Since the RNA aptamer of the present invention can bind strongly to Lin28 or Lin28B protein present in the cell, it may be widely used for diagnosis or treatment of cancer in which the protein is expressed.

1 is a schematic diagram of the effect of Lin28 protein during the production of let7 miRNA
Figure 2 is a schematic diagram of cloning the pQE-80L vector with Lin28 or Lin28B expression vector for extracting recombinant protein
Figure 3 is a photograph showing the result of performing an induction test to efficiently extract Lin28 or Lin28B protein. (a) Lin28 protein (b) Lin28B protein
Figure 4 is a photograph showing the result confirmed by SDS-PAGE extracted from the recombinant protein Lin28 or Lin28B protein in E. coli.
FIG. 5 is a schematic diagram of performing SELEX (Systematic Evolution of Ligands by Exponential enrichment).
Figure 6 is a photograph showing the results of measuring the amount of RNA bound to Lin28 or Lin28B protein.
7 is a diagram showing the sequence of the aptamer for the selected Lin28 protein divided into three groups, each secondary structure. The indicated part of the secondary structure is the random sequencing part.
8 is a diagram showing the sequence of the aptamer for the selected Lin28B protein divided into three groups, each secondary structure. The indicated part of the secondary structure is the random sequencing part.
Figure 9 is a photograph showing the results confirmed through the EMSA to check whether the specifically selected aptamer binding.
10 is a photograph and a graph showing the results of the binding test using the isotope to determine whether Group 1 aptamer binds to Lin28 protein.
11 is a graph showing the results of confirming the affinity for the selected RNA aptamer and Lin28 protein through a binding assay.
Figure 12 is a photograph and a graph confirming the amount of binding to the isotope-labeled group 1 aptamer (a) and pre-let7 miRNA (b) by treating the isotopically labeled library, group 1, pre-let7 RNA to be.
Figure 13 is a graph showing the results confirmed the binding affinity for the selected RNA aptamer and Lin28B protein through a binding assay.
FIG. 14 shows the results of confirming that ACATGATATCGC, a sequence commonly derived from Group 1 RNA aptamer, has a similar sequence in (a) miRNA or (b) intron and mRNA by blast search.

Hereinafter, the present invention will be described in more detail with reference to Examples. These embodiments are only for illustrating the present invention, and the scope of the present invention is not construed as being limited by these embodiments.

Example 1: PCR

PET28a-Lin28 and pET28a-Lin28B plasmid DNA containing Lin28 or Lin28B gene, respectively, was provided by Professor Kim, Nae-ri of Seoul National University. In order to obtain Lin28 or Lin28B gene from the plasmid DNA, PCR (Polymerase Chain Reaction) was performed under the following conditions. Template plasmid DNA 10 ng for Lin28, 5 'primer 100 nM (5'-CGCGGATCCATGGGCTCCGTGTCC-3') (SEQ ID NO: 30), 3 'primer 100 nM (5'-CCCAAGCTTTCAATTCTGTGCCTCCGG-3') (SEQ ID NO: 31), 5X 20 μl of HF buffer, 200 μM dNTP, 0.4 unit of Phusion Taq polymerase (Finnzyme) were mixed and performed in a total volume of 100 μl. For Lin28B template plasmid DNA 10 ng, 5 'primer 100 nM (5'-CGCGGATCCATGGCCGAAGGCGGGGC-3') (SEQ ID NO: 32). 100 nM of 3 'primer (5'-CGCGGATCCTCCCAGGTCAGCTACTGC-3') (SEQ ID NO: 33), 20 μl of 5X HF buffer, 200 μM dNTP, 0.4 unit of Phusion Taq polymerase were mixed and performed in a total volume of 100 μl. As PCR conditions, 35 cycles were repeated under the conditions of 95 ° C. 30 sec, 58 ° C. 30 sec, 72 ° C. for 1 minute, and finally, Lin28 gene was obtained by performing 72 ° C. for 7 min.

Example 2: Cloning and Sequencing

In order to express the protein of the DNA obtained through the procedure of Example 1 was cloned into the pQE-80L vector, which is a protein expression vector. In the case of Lin28, the vector and Lin28 DNA were cut with Bam HI (Roche), and then phenol extracted (ethanol) and ethanol precipitation and then cut back with Hin dIII (Roche). In the case of Lin28B, the vector and Lin28 DNA were cut into Bam HI, and the vector DNA was treated with alkaline phospatase (NEB). The DNA obtained through this process was reacted at 4 ° C. for 16 hours using 5 units of T4 DNA ligase (Roche). The reaction product was transformed into BL21 (DE3) PlysS Escherichia coli by shocking for 90 seconds at 42 ° C., and then spread on agar plates made with 50 μg / ml of ampicillin for 16 hours at 37 ° C. Incubated. The colonies were inoculated to obtain plasmid DNA through a mini-preparation method. For Lin28, clones containing Lin28 gene were obtained using Bam HI and Hind III for Lin28, and Bam for Lin28B. Clones containing genes were obtained using HI. (FIG. 2) The clones obtained were confirmed to be the correct base sequence by sequencing (ABI PRISM 310 genetic analyzer).

Figure 2 is a schematic diagram of the Lin28 or Lin28B construct for extracting a recombinant protein, as shown in Figure 2 was able to obtain an expression vector containing the Lin28 or Lin28B gene in the pQE-80L vector.

