KR101680903B1 - Transformants expressing epitope of porcine epidemic diarrhea virus and rotavirus and vaccine composition containing the same - Google Patents

Abstract

The present invention relates to a recombinant vector operably linked to a gene encoding a novel PEDV (porcine epidemic diarrhea virus) epitope protein and a rotavirus gene, and a transformant transformed with the recombinant vector, a PEDV Vaccine compositions, and methods for their preparation. In addition, the transformant of the present invention can be used as an oral vaccine to induce the formation of antibodies having neutralizing activity against PEDV and rotavirus, so that PEDV and rotavirus infection can be prevented or treated, and when infected, It has a merit that can be solved by one switch. In addition, the oral vaccine of the present invention is safe because it is low in possibility of contamination with animal virus, and it is possible to store and transplant the plant transformant for a long time, thereby making it easy to manufacture a vaccine and drastically reduce cost due to injection by oral administration .

Description

FIELD OF THE INVENTION [0001] The present invention relates to a transformant expressing an epitope of a porcine epidemic diarrhea virus and a rotavirus gene, and a vaccine composition comprising the vaccine composition comprising the same,

The present invention relates to a recombinant vector operably linked to a gene encoding a novel PEDV (porcine epidemic diarrhea virus) epitope protein and a rotavirus gene, a transformant transformed with the recombinant vector, a vaccine composition comprising the transformant And a method for producing the same.

Pandemic influenza (PED) was first reported in Belgium and Britain in 1978 and has occurred in many countries producing pigs (Asia including Europe, Japan, China, and Korea) and has caused great economic losses in Europe and Asia (Pensaert 1978; Chasey 1978). PEDV, which causes swine diarrhea, mainly proliferates to small villous cells and denatures or necrosis of villous epithelial cells, accompanied by atrophy and loss of villi, resulting in absorptive disturbances and persistent positive diarrhea (Straw 2006). It causes enteritis, irrespective of the age of the pig, accompanied by severe diarrhea and dehydration, and even the mortality rate in piglets ranges from 80 to 90% (Jinghui 2005).

Pig epidemic diarrhea in Korea has been epidemic for two years since the first PED virus was isolated in 1992 and has not been clinically distinguished from TGEV (Duarte 1994). In recent years, TGE and mixed infections are more common than PED alone but occur in the winter season.

 And rotavirus is a pathogen causing severe enteritis in mammals and birds. It causes vomiting and diarrhea, leading to death due to dehydration symptoms especially when infected with infants (Yuan 2002). Rotavirus infections in pigs develop at an early age and are severely exacerbated by secondary bacterial infections.

On the other hand, antibiotics are soluble organic substances produced by microorganisms, which inhibit and destroy the growth of other microorganisms. Compounds that were originally produced only in microorganisms but now produced industrially also have antibiotic action. Although these antibiotics have been developed for medical and veterinary purposes to inhibit pathogens, they have also been shown to improve animal growth and feed efficiency, and are also used as feed additives (Sarmah 2006).

The use of antibiotics in the swine industry is more effective in reducing the mortality rate of young pigs as well as in improving growth rates and in farms with higher density due to the effect of reducing the mortality rate in poor hygiene conditions. However, since the use of indiscriminate antibiotics on livestock has raised safety concerns for humans, including increased antibiotic residues, increased resistance to bacteria, and resistance to bacterial resistance in animals, the use of antibiotics for feed additives in livestock is prohibited worldwide There is a trend.

Recently, the US Food and Drug Administration (FDA) has recommended restrictions on antibiotics that promote livestock growth, and is reviewing a ban on strong antibiotics that can affect the human body. Since the addition of antibiotics in feeds is prohibited in Korea since July 2011, it is urgent to develop feed additives that are harmless to humans and have excellent growth efficiency.

