KR20120103959A - Method for preparing 5-aminovaleric acid using recombinant escherichia coli strains - Google Patents

Abstract

PURPOSE: A method for preparing 5-aminovaleric acid from lysine using recombinant E.coli is provided to cheaply prepare a large amount of 5-aminovaleric acid. CONSTITUTION: A method for producing recombinant E.coli for preparing 5-aminovaleric acid comprises: a step of inserting a gene encoding lysine 2-monooxygenase(DavB) and delta-aminovaleramidase(DavA) into an expression vector to prepare a recombinant vector; and a step of transforming the recombinant vector to the E.coli. A method for preparing 5-aminovaleric acid comprises: a step of inserting a gene encoding DavB and DavA enzyme to the expression vector to prepare a recombinant vector; a step of transforming the recombinant vector to the E.coli to prepare a recombinant E.coli; a step of culturing the recombinant E.coli in a medium containing glucose and lysine; and a step of collecting 5-aminovaleric acid.

Description

Method for preparing 5-aminovaleric acid using recombinant Escherichia coli strains

The present invention relates to a method for preparing 5-aminovaleric acid from lysine using a recombinant E. coli strain.

In recent years, in response to the global oil supply instability and the crisis of depletion of petroleum resources, all human efforts to produce alternative production methods or alternative compounds derived from biomass using industrial biotechnology have recently been developed. It is visualized in various fields, such as a compound. The bioplastics market, which utilizes biomass, is produced in 140,000 tonnes of polylactic acid, commercialized by Natureworks in 2002, and is expanding rapidly. Poly- (3-hydroxybutyrate-co-3-hydroxyvalarate)} (P (3HB-co-3HV)), a PHA-based bioplastic, is also metabolix. The product is being marketed by the Telles, a joint venture between ADM and ADM, with a production capacity of 50,000 tonnes completed in 2010. In addition, PTT polymer products are manufactured using biomass-based 1,3-propanediol produced by DuPont. In addition, succinic acid-based PBS is being actively developed, and one of the disadvantages of the biomass-derived polymers mentioned above is low heat resistance, and a representative example of a polymer having high heat resistance is nylon. Nylon 6 and 6 dominate the nylon market, but there is a growing interest in nylon 4, which has both biodegradability and heat resistance.

2-pyrrolidone, a raw material of nylon 4, can be produced from gamma butyrolactone and can be produced by the dehydration ring reaction of 4-aminobutyl acid. 4-aminobutyric acid is also called gamma-aminobutyric acid (GABA), which is known to have hypotension and analgesic effects by neurotransmitter inhibitory effects, and is currently used as a food and pharmaceutical material ( Erlander et al., Neurochem Res. 16: 215-226, 1991). Such GABA can be prepared by glutamate decarboxylase based on glutamate, and various glutamate decarboxylases have been reported to date (Proc. Natl. Acad. Sci. USA, 87: 8491-8495, 1990; Protein Expression and Purification 8: 430-438, 1996; Biosci.Biotechnol.Biochem. 66 (12): 2600-2605, 2002), a process for producing GABA using glutamate decarboxylase This has been developed. In addition to nylon 4, interest in nylon 5 has also increased recently. The monomer of nylon 5 is currently used cadaverine, a diamine derived from lysine.

Therefore, the present inventors have studied to develop a process for producing 5-aminovaleric acid as another monomer of nylon 5 which may be derived from lysine (lysine). As a result of amplifying the lysine 2-monooxygenase (DavB) enzyme converting to -aminovaleramide and the delta-aminovaleramidase (DavA) enzyme converting 5-aminovaleramide to 5-aminovaleric acid, it was confirmed that 5-aminovaleric acid is produced from lysine. The strain has completed the present invention by revealing that the strain can be usefully used to mass-produce 5-amino valeric acid at low cost.

An object of the present invention is a recombinant for producing 5-aminovaleric acid prepared by transformation with a recombinant vector comprising a gene encoding a lysine 2-monooxygenase (DavB) enzyme and a delta-aminovaleramidase (DavA) enzyme. To provide an E. coli strain.

Still another object of the present invention is a method for producing 5-amino valeric acid from a medium containing glucose and lysine using a recombinant E. coli strain prepared by transforming with a recombinant vector comprising a gene encoding a DavB enzyme and a DavA enzyme. It is to provide.

In order to achieve the above object,

1) preparing a recombinant vector by inserting a gene encoding the lysine 2-monooxygenase (DavB) enzyme and delta-aminovaleramidase (DavA) enzyme into the expression vector; And

2) transforming the recombinant vector prepared in step 1) to E. coli strain to provide a recombinant E. coli strain for the production of 5-amino valeric acid (5-aminovaleric acid) produced by the manufacturing method comprising the step of producing a recombinant E. coli strain do.

