KR20120066556A - Transformants expressing epitope of porcine epidemic diarrhea virus and mucosal adjuvant and vaccine compositions containing the same - Google Patents

Abstract

PURPOSE: A recombinant vector expressing PEDV epitope protein and mucosal adjuvant is provdied to induce antibody formation and to prevent and treat PEDV infection. CONSTITUTION: A recombinant vector contains genes encoding PEDV epitope protein and genes encoding mucosal adjuvant which are operatively linked. The gene encoding PEDV epitope has a base sequence of sequence number 2 or 3. The recombinant vector additionally has rotavirus gene. The rotavirus gene is VP8 or BVP5 gene. The mucosal adjuvant is CTB(cholera toxin subunit B).

Description

Transformants expressing epitope of porcine epidemic diarrhea virus and mucosal adjuvant and vaccine compositions containing the same}

The present invention relates to a recombinant vector expressing a PEDV epitope protein and a mucosal immune adjuvant, a transformant transformed with the recombinant vector, a PEDV vaccine composition comprising the transformant, and a method of manufacturing the same. .

Swine pandemic diarrheal disease (PED) was first reported in Belgium and the United Kingdom in 1978, and has occurred in many pig-producing countries (Asia, including Europe, Japan, China, and Korea), and has caused significant economic losses in Europe and Asia ( Pensaert 1978; Chasey 1978). PEDV, which causes swine epidemic diarrheal disease, mainly proliferates in small intestinal chollocytes, denatures or necrosis of chorionic epithelial cells, causes atrophy and excretion of villi, and causes malabsorption, resulting in sustained diarrhea (Straw 2006). Regardless of the age of pigs, enteritis is associated with severe diarrhea and dehydration, and even mortality in piglets ranges from 80 to 90% (Jinghui 2005).

Swine epidemic diarrhea in Korea has been in vogue for two years since the PED virus was first isolated in 1992, and it has not been clinically differentiated from TGEV (Transmissible Gastroenteritis virus), causing massive economic damage (Duarte 1994). In recent years, mixed infection with TGE is increased rather than PED alone, and occurs regardless of season, but occurs frequently in winter.

Meanwhile, antibiotics are soluble organic substances produced by microorganisms and are substances that inhibit and destroy the growth of other microorganisms. Originally produced only by microorganisms, now industrially produced compounds also exhibit antibiotic activity. These antibiotics have been developed for medical and veterinary purposes to suppress pathogens, but they are also used as feed additives because they are recognized for promoting animal growth and improving feed efficiency (Sarmah 2006).

In the swine industry, the use of antibiotics increases the mortality rate of young pigs in addition to improving the growth rate, and in farms with higher densities due to the lower mortality rate in poor hygiene. However, the use of indiscriminate antibiotics on livestock raises safety concerns on humans such as antibiotic residues, increased bacterial resistance and the transfer of bacterial resistance from animals to humans. There is a trend.

The US FDA recently recommends restrictions on antibiotics that promote livestock growth and is reviewing bans on potent antibiotics that could affect the human body. In Korea, the addition of antibiotics in feeds has been banned since July 2011. Therefore, it is urgent to develop feed additives that are harmless to humans and have excellent growth efficiency.

In addition, the use of antibiotics by pig farmers is mainly used to prevent and treat diseases of the digestive or respiratory system, which are infectious diseases of piglets that cause economic losses. Currently, vaccine injections developed for antibiotics cannot induce a mucosal immune system that can effectively protect against digestive or respiratory diseases. The mucous membrane, which is the place of disease of the digestive or respiratory system, is about 200 times the area of the skin and is exposed to numerous pathogens from the outside of the body. It has the equivalent of a ship. In particular, the human gut secreted IgA is 40 mg / kg, twice that of IgG (Conley et al., 1987). Although it has such a strong immune system, it is exposed to numerous proteins and pathogens, making it difficult to operate the immune system by reaching an immune tolerance (Mowat and Weiner, 1999). However, mucosal immunity system is highly useful because the intestinal immune system is stimulated and antibodies are formed, and the antibody to the antigen is also generated in the immune system in the mammary gland (Haneberg et al., 1994). Plant oral vaccines are attracting attention as vaccines that effectively operate the mucosal immune system. Live and dead vaccines are attenuated or killed by pathogens and can cause side effects if proper inoculation is not given. Recombinant vaccine is a vaccine that isolates and expresses a gene having an antigenicity of a pathogen in cells of genetically engineered bacteria, yeasts or mammals. Recombinant vaccines produced by E. coli have the advantages of eliminating pathogen contamination and low cost of mass production. However, animal and plant proteins may be less immune due to differences in post-translational modifications with E. coli. Proteins are also destroyed by unfriendly conditions (Amanda and Charles 2000; Tacket 2005). Higher organism protein expression systems, such as plants, can be used to circumvent immunity deprivation problems and intestinal unfriendly conditions (Kong 2001; Youm 2007).

Against this background, the present inventors developed a novel antigenic gene of PEDV and fused a mucosal immune adjuvant to produce a recombinant vector, and improved diarrhea in pigs when the vector-transformed plant transformant was administered to a pig infected with PEDV. By confirming that the present invention was completed.

It is an object of the present invention to provide a recombinant vector operably linked to a gene encoding a porcine epidemic diarrhea virus (PEDV) epitope protein and a gene encoding a mucosal immune adjuvant.

Another object of the present invention is to provide a transformant transformed with the recombinant vector.

Still another object of the present invention is to provide a vaccine composition of PEDV or rotavirus comprising the transformant, the protein extract of the transformant or the recombinant protein isolated from the transformant.

Another object of the present invention to provide a feed composition and feed additive for the prevention or treatment of PEDV or rotavirus infection comprising the transformant.

Still another object of the present invention is to provide a method for preparing a PEDV or rotavirus vaccine in which a mucosal immune adjuvant is fused.

As one aspect for achieving the above object, the present invention relates to a recombinant vector operably linked to a gene encoding a Pcine epidemic diarrhea virus (PEDV) epitope protein of SEQ ID NO: 1 and a gene encoding a mucosal immune adjuvant.

In the present invention, the term "porcine epidemic diarrhea virus" (PEDV) belongs to the family of coronaviridae ( coronaviridae ) and has a single stranded RNA genome (genome) of about 28Kb in length and three major constituent protein spike protein (180-220KDa) It encodes membrane protein or envelope protein (27-32KDa) and nucleocapsid protein (55-58KDa) (Shenyang 2007). It has a structure similar to that of the same species SARS coronavirus and is cultured in African green monkey kidney cells with trypsin added (Kim 2003; Stadler 2003; Vol. 2009).

As used herein, the term "Spike protein" is a major constituent protein of PEDV and has a biologically important function of recognizing target cells and fusing viruses and cellular membranes (Chang 2002). COE (CO-26K fragment equivalent) gene, which is part of the spike protein, can be used as an attenuating epitope.

As used herein, the term "epitope" refers to a set of amino acid residues at an antigen binding site recognized by a particular antibody, or in T cells, recognized by a T cell receptor protein and / or a Major Histocompatibility Complex (MHC) receptor. Residue. Epitopes are molecules that form a site recognized by an antibody, T cell receptor, or HLA molecule and refer to primary, secondary, and tertiary peptide structures, or charges.

As used herein, the term "vector" refers to any medium for cloning and / or transferring bases to a host cell. The vector may be a replica, in which other DNA fragments can bind to result in replication of the bound fragment. A "replicating unit" refers to any genetic unit (e.g., plasmid, phage, cosmid, chromosome, virus) that functions as a self-unit of DNA replication in vivo, i.e., is replicable by its own regulation. . The term "vector" includes viral and non-viral mediators for introducing bases into host cells in vitro, ex vivo or in vivo. The term "vector" may also include minispherical DNA. For example, the vector may be a plasmid that does not have a bacterial DNA sequence. Removal of bacterial DNA sequences enriched in the CpG region has been done to reduce transgene expression silencing and lead to more sustained expression from plasmid DNA vectors. The term “vector” may also include transposons (Szping, et al. J. MoI. Biol. 302: 93-102 (2000)), such as Sleeping Beauty, or artificial chromosomes.

In one embodiment of the present invention, in order to clone a COE gene that is part of the PEDV spike protein and antigenic, a new COE gene, ie, PEDV epitope, was obtained from a KPEDV-9 strain instead of the conventional Brl / 27 strain.

The new PEDV epitope protein of the present invention comprises an amino acid sequence of SEQ ID NO: 1, preferably having a nucleotide sequence of SEQ ID NO: 2. More preferably, the gene encoding the PEDV epitope protein may be a nucleotide sequence represented by SEQ ID NO: 3, wherein the 148th base is guanine, the 151th base is modified with cytosine, and the base of SEQ ID NO: 2.

In addition, a gene encoding a portion of the protein present at the c-terminus of the spike protein may be fused to a gene encoding the PEDV epitope protein, and preferably, a gene encoding the amino acid of SEQ ID NO: 4 is fused. More preferably, the nucleotide sequence represented by SEQ ID NO: 5 is fused.

In addition, in the recombinant vector of the present invention, a rotavirus gene may be further fused to a gene encoding a PEDV epitope protein.

In the present invention, the term "rotavirus" refers to vomiting and diarrhea as a pathogen causing severe enteritis in mammals and birds, and especially when infected with infants, it can lead to death due to dehydration symptoms. Rotavirus infection in pigs also occurs in young pigs but is not fatal and is aggravated by secondary bacterial infections.

Rotavirus belongs to Reoviridae, which contains 11 fragment double-stranded RNA as a genome and encodes six structural proteins and six nonstructural proteins. The two envelope capsid proteins VP4 and VP7 individually elicit attenuated antibodies to induce immunity and can be divided into two antigenic types, P (proteinase sensitivity) and G (glycoprotein). VP4 on the surface of the viral molecule plays an important role in the interaction between the virus and the cell, including invading cells and receptors that bind to the cell. Trypsin treatment of VP4 specifically divides VP5 and VP8, VP8 contains the hemagglutin of the virus, and VP5 has a hydrophobic moiety inside, allowing the virus to penetrate cells.