Example 3: Induction Test

The expression vector cloned into pQE-80L in Example 2 was inoculated in 5 ml LB medium (1% tryptone, 1% sodium chloride, 0.5% yeast extract) containing 50 µg / ml empicillin and incubated for 16 hours. . 50 µg / ml Empicillin was added to 30 ml of LB medium, and 300 µl of the 5 ml medium incubated for 16 hours was inoculated again. When the OD 600 value is 0.6, 1 ml each of the sterile 1.5 ml micro-tubes is dispensed, followed by IPTG (Isopropylthio-β-D-Galactoside) concentration (0, 0.2 mM, 0.4 mM, 0.6 mM, 0.8 mM) and time. (30 minutes, 1, 2, 4 hours), induction test was carried out through the culture by varying the temperature conditions (37 ℃). After induction of each condition, each tube was centrifuged at 13000 rpm for 1 minute, the supernatant was removed, 100 μl of H ₂ O was added and 20 μl of the precipitate was removed to remove 5 × protein sample buffer (250 mM Tris- Mix 5 μl of Cl, pH 6.8, 10% SDS, 1% Brommophenol blue, 50% Glycerol, 5% β-mercaptoethanol) and boil in boiling water for 5 minutes. Allow to cool on ice for 5 minutes and then drop on 15% Polyacrylamide gel electrophoresis (SDS-PAGE) gel for 2 hours 30 minutes. The gels were separated and stained with protein staining buffer solution (45% Methanol, 10% Glacial acetic acid, 45% H ₂ O, 0.025% Coomassie Brillian Blue R-250) for 3 hours, followed by protein distection. The bands were identified by destining with an inning buffer solution (50% Methanol, 10% Glacial acetic acid, 40% H ₂ O). (Fig. 3)

Figure 3 is the result of selecting the best conditions for the expression level of the protein by the above method, as shown in Figure 3a Lin28 protein was performed at 37 ℃ from 1 to 4 hours, IPTG concentration from 0mM to 0.8mM, As shown in FIG. 3b, the Lin28B protein was performed at 37 ° C. from IPTG concentration of 0 mM to 0.8 mM at 30 minutes to 4 hours. Optimal conditions were selected for concentrations of IPTG 0.1 mM.

Example 4: Lin28 Protein Purification

LinB expression vector cloned into pQE-80L vector in Example 2 was inoculated in LB medium containing 50 μg / ml empicillin and incubated at 37 ° C. for 16 hours. The culture solution was inoculated again with 10 ml in 1 L of LB medium containing 50 µg / ml empicillin and the induction was performed under the conditions of Example 3 when the OD 600 value was 0.6. Induced E. coli was centrifuged at 6000 ㅧ g for 4 minutes to obtain a precipitate. The obtained precipitate was stored at -80 ° C for 16 hours. This precipitate was well dissolved in 20 ml lysis buffer (20 mM Tris-HCl, pH 8.0), 0.5 M NaCl, 5 mM beta-mercaptoethanol, and 100 mg / ml lysozyme was added to react for 1 hour on ice. Thereafter, 5 ml each of the different tubes were divided and sonicated 20 times for 10 seconds at 60% amplitude. After centrifugation for 30 minutes at 20000gg of 4 ℃ the supernatant was transferred to a 50 ml tube. 1 ml of Ni-NTA-agarose beads (QIAGEN) was placed in a micro-tube and centrifuged at 13000 rpm for 10 seconds. The supernatant was discarded and released in 500 μl of lysis buffer three times. The washed beads were mixed with the supernatant after sonication and centrifuged to bind proteins and beads at 4 ° C. at a speed of 8 rpm for 3 hours. The mixture was flowed into a polypropylene column (QIAGEN) to obtain a flow through (FT), and was stored and washed with buffer 1 (20 mM Tris-HCl, pH 8.0), 0.5 M NaCl, 5 mM beta-mercaptoethanol. , 500 mM of 20 mM imidazole) was flowed to remove non-specifically bound protein. Washed beads in elution buffer 1 (20 mM Tris-HCl (pH 8.0), 0.5 M NaCl, 5 mM beta-mercaptoethanol, 60 mM imidazole), elution buffer 2 (20 mM Tris-HCl (pH 8.0) ), 0.5M NaCl, 5 mM beta-mercaptoethanol, 150 mM imidazole), 1 ml of solution buffer 3 (20 mM Tris-HCl, pH 8.0), 0.5M NaCl, 5 mM beta-mercaptoethanol, 250 mM imidazole) The solution was allowed to flow into the micro-tube and stored. 500 ml of Elution Column Buffer 1 was poured, and 50 ml of Washing Buffer 2 (20 mM Tris-HCl, pH 8.0), 0.5 M NaCl, 5 mM beta-mercaptoethanol, 40 mM imidazole) Protein was removed. The subsequent procedure is the same as in Example 4.

Example 6: Dialysis

Example 6-1 Membrane Activation

A dialysis membrane with a membrane pore size of 3.5 kDa was cut to about 10 cm. Thereafter, 600 ml of a solution containing 2% sodium hydrocarbon (W / V), 1 mM EDTA (pH 8.0) was heated and boiled. When the solution began to boil, put the cut membrane to activate the membrane and boil with stirring for 10 minutes. The activated membrane was added to 600 ml of a solution containing 1 mM EDTA (pH8.0), which was then heated in the same manner as above, and then boiled with stirring for 10 minutes. After all the process was put into DW and stored at 4 ℃ was used.