On the other hand, it is done by inoculation of a virulent vaccine, a sadoc vaccine, and a recombinant vaccine as a method of preventing disease of a human or a livestock. The live monkey vaccine and the Sadok Vaccine may cause side effects if the vaccine is weakened or killed and the proper inoculation is not carried out. A recombinant vaccine is a vaccine in which a gene having the antigenicity of a pathogen is isolated and expressed in cells of genetically engineered bacteria, yeast or mammals. Although recombinant vaccines produced in Escherichia coli have advantages of eliminating pathogen contamination and cost-effective mass production costs, the animal and plant proteins may have decreased immunity due to the difference in post-translational transformation system with Escherichia coli, and the recombinant vaccine produced by recombinant E. coli vaccine Proteins are destroyed by unfavorable conditions (Amanda and Charles 2000; Tacket 2005). Using protein expression systems of higher organisms such as plants can avoid immune degradation problems or unfavorable conditions in the field (Kong 2001; Youm 2007).

The plant oral vaccine has the advantages of easy inoculation without pain and stress and cost for production cost and low temperature transport, which makes it easy to supply in areas where medical activities are difficult, (Lamphear 2004). However, a plant vaccine is a genetically modified organism that is very useful for inserting genes in bacteria, viruses or animals to create new species. However, due to the safety of the human body due to ingestion of GMOs and genetic contamination due to GMO cultivation There is a question about environmental risk (Uzogara 2000; Conner 2003). The main trend is to make genetically modified organisms that can not progress to the next generation in order to avoid environmental risks from GMO cultivation, or to use in-vitro cultured tissues in which plant pollen can not occur (Wilkinson, 2003).

Under these circumstances, the present inventors prepared a recombinant vector by fusing a rotavirus gene to the antigen gene of a new PEDV. When the plant transformant transformed with the vector was administered to PED-infected pigs, it was confirmed that diarrhea of pigs was improved The present invention has been completed.

It is an object of the present invention to provide a recombinant vector in which a gene encoding the porcine epidemic diarrhea virus (PEDV) epitope protein of SEQ ID NO: 1 and a rotavirus gene are operably linked.

It is another object of the present invention to provide a transformant transformed with said recombinant vector.

Yet another object of the present invention is to provide a vaccine composition of PEDV or rotavirus comprising the transformant, the protein extract of the transformant or the recombinant protein isolated from the transformant.

It is still another object of the present invention to provide a feed composition for preventing or treating PEDV or rotavirus infection comprising the transformant, the protein extract of the transformant or the recombinant PEDV epitope protein isolated from the transformant, To provide a composition.

Another object of the present invention is to provide a recombinant vector comprising (1) a gene encoding a porcine epidemic diarrhea virus (PEDV) epitope protein of SEQ ID NO: 1 and a recombinant vector in which a rotavirus gene is operably linked; (2) introducing the expression vector of step (1) into Agrobacterium; And (3) transforming the Agrobacterium and the plant cell of step (2) with PEDV or a rotavirus vaccine.

In one aspect of the present invention, the present invention relates to a gene encoding a PEDV (porcine epidemic diarrhea virus) epitope protein of SEQ ID NO: 1 and a recombinant vector in which a rotavirus gene is operably linked.

The term "porcine epidemic diarrhea virus " (PEDV) in the present invention belongs to the coronaviridae family and has single-stranded RNA as a genome, about 28 Kb in length and comprises three major constituent protein spike proteins (180-220 kDa) (27-32 kDa) and the nucleocapsid protein (55-58 kDa) (Shenyang 2007). It is cultured in African green monkey kidney cells (Tryzin 2003) with similar structure to the same species, SARS coronavirus (Kim 2003; Stadler 2003;

In the present invention, the term "Spike protein" is a major constituent protein of PEDV and has a biologically important function of recognizing a target cell and fusing a virus with a cellular membrane (Chang 2002). The COE (CO-26K fragment equivalent) gene, a part of the spike protein, can be used as a neutralizing epitope.

As used herein, the term "epitope" refers to a set of amino acid residues of an antigen binding site recognized by a particular antibody, or a T cell receptor protein and / or major histocompatibility complex (MHC) Lt; / RTI > An epitope is a molecule that forms a site recognized by an antibody, T cell receptor or HLA molecule, and refers to a primary, secondary and tertiary peptide structure, or charge.