In the present invention, the rotavirus gene is preferably a VP8 gene or a BVP5 gene, and more preferably a gene having a nucleotide sequence of SEQ ID NO: 6 or 7.

As used herein, the term "operably linked" may generally affect the expression of a base sequence encoding a base expression control sequence and a base sequence encoding a protein of interest to perform a function. Operable linkage with recombinant vectors can be made using genetic recombination techniques known in the art, and site-specific DNA cleavage and linkage can be made using cleavage and linking enzymes, and the like, in the art.

In the present invention, the term "mucosa immunity adjuvant" means an immunoadjuvant that enhances mucosal immunity, for example, CTB (Cholera toxin subunit B, CTB), LTB (Heat-Labile Toxin B subunit), plant toxin ricin toxin B [ricinus communis AB dimeric toxin B subuit (RTB)], but its kind is not limited.

Preferably, the mucosal immune adjuvant of the present invention is cholera toxin, more preferably cholera toxin subunit B (CTB).

In the present invention, the term "Cholera toxin" is divided into A and B subunits, but the A subunit is toxic and the B subunit is not toxic. It also has the ability to attach to the intestinal epithelial receptor (GM1 ganglioside) in the form of a pentamer, and to find M cells that are the 'gateway' of the mucosal immune system. Function as an adjuvant has been demonstrated (Frey et al., 1996; Mckenzie et al., 1984: Tamura et al., 1988). In addition, when the subunit B is administered through the mucosal pathway as an antigen carrier, it can be observed to effectively induce mucosal immunity to secrete IgG as much as the secreted type IgA (Hirabaysshi et al., 1990; Lenher et al., 1994: Nasher et al. , 1993).

Therefore, the recombinant vector provided in the present invention is a mucosal immune adjuvant gene in a form in which a gene encoding a PEDV epitope protein or a rotavirus gene having a nucleotide sequence of SEQ ID NO: 6 or 7 is fused to a gene fused to an amino acid of SEQ ID NO: 4 thereto. Is an operably linked vector. Preferably the recombinant vector is to include the nucleotide sequence of SEQ ID NO: 8 to 11. In one embodiment of the present invention, the gene encoding the PEDV epitope protein of SEQ ID NO: 3 and mCOECT (CTB :: mCOE, SEQ ID NO: 8) fused with a mucosal immune adjuvant, the gene encoding the PEDV epitope protein of SEQ ID NO: 3, MCOEGYCT (CTB :: mCOEGY, SEQ ID NO: 9) fused with a nucleotide sequence of SEQ ID NO: 5, a gene encoding the PEDV epitope protein of SEQ ID NO: 3, a base sequence of SEQ ID NO: 5, a rotavirus VP8 gene, and a mucosa PERO8CT fused with an adjuvant (CTB :: mCOEGY :: VP8, SEQ ID NO: 10) and gene encoding the PEDV epitope protein of SEQ ID NO: 3, nucleotide sequence of SEQ ID NO: 5, rotavirus BVP5 gene, and mucosal immunity adjuvant Provided is a recombinant vector comprising PERO5CT (CTB :: mCOEGY :: BVP5, SEQ ID NO: 11).

As another aspect, the present invention relates to a transformant transformed with the recombinant vector.

In the present invention, the term “transformation” refers to a change in the genetic properties of an organism by DNA given from the outside, that is, when DNA is a kind of nucleic acid extracted from a cell of a certain organism, the DNA of a living cell of another strain Is a phenomenon in which the genotype changes in the cell and is also called transformation, transformation, or transformation.

As used herein, the term “transformer” refers to a transformed plant or a transgenic animal produced by transformation, and includes a genetic recombinant produced by modification or mutation of a specific gene using genetic recombination technology. do. Preferably, the transformant of the present invention may be a transformant derived from plant cells.

As used herein, the term “plant cell” is a basic unit constituting a plant, and may be cultured cells, culture tissues, culture organs or whole plants of plant tissue, preferably culture cells, culture tissues, or culture organs. And more preferably all possible forms of cultured cells, most preferably cells derived from carrots.

As used herein, the term “plant tissue” refers to tissues of differentiated or undifferentiated plants, such as, but not limited to, roots, stems, leaves, pollen, seeds, cancer tissues and various types of cells used in culture, Ie, single cells, protoplasts, shoots and callus tissue. The plant tissue may be in planta or in an organ culture, tissue culture or cell culture.

As used herein, the term "recombinant" refers to a cell in which a cell replicates a heterologous nucleic acid, expresses the nucleic acid, or expresses a protein encoded by a peptide, a heterologous peptide, or a heterologous nucleic acid. The recombinant cell can express a gene or a gene fragment that is not found in the natural form of the cell in one of the sense or antisense form. Recombinant cells can also express genes found in natural cells, which are modified and reintroduced into cells by artificial means.

The transformant of the present invention may be appropriately selected and used by those skilled in the art without limitation as long as the cell can be used for transformation known in the art, and the transformant of the present invention may be Agrobacterium, Escherichia coli or a transgenic plant. Preferably, the transformant may be a plant cell, more preferably a group consisting of tobacco, Arabidopsis, potato, lettuce, radish, Chinese cabbage, tomato, soybean, rice, barley, wheat, corn and carrot It may be a transformant is selected from, and most preferably is a transformant of carrots.

As another aspect, the present invention relates to a PEDV or rotavirus vaccine composition comprising a transformant of the present invention, a protein extract of the transformant or a recombinant protein isolated from the transformant.

In the present invention, the term "transformer" is as described above.

As used herein, the term “vaccine” refers to a biological agent containing an antigen that immunizes a living body, and refers to an immunogen or antigenic substance that immunizes the living body by injection or oral administration to a human or animal to prevent infection. . In vivo immunization is largely divided into autoimmunity, in which immunity is automatically obtained after infection by pathogens, and passive immunity obtained by an externally injected vaccine. While autoimmunity is characterized by a long period of generation of antibodies related to immunity and continuous immunity, passive immunization with vaccines acts immediately to treat infectious diseases, but has a disadvantage of poor sustainability.

As used herein, the term “immunogen” or “antigenic substance” refers to a peptide, polypeptide, lactic acid bacteria expressing the polypeptide, protein, lactic acid bacteria expressing the protein, oligonucleotide, polynucleotide, recombinant bacteria and recombinant virus in the group consisting of It may be characterized in that it is any one selected. In specific embodiments, the antigenic substance may be in the form of an inactivated whole or partial cell preparation, or in the form of an antigen molecule obtained by conventional protein purification, genetic engineering techniques or chemical synthesis.

Preferably, the antigenic substance of the present invention may be PEDV which causes epidemic diarrheal disease in pigs, and more preferably, a form in which the gene sequence present at the C-terminus of the PEDV-derived COE protein and spike protein is fused or rotavirus. The gene may be in a combined form. Most preferably, mCOECT (CTB :: mCOE, SEQ ID NO: 8) fused with a gene encoding the PEDV epitope protein of SEQ ID NO: 3 and a mucosal immunity adjuvant, a gene encoding the PEDV epitope protein of SEQ ID NO: 3, of SEQ ID NO: 5 Fusion of mCOEGYCT (CTB :: mCOEGY, SEQ ID NO: 9), a gene encoding the PEDV epitope protein of SEQ ID NO: 3, a nucleotide sequence of SEQ ID NO: 5, a rotavirus VP8 gene, and a mucosal immunity adjuvant PERO5CT (CTB :) fused with a gene encoding the PERO8CT (CTB :: mCOEGY :: VP8, SEQ ID NO: 10) and the PEDV epitope protein of SEQ ID NO: 3, the nucleotide sequence of SEQ ID NO: 5, the rotavirus BVP5 gene, and a mucosal immune adjuvant : mCOEGY :: BVP5, SEQ ID NO: 11).

The content of the antigen may be 1 to 10% by weight relative to the total weight of the vaccine composition, preferably within 5% by weight.

Vaccine compositions according to the invention are stabilizers, emulsifiers, aluminum hydroxide, aluminum phosphate, pH adjusters, surfactants, liposomes, iscom adjuvants, synthetic glycopeptides, extenders, carboxypolymethylenes, bacterial cell walls, derivatives of bacterial cell walls, Bacterial vaccine, animal poxvirus protein, subviral particle adjuvant, cholera toxin, N, N-dioctadecyl-N ', N'-bis (2-hydroxyethyl) -propanediamine, monophosphoryl lipid A, dimethyldioctadecyl-ammonium bromide and mixtures thereof may be further contained in at least one second adjuvant.

In addition, the vaccine composition of the present invention may comprise a veterinary acceptable carrier. As used herein, the term "veterinarily acceptable carrier" includes any and all solvents, dispersion media, coatings, adjuvant, stabilizers, diluents, preservatives, antibacterial and antifungal agents, isotonic agents, adsorptive delay agents and the like. Carriers, excipients, and diluents that may be included in the composition for vaccines include lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, maltitol, starch, glycerin, starch, acacia rubber, alginate, gelatin, calcium phosphate, calcium silicate, Cellulose, methyl cellulose, microcrystalline cellulose, polyvinyl pyrrolidone, water, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate and mineral oil.

In addition, the vaccine composition of the present invention can be used in the form of oral dosage forms, such as powders, granules, tablets, capsules, suspensions, emulsions, syrups, aerosols, and sterile injectable solutions, respectively, according to conventional methods. When formulated, diluents or excipients such as fillers, extenders, binders, wetting agents, disintegrating agents, surfactants, etc. which are commonly used can be prepared. Solid preparations for oral administration include tablets, pills, powders, granules, capsules, and the like, and such solid preparations include at least one excipient such as starch, calcium carbonate and sucrose in the lecithin-like emulsifier. (sucrose), lactose (lactose), gelatin, etc. can be mixed and prepared. In addition to simple excipients, lubricants such as magnesium styrate talc may also be used. As a liquid preparation for oral administration, suspending agents, liquid solutions, emulsions, syrups, etc. may be used, and various excipients, such as wetting agents, sweeteners, fragrances, and preservatives, in addition to commonly used simple diluents such as water and liquid paraffin, may be included. Can be. Formulations for parenteral administration include sterile aqueous solutions, non-aqueous solutions, suspensions, emulsions, lyophilized preparations. As the non-aqueous preparation and suspending agent, propylene glycol, polyethylene glycol, vegetable oils such as olive oil, injectable esters such as ethyl oleate and the like can be used.