Example 6-2 Dialysis

A membrane was plugged into the bottom of the activated membrane and then the protein of Example 4 and the protein of Example 5 were placed inside the tube. When all the proteins were added, the solution was capped to prevent the solution from falling out and then immersed in a 1000-fold volume of dialysis buffer (50 mM Tris-HCl, pH 8.0), 50 mM NaCl, 1 mM DTT, 5 mM MgCl ₂ , 10% glycerol). Dialysis was performed while rotating at 4 ° C. for 4 hours, and then changed to the same amount of dialysis buffer solution and dialyzed for 16 hours. After dialysis, the stopper was carefully opened to obtain all the protein solution and then stored frozen at -80 ℃.

Example 7: Electrophoresis

1 μg / μl of BSA (Bovine Serum Albumin) protein (CALBIOCHEM) was prepared for each concentration (0, 1, 2, 4, 8 μg), and the protein of Example 6 to be measured was prepared. 1 ml of Bio-Rad Protein Assay (BMS) reagent diluted in 1/5 was mixed with all the protein solutions, and then reacted at room temperature for 10 minutes. The reacted solution was measured by UV spectrophotometer (Smart Spec 3000 / BMS) to measure the degree of change of wavelength at 595 nm, and electrophoresis was performed based on the amount of protein. (Figure 4)

Figure 4 is an electrophoresis picture showing the results confirmed by SDS-PAGE extracted from E. coli Lin28 or Lin28B protein produced under the optimal conditions of induction results, as shown in FIG. As a result of confirming 1 ㎍ through SDS-PAGE, the bands were identified at each size of 25kDa and 28kDa.

Example 8: Preparation of DNA Library

A 5'-primer (5'-GGTAATACGACTCACTATAGGGAGAGCGGAAGCGTGCTGGG) using 76mer single oligonucleotides (5'-GCGGAAGCGTGCTGGGCC-N ₄₀ -CATAACCCAGAGGTCGAT-3 ') as a template to prepare RNA libraries required for SELEX A double helix DNA library was prepared by PCR with -3 ') (SEQ ID NO: 34) and 3'-primer (5'-GGGGGGATCCATCGACCTCTGGGTTATG-3') (SEQ ID NO: 35). The 5'-primer contains the T7 RNA polymerase promoter sequence for producing RNA using T7 RNA polymerase, and the 3'-primer contains the Bam HI restriction enzyme sequence. DNA library template of 119 bp was 100 nM DNA oligonucleotide, 250 nM 5'-primer (5'-GGGGGAATTCTAATACGACTCACTATAGGGAGAGCGGAAGCGTGCTGGG-3 ') (SEQ ID NO: 36), 250 nM 3'-primer (5'-GGGGGGATCCATCGACCTCTGGGTTATG-3') No. 37), 200 μM dNTP, 10 μL 10 μL buffer, 3 unit DyNazyme Taq polymerase (Finnzyme) were mixed at 95 ° C. for 5 minutes, followed by 95 ° C. 30 sec, 58 ° C. 30 sec, and 72 ° C. 30 sec. After repeating 10 cycles, the DNA library was finally prepared at 72 ° C. for 7 minutes.

Example 9: Construction of RNA Library

An RNA library having various nucleotide sequences was prepared by in vitro transcription using the DNA library obtained in the procedure of Example 8 as a template.

Specifically, DNA library, 10 × transcription buffer, 5 mM DTT, 0.5 mM ATP. GTP, CTP, UTP (Roche), 40 unit RNase inhibitor (koscheme), 100 unit T7 RNA polymerase (TaKaRa), using DEPC-H ₂ O were adjusted to 100 μl in total and reacted for 3 hours at 37 ℃. Thereafter, 20 unit DNase (Roche) was treated at 37 ° C. for 30 minutes to remove the template DNA library, thereby constructing an RNA library.

Example 10 RNA Solution

RNA obtained in Example 9 was dissolved in 10 μl of DEPC-H ₂ O by phenol extraction and ethanol precipitation. An equal amount of denatured RNA loading die (95% deionized formamide, 5 mM EDTA, 0.025% Bromophenol blue, 0.025% Xylene cyanol, 5 mM EDTA) was mixed and denatured at 80 ° C. for 5 minutes and cooled in ice for 5 minutes. Denatured RNA was isolated by electrophoresis at 180 V on a 7 M urea-8% polyacrylamide gel, and then cut into a band of correct RNA size with 400 μl of Buffer (0.5 M Ammonium acetate, 1 mM EDTA, 0.2%). SDS) and incubated for 3 hours at 37 ℃. Eluted RNA was purified by phenol extraction and ethanol precipitation and quantified by UV spectrometer (Biomate3 / Thermo).