In addition,

1) preparing a recombinant vector by inserting a gene encoding DavB enzyme and DavA enzyme into an expression vector;

2) transforming the recombinant vector prepared in step 1) to E. coli strain to produce a recombinant E. coli strain;

3) culturing the recombinant E. coli strain of step 2) in a medium containing glucose and lysine; And

4) It provides a 5-amino valeric acid production method comprising the step of obtaining 5-amino valeric acid from the culture medium of step 3).

The present invention relates to a recombinant E. coli strain amplified lysine 2-monooxygenase (DavB) enzyme for converting L-lysine to 5-aminovaleramide and delta-aminovaleramidase (DavA) enzyme for converting 5-aminovaleramide to 5-aminovaleric acid. When the recombinant Escherichia coli strain is cultured in a medium containing lysine, 5-amino valeric acid may be mass-produced, and thus, it may be useful for developing 5-amino valeric acid mass production industrialization technology.

Hereinafter, the present invention will be described in detail.

1) preparing a recombinant vector by inserting a gene encoding the lysine 2-monooxygenase (DavB) enzyme and delta-aminovaleramidase (DavA) enzyme into the expression vector; And

2) transforming the recombinant vector prepared in step 1) to E. coli strain to provide a recombinant E. coli strain for the production of 5-amino valeric acid (5-aminovaleric acid) produced by the manufacturing method comprising the step of producing a recombinant E. coli strain do.

DavB preferably has a nucleotide sequence as set forth in SEQ ID NO: 1, but is not limited thereto.

DavA preferably has a nucleotide sequence represented by SEQ ID NO: 2, but is not limited thereto.

The E. coli strains may be applied to all kinds of E. coli strains, more preferably BL21 codon plus, but is not limited thereto.

In addition,

1) preparing a recombinant vector by inserting a gene encoding DavB enzyme and DavA enzyme into an expression vector;

2) transforming the recombinant vector prepared in step 1) to E. coli strain to produce a recombinant E. coli strain;

3) culturing the recombinant E. coli strain of step 2) in a medium containing glucose and lysine; And

4) It provides a 5-amino valeric acid production method comprising the step of obtaining 5-amino valeric acid from the culture medium of step 3).

As the medium of step 3), any medium used for the culture of E. coli strains may be used, but the LB medium is more preferably but not limited thereto.

The culture of step 3) is preferably 48 to 96 hours, the culture temperature is preferably 20 to 40 ℃, more preferably 37 ℃ but is not limited thereto.

The 5-amino valeric acid obtained in step 4) can be obtained by spray-drying the culture solution to obtain a large amount of low concentration of 5-amino valeric acid-containing powder. It is also possible to obtain a 5-amino valeric acid, and can also obtain a high purity of 5-amino valeric acid by using a purification method using an ion exchange resin followed by a concentration and drying process, but is not limited thereto. Valeric acid is not significantly affected by changes in temperature and pH, and there is no limitation in the recovery process because of its process stability.

In a specific embodiment of the present invention, the E. coli strain is transformed with a recombinant vector containing a gene encoding a lysine 2-monooxygenase (DavB) enzyme and a delta-aminovaleramidase (DavA) enzyme that converts 5-aminovaleramide to 5-aminovaleric acid. The transformed E. coli strains were cultured in a medium containing lysine, and then confirmed the ability to produce 5-amino valeric acid conversion.

Therefore, the recombinant E. coli strain of the present invention can be usefully used for mass production of 5-amino valeric acid at low cost.

Hereinafter, the present invention will be described in detail by way of examples.

However, the following examples are illustrative of the present invention, and the contents of the present invention are not limited by the following examples.

< Example  1> DavA  And DavB  Preparation of Expression Vectors for Gene Expression

By culturing the L-lysine 5-aminovaleramide lysine 2-monooxygenase ( DavB) enzyme and 5-aminovaleramide the 5-aminovaleric acid delta-aminovaleramidase ( DavA) recombinant E. coli BL21 codon plus amplified for the enzyme switches to switch to In order to confirm the 5-aminovaleric acid production ability from lysine, a vector expressing the DavA and DavB genes was constructed.

Expression vectors pZE12-MCS were derived from muti-cloning sites (MCS) and Ralstonia of pTacLac (Lee et al. Appl . Microbiol . Biotechnol . 79 , 633-641, 2008) . It was modified to have a PHA biosynthetic gene transcription terminator of eutropha .