The present invention also relates to a method of increasing the antibody production rate against the antigen by injecting the vaccine composition into animals other than humans.

In the present invention, the term "animal except human" may be characterized as a mammal or a bird, the "injection" is subcutaneous injection, intramuscular injection, subcutaneous injection, intraperitoneal injection, nasal administration, oral administration, transdermal It may be characterized in that it is carried out by any one method selected from the group consisting of administration and oral administration. Preferably the vaccine of the present invention may be an oral vaccine.

In the present invention, the term "injection" or "administration" may vary depending on the age, sex, and weight of the subject to be administered, and the dose of the vaccine also depends on the route of administration, the degree of disease, sex, weight, age, and the like. Can vary.

In another aspect, the present invention relates to a feed composition for the prevention or treatment of a PEDV or rotavirus infection comprising a transformant of the present invention, a protein extract of the transformant or a recombinant protein isolated from the transformant. .

As used herein, the term “prevention” refers to a transformant expressing the PEDV epitope protein and a mucosal immune adjuvant of the present invention, a transformant expressing the PEDV epitope protein and a mucosal immune adjuvant fused with rotavirus, or the transformant. It refers to all the actions of inhibiting or delaying the PEDV or rotavirus infection by administration of a composition comprising an active ingredient.

In the present invention, the term “treatment” refers to a transformant expressing the PEDV epitope protein and mucosal immune adjuvant of the present invention, a transformant expressing the PEDV epitope protein and mucosal immune adjuvant fused with rotavirus, or the transformant. By the administration of the composition as an active ingredient refers to any action that improves or benefits the symptoms of the PEDV or rotavirus infection.

The feed composition used in the present invention may be appropriately configured by those skilled in the art in various forms of composition known in the art as long as it includes the feed additive according to the present invention as an active ingredient, preferably 20% protein, fat, ether It may be a feed composition comprising 4.5% extract, 5.4% fat, acid hydrolysis, 4.7% crude fiber, 6% ash, 0.80% calcium and 0.62% phosphate.

In still another aspect, the present invention is directed to a composition for preventing or treating PEDV or rotavirus infection comprising a transformant of the present invention, a protein extract of the transformant or a recombinant protein isolated from the transformant. It is about.

The feed composition of the present invention may be prepared in various forms known in the art, preferably the transformant expressing the PEDV epitope protein and mucosal immune adjuvant of the present invention, PEDV epitope protein fused with rotavirus and It is to include a transformant expressing a mucosal immune adjuvant or the transformant as an active ingredient.

The feed additives according to the present invention can be used individually and in combination with conventionally known feed additives and can be used sequentially or simultaneously with conventional feed additives. And single or multiple administrations. Taking all of the above factors into consideration, it is important to administer an amount that can obtain the maximum effect in a minimum amount without side effects, and can be easily determined by those skilled in the art.

The individual to which the composition for feed of the present invention can be applied is not particularly limited and may be applied in any form. For example, it is applicable without limitation to animals such as chickens, pigs, monkeys, dogs, cats, rabbits, morphots, rats, mice, cows, sheep, goats, etc., according to an embodiment of the present invention the feed composition PEDV When added to the feed composition of infected pigs, diarrhea index was relieved, the antibody titer to PEDV was increased, and the visual examination through anatomy confirmed that the symptoms of PEDV infection were alleviated.

In another aspect, the present invention relates to a method of preventing or treating PEDV or rotavirus infection. Specifically, the present invention relates to a method for preventing and treating PEDV or rotavirus infection by administering the PEDV or rotavirus vaccine composition to a subject in need of prevention and treatment of PEDV or rotavirus infection. The present invention also includes a method of preventing and treating PEDV or rotavirus infection by administering the feed composition or the feed composition to the subject.

In still another aspect, the present invention provides a method for preparing a recombinant vector expressing a PEDV epitope protein and a mucosal immune adjuvant, or a recombinant vector expressing a PEDV epitope protein and a mucosal immune adjuvant fused with a rotavirus; (2) introducing the recombinant vector of step (1) into an Agrobacteria; And (3) relates to a method for producing a PEDV or rotavirus vaccine fused with a mucosal immune adjuvant comprising the step of transforming the agrobacteria and plant cells of step (2).

Step (1) is a gene encoding a PEDV epitope protein fused with a recombinant vector or a rotavirus gene operably linked to a gene encoding a PEDV epitope protein and a mucosal immune adjuvant of the present invention. It relates to a step of producing a recombinant vector operably linked genes encoding the. The gene encoding a PEDV epitope protein may be selected without limitation as long as the site includes a sequence having a PEDV antigenicity, preferably the nucleotide sequence represented by SEQ ID NO: 2, and more preferably. The gene may be a nucleotide sequence represented by SEQ ID NO: 3, wherein the 148th base is guanine and the 151th base is modified with cytosine. In addition, it may be a vector expressing a gene in the form of a fusion of a gene encoding an epitope protein (porce epidemic diarrhea virus) epitope protein and a gene sequence encoding a protein at the C-terminus of a spike protein, wherein the rotavirus is fused. Can be. Preferably it is a recombinant vector comprising the nucleotide sequence of SEQ ID NO: 8 to 11.

Step (2) and step (3) include the steps of introducing the recombinant vector of step (1) into Agrobacteria; And it relates to a method for producing a PEDV vaccine comprising the step of transforming agrobacteria and plant cells.

The method for transducing the expression vector of the present invention to Agrobacteria may be appropriately applied by those skilled in the art by methods known in the art. Preferably, in the present invention, the recombinant vector of the present invention may be used in Agrobacteria tumerfaciens GV3101. Transformation was performed using the freeze-thaw method. In addition, the vaccine manufacturing method can be prepared by adding the appropriate weight% of the antigenic composition of the present invention, according to the preparation of vaccines known in the art, preferably 1 to 10% by weight relative to the total weight of the vaccine composition And preferably within 5% by weight.

As mentioned above, plant transformants producing the PEDV epitope protein and mucosal immunity adjuvant of the present invention can be used as oral vaccines to induce the formation of antibodies having neutralizing potential against PEDV, thereby preventing infection of PEDV. It can be prevented and treated.

In addition, the oral vaccine of the present invention is safe due to the possibility of animal virus contamination, and can be stored and transported for a long period of time, thus facilitating vaccine preparation and greatly reducing the cost of injection due to oral administration. have. In particular, it can be usefully used as a high value-added feed additive to replace the antibiotics that have been used to prevent the conventional pig E. coli diarrhea, through which it is expected to contribute greatly to the productivity of pig farms and the production of high quality livestock products.

Figure 1 shows the results confirmed by electrophoresis of the product COE antigen gene (430bp) obtained by the PCR reaction (A). It also shows whether the PCR product is inserted into the topo-vector (B).
Figure 2 shows the alignment (Alignmnet) of the COE antigen gene amplified by NCBI blast search.
FIG. 3 shows multiple alignments of amino sequences in PEDV by expasy.
Figure 4 shows GPRLQPY amino sequence (mCOEGY) antigen gene (469 bp) recombinant after amplification by 1% agarose gel electrophoresis of the site-specific mutant COE (mCOE) antigen gene and pENTR / D / TOPO-COE plasmid DNA. (A) which shows. Figure B shows the insertion of mCOE into the Topo-vector (gateway) of two products of 2.7 Kb and 0.28 Kb digested with BglII and EcoRV (B). Figure (C) shows the insertion of mCOE into the Topo-vector (gateway) of two products of 2.7 Kb and 0.32 Kb cleaved with NotI and BglII.
Figure 5 shows the recombinant PCR process to fuse the PEDV and rotavirus antigen gene.
Figure 6 shows agarose gel electrophoresis results of PER08 (mCOEGY ;; VP8) 874 bp and PER05 (mCOEGY ;; BVP5) 952 bp amplified by recombinant PCR (A). The insertion of PER08 into the Topo-vector (gateway) of two products, 0.47Kb and 3.1Kb, digested with BglII and HindIII. M; 1 Kb + DNA ladder marker, # 1-10; pENTR / D / TOPO-PERO8 (B). In addition, pENTR / D / TOPO-PERO5 was confirmed in the TOP10 colony by PCR (952bp). M; 1 Kb + DNA ladder marker, # 1-10; pENTR / D / TOPO-PERO5 (C). (Circle (O) means complete sequence).
7 shows a recombinant PCR process for fusion of the CTB and antigen genes.
8 shows agarose gel electrophoresis of mCOECT (CTB :: mCOE) 814bp and mCOEGYCT (CTB :: mCOEGY) 853bp propagated by recombinant PCR (A). In addition, electrophoresis results of 1357bp of PERO8CT (CTB :: mCOEGY :: VP8) and 1336bp of PERO5CT (CTB :: mCOEGY :: VP5) propagated by recombinant PCR are shown (B).
9 shows the results obtained by electrophoresis of two DNA fragments (0.55 Kb and 2.8 Kb) of pENTR / D / TOPO-mCOECT digested with BglII and HindIII. M; 1 Kb + DNA ladder marker, # 1-4; pENTR / D / TOPO-mCOECT (A). In addition, one DNA fragment (3.5Kb) of pENTR / D / TOPO-mCOEGYCT digested with HindIII was confirmed. M; 1 Kb + DNA ladder marker, # 1-5; pENTR / D / TOPO-mCOEGYCT (B). Moreover, pENTR / D / TOPO-PERO8CT (1357bp) (C) was confirmed by PCR, and pENTR / D / TOPO-PERO5CT (1336bp) (D) was confirmed. Circle O represents the complete sequence.
Figure 10 shows the result of agarose gel electrophoresis after treatment of the restriction enzyme to the pK2GW7.0 plant transformation vector. The left figure shows the 0.55Kb band, a DNA fragment obtained by cutting pK2GW7-mCOECT with BglII, and the right picture shows the 0.83Kb band, the DNA fragment obtained by cutting pK2GW7-mCOEGYCT with Hind III.
Figure 11 shows the results of PCR confirmed the gene in Agrobacterium tumer faciens GV3101. The picture on the left shows the insertion of mCOECT (814bp) and the picture on the right shows the insertion of mCOEGYCT (853bp). NC; Untransformed Agrobacterium tumerfaciens GV3101.
12 shows the result of confirming that PERO8CT was inserted into pK2GW7.0 by treating restriction enzyme BglII, and confirmed the 0.55Kb band (left figure). In addition, BglII and Xba I treatment were shown to confirm whether the PERO5CT was inserted into pK2GW7.0, and confirmed the 0.55Kb band (right picture).
Figure 13 shows the results of PCR confirmed the PERO8CT (1357bp) and PERO5CT (1357bp) gene colonies.
Figure 14 shows the antigen gene confirmed by genomic DNA PCR in the transformed carrot callus (PERO8CT (CTB :: mCOEGY :: VP8) 1357bp).
Figure 15 shows the results of RT-PCR analysis of carrot callus gene transformed with mCOECT (CTB :: mCOE), mCOEGYCT (CTB :: mCOEGY) and PERO8CT (CTB :: mCOEGY :: VP8).
16 shows the results of SDS-PAGE and Western blot analysis of transformed carrot callus. SDS-PAGE; 15% acrylamide gel, 50 ug total protein loading, C, untransformed carrot callus; M, low molecular weight protein markers; 1, COE J 1 transgenic callus; 2, COEGYCT C 5-5 transgenic callus (A). Western analysis of the transformed carrot callus using the mCOEGY polyclonal antibody is shown. C, untransformed carrot callus; 1, COE J 1 transgenic callus; 2, COEGYCT C 5-5 transgenic callus (B).
Figure 17 shows the experimental content over time in the mouse oral immune response experiment.
Fig. 18 shows results showing ELISA measurements of antibodies to mCOEGYCT in mouse serum. (A) IgG. (B) IgA. The mean of the columns except common superscripts shows a significant difference (* P <0.05).