Example 11: SELEX

20 μl of 150 pmole RNA library and 20 μl of Ni-NTA-agarose beads in 40unit RNase inhibitor, binding buffer (30 mM Tris-Cl, pH 7.5, 150 mM Sodium Chloride, 1.5 mM Magnesium Chloride, 2 mM DTT, 1% BSA) After adjusting the volume to 200 μl by tapping for 20 minutes at room temperature. Non-specifically bound RNA was removed by centrifugation at 13000 rpm for 10 seconds. The supernatant was transferred to an empty tube, and then centrifuged at 13000 rpm for 10 seconds to remove the remaining beads by repeating the process. The supernatant was reacted with Lin28 protein or 75 pmole of Lin28B protein at room temperature for 20 minutes. The reaction was reacted by tapping with 20 μl of Ni-NTA-agarose beads. After settling for 13000rpm for 10 seconds, the supernatant that did not react with the protein was removed, 400 μl of binding buffer was added, and tapping 40 times to remove weakly bound RNA. This process was repeated five times. (As the number of SELEX increases, the ratio of protein to RNA and washing depends on Tables 1 and 2.) After the whole process, 200 μl of DEPC-H ₂ O and 80% phenol were added and strongly vortexed. Then concentrated to ethanol precipitation.

Experiments were performed using RNA libraries with 10 ²⁴ different nucleotide sequences. RNA was prepared using 2'-hydroxyl RNA, and SELEX (Figure 5) was performed under the conditions of Tables 1 and 2 to select RNA aptamers that specifically bind to proteins. Pre-clearing was performed by removing the RNA binding to the beads using Ni-NTA-agarose beads. After the sixth and ninth confirming tests were performed, the amount of protein was reduced to select more specifically binding RNA. In this manner, Lin28 was performed 13 rounds and Lin28B was 9 rounds.

Lin28 of SELEX  The protein concentration used in the run and Wash  Condition cycle RNA ( pmole ) Lin28 ( pmole ) RNA  : Lin28 Wash  time One 300 75 4: 1 X5 2 150 75 2: 1 X5 3 150 75 2: 1 X5 4 150 75 2: 1 X5 5 150 75 2: 1 X5 6 150 75 2: 1 X5 7 150 15 10: 1 X5 8 150 15 10: 1 X5 9 150 15 10: 1 X5 10 150 5 30: 1 X7 11 150 5 30: 1 X7 12 150 5 30: 1 X7 13 150 5 30: 1 X7

Of Lin28B SELEX  The protein concentration used in the run and Wash  Condition cycle RNA (pmole) Lin28B (pmole) RNA: Lin28B Wash time One 300 75 4: 1 X5 2 150 75 2: 1 X5 3 150 75 2: 1 X5 4 150 75 2: 1 X5 5 150 75 2: 1 X5 6 150 75 2: 1 X5 7 150 15 10: 1 X5 8 150 15 10: 1 X5 9 150 15 10: 1 X5

Example  12: RT - PCR

500 nM 3′-primer (5′-GGGGGGATCCATCGACCTCTGGGTTATG-3 ′) (SEQ ID NO: 35) was added to the RNA obtained in Example 11, denatured at 65 ° C. for 5 minutes, and then allowed to bind to RNA and primer for 10 minutes at room temperature. 1 mM dNTP, 5X RT buffer, and 10 unit AMV RTase (Promega) were added and reacted at 37 ° C. for 30 minutes, then heated at 95 ° C. for 5 minutes and cooled in ice to inactivate RTase. The synthesized cDNA was amplified by PCR in 20 cycles under the conditions of Example 8. DNA obtained by RT-PCR was confirmed on a 2% agarose gel and RNA was synthesized through the procedure of Example 9. (Fig. 6)

6 is a result of confirming the degree of binding through Real-Time PCR to determine how much was selected in the middle of the SELEX cycle, comparing the cycle value between each sample to check the selected degree. The amount of RNA obtained from each sample is expressed as a percentage of the RNA. Lin28 is the sixth and ninth (Fig. 6a), 13th (Fig. 6b), Lin28B is the pool after the sixth and ninth (Fig. Relatively better binding was confirmed. The reason why Lin28 was less bound than confirmation after 9th was confirmed because the standard library was used to determine the quantity, so the quantitative value would be inaccurate. .

However, both results resulted in at least four times more binding than libraries or beads.

Example 13: Conformation Test

In the same manner as in Example 11, 300 fmole of the RNA and the initial RNA library where the SELEX process was performed were bound to Lin28 and Lin28B proteins, 30 pmole and 20 minutes, respectively. Then, SELEX is carried out in the same manner as in Example 11, and 3 mg of 10 mg / ml glycogen (sigma) phenol extracted ethanol is precipitated. After RNA is obtained by ethanol precipitation, DEPC-H ₂ O is added to dissolve RNA. 200 nM 3'-primer (5'-GGGGGGATCCATCGACCTCTGGGTTATG-3 ') (SEQ ID NO: 35) was added thereto, heated at 65 ° C for 5 minutes, and then allowed to bind RNA and 3'-primer for 10 minutes at room temperature. After adding 1 mM dNTP, 5X RTase buffer and 200 unit M-MLV RTase (Promega) for 1 hour at 42 ° C, RTase was inactivated at 95 ° C for 5 minutes. Only 1/10 of the reverse DNA single transcription was used as a PCR template. Real-time PCR (Rotor Gene RG-6000) was used under the following conditions to measure the amount in real time. cDNA, 100 nM 5'-primer (5'-GGTAATACGACTCACTATAGGGAGAGCGGAAGCGTGCTGGG-3 ') (SEQ ID NO: 34), 70 nM 3'-primer (5'-GGGGGGATCCATCGACCTCTGGGTTATG-3') (SEQ ID NO: 35), 10X PCR Buffer 10 μL, 500 μM dNTP, 7 μl of 5X RTase Buffer, 100X Syber green, 3 unit DyNAzyme polymerase (Finnzyme) was mixed and maintained at 95 ℃ for 5 minutes, then 40 ℃ for 95 ℃ 30 seconds, 58 ℃ 30 seconds, 72 ℃ 30 seconds. The cycle was repeated to determine the relative binding of RNA to Lin28 or Lin28B protein relative to the beads.