As used herein, the term "vector" refers to any medium for cloning and / or transfer of a base into a host cell. A vector can be a replicon that can bring about the replication of a joined fragment of another DNA fragment. Refers to any genetic unit (e.g., a plasmid, phage, cosmid, chromosome, or virus) that functions in vivo as an autologous unit of DNA replication, that is, . The term "vector" includes viral and non-viral mediators for introducing a base into a host cell in vitro, in vitro or in vivo. The term "vector" may also include mini-spherical DNA. For example, the vector may be a plasmid without a bacterial DNA sequence. Removal of abundant bacterial DNA sequences in the CpG region has been done to reduce transgene expression silencing and to bring about a more sustained expression from the plasmid DNA vector. The term "vector" may also include a transposon such as Sleeping Beauty (Izsvak et al., J. MoI. Biol. 302: 93-102 (2000)), or an artificial chromosome.

In the present invention, the term "rotavirus" belongs to Reoviridae and has eleven fragmented double-stranded RNAs as genomes encoding six structural proteins and six nonstructural proteins. Two envelope capsid proteins, VP4 and VP7, induce immunity independently of the attenuated antibody and can be divided into two serotypes, P (protease sensitive) and G (glycoprotein). VP4, a viral molecule surface, plays an important role in the interaction between viruses and cells, including invading receptors and cells that bind to cells. When VP4 is trypsinized, it is divided into VP5 and VP8. VP8 contains hemagglutinin of virus and VP5 has hydrophobic part inside, so that virus can penetrate into cells.

In one embodiment of the present invention, a new COE gene, PEDV epitope, was obtained from the KPEDV-9 strain, which is not a Brl / 27 strain used in the prior art, in order to clone an antigenic COE gene that is part of the PEDV spike protein.

The PEDV epitope protein of the present invention includes the amino acid sequence of SEQ ID NO: 1 and preferably has the nucleotide sequence of SEQ ID NO: 2. More preferably, the gene encoding the PEDV epitope protein may be the nucleotide sequence of SEQ ID NO: 3, wherein the 148th base of SEQ ID NO: 2 is guanine and the 151st base is modified to cytosine.

In addition, the gene encoding the PEDV epitope protein may be fused with a gene encoding a part of the protein existing at the c-terminal of the spike protein. Preferably, the gene encoding the amino acid sequence of SEQ ID NO: 4 is fused. More preferably, the nucleotide sequence shown in SEQ ID NO: 5 is fused

The rotavirus gene fused in the recombinant vector of the present invention is preferably the VP8 gene or the BVP5 gene, more preferably the gene having the nucleotide sequence of SEQ ID NO: 6 or 7.

In one embodiment of the present invention, the gene encoding the PEDV epitope COE protein of SEQ ID NO: 1, the VP8 gene of rotavirus, and the antigen conjugated with COEGY are denoted by PER08, BVP5 gene and COEGY-conjugated antigen as PER05.

Preferably, the PERO8 comprises SEQ ID NO: 22 and the PERO5 comprises the nucleotide sequence of SEQ ID NO: 23.

In yet another embodiment, the present invention relates to a transformant transformed with said recombinant vector.

More specifically, the present invention relates to a transformant transformed with a recombinant vector in which a PEDV epitope protein of SEQ ID NO: 1 and a rotavirus gene are expressed. The amino acid of SEQ ID NO: 3 may be fused to the PEDV epitope protein. That is, a gene encoding the amino acid sequence of SEQ ID NO: 1 and SEQ ID NO: 3, and a transformant transformed with a recombinant vector in which a rotavirus gene of SEQ ID NO: 6 or 7 is operably linked. Preferably a transformant in which the gene of SEQ ID NO: 22 or 23 is expressed.

The term " transformed " in the present invention means that the genetic properties of an organism are changed by exogenously given DNA, that is, DNA, which is a kind of nucleic acid extracted from a cell of a certain line of an organism, Is a phenomenon in which the genetic traits are changed by entering the cell and is sometimes referred to as transformation or transformation.

In the present invention, the term " transformant " refers to a transgenic plant or a transgenic animal produced by transformation, and includes a gene recombinant produced by inducing transformation or mutation of a specific gene using a gene recombination technique do. Preferably, the transformant of the present invention may be a transformant derived from a plant cell.