Hereinafter, the present invention will be described in more detail with reference to the following examples. These embodiments are only for illustrating the present invention, and the scope of the present invention is not construed as being limited by these embodiments.

Example  One: PEDV  Of a single antigenic gene Cloning

1-1) Virus RNA  Extraction and cDNA  synthesis

RNA was extracted from the live vaccine of PEDV (KPEDV-9, Korea B & P) using QIAamp MinEluteVirus Spin Kit (Qiagen). 2 μl of the extracted 1 μg RNA and 50 pmol Anchored-oligo (dT) ₁₈ primer and sterile distilled water were mixed to make a total of 13 μl of solution, followed by reaction at 65 ° C. for 10 minutes. Then, add 4 µl of 5X reverse transcriptase reaction buffer, 0.5 µl of 40U protease inhibitor, 2 µl of 10 mM dNTP (Deoxynucleotide) mix, and 0.5 µl of 20U reverse transcriptase (Transcriptor First Strand cDNA Synthesis Kit, Roche). CDNA was synthesized using PCR for 5 minutes at 85 ° C.

1-2) primer  synthesis

Part of the swine epidemic diarrheal virus (PEDV) spike protein, known as antigenic, is the COE (CO-26K fragment equivalent, 15KDa) gene and the amino acid sequence (GPRLQPY) present in the c-terminal of the spike protein. Primers (SEQ ID NOS: 12-19) were prepared based on genebank searches of the National Center for Biotechnology Information, www.ncbi.nlm.gov/) (Table 1).

1-3) PCR Cloning

PCR was performed under the following conditions to obtain a COE (CO 26K equivalent) gene in the cDNA of PEDV; 1 ug PEDV cDNA, 5 μl of 10 × pfu reaction buffer, 1 μl of 10 mM dNTP, 1 μl of 100 pmol PEDs 5 ′ primer (SEQ ID NO: 12), 1 μl of 100 pmol PEDs 3 ′ primer (SEQ ID NO: 13), 0.5 μl of 2.5U pfu polymerase solgent); 95 ° C 2 minutes, 95 ° C 20 seconds, 60 ° C 40 seconds, 72 ° C 2 minutes, 72 ° C 5 minutes, 35 cycles.

The obtained PCR product was confirmed by electrophoresis using 1% TAE agarose gel (Fig. 1A). The obtained band was inserted into pENTR ^™ / D-TOPO (invitrogen) and transformed into TOP10. Plasmid DNA was isolated and identified the bands of 252bp and 2752bp expected in three colonies using Bgl II and EcoR I restriction enzymes (FIG. 1B). Three plasmid DNAs were confirmed by sequencing and confirmed nucleotide sequence information of the COE gene of the KPEDV-9 strain. NCBI BLAST based on the sequence information of KPEDV-9 COE gene showed more than 95% homology with other PEDV virus lines. In addition, the alignment regions of the KPEDV-9 COE gene and the spike protein regions of other virus strains were compared and identified for a variable region (FIGS. 2 and 3).

In addition, PCR was performed under the following conditions in order to position-specific mutation of the ATTTA sequence destabilizing mRNA of the COE gene to GTTCA according to the carrot codon preference; 20 ng pENTR / D / TOPO-COE, 5 μl 10X pfu reaction buffer, 1 μl 10 mM dNTP, 1 μl 100 pmol PEDs 5 ′ primer (SEQ ID NO: 12), 1 μl 100 pmol PEDs (mut) 5 'primer (SEQ ID NO: 14), 1 μl of 100 pmol PEDs (mut) 3 ′ primer (SEQ ID NO: 15), 1 μl of 100 pmol PEDs 3 ′ primer (SEQ ID NO: 13) and 0.5 μl of 2.5U pfu polymerase; 95 ° C 2 minutes, 95 ° C 20 seconds, 58 ° C 40 seconds, 72 ° C 2 minutes, 72 ° C 5 minutes, 35 cycles.

The mCOE (mutated COE) PCR product was electrophoresed on 1% TAE agarose gel and DNA was obtained using HiYield ^TM Gel / PCR DNA extraction kit (RBC), which was then transferred to pENTR / D / TOPO (invitrogen). After ligation, digestion with Not I and Bgl II restriction enzymes was confirmed by electrophoresis. Subsequently, the sequencing of the sequencing was requested to Cosmojintech to confirm the mutated nucleotide sequence through alignment (http://www.expasy.ch/).

In addition, PCR was performed under the following conditions to recombine GPRLQPY (GGTCCTAGACTTCAACCTTAC; SEQ ID NO: 5) to the mCOE gene; 20 ng pENTR / D / TOPO-mCOE, 5 μl 10X fu reaction buffer, 1 μl 10 mM dNTP, 1 μl 100 pmol COE (fus) 5 ′ primer (SEQ ID NO: 16), 1 μl, 100 pmol COE (fus) 3 ′ primer (SEQ ID NO: 17) 1 μl, 1 μl of 100 pmol COE (c-ter) 5 ′ primer (SEQ ID NO: 18), 1 μl of 100 pmol COE (c-ter) 3 ′ primer (SEQ ID NO: 19) and 0.5 μl of 2.5U pfu polymerase; 95 2 min, 95 ° C. 20 sec, 58 ° C. 40 sec, 72 ° C. 2 min, 72 ° C. 5 min, 35 cycles.

The mCOEGY (mutated COE GPRLQPY amino acid sequence) PCR product was subjected to electrophoresis on 1% TAE agarose gel, and then obtained DNA using HiYield ^TM Gel / PCR DNA Extraction Kit (RBC), which was then converted into pENTR / D / TOPO (invitrogen). G) After ligation, it was confirmed by electrophoresis by cutting with Bgl II and EcoR V restriction enzymes (FIG. 4A). Subsequently, the sequencing of the nucleotide sequence to Cosmojintech confirmed the recombination of the GPRLQPY amino acid sequence (SEQ ID NO: 3) through alignment (http://www.expasy.ch/).

MCOE and mCOEGY genes isolated from agarose gel were inserted into pENTR / D / TOPO vector, transformed to TOP10, plasmid DNA was extracted from colonies selected from antibiotic medium, and BglII and EcoRV were extracted from pENTR / D / TOPO-mCOE. Treatment with restriction enzymes confirmed the expected 289bp and 2717bp bands, and nucleotide sequence analysis was performed to select 9 times (FIG. 4B).

pENTR / D / TOPO-mCOEGY was treated with NotI and BglII restriction enzymes to confirm the expected bands of 320bp and 2725bp, and 3 colonies were finally selected by sequencing analysis (FIG. 4C).

Example  2: PEDV And fusion of rotavirus antigen genes Cloning

2-1) primer  synthesis

Recombinant PCR was used to prepare primers of VP8 and BVP5 (bridge VP5), which are antigens of the mCOEGY gene and rotavirus, in order to make oral vaccines in which PEDV and rotavirus are causing enteritis in pigs (SEQ ID NOs: 20 to 25). 2).

NAME SEQUENCE COEGY VP8 5 ' GACTTCAACCTTAC GGACCTGGACCT ATGTTGGATGGACC
Hinge COEGY VP8 3 ' GGTCCATCCAACAT AGGTCCAGGTCC GTAAGGTTGAAGTC
Hinge COEGY BVP5 5 ' GACTTCAACCTTAC GGACCTGGACCT ATGCAGAACACCAG
Hinge COEGY BVP5 3 ' CTGGTGTTCTGCATAGGTCCAGGACCGTAAGGTTGAAGTC fus VP8 3 ' CTATATAGGTGGAAGTCCATGGTTAATGTAATTTGTCC fus BVP5 3 ' TTAGCCGCCACTACAAATAATGGACTTCAAGTCAGCAG

2-2) Recombination PCR Cloning

In order to fuse mCOEGY and VP8, mCOEGY and BVP5, a total of four PCRs were performed under the following conditions. In addition, Hinge (GPGP) was added to have flexibility of antigen and antigen protein.

① 20ng pENTR / D / TOPO-mCOEGY, 5μl of 10X pfu reaction buffer, 1μl of 10mM dNTP, 1μl of 100pmol COE (fus) 5 ′ primer, 1μl of 100pmol mCOEGY :: VP8 3 ′ primer, 2.5U pfu polymerase 0.5 Μl.