Example 14 Cloning

DNA obtained from the SELEX process was converted to 5 'primer (5'-GGGGGAATTCTAATACGACTCACTATAGGGAGAGCGGAAGCGTGCTGGG-3') (SEQ ID NO: 36) and 3 'primer (5'-GGGGGGATCCATCGACCTCTGGGTTATG-3') containing the restriction enzyme recognition site (SEQ ID NO: 37). 20 cycles were carried out under the conditions of Example 8. To clone the pUC19 vector, the vector and insult were cut with EcoR I and Bam HI restriction enzymes, and the cut DNAs were reacted at 4 ° C. for 16 hours using a 5 unit T4 DNA ligase. Ligate was heat shocked to DH5α E. coli for 1 minute and 30 seconds at 42 ° C by heat shock method, and then spread on agar plate containing 50 μg / ml of empicillin after transformation to 37 ° C. Incubated for 16 hours at. Since the process is the same as in Example 2.

Example 15 Base Sequence Identification

By sequencing the clones obtained through the process of Example 14, the respective aptamer sequences were grouped using the 'Multiple Sequence Alignment by Florence Corpet' program, and the groups thus obtained were analyzed using the secondary structure of RNA using the 'Mfold' program. Predicted.

Through the selection process, the clone was cloned to identify RNA sequences that bind well with the target proteins Lin28 and Lin28B proteins, and the sequencing was confirmed. Lin28 identified 37 nucleotide sequences and could be grouped into three groups. Lin28B identified 38 nucleotide sequences and could be grouped into four groups. In order to predict the RNA structure of each group, 'Mfold' (http://www.bioinfo.rpi.edu/applications/mfold/cgi-bin/rna-form1.cgi) program was confirmed. (Figures 7, 8)

7 and 8 divide the nucleotide sequence of the aptamer for the selected Lin28 or Lin28B protein, respectively, into three groups, and each shows a secondary structure, and the indicated portion of the secondary structure is a random sequence portion. Group 1 aptamers occupying the highest proportions of the two proteins were confirmed to be the same sequence.

Example 16: 5 ′ Biotin RNA Transcription

The DNA vector was obtained by performing 20 cycles of the expression vector obtained in the process of Example 14 under the same conditions as in Example 8. 10 × transcription buffer, 5 mM DTT, 0.5 mM ATP. 100 μl total with CTP, UTP, 0.1 mM GTP (Roche), 0.4 mM Biotin GMP (Trilink) 40 unit RNase inhibitor (koscheme), 100 unit T7 RNA polymerase (TaKaRa), DEPC-H ₂ O After reaction at 37 ℃ for 3 hours. The subsequent procedure is the same as that of Example 10.

Example 17: Electrophoretic Mobility Shift assay (EMSA)

5 n biotin RNA 3 nM (60 fmole) and protein 300 nM (6 pmole), 2 μg tRNA, 40 unit RNase inhibitor, 10X binding buffer (300 mM Tris-Cl, pH 7.5, 1.5 M Sodium Chloride) , 15 mM Magnesium Chloride, 20 mM DTT) 2 μl and DEPC-H ₂ O were used to make 20 μl, followed by binding at room temperature for 20 minutes. Add 6X loading buffer (30% glycerol, 0.25% bromophenol blue, 0.25% xylene cyanol) and add 8% native gel (8% acrylamide, 1X TBE, 10mM MgCl ₂ , 2% Glycerol) at 100V at 4 ° C. ) Was electrophoresed for 2 hours and 30 minutes in 0.5X TBE buffer. Electrophoresed gels were transferred to 0.45 μm nylon transfer membrane (Whatman) at 0.25 ° C. TBE buffer at 200 ° C. at 200 ° C. for 1 hour. The membrane was crosslinked with RNA at 240mJ / cm 2 so that the site with RNA was exposed to UV light. 10 ml of blocking buffer (Brightstar BioDetect kit, Ambion) and a hybridizer (hybridizer) for 1 hour at 37 ℃, blocking buffer containing 1 μl of streptavidin-AP (Brightstar BioDetect kit, Ambion) 10 The ml is reacted for 1 hour. Subsequently, streptavidin-AP, which is nonspecifically bound, was removed with 10 ml of blocking buffer for 10 minutes and 10 ml of washing buffer (Brightstar BioDetect kit, Ambion) three times for 5 minutes. It was stirred twice with 10 ml of assay buffer (Brightstar BioDetect kit, Ambion) twice. After removal of the assay buffer from the membrane, the mixture was evenly sprayed with 1 ml of CDP-Star (Brightstar BioDetect kit, Ambion) for 5 minutes. The film was photosensitive to the X-ray film to identify the bands. (Fig. 9)

9 is a result of performing EMSA by labeling with biotin to confirm the binding of the obtained clones, and it was confirmed that a band of a specifically shifted size appeared only when Lin28 and Lin28B were present in all groups except the library.