In the present invention, the term " plant cell " is a basic unit constituting a plant, and may be a cultured cell of a plant tissue, a cultured tissue, a culture organ or a whole plant and is preferably a cultured cell, More preferably all possible forms of cultured cells, most preferably carrot-derived cells.

The term " plant tissue " is used herein to refer to a tissue of a differentiated or undifferentiated plant, such as but not limited to roots, stems, leaves, pollen, seeds, cancer tissues, I. E., Single cells, protoplasts, shoots and callus tissue. The plant tissue may be in planta or may be in an organ culture, tissue culture or cell culture.

As used herein, the term "recombinant" refers to a cell in which a cell replicates a heterologous nucleic acid, expresses the nucleic acid, or expresses a protein encoded by a peptide, heterologous peptide or heterologous nucleic acid. The recombinant cell can express a gene or a gene fragment that is not found in the natural form of the cell in one of the sense or antisense form. In addition, the recombinant cell can express a gene found in a cell in a natural state, and the gene has been re-introduced into the cell by an artificial means as a modification. In one embodiment of the present invention, a vector encoding a PEDV epitope protein and a gene encoding a partial sequence of a spike protein are fused and a vector operatively linked with an antigen to which a part of the sequence of rotavirus is bound is prepared. A transformant obtained by transforming the vector was prepared. The transformant of the present invention can be appropriately selected and used by a person skilled in the art without limitation as long as it is a cell which can be used for transformation known in the art, and the transformant of the present invention can be transformed into Agrobacterium, Escherichia coli or Transgenic plant And preferably the transformant may be a plant cell and more preferably a group consisting of tobacco, Arabidopsis, potatoes, lettuce, radishes, cabbage, tomatoes, beans, rice, barley, wheat, corn and carrots , And most preferably the transformant is transformed into carrots.

In another aspect, the present invention relates to a vaccine composition of PEDV or rotavirus comprising a transformant of the present invention, a protein extract of the transformant, or a recombinant PEDV epitope protein isolated from the transformant.

In the present invention, the terms " transformant " and " PEDV epitope protein " are as described above.

The term " vaccine " in the present invention refers to a biological agent containing an antigen that immunizes a living body, and refers to an immunogen or an antigenic substance that causes immunity to a living body by injection or oral administration to a human or animal for the prevention of infection . In vivo immunity is largely divided into autoimmunity, which is obtained automatically in vivo after infection with pathogenic bacteria, and passive immunization, which is obtained by externally injected vaccine. While autoimmunity has long duration of immune-related antibodies and is characterized by persistent immunity, passive immunization by vaccine acts immediately for the treatment of infectious diseases but has a disadvantage that its persistence is poor.

The term " immunogen " or " antigenic substance " in the present invention refers to a group consisting of a peptide, a polypeptide, a lactic acid bacterium expressing the polypeptide, a protein, a lactic acid bacterium expressing the protein, an oligonucleotide, a polynucleotide, a recombinant bacterial and a recombinant virus And is selected. As a specific example, the antigenic substance may be in the form of an inactivated whole or partial cytostatic form, or an antigenic molecule obtained by conventional protein purification, genetic engineering techniques or chemical synthesis. Preferably, the antigenic substance of the present invention may be PEDV which induces epidemic diarrhea in a pig, more preferably a gene sequence encoding the PEDV-derived COE protein and a gene sequence located at the C-terminus of the spike protein are fused A sequence encoding VP8 and BVP5 that exhibits antigenicity of the rotavirus to the antigen may be operatively linked, and most preferably a gene encoding the amino acid sequence of SEQ ID NO: 1 and a gene encoding the amino acid sequence of SEQ ID NO: 3 are fused Or an antigen fused with a rotavirus sequence represented by SEQ ID NO: 5 or SEQ ID NO: 6.

The content of the antigen may be 1 to 10 wt%, preferably 5 wt% or less, based on the total weight of the vaccine composition.