② 20ng pENTR / D / TOPO-VP8, 5μl of 10X pfu reaction buffer, 1μl of 10mM dNTP, 1μl of 100pmol mCOEGY :: VP8 5 ′ primer, 1μl of 100pmol syn :: VP8 3 ′ primer, 2.5U pfu polymerase 0.5 Μl.

③ 20ng pENTR / D / TOPO-mCOEGY, 5μl of 10X pfu reaction buffer, 1μl of 10mM dNTP, 1μl of 100pmol COE (fus) 5 ′ primer, 1μl of 100pmol mCOEGY :: BVP5 3 ′ primer, 2.5U pfu polymerase 0.5 Μl.

④ 20 ng pENTR / D / TOPO BVP5, 5 μl of 10 × pfu reaction buffer, 1 μl of 10 mM dNTP, 1 μl of 100 pmol mCOEGY :: BVP5 5 ′ primer, 1 μl of 100 pmol syn BVP5 3 ′ primer, 0.5 μl of 2.5 U pfu polymerase; 95 ° C. 2 minutes, 95 ° C. 30 seconds, 60 ° C. 30 seconds, 72 ° C. 30 seconds, 72 ° C. 5 minutes, 30 cycles.

The PCR products obtained were electrophoresed on a 1% TAE agarose gel and DNA was obtained using HiYield ^™ Gel / PCR DNA Extraction Kit (RBC).

5 μl of 10 × pfu reaction buffer, 1 μl of 100 pmol COE (fus) 5 ′ primer, 1 μl of 100 pmol syn VP8 3 ′ primer, 0.5 μl of 2.5U pfu polymerase using DNAs ① and ② extracted from the gel as templates; PERO8 (mCOEGY :: VP8) was synthesize | combined by 95 degreeC 2 minutes, 95 degreeC 30 second, 60 degreeC 30 second, 72 degreeC 30 second, 72 degreeC 5 minutes, and 30 cycles.

5 μl of 10 × pfu reaction buffer, 1 μl of 100 pmol COE (fus) 5 ′ primer, 1 μl of 100 pmol syn BVP5 3 ′ primer, 0.5 μl of 2.5 U pfu polymerase using DNA of ③, ④ extracted from gel as a template; PERO5 (mCOEGY :: BVP5) was synthesized by performing 95 ° C 2 minutes, 95 ° C 30 seconds, 60 ° C 30 seconds, 72 ° C 30 seconds, 72 ° C 5 minutes, and 30cycles (FIG. 5).

The synthesized PERO8 and PERO5 were also ligated to pENTR / D / TOPO and identified as EcoR V, Hind III, and sequencing was confirmed by Cosmogenetech through alignment (http: //www.expa sy.ch/). .

Electrophoresis confirmed the expected band of PERO8 974bp, PERO5 952bp (Fig. 6A). The identified band was separated from the gel and inserted into pENTR / D / TOPO and transformed into TOP10. Plasmid DNA was extracted from the transformed colonies. pENTR / D / TOPO-PERO8 DNA was treated with BglII and HindIII restriction enzymes to confirm the expected bands of 469 bp and 3080 bp, and sequencing was performed to select 8 times (FIG. 6B).

PCR was performed using a TOP10 colony transformed with pENTR / D / TOPO-PERO5 as a template to confirm that 952 bp of PERO5 gene was inserted and finally, 2 colonies were selected through sequencing (FIG. 6C). .

Example  3: mucosal immune aid CTB  Fusion of genes

3-1) primer  write

As a method of antigenicity enhancement, primers (SEQ ID NOs 26 to 29) were prepared for fusing mucosal immune adjuvant CTB (Cholera toxin subunit B) to mCOE and mCOEGY, PERO8 and PERO5 (Table 3).

NAME SEQUENCE CTB 5 ' CACCATGATCAAGCTCAAGTTTGGAGTGTTCTTCACTGTG CTB mCOE 5 ' ATCAGCATGGCTAAT GGACCTGGACCT ATGGTTACTTTGC
Hinge CTB mCOE 3 ' GCAAAGTAACCAT AGGTCCAGGTCC ATTAGCCATGCTGAT
Hinge mCOE 3 ' TTAAACGTCTGTGATACCTTCAAGTGGTTTAGGCGTGCCA

3-2) Recombination PCR Cloning

In order to fuse CTB to mCOE, mCOEGY and PERO8 and PERO5 genes, the recombinants were recombined under the following conditions, and Hinge (GPGP) was added to have flexibility of the CTB and antigen proteins (FIG. 7).

① 20 ng pGEM-T easy CTB, 5 μl of 10 × pfu reaction buffer, 1 μl of 10 mM dNTP, 1 μl of 100 pmol CTB 5 ′ primer, 1 μl of 100 pmol CTB mCOE 3 ′ primer, 0.5 μl of 2.5U pfu polymerase; 95 ° C. 2 minutes, 95 ° C. 30 seconds, 60 ° C. 30 seconds, 72 ° C. 30 seconds, 72 ° C. 5 minutes, 30 cycles.

② 20 ng pENTR / D / TOPO-mCOE, 5 μl of 10X pfu reaction buffer, 1 μl of 10 mM dNTP, 1 μl of 100 pmol CTB mCOE 5 ′ primer, 1 μl of 100 pmol mCOE 3 ′ primer, 0.5 μl of 2.5U pfu polymerase; 95 ° C. 2 minutes, 95 ° C. 30 seconds, 60 ° C. 30 seconds, 72 ° C. 30 seconds, 72 ° C. 5 minutes, 30 cycles.

③ 20ng pENTR / D / TOPO-mCOEGY, 5μl of 10X pfu reaction buffer, 1μl of 10mM dNTP, 1μl of 100pmol CTB mCOE 5 ′ primer, 1μl of 100pmol COE (c-ter) 3 'primer, 2.5U pfu polymerase 0.5 Μl; 95 ° C. 2 minutes, 95 ° C. 30 seconds, 60 ° C. 30 seconds, 72 ° C. 30 seconds, 72 ° C. 5 minutes, 30 cycles.

④ 20 ng ENTR / D / TOPO-mCOEGYCT (CTB :: mCOEGY), 5 μl of 10X pfu reaction buffer, 1 μl of 10 mM dNTP, 100 μl CTB 5 ′ primer 1 μl, 100 pmol mCOEGY :: VP8 3 ′ primer 1 μl, 2.5 U pfu 0.5 μl of polymerase; 95 ° C. 2 minutes, 95 ° C. 30 seconds, 60 ° C. 30 seconds, 72 ° C. 30 seconds, 72 ° C. 5 minutes, 30 cycles.

⑤ 20ng pENTR / D / TOPO-VP8, 5μl of 10 × pfu reaction buffer, 1μl of 10mM dNTP, 1μl of 100pmol mCOEGY :: VP8 5 ′ primer, 1μl of 100pmol syn :: VP8 3 ′ primer, 2.5U pfu polymerase 0.5 μl; 95 ° C. 2 minutes, 95 ° C. 30 seconds, 60 ° C. 30 seconds, 72 ° C. 30 seconds, 72 ° C. 5 minutes, 30 cycles.

⑥ 20ng ENTR / D / TOPO-mCOEGYCT (CT B :: mCOEGY), 5μl of 10X pfu reaction buffer, 1μl of 10mM dNTP, 100pmol CTB 5 ′ primer 1μl, 100pmol mCOEGY :: BVP5 3 ′ primer 1μl, 2.5U 0.5 μl pfu polymerase; 95 ° C. 2 minutes, 95 ° C. 30 seconds, 60 ° C. 30 seconds, 72 ° C. 30 seconds, 72 ° C. 5 minutes, 30 cycles.

⑦ 20 ng pENTR / D / TOPO BVP5, 5 μl of 10 × pfu reaction buffer, 1 μl of 10 mM dNTP, 1 μl of 100 pmol mCOEGY :: BVP5 5 ′ primer, 1 μl of 100 pmol syn BVP5 3 ′ primer 0.5 μl; 95 ° C. 2 minutes, 95 ° C. 30 seconds, 60 ° C. 30 seconds, 72 ° C. 30 seconds, 72 ° C. 5 minutes, 30 cycles.

PCR products were electrophoresed on 1% TAE agarose gel, and then DNA was extracted using HiYield ^™ Gel / PCR DNA Extraction Kit (RBC). 5 μl of 10X pfu reaction buffer, 1 μl of 100 pmol CTB 5 ′ primer, 1 μl of 100 pmol mCOE 3 ′ primer, 0.5 μl of 2.5U pfu polymerase using DNA from ① and ② as templates; MCOECT (CTB :: mCOE) was synthesize | combined by 95 degreeC 2 minutes, 95 degreeC 30 second, 60 degreeC 30 second, 72 degreeC 30 second, 72 degreeC 5 minutes, and 35 cycles.

5 μl of 10 × pfu reaction buffer, 1 μl of 100 pmol CTB 5 ′ primer, 1 μl of 100 pmol COE (c-ter) 3 ′ primer, 0.5 μl of 2.5 U pfu polymerase using DNA from ① and ③ as a template; MCOEGYCT (CTB :: mCOEGY) was synthesize | combined by 95 degreeC 2 minutes, 95 degreeC 30 second, 60 degreeC 30 second, 72 degreeC 30 second, 72 degreeC 5 minutes, and 35 cycles.

The synthesized mCOECT and mCOEGYCT was ligated to pENTR / D / TOPO, identified as Bgl II, Hind III, and nucleotide sequence was requested from Cosmojintech (SEQ ID NOs. 8, 9).