Example 18 α- ³² Body Labeling with P UTP

Using 200 ng of PCR DNA obtained by performing 30 cycles under the conditions of Example 8, 500 μM ATP (Roche), 500 μM, CTP (Roche), 500 μM GTP (Roche), 10 μM UTP (Roche), 2.5 μM radiolabeled UTP (PerkinElmer), 40 unit RNase inhibitors, 100 unit T7 RNA polymerase, 10X transcription buffer, using a 5 mM DTT was adjusted to a total of 20 μl and reacted for 3 hours at 37 ℃. Since the process is the same as the process of Example 9,10.

Example 19: Binding Test

RNA obtained in Example 18 was quantified using a Liquid Scintillation Counter / PerkinElmer, and 20fmole of each of Libraries, Group 1, pre-let7, and pre-mir122 RNA were bound with Lin28 2pmole and tRNA 40pmole for 20 minutes. SELEX was carried out in the same manner as in Examples 2 and 5, and 25 μl of the last DEPC-H ₂ O and 20 μl of phenol / chloroform / isoamyl alcohol were mixed by vortexing and centrifuged at 4 ° C. 13000 rpm for 10 minutes. . Transfer 20 μl of supernatant to another tube and quantify 5 μl using a liquid scintillation counter. 15 μl of 5 μl denatured RNA loading die and denature at 80 ° C. for 5 min, followed by a 7M urea-8% polyacrylamide gel. Electrophoresis at 180V. It was developed using an X-ray film thereon. (Figure 10)

10 is a result of a binding test using an isotope to confirm that Lin288 and Group 1 aptamers specifically bind, and as a control group does not bind to pre-let7a RNA and Lin28 already known to bind to Lin28. The miRNA pre-mir122 was used. As shown in 10a above, binding with Lin28 was seen even in the case of pre-let7a, but it was confirmed that Group 1 aptamer binds more than 6 times more (FIG. 10).

In addition, in order to confirm the binding force between the aptamer and Lin28, affinity test was performed to measure the Kd of the aptamer and pre-let7a and the library. (FIG. 11) As shown in FIG. 11, increasing the protein concentration (300 pM ~ 400 nM) As a result of confirming the amount of binding aptamer was able to confirm the binding force from 45 nM to 200 nM, it was confirmed a higher binding force than the pre-let7a (107.8 nM), library (265.1 nM). Although the binding strength of the library is greater than expected, it is thought to be a nonspecific binding resulting from Lin28 being an RNA binding protein. In Figure 13 Lin28B aptamer showed a high binding force from 15 nM to 190 nM.

Example 20: Competition Assay

RNA 20fmole and Lin28 2pmole, tRNA 40fmole obtained in Example 18, the library is not isotopically labeled, Group 1, pre-let7a RNA was added 200fmole, 2pmole, 20pmole, respectively, and bound for 20 minutes. The procedure is the same as in Example 19.

We confirmed that Group 1 binds more than let7, but we performed a competition assay to see if the binding affinity is better. Isotope-labeled group 1 RNA, unlabeled library, group 1, let7 were bound together by 10, 100, and 1000 folds to confirm specific binding. (Figure 12a, b)

12 is a result of confirming the binding amount of the isotopically labeled group 1 aptamer (a) and the pre-let7 miRNA (b) by treating the isotopically labeled library, the group 1, and the pre-let7 RNA, Competitor RNA was treated 10 times, 100 times, and 1000 times, and the amount of samples not treated with the competitor RNA was corrected to 100%. As shown in FIG. 12, it was confirmed that the library and the let7 were not compiled, and the group 1 aptamer was compiled. Conversely, let7 labeled with isotope is not complicated by the library, but competed by group 1 aptamer or let7. This confirms that Group 1 aptamer binds better than let7 with specific binding rather than nonspecific binding with Lin28. The results also suggest that the binding site with Group 1 in Lin28 protein overlaps at least partially with the site where Lin28 binds to let7.

Example  21: Blast  analysis

Using the base sequence of 'ACATGATATCGC', which is a base sequence specific to the loop region of group 1, blast search was performed to determine whether the pre-miRNA and the genomic sequence existed (FIG. 14). At this time, miRNA search was performed in miRBase (http://www.mirbase.org), genomic DNA search was performed in NCBI (http://www.ncbi.nlm.nih.gov).

FIG. 14 was a blast search for sequences commonly derived from group 1 RNA aptamers. As a result, transcripts present in the intron site were found by confirming whether (a) miRNA or (b) intron and mRNA had similar sequences.