Specifically, Ralstonia PHA biosynthetic gene transcription terminator gene fragment of eutropha was obtained from p619C1437-pct540 by PCR using primers of SEQ ID NO: 3 and SEQ ID NO: 4 shown in Table 1 below, and the obtained gene fragment as a template was shown in Table 1 below. PCR was performed using primers of SEQ ID NO: 5 and SEQ ID NO: 4 to obtain PHA biosynthetic gene transcription terminators of RBS, pTacLac MCS and R. eutropha . The PCR product was digested with MfeI and AvrII and inserted into pZE12-MCS digested with EcoRI / AvrII to prepare pKE12-MCS. Plasmid pZE12-MCS was purchased from ESPRESSYS (www.expressys.com) and received. pKE12DavA was prepared by inserting the DavA gene of Pseudomonas putida as EcoRI / KpnI in pKE12-MCS, and inserting the DavB gene of Pseudomonas putida as KpnI / BamHI in pKE12DavA to prepare pKE12DavAB.

Primer sequence Target gene SEQ ID NO: 3 gagtcgacctgcaggcatgcaagcttcctgccggcctggttcaacc R. eutropha PHA biosynthesis genes transcription terminator
SEQ ID NO: 4 cctagg gcctcgcccccgcgagggcc SEQ ID NO: 5 caattgattaaagaggagaaagaattcgagctcggtacccggggatcctctagagtcgacctgcaggcatgcaagctt RBS and MCS for pKE12-MCS

< Example  2> 5- Amino valeric acid (5- aminovaleric acid ) Production capacity  Confirm

In order to confirm the 5-amino valeric acid production capacity using the E. coli BL21 codon plus (pKE12DavAB) prepared in Example 1, E. coli BL21 codon plus LB medium and glucose 10 g / L and lysine Cultured in LB and MR medium containing 10 g / L. MR medium (pH 6.9) consists of the following composition per liter: 6.67 g KH ₂ PO ₄ , 4 g (NH ₄ ) ₂ HPO ₄ , 0.8 g MgSO ₄ 7H ₂ O, 0.8 g citric acid, 5 ml trace metal solution. Trace metal solution consists of the following composition per liter (0.5 M HCl), 10 g FeSO ₄ 7H ₂ O, 2 g CaCl ₂ , 2.2 gZnSO ₄ 7H ₂ O, 0.5 g MnSO ₄ 4H ₂ O, 1 g CuSO ₄ 5H ₂ O, 0.1 g (NH ₄ ) ₆ Mo ₇ O ₂₄ 4H ₂ O, 0.02 g Na ₂ B ₄ O ₇ 10H ₂ O.

As a result, as shown in Table 2, it was confirmed that 5-amino valeric acid is significantly produced from lysine.