5 μl of 10 × pfu reaction buffer, 1 μl of 100 pmol CTB 5 ′ primer, 1 μl of 100 pmol syn VP8 3 ′ primer, 0.5 μl of 2.5U pfu polymerase using DNA from ④ and ⑤ as a template; 95 ° C 2 min, 95 ° C 30 sec, 60 ° C 30 sec, 72 ° C 30 sec, 72 ° C 5 min, 30cycles to synthesize PERO8CT (CTB :: mCOEGY :: VP8) and DNA from ⑥, ⑦ 5 μl of 10 × pfu reaction buffer, 1 μl of 100 pmol CTB 5 ′ primer, 1 μl of 100 pmol syn BVP5 3 ′ primer, 0.5 μl of 2.5 U pfu polymerase; PERO8CT (CTB :: mCOEGY :: VP8) was synthesized by 95 ° C 2 minutes, 95 ° C 30 seconds, 60 ° C 30 seconds, 72 ° C 30 seconds, 72 ° C 5 minutes, and 30 cycles. The synthesized PERO8CT and PERO5CT were ligated to pENTR / D / TOPO and confirmed by colony PCR, and nucleotide sequences were requested from Cosmojintech (SEQ ID NOs: 10, 11).

Electrophoresis confirmed a band of expected size of 814 bp for mCOECT (CTB :: mCOE) and 853 bp for mCOEGYCT (CTB :: mCOEGY) (FIG. 8A).

PERO8CT (CTB :: mCOEGY :: VP8) had 1357 bp and PERO5CT (CTB :: mCOEGY :: BVP5) separated DNA only from the expected band of 1336 bp (FIG. 8B).

Four types of DNA thus obtained were inserted into pENTR / D / TOPO and transformed into TOP10. Plasmid DNA was extracted from the colonies formed.

pgl / D / TOPO-mCOECT DNA was treated with BglII restriction enzymes to confirm the expected bands of 556 bp and 2834 bp, and baseline 2 was finally selected (FIG. 9A).

pENTR / D / TOPO-mCOEGYCT DNA was treated with HindIII restriction enzymes to identify a band of 3429 bp, and 5 was finally selected by analyzing the nucleotide sequence (FIG. 9B). The bands of 1357bp and 1336bp were identified by PCR using TOP10 colonies of pENTR / D / TOPO-PERO8CT and pENTR / D / TOPO-PERO5CT as templates, respectively. 9D).

Example  4: For plant transformation  Vector building and Agrobacteria ( Agrobacteria ) Transformation

4-1) PEDV  Antigen and CTB  Plant transformation vector construction of fusion antigen

To transform carrots, antigen genes inserted into pENTR / D / TOPO were LR-reacted, inserted into pK2GW7.0 plant transformation vector, transformed into TOP10, colonies were selected from antibiotic medium, and plasmid DNA was extracted. pK2GW7-mCOECT treated with Bgl II restriction enzyme confirmed the expected band of 556bp and pK2GW7-mCOEGYCT treated Hind III restriction enzyme and identified the expected band of 835bp (Figure 10).

The pK2GW7 plasmid DNA, whose gene insertion was confirmed by restriction enzyme treatment, was transferred to Agrobacterium tumefaciens ( Agrobacterium). tumefaciens ) GV3101 was transformed and the colonies selected from antibiotic medium were PCR amplified gene as a template and confirmed by electrophoresis. pK2GW7-mCOECT was confirmed by PCR using a template diluted 814bp, pK2GW7-mCOEGYCT 5053 diluted colony of 853bp (Fig. 11).

4-2) PERO  Antigen and CTB Of fusion antigen Plant transformation vector construction

In order to transform carrots, antigen genes (PERO8CT, PERO5CT) contained in the pENTR / D / TOPO vector were LR-reacted, inserted into pK2GW7.0 plant transformation vector, transformed to TOP10 and selected from antibiotic medium. Plasmid DNA was extracted from the colonies formed and subjected to restriction enzyme treatment for cloning confirmation (FIG. 12). The pK2GW7 clone vector identified by restriction enzyme treatment was treated with Agrobacterium tumefaciens ( Agrobacterium). tumefaciens ) GV3101 was transformed and the insertion was confirmed by PCR using a template diluted 50-fold colonies selected from antibiotic medium (Fig. 13).

Example  5: Agrobacteria Transformation with Carrot

For the carrot transformation, Chochon 5 Village (J seedling, H seedling) and Chun Hong 5 village (S seedling) varieties were used. Carrot seeds were washed three times with 70% EtOH, sterilized with 4% finite lacquer for 30 minutes, and then washed 5 to 6 times using sterile water. Sterilized sterilized carrot seeds were cut into 0.8% Agar medium, and germinated embryonic embryos germinated for 7 days at 25 ° C dark conditions at intervals of 0.3 to 0.5 cm, followed by MS ⁺ medium (4.4 g / l MS salt w / vitamin (Duchefa), 0.1mg / l 2iP, 1mg / l 2,4-D, 3% sucrose) was incubated for 1 to 2 days. M9 medium for 2 days (6g / l Na ₂ HPO ₄ , 3g / l KH ₂ PO ₄ , 0.5g / l NaCl, 1g / l NH ₄ Cl, 0.5g / l MgSO ₄ , 2g / l glucose, 0.015g / l Agrobacteria grown in a medium added with CaCl ₂ ) antibiotics (100 μg / μl spectinomycin) were resuspended in MS ⁺ medium and co-cultivated for 2 to 10 days in carrot embryos and cancer conditions. The plant sections were then transferred to sterile strains and air dried, then suspended in liquid MS ⁺ medium for one day (25, 100 rpm, dark) to contain 400 μg / μl of carbenicillin and 100 μg / μl of kanamycin. Callus was induced after transfer to solid MS ⁺ medium.

After coculture with slices of two varieties of carrots using transformed Agrobacterium GV3101, the callus was induced in the primary selection medium to remove the remaining agrobacteria in the carrot slices and a total of 167 in the secondary selection medium were systematized. MCOECT 81 strains, mCOEGYCT 59 strains, and PERO8CT 27 strains. As a result of analyzing the transformation efficiency of carrot varieties, the transformation of Chochun varieties was high (Table 4).

Gene Cultivars of carrot Percentage of resistant callus appeared per tissue innoculated (%) Number of callus lines maintained mCOECT Jochun5chon 20.1 81 Chonhong5chon 6.5 mCOEGYCT Jochun5chon 2.3 59 Chonhong5chon 8.9 PERO8CT Jochun5chon 16.2 27 PERO5CT - - -

Example  6: PEDV  Antigen Gene Transformant Carrot Analysis

6-1) Carrot Callus genomic DNA  extraction

Callus selected with antibiotic resistance 0.5 cm ² The tissue was placed in a 1.5 ml tube and ground at room temperature using a plastic pestle. Genomic DNA was extracted using DNA extraction buffer (0.1M Tris-HCl. PH7.5, 0.5M NaCl, 50mM EDTA, 0.5% SDS) (Kang et al., 2004).

PCR was performed using primers corresponding to each gene. As a result, it was confirmed that genes were inserted in 5 of the 16 cell lines (FIG. 14).

6-2) Transgenic Carrots RT - PCR  analysis

RNA was extracted from carrot transformants selected through genomic DNA PCR analysis, cDNA was synthesized, and RT-PCR was performed for analysis at the transcript level. As a result, it was confirmed that 11 cell lines were expressed at the transcript level in a total of 15 cell lines (FIG. 15).

6-3) Plant Protein Extraction

To 50 mg of lyophilized tissue, 500 μl PBST (100 mM NaCl, 10 mM Na ₂ HPO ₄ , 3 mM KH ₂ PO ₄ pH7.2, 0.05% tween-20 (v / v), Protease Inhibitor Cocktail (Roche)) The procedure of votexing and placing on ice was repeated five times at 30 second intervals, centrifuged at 4 ° C and 14,000 rpm for 10 minutes, and only the supernatant was collected and stored at -20 ° C (Rosales-Mendoza 2010).

6-4) Weston Blot Analysis

The total protein extracted was electrophoresed using 15% SDS-PAGE and blotted onto PVDF membrane (millipore) for 2 hours at 400 mA in Trans-Blot cell (bio-rad) using transfer buffer (15% methanol). It was. The membrane was then washed for 10 minutes in TBST (100 mM Tris-Cl pH8.0, 150 mM NaCl, 0.05% Tween 20) and blocked for 1 hour with a solution containing 5% nonfat dry milk in TBST. The primary antibody was reacted for 1 hour by diluting the prepared mCOEGY polyclonal antibody in a solution containing 5% nonfat dry milk in TBST at a ratio of 1: 1,000. Washed. The secondary antibody was diluted anti-rabbit IgG (GE healthcare) at a ratio of 1: 10,000 in TBST solution for 1 hour and washed once with TBST for 15 minutes and 3 times for 5 minutes. After the reaction, the membrane was detected using an X-ray film in a dark room at room temperature using an ECL plus kit (GE healthcare company).

As a result, two bands showing differences in the mCOE and mCOEGYCT transformants and the control were identified. One band was able to confirm the band of the expected size of 16.6KDa, but unexpected band of 24KDa was confirmed in mCOEGYCT (Fig. 16). This is expected due to post-translational modifications in plants (Wee 1998; Gomord 2004).

Example  7: Rat Feed additives  Clinical Trials of Vaccine Carrots

7-1) Materials and Processing

Eight weeks old ICR mice (Orient Bio Co.) used 8 mice per group. The control group was fed general feed and non-transformed carrots, and the treated group was lyophilized by general transformation and carrot transformations of mCOEJ 1, mCOEJ 13, mCOEGYJ 5, and mCOEGYCTC 5-5 strains, and then mixed with distilled water. A total of four oral doses fed 80 mg of the sample per animal and serum was obtained 2 days before and 4 days after oral administration (FIG. 17).

7-2) Test feed and specification management

The experimental mouse feed contained protein, fat, crude fiber and the like and used gamma-sterilized PICO 5035 (Orient Bio Co., Ltd.) (Table 5). Water and feed were free vegetarian. Vaccine carrot callus was mixed with a 20 mg powder of powder and water at the time of one oral administration and fed to rats using a syringe.