<110> Industry-Academic Cooperation Foundation, Dankook University <120> Novel RNA aptamers and the Uses <130> PA110233KR <160> 37 <170> Kopatentin 2.0 <210> 1 <211> 92 <212> RNA <213> Artificial Sequence <220> <223> Lin28 aptamer Group1_Clone1 <400> 1 gggagagcgg aagcgugcug ggccacauga uaucgccggc guuuccaguc acccuucugg 60 cuagcauaac ccagaggucg auggaucccc cc 92 <210> 2 <211> 90 <212> RNA <213> Artificial Sequence <220> <223> Lin28 aptamer Group1_Clone8 <400> 2 gggagagcgg aagcgugcug ggccgacaca ugauaucuuc gccaacgcua aucucuguag 60 cucauaaccc agaggucgau ggaucccccc 90 <210> 3 <211> 92 <212> RNA <213> Artificial Sequence <220> <223> Lin28 aptamer Group1_Clone13 <400> 3 gggagagcgg aagcgugcug ggccacauga uaucgccggc guuuccaguc acccuucugg 60 uuagcauaac ccagaggucg auggaucccc cc 92 <210> 4 <211> 92 <212> RNA <213> Artificial Sequence <220> <223> Lin28 aptamer Group1_Clone14 <400> 4 gggagagcgg aagcgugcug gggcuuggac ugcacaugau aucgcguuaa ccaagcucgg 60 agugcauaac ccagaggucg auggaucccc cc 92 <210> 5 <211> 94 <212> RNA <213> Artificial Sequence <220> <223> Lin28 aptamer Group1_Clone15 <400> 5 gggagagcgg aagcgugcug ggggcccaau agccacauga uaucgcauug gaaccagcag 60 uuguugcaua acccagaggu cgauggaucc cccc 94 <210> 6 <211> 94 <212> RNA <213> Artificial Sequence <220> <223> Lin28 aptamer Group1_Clone16 <400> 6 gggagagcgg aagcgugcug gggguccaau agccacauga uaucgcauug gaaccagcaa 60 uuguugcaua acccagaggu cgauggaucc cccc 94 <210> 7 <211> 93 <212> RNA <213> Artificial Sequence <220> <223> Lin28 aptamer Group1_Clone17 <400> 7 gggagagcgg aagcgugcug gggcccaaua gccacaugau aucgcauugg aaccagcagu 60 uguugcauaa cccagagguc gauggauccc ccc 93 <210> 8 <211> 101 <212> RNA <213> Artificial Sequence <220> <223> Lin28 aptamer Group1_Clone23 <400> 8 gggagagcgg aagcgugcug gggccuggcg uguugaccug cacaugauau cgcguuggaa 60 ccagcaguug uuacauaacc cagagggcga uggauccccc c 101 <210> 9 <211> 92 <212> RNA <213> Artificial Sequence <220> <223> Lin28 aptamer Group1_Clone34 <400> 9 gggagagcgg aagcgugcug ggccacauga uaucgccggc guuuccaguc acccuucugg 60 uuggcauaac ccagaggucg auggaucccc cc 92 <210> 10 <211> 91 <212> RNA <213> Artificial Sequence <220> <223> Lin28 aptamer Group1_Clone39 <400> 10 gggagagcgg aagcgugcug ggccacauga uaucgccggc guuuccaguc acccuucugg 60 uuaacauaac ccagaggucg auggaucccc c 91 <210> 11 <211> 101 <212> RNA <213> Artificial Sequence <220> <223> Lin28 aptamer Group1_Clone41 <400> 11 gggagagcgg aagcgugcug gggcccaaua gccacaugau aucgccggcg uuuccaguca 60 cccuucugau uagcauaacc cagaggucga uggauccccc c 101 <210> 12 <211> 93 <212> RNA <213> Artificial Sequence <220> <223> Lin28 aptamer Group1_Clone48 <400> 12 gggagagcgg aagcaugcug gggucuggcg uguugaccug cacaugauau cgcguucaac 60 uaugucauaa cccagagguc gauggauccc ccc 93 <210> 13 <211> 92 <212> RNA <213> Artificial Sequence <220> <223> Lin28 aptamer roup2_Clone5 <400> 13 gggagagcgg aagcgugcug ggccuaggac aguucguccu cauugcaucg cugccuaaca 60 cauccauaac ccagaggucg auggaucccc cc 92 <210> 14 <211> 92 <212> RNA <213> Artificial Sequence <220> <223> Lin28 aptamer Group2_Clone27 <400> 14 gggagagcgg aagcgugcug ggccuaggac aguucguccu cauuacaucg ccgccuaaca 60 cauccauaac ccagaggucg auggaucccc cc 92 <210> 15 <211> 92 <212> RNA <213> Artificial Sequence <220> <223> Lin28 aptamer Group3_Clone6 <400> 15 gggagagcgg aagcgugcug ggccgaacga auccgaugug ugauguuucc ggauucgcgu 60 gauccauaac ccagaggucg auggaucccc cc 92 <210> 16 <211> 92 <212> RNA <213> Artificial Sequence <220> <223> Lin28 aptamer Group3_Clone19 <400> 16 gggagagcgg aagcgugcug ggccgaacga auccgaugug ugauguuucc ggauucgcgu 60 guuccauaac ccagaggucg auggaucccc cc 92 <210> 17 <211> 92 <212> RNA <213> Artificial Sequence <220> <223> Lin28 aptamer Group3_Clone29 <400> 17 gggagagcgg aagcgugcug ggccgaacga auccgaugug ugauguuucc ggauucgcgu 60 gagucauaac ccagaggucg auggaucccc cc 92 <210> 18 <211> 92 <212> RNA <213> Artificial Sequence <220> <223> Lin28B aptamer Group1_Clone2 <400> 18 gggagagcgg aagcgugcug ggccacauga uaucgccggc guuuccaguc acccuucugg 60 cuagcauaac ccagaggucg auggaucccc cc 92 <210> 19 <211> 92 <212> RNA <213> Artificial Sequence <220> <223> Lin28B aptamer Group1_Clone3 <400> 19 gggagagcgg aagcgugcug ggccacauga uaucgccggc guuuccaguc acccuucugg 