<110> Korea research institute of chemical technology <120> Method for Preparing 5-aminovaleric acid using recombinant          Escherichia coli strains <130> 11p-02-20 <160> 5 <170> Kopatentin 1.71 <210> 1 <211> 1683 <212> DNA (213) Pseudomonas putida <400> 1 atgaacaaga agaaccgcca ccccgccgac ggcaagaagc cgatcaccat tttcggcccg 60 gacttccctt ttgctttcga cgactggctg gaacacccgg caggcctggg cagcattccg 120 gctgagcgcc atggggaaga ggtggccatt gtcggtgccg gtatcgccgg cctggtagcg 180 gcctacgagc tgatgaagct gggcctcaag ccggtggtgt acgaggcttc caagctgggc 240 ggccggctgc gctcgcaagc cttcaatggc actgacggga tcgttgccga actgggtggc 300 atgcgcttcc cggtgtcgtc caccgccttc taccactacg tcgacaagct gggcctggaa 360 accaagccct tccccaaccc gctgaccccg gcttcgggca gcacggtgat cgacctggaa 420 ggccagacct actacgccga gaagcccacc gacctgccac aactgtttca tgaggtagcc 480 gacgcctggg ccgatgcgct ggagagcggt gcgcagttcg ccgatatcca gcaggccatc 540 cgcgaccgtg atgtaccgcg cctgaaggaa ctttggaaca agctggtgcc gctgtgggac 600 gaccgcacct tctacgactt cgtcgccacc tcgcgctctt ttgccaagct gagcttccag 660 caccgcgaag tgttcggcca ggtcggtttc ggcaccggcg gttgggactc ggacttcccc 720 aactcgatgc tggaaatctt ccgcgtggtg atgaccaact gcgacgacca ccagcacctg 780 gtggtcgggg gcgtggaaca agtgccacaa ggcatctggc gccacgtacc ggaacgctgc 840 gtgcattggc cagagggcac cagcctgagc acgctgcatg gcggcgcacc gcgtaccggt 900 gtcaagcgca ttgcccgcgc ctccgatggc cgcctggcgg tcaccgacaa ctggggcgat 960 acccgccact acagcgcagt actcgccacc tgccagacct ggttgctgac cacccagatc 1020 gactgcgaag aatcgctgtt ctcgcaaaag atgtggatgg ccctggaccg tacccgctac 1080 atgcagtcgt cgaaaacctt cgtcatggtc gaccgcccgt tctggaagga caaggacccg 1140 gaaaccggcc gtgacctgct gagcatgacc ctcaccgatc gcctcacccg cggcacttac 1200 ctgttcgaca acggcaacga caagcccggg gtgatctgcc tgtcatactc gtggatgagc 1260 gacgcgctga agatgctgcc gcacccggtg gagaagcgcg tacaactggc cctggatgcg 1320 ctgaagaaga tctacccgaa gaccgatatc gccggccaca tcatcggcga cccgatcacg 1380 gtttcctggg aggccgaccc gtacttcctc ggcgccttca aaggcgcgct tccgggccat 1440 taccgctaca accagcgcat gtacgcgcac ttcatgcagc aggacatgcc ggcagagcag 1500 cgcggtatct tcattgctgg tgacgacgtg tcatggaccc ccgcctgggt tgaaggcgcg 1560 gtgcagacgt cgctgaatgc agtgtggggt atcatgaacc actttggtgg ccacacccac 1620 cccgacaacc cgggcccggg cgatgtgttc aacgaaatcg gcccgatcgc cctggcggat 1680 tga 1683 <210> 2 <211> 795 <212> DNA (213) Pseudomonas putida <400> 2 atgcgcatcg ctctgtacca gggcgcaccc aagccactgg atgtgcccgg caacctgcaa 60 cggctgcgcc accaggcgca gctggcagcc gaacgcggcg cacagttgct ggtgtgcccg 120 gagatgttcc tgaccggcta caacatcggc ctggcccagg tcgagcgcct ggccgaggcc 180 gccgatggcc cggcagccat gaccgtggta gagatcgccc aggcgcaccg catcgccatt 240 gtctatggct acccggagcg cggtgacgac ggggcgatct acaacagcgt gcagttgatc 300 gatgcgcatg gccgcagcct gagcaattac cgcaagacgc acctgttcgg tgaactggac 360 cgctcgatgt tcagccctgg tgcggaccac ttcccggtgg tggaactgga aggctggaag 420 gttggcctgc tgatctgcta cgacatcgag ttcccggaga acgcccgacg cctagcgctg 480 gacggcgccg agctgatcct ggtgccgacg gcgaacatga cgccgtacga ctttacctgc 540 caggtgaccg tgagagcgag ggcacaggaa aaccagtgct acctggtata tgccaactac 600 tgcggtgcgg aagacgagat tgagtattgc gggcagagca gcatcatcgg cccggatggc 660 agcttgctgg ccatggccgg gcgggatgag tgccagttgt tggcagagct tgaacatgag 720 cgggtggtgc aggggcgcac ggcgtttccc tacctgaccg atttgcgcca ggagctgcac 780 ctgcgtaaag gctga 795 <210> 3 <211> 46 <212> DNA <213> Artificial Sequence <220> <223> forward primer for R. eutropha PHA biosynthesis genes          transcription terminator <400> 3 gagtcgacct gcaggcatgc aagcttcctg ccggcctggt tcaacc 46 <210> 4 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> reverse primer for R. eutropha PHA biosynthesis genes          transcription terminator <400> 4 cctagggcct cgcccccgcg agggcc 26 <210> 5 <211> 78 <212> DNA <213> Artificial Sequence <220> <223> forward primer for RBS and MCS for pKE12-MCS <400> 5 caattgatta aagaggagaa agaattcgag ctcggtaccc ggggatcctc tagagtcgac 60 ctgcaggcat gcaagctt 78

Claims (5)

1) preparing a recombinant vector by inserting a gene encoding the lysine 2-monooxygenase (DavB) enzyme and delta-aminovaleramidase (DavA) enzyme into the expression vector; And
2) Recombinant Escherichia coli strain for 5-aminovaleric acid production prepared by the manufacturing method comprising the step of transforming the recombinant vector prepared in step 1) to E. coli strain.
The recombinant E. coli strain for producing 5-amino valeric acid according to claim 1, wherein DavB has a nucleotide sequence as set forth in SEQ ID NO: 1.
The recombinant E. coli strain for producing 5-amino valeric acid according to claim 1, wherein DavA has a nucleotide sequence as set forth in SEQ ID NO: 2.
1) preparing a recombinant vector by inserting a gene encoding DavB enzyme and DavA enzyme into an expression vector;
2) transforming the recombinant vector prepared in step 1) to E. coli strain to produce a recombinant E. coli strain;
3) culturing the recombinant E. coli strain of step 2) in a medium containing glucose and lysine; And
4) A 5-amino valeric acid production method comprising the step of obtaining 5-amino valeric acid from the culture medium of step 3).
5. The method of claim 4, wherein the culturing of step 3) is performed at 30 to 40 ° C. for 48 to 96 hours.