7-3) ELISA Identification of antibodies by

100 ul of antigen diluted in carbonate coated buffer (0.1 M NaHCO ₃ , 0.1 M Na ₂ CO ₃ pH 9.6) and coated buffer in each well of the ELISA plate using the live PEDV distributed by Kangwon National University Each was busy. Then, the reaction was carried out at 4 ° C. for one day, and 200 μl of washing buffer (PBS + 0.1% Tween 20) was added to each well, followed by washing three times. The wells were dispensed with 200ul of blocking buffer (2% BSA (Bovine serum albumin) in PBS) and then allowed to stand at 37 ° C for 1 hour. 200 ul of wash buffer was dispensed into each well, followed by three washes, followed by diluting the hybridized anti-bovine IgA peroxidase and the hybridized anti-bovine IgG peroxidase in PBS at a 1: 8000 ratio. After reacting at 37 ° C. for 1 hour. Wash buffer was dispensed into each well of 200 ul and then washed four times. The substrate (OPD) was dispensed into each well for 100ul and then reacted for exactly 10 minutes at room temperature. Then, 50ul of stop solution was added to stop the reaction, and the absorbance was measured at 450nm with ELISA reader.

As a result, there was a significant difference in IgG and IgA between normal feed and mCOE J1, mCOEJ13, and mCOEGYJ5, but there was no significant difference between IgG and IgA in each treatment except control (normal feed) (Fig. 18). .

<110> Industry-Academic Cooperation Foundation, Dankook University <120> Transformants expressing epitope of porcine epidemic diarrhea          virus and mucosal adjuvant and vaccine composition containing the          same <130> PA100815 / KR <160> 29 <170> Kopatentin 1.71 <210> 1 <211> 142 <212> PRT <213> porcine epidemic diarrhea virus <400> 1 Thr Met Val Thr Leu Pro Ser Phe Asn Asp His Ser Phe Val Asn Ile   1 5 10 15 Thr Val Ser Ala Ala Phe Gly Gly His Ser Gly Ala Asn Leu Ile Ala              20 25 30 Ser Asp Thr Thr Ile Asn Gly Phe Ser Ser Phe Cys Val Asp Thr Arg          35 40 45 Gln Phe Thr Ile Thr Leu Phe Tyr Asn Val Thr Asn Ser Tyr Gly Tyr      50 55 60 Val Ser Lys Ser Gln Asp Ser Asn Cys Pro Phe Thr Leu Gln Ser Val  65 70 75 80 Asn Asp Tyr Leu Ser Phe Ser Lys Phe Cys Val Ser Thr Ser Leu Leu                  85 90 95 Ala Gly Ala Cys Thr Ile Asp Leu Phe Gly Tyr Pro Glu Phe Gly Ser             100 105 110 Gly Val Lys Phe Thr Ser Leu Tyr Phe Gln Phe Thr Lys Gly Glu Leu         115 120 125 Ile Thr Gly Thr Pro Lys Pro Leu Glu Gly Ile Thr Asp Val     130 135 140 <210> 2 <211> 430 <212> DNA <213> porcine epidemic diarrhea virus <220> <221> gene (222) (1) .. (430) P223 epitope gene sequence <400> 2 caccatggtt actttgccat cattcaatga tcattctttt gttaatatta ctgtctctgc 60 ggcttttggt ggtcatagtg gtgccaacct cattgcatct gacactacta tcaatgggtt 120 tagttctttc tgtgttgaca ctagacaatt taccattaca ctgttttata acgttacaaa 180 cagttatggt tatgtgtcta agtcacagga tagtaattgc cctttcacct tgcaatctgt 240 taatgattac ctgtctttta gcaaattttg tgtttcaacc agccttttgg ctggtgcttg 300 taccatagat ctttttggtt accctgagtt cggtagtggt gttaagttta cgtcccttta 360 ttttcaattc acaaagggtg agttgattac tggcacgcct aaaccacttg aaggtatcac 420 agacgtttaa 430 <210> 3 <211> 430 <212> DNA <213> Artificial Sequence <220> <223> mutant of COE gene <400> 3 caccatggtt actttgccat cattcaatga tcattctttt gttaatatta ctgtctctgc 60 ggcttttggt ggtcatagtg gtgccaacct cattgcatct gacactacta tcaatgggtt 120 tagttctttc tgtgttgaca ctagacagtt caccattaca ctgttttata acgttacaaa 180 cagttatggt tatgtgtcta agtcacagga tagtaattgc cctttcacct tgcaatctgt 240 taatgattac ctgtctttta gcaaattttg tgtttcaacc agccttttgg ctggtgcttg 300 taccatagat ctttttggtt accctgagtt cggtagtggt gttaagttta cgtcccttta 360 ttttcaattc acaaagggtg agttgattac tggcacgcct aaaccacttg aaggtatcac 420 agacgtttaa 430 <210> 4 <211> 7 <212> PRT <213> Artificial Sequence <220> <223> C-terminal region of spike protein <400> 4 Gly Pro Arg Leu Gln Pro Tyr   1 5 <210> 5 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> C-terminal region of spike gene <400> 5 ggtcctagac ttcaacctta c 21 <210> 6 <211> 495 <212> DNA <213> Rotavirus sp. <220> <221> gene (222) (1) .. (495) <223> VP8 gene <400> 6 atgttggatg gaccttatca accaacaact ttcaatcctc caataggata ctgggtgttg 60 tttgctccaa ccgttcaagg ggttgtggct gaaggaacaa acaacactag tagatggttg 120 gctattattt tggtcgaacc aaacgtgtct caggaaacta gaacatatac tatatttggt 180 caacaagttc agcttcaggt tgagaatgtt tcacaaacta aatggaaatt cattgatgtg 240 agtaagacta gtcaaggcgg tagttataca cagtacagca ccctcttgtc aaatacaaag 300 cttgatgctg tcataaagta tggaggtaaa gtgttcacat ataacggcga aactcctagt 360 gcaacttcag gtcaatacac aacaaccaac tatgaagcta tagttatgac tctcttctgg 420 gacttttata taattcctcg tacacaggag gaaacttgga caaattacat taaccatgga 480 cttccaccga tatag 495 <210> 7 <211> 474 <212> DNA <213> Rotavirus sp. <220> <221> gene (222) (1) .. (474) <223> BVP5 gene <400> 7 atgcagaaca ccaggaaggt ggtgccagtt gcactttctg ctcgagatat ttcaatatct 60 aaagcaagtg ttaatgaaga cattgttgtt tctaagactt ctctttggaa agaaatgcag 120 tacaacaggg agatgaccat taggtttaag ttcgctaacc aaataattaa atctggagga 180 ttgggttata aatggtcaga aatatccttc aaaccagcaa cctaccaata tacatatatt 240 agagatggag aagaggtcat agctcatacc acttgttcag ttaacggagt gaataatttc 300 aattacaacg ggggttcact tccaacagat tttgtgatat ctagatatga agttatcaaa 360 gagaattcat atgtgtatat agattattgg gatgattctc aagcctttaa gaatatggtt 420 tacgttagag cattagctgc tgacttgaag tccattattt gtagtggcgg ctaa 474 <210> 8 <211> 814 <212> DNA <213> Artificial Sequence <220> CTB :: mCOE (mCOECT) <400> 8 caccatgatc aagctcaagt ttggagtgtt cttcactgtg ctccttagct ctgcctatgc 60 acatggcacc ccacaaaaca tcactgactt gtgtgctgag taccataaca cccaaatcca 120 taccctcaat gacaagatct tgagctacac cgagagcctt gctggcaaga gggagatggc 180 tatcatcacc ttcaagaatg gtgctacctt ccaagtggag gtgcctggaa gccaacatat 240 tgatagccaa aagaaggcca ttgagaggat gaaggacaca cttaggattg cttacctcac 300 tgaggctaag gtggagaagc tttgtgtgtg gaacaacaag acccctcatg ctattgctgt 360 tatcagcatg gctaatggac ctggacctat ggttactttg ccatcattca atgatcattc 420 ttttgttaat attactgtct ctgcggcttt tggtggtcat agtggtgcca acctcattgc 480 atctgacact actatcaatg ggtttagttc tttctgtgtt gacactagac agttcaccat 540 tacactgttt tataacgtta caaacagtta tggttatgtg tctaagtcac aggatagtaa 600 ttgccctttc accttgcaat ctgttaatga ttacctgtct tttagcaaat tttgtgtttc 660 aaccagcctt ttggctggtg cttgtaccat agatcttttt ggttaccctg agttcggtag 720 tggtgttaag tttacgtccc tttattttca attcacaaag ggtgagttga ttactggcac 780 gcctaaacca cttgaaggta tcacagacgt ttaa 814 <210> 9 <211> 853 <212> DNA <213> Artificial Sequence <220> CTB :: mCOEGY (mCOEGYCT) <400> 9 caccatgatc aagctcaagt ttggagtgtt cttcactgtg ctccttagct ctgcctatgc 60 acatggcacc ccacaaaaca tcactgactt gtgtgctgag taccataaca cccaaatcca 120 taccctcaat gacaagatct tgagctacac cgagagcctt gctggcaaga gggagatggc 180 tatcatcacc ttcaagaatg gtgctacctt ccaagtggag gtgcctggaa gccaacatat 240 tgatagccaa aagaaggcca ttgagaggat gaaggacaca cttaggattg cttacctcac 300 tgaggctaag gtggagaagc tttgtgtgtg gaacaacaag acccctcatg ctattgctgt 360 tatcagcatg gctaatggac ctggacctat ggttactttg ccatcattca atgatcattc 420 ttttgttaat attactgtct ctgcggcttt tggtggtcat agtggtgcca acctcattgc 480 atctgacact actatcaatg ggtttagttc tttctgtgtt gacactagac agttcaccat 540 tacactgttt tataacgtta caaacagtta tggttatgtg tctaagtcac aggatagtaa 600 ttgccctttc accttgcaat ctgttaatga ttacctgtct tttagcaaat tttgtgtttc 660 aaccagcctt ttggctggtg cttgtaccat agatcttttt ggttaccctg agttcggtag 720 tggtgttaag tttacgtccc tttattttca attcacaaag ggtgagttga ttactggcac 780 gcctaaacca cttgaaggta tcacagacgt tttttcaggt tgttgtaggg gtcctagact 840 tcaaccttac taa 853 <210> 10 <211> 1357 <212> DNA <213> Artificial Sequence <220> CTB :: mCOEGY :: VP8 (PERO8CT) <400> 10 caccatgatc aagctcaagt ttggagtgtt cttcactgtg ctccttagct ctgcctatgc 60 acatggcacc ccacaaaaca tcactgactt gtgtgctgag taccataaca cccaaatcca 120 taccctcaat gacaagatct tgagctacac cgagagcctt gctggcaaga gggagatggc 180 tatcatcacc ttcaagaatg gtgctacctt ccaagtggag gtgcctggaa gccaacatat 240 tgatagccaa aagaaggcca ttgagaggat gaaggacaca cttaggattg cttacctcac 300 tgaggctaag gtggagaagc tttgtgtgtg gaacaacaag acccctcatg ctattgctgt 360 tatcagcatg gctaatggac ctggacctat ggttactttg ccatcattca atgatcattc 420 ttttgttaat attactgtct ctgcggcttt tggtggtcat agtggtgcca acctcattgc 480 atctgacact actatcaatg ggtttagttc tttctgtgtt gacactagac agttcaccat 540 tacactgttt tataacgtta caaacagtta tggttatgtg tctaagtcac aggatagtaa 600 ttgccctttc accttgcaat ctgttaatga ttacctgtct tttagcaaat tttgtgtttc 660 aaccagcctt ttggctggtg cttgtaccat agatcttttt ggttaccctg agttcggtag 720 tggtgttaag tttacgtccc tttattttca attcacaaag ggtgagttga ttactggcac 780 gcctaaacca cttgaaggta tcacagacgt tttttcaggt tgttgtaggg gtcctagact 840 tcaaccttac ggacctggac ctatgttgga tggaccttat caaccaacaa ctttcaatcc 900 tccaatagga tactgggtgt tgtttgctcc aaccgttcaa ggggttgtgg ctgaaggaac 960 aaacaacact agtagatggt tggctattat tttggtcgaa ccaaacgtgt ctcaggaaac 1020 tagaacatat actatatttg gtcaacaagt tcagcttcag gttgagaatg tttcacaaac 1080 taaatggaaa ttcattgatg tgagtaagac tagtcaaggc ggtagttata cacagtacag 1140 caccctcttg tcaaatacaa agcttgatgc tgtcataaag tatggaggta aagtgttcac 1200 atataacggc gaaactccta gtgcaacttc aggtcaatac acaacaacca actatgaagc 1260 tatagttatg actctcttct gggactttta tataattcct cgtacacagg aggaaacttg 1320 gacaaattac attaaccatg gacttccacc gatatag 1357 <210> 11 <211> 1336 <212> DNA <213> Artificial Sequence <220> CTB :: mCOEGY :: BVP5 (PERO5CT) <400> 11 caccatgatc aagctcaagt ttggagtgtt cttcactgtg ctccttagct ctgcctatgc 60 acatggcacc ccacaaaaca tcactgactt gtgtgctgag taccataaca cccaaatcca 120 taccctcaat gacaagatct tgagctacac cgagagcctt gctggcaaga gggagatggc 180 tatcatcacc ttcaagaatg gtgctacctt ccaagtggag gtgcctggaa gccaacatat 240 tgatagccaa aagaaggcca ttgagaggat gaaggacaca cttaggattg cttacctcac 300 tgaggctaag gtggagaagc tttgtgtgtg gaacaacaag acccctcatg ctattgctgt 360 tatcagcatg gctaatggac ctggacctat ggttactttg ccatcattca atgatcattc 420 ttttgttaat attactgtct ctgcggcttt tggtggtcat agtggtgcca acctcattgc 480 atctgacact actatcaatg ggtttagttc tttctgtgtt gacactagac agttcaccat 540 tacactgttt tataacgtta caaacagtta tggttatgtg tctaagtcac aggatagtaa 600 ttgccctttc accttgcaat ctgttaatga ttacctgtct tttagcaaat tttgtgtttc 660 aaccagcctt ttggctggtg cttgtaccat agatcttttt ggttaccctg agttcggtag 720 tggtgttaag tttacgtccc tttattttca attcacaaag ggtgagttga ttactggcac 780 gcctaaacca cttgaaggta tcacagacgt tttttcaggt tgttgtaggg gtcctagact 840 tcaaccttac ggacctggac ctatgcagaa caccaggaag gtggtgccag ttgcactttc 900 tgctcgagat atttcaatat ctaaagcaag tgttaatgaa gacattgttg tttctaagac 960 ttctctttgg aaagaaatgc agtacaacag ggagatgacc attaggttta agttcgctaa 1020 ccaaataatt aaatctggag gattgggtta taaatggtca gaaatatcct tcaaaccagc 1080 aacctaccaa tatacatata ttagagatgg agaagaggtc atagctcata ccacttgttc 1140 agttaacgga gtgaataatt tcaattacaa cgggggttca cttccaacag attttgtgat 1200 atctagatat gaagttatca aagagaattc atatgtgtat atagattatt gggatgattc 1260 tcaagccttt aagaatatgg tttacgttag agcattagct gctgacttga agtccattat 1320 ttgtagtggc ggctaa 1336 <210> 12 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> 5 'primer for PEDs <400> 12 caccatggtt actttgccat cattt 25 <210> 13 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> 3 'primer for PEDs <400> 13 ttaaacgtct gtgatacctt caagtgg 27 <210> 14 <211> 36 <212> DNA <213> Artificial Sequence <220> <223> 5 'primer for PEDs (mut) <400> 14 tgtgttgaca ctagacagtt caccattaca ctgttt 36 <210> 15 <211> 36 <212> DNA <213> Artificial Sequence <220> <223> 3 'primer for PEDs (mut) <400> 15 aaacagtgta atggtgaact gtctagtgtc aacaca 36 <210> 16 <211> 39 <212> DNA <213> Artificial Sequence <220> 5 'primer for COE (fus) <400> 16 caccatggtt actttgccat cattcaatga tcattcttt 39 <210> 17 <211> 39 <212> DNA <213> Artificial Sequence <220> 3 'primer for COE (fus) <400> 17 aagtctagga cccctacaac aacctgaaaa aacgtctgt 39 <210> 18 <211> 39 <212> DNA <213> Artificial Sequence <220> 5 'primer for COE (c-ter) <400> 18 acagacgttt tttcaggttg ttgtaggggt cctagactt 39 <210> 19 <211> 36 <212> DNA <213> Artificial Sequence <220> 3 'primer for COE (c-ter) <400> 19 ttagtaaggt tgaagtctag gacccctaca acaacc 36 <210> 20 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> 5 'primer for COEGY VP8 <400> 20 gacttcaacc ttacggacct ggacctatgt tggatggacc 40 <210> 21 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> 3 'primer for COEGY VP8 <400> 21 ggtccatcca acataggtcc aggtccgtaa ggttgaagtc 40 <210> 22 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> 5 'primer for COEGY BVP5 <400> 22 gacttcaacc ttacggacct ggacctatgc agaacaccag 40 <210> 23 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> 3 'primer for COEGY BVP5 <400> 23 ctggtgttct gcataggtcc aggaccgtaa ggttgaagtc 40 <210> 24 <211> 38 <212> DNA <213> Artificial Sequence <220> 3223 primer for fus VP8 <400> 24 ctatataggt ggaagtccat ggttaatgta atttgtcc 38 <210> 25 <211> 38 <212> DNA <213> Artificial Sequence <220> 3223 primer for fus BVP5 <400> 25 ttagccgcca ctacaaataa tggacttcaa gtcagcag 38 <210> 26 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> 5 'primer for CTB <400> 26 caccatgatc aagctcaagt ttggagtgtt cttcactgtg 40 <210> 27 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> 5 'primer for CTB mCOE <400> 27 atcagcatgg ctaatggacc tggacctatg gttactttgc 40 <210> 28 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> 3 'primer for CTB mCOE <400> 28 gcaaagtaac cataggtcca ggtccattag ccatgctgat 40 <210> 29 <211> 40 <212> DNA <213> Artificial Sequence <220> 3223 primer for mCOE <400> 29 ttaaacgtct gtgatacctt caagtggttt aggcgtgcca 40