60 uuagcauaac ccagaggucg auggaucccc cc 92 <210> 20 <211> 92 <212> RNA <213> Artificial Sequence <220> <223> Lin28B aptamer Group1_Clone5 <400> 20 gggagagcgg aagcgugcug ggccacauga uaucgccggc guuuccaguc acccuucugg 60 ucaacauaac ccagaggucg auggaucccc cc 92 <210> 21 <211> 92 <212> RNA <213> Artificial Sequence <220> <223> Lin28B aptamer Group1_Clone13 <400> 21 gggagagcgg aagcgugcug ggccacauga caucgccggc guuuccaguc acccuucugg 60 uuagcauaac ccagaggucg auggaucccc cc 92 <210> 22 <211> 92 <212> RNA <213> Artificial Sequence <220> <223> Lin28B aptamer Group1_Clone19 <400> 22 gggagagcgg aagcgugcug ggccacauga uaucgccggc guuuccaguc acccuucugg 60 uuaacauaac ccagaggucg auggaucccc cc 92 <210> 23 <211> 92 <212> RNA <213> Artificial Sequence <220> <223> Lin28B aptamer Group2_Clone11 <400> 23 gggagagcgg aagcgugcug ggccaguuua cuguauuaca cucuagccca uaacaguguu 60 gauccauaac ccagaggucg auggaucccc cc 92 <210> 24 <211> 92 <212> RNA <213> Artificial Sequence <220> <223> Lin28B aptamer Group2_Clone18 <400> 24 gggagagcgg aagcgugcug ggccaguuua cuguauuaca cucuagccca uaacaguguu 60 gguccauaac ccagaggucg auggaucccc cc 92 <210> 25 <211> 91 <212> RNA <213> Artificial Sequence <220> <223> Lin28B aptamer Group3_Clone1 <400> 25 gggagagcgg aagcgugcug ggccugcuac aucgugugug ucaugcgucu gccuuaccau 60 ucucauaacc cagaggucga uggauccccc c 91 <210> 26 <211> 107 <212> RNA <213> Artificial Sequence <220> <223> Lin28B aptamer Group3_Clone15 <400> 26 auucuauacg acucuaggga gagcggaagc gugcugggcc uguuacaucg ugugugucau 60 gcgucugccu uaccauucuc auaacccaga ggucgaugga ucccccc 107 <210> 27 <211> 91 <212> RNA <213> Artificial Sequence <220> <223> Lin28B aptamer Group3_Clone33 <400> 27 gggagagcgg aagcgugcug ggccugcuac aucgugugug ucaugcgucu gccuuaccau 60 ucccauaacc cagaggucga uggauccccc c 91 <210> 28 <211> 92 <212> RNA <213> Artificial Sequence <220> <223> Lin28B aptamer Group4_Clone9 <400> 28 gggagagcgg aagcgugcug ggccaugggg gcguuagcga aaggccguua accugugaua 60 gaaccauaac ccagaggucg auggaucccc cc 92 <210> 29 <211> 92 <212> RNA <213> Artificial Sequence <220> <223> Lin28B aptamer Group4_Clone16 <400> 29 gggagagcgg aagcgugcug ggccaugggg gcguuagcga aaggcugcua accugugaua 60 gaaccauaac ccagaggucg auggaucccc cc 92 <210> 30 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 30 cgcggatcca tgggctccgt gtcc 24 <210> 31 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 31 cccaagcttt caattctgtg cctccgg 27 <210> 32 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 32 cgcggatcca tggccgaagg cggggc 26 <210> 33 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 33 cgcggatcct cccaggtcag ctactgc 27 <210> 34 <211> 41 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 34 ggtaatacga ctcactatag ggagagcgga agcgtgctgg g 41 <210> 35 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 35 ggggggatcc atcgacctct gggttatg 28 <210> 36 <211> 49 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 36 gggggaattc taatacgact cactataggg agagcggaag cgtgctggg 49 <210> 37 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 37 ggggggatcc atcgacctct gggttatg 28

Claims (7)

RNA aptamer binding to a protein selected from the group consisting of Lin28 and Lin28B.
The method of claim 1,
RNA aptamers selected from the group consisting of nucleotide sequences of SEQ ID NOs: 1-29
A diagnostic kit for cancer comprising the RNA aptamer of claim 1.
The method of claim 3,
And a buffer for carrying out and analyzing the buffer and detection.
A pharmaceutical composition for treating cancer, comprising the RNA aptamer of claim 1 or 2 as an active ingredient.
The method of claim 5,
A pharmaceutical composition for treating cancer, further comprising a pharmaceutically acceptable carrier.
(Iii) deriving a common nucleotide sequence included in the RNA aptamer of claim 1;
(Ii) searching the derived common nucleotide sequence in a DNA / RNA database to search for a new gene fragment comprising the common sequence; And,
(Iii) selecting a gene fragment that interacts with Lin28 or Lin28B by measuring the interaction activity of Lin28 or Lin28B of the retrieved gene fragment, and the method for screening a gene fragment that interacts with Lin28 or Lin28B.

Images