Claims (15)

A recombinant vector operably linked to a gene encoding a PEDV (porcine epidemic diarrhea virus) epitope protein of SEQ ID NO: 1 and a gene encoding a mucosal immune adjuvant.
The recombinant vector of claim 1, wherein the gene encoding the PEDV epitope protein has a nucleotide sequence represented by SEQ ID NO: 2. 6.
According to claim 1, wherein the gene encoding the PEDV epitope protein has a nucleotide sequence represented by SEQ ID NO: 3.
The recombinant vector according to claim 1, wherein the gene encoding the amino acid of SEQ ID NO: 4 is fused to the gene encoding the PEDV epitope protein of SEQ ID NO: 1.
The recombinant vector of claim 4, wherein the rotavirus gene is further fused.
The recombinant vector of claim 5, wherein the rotavirus gene is a VP8 gene or a BVP5 gene.
The recombinant vector of claim 5, wherein the rotavirus gene is SEQ ID NO: 6 or 7. 7.
The recombinant vector of claim 1, wherein the mucosal immune adjuvant is CTB (Cholera toxin subunit B).
A transformant transformed with the recombinant vector of any one of claims 1 to 8.
The transformant of claim 9, wherein the transformant is selected from the group consisting of Agrobacterium, Escherichia coli or plant cells.
The tobacco plant of claim 10, wherein the plant cell is tobacco. A transformant selected from the group consisting of Arabidopsis, potato, lettuce, radish, cabbage, tomato, soybean, rice, barley, wheat, corn, and carrot.
The vaccine composition of PEDV or rotavirus comprising the transformant of any one of Claims 9-11, the protein extract of the said transformant, or the recombinant protein isolate | separated from the said transformant.
12. A feed composition for preventing or treating a PEDV or rotavirus infection comprising the transformant of any one of claims 9 to 11, a protein extract of the transformant or a recombinant protein isolated from the transformant.
12. A composition for preventing or treating PEDV or rotavirus infection comprising the transformant of any one of claims 9 to 11, a protein extract of the transformant or a recombinant protein isolated from the transformant.
(1) preparing a recombinant vector of any one of claims 1 to 8;
(2) introducing the recombinant vector of step (1) into an Agrobacteria; And
(3) A method for producing a PEDV or rotavirus vaccine fused with a mucosal immune adjuvant comprising transforming agrobacteria and plant cells in step (2).

Images