The vaccine composition according to the present invention can be used as a stabilizer, emulsifier, aluminum hydroxide, aluminum phosphate, pH adjuster, surfactant, liposome, iscom adjuvant, synthetic glycopeptide, extender, carboxypolymethylene, bacterial cell wall, (2-hydroxyethyl) -propanediamine, monophosphoryl lipid, < RTI ID = 0.0 > A, dimethyl dioctadecyl-ammonium bromide, and mixtures thereof. The second auxiliary agent may further comprise at least one second auxiliary selected from the group consisting of A, dimethyl dioctadecyl-ammonium bromide, and mixtures thereof.

In addition, the vaccine composition of the present invention may comprise a veterinarily acceptable carrier. The term "veterinarily acceptable carrier" in the present invention includes any and all solvents, dispersion media, coating agents, adjuvants, stabilizers, diluents, preservatives, antibacterial and antifungal agents, isotonic agents, Examples of the carrier, excipient and diluent which can be contained in the composition include lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, maltitol, starch, glycerin, starch, acacia rubber, alginate, gelatin, calcium phosphate, calcium silicate, Cellulose, methylcellulose, microcrystalline cellulose, polyvinylpyrrolidone, water, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate and mineral oil.

In addition, the vaccine composition of the present invention can be formulated in the form of powders, granules, tablets, capsules, suspensions, emulsions, syrups, aerosols and the like in the form of oral preparations and sterilized injection solutions according to a conventional method. In the case of formulation, it may be prepared using diluents or excipients such as fillers, extenders, binders, wetting agents, disintegrants, surfactants and the like which are usually used. Solid formulations for oral administration include tablets, pills, powders, granules, capsules and the like, which may contain at least one excipient such as starch, calcium carbonate, sucrose, sucrose, lactose, gelatin and the like. In addition to simple excipients, lubricants such as magnesium stearate talc may also be used. As the liquid preparation for oral administration, suspensions, solutions, emulsions, syrups and the like may be used. In addition to water and liquid paraffin which are commonly used simple diluents, various excipients such as wetting agents, sweeteners, . Formulations for non-oral administration include sterilized aqueous solutions, non-aqueous agents, suspensions, emulsions, and freeze-drying agents. As the non-aqueous preparation and suspension, propylene glycol, polyethylene glycol, vegetable oil such as olive oil, injectable ester such as ethyl oleate, and the like can be used.

The present invention also relates to a method for enhancing the antibody production rate to an antigen by injecting the vaccine composition into an animal other than human.

In the present invention, the term "animal excluding human being" is a mammal or a bird. The "infusion" Administration and oral administration of the compound of the present invention. Preferably, the vaccine of the invention may be an oral vaccine.

The term "injection" or "administration" in the present invention means that the dosage may vary depending on the age, sex, body weight, etc. of the subject to be administered and depending on the route of administration, degree of disease, sex, It can be different. The vaccine enhancer of the present invention can be used together with a vaccine by parenteral, mucosal (oral and nasal) and transdermal routes. In one embodiment of the present invention, the vaccine prepared as an antigen of the present invention was administered to pigs infected with PEDV, and the presence of PEDV infection through diarrhea index, antibody titer, and dissection was examined. As a result, Diarrhea was alleviated in the treated group, antibody titers were elevated, and visual examination through dissection showed relieving symptoms of PEDV infection. This effect was confirmed to be further enhanced when the administration of the PEDV vaccine of the present invention and the transgenic carrot transformed with the antigen were administered simultaneously.

In another aspect, the present invention relates to a feed composition for preventing or treating PED V or rotavirus infection comprising the transformant of the present invention.

In the present invention, the term " prophylactic " refers to a method of inhibiting or delaying the infection of PEDV or rotavirus by administration of a PEDV epitope protein of the present invention and a transformant expressing rotavirus or a composition comprising the transformant as an active ingredient Every act is called.

In the present invention, the term " treatment " refers to the administration of a PEDV epitope protein of the present invention and a transformant expressing rotavirus, or a composition containing the transformant as an active ingredient, to ameliorate symptoms of PEDV or rotavirus infection All activities that

The feed composition used in the present invention may be suitably constituted by those skilled in the art in various forms of composition known in the art including the feed additive according to the present invention as an active ingredient, preferably 20% of protein, A feed composition comprising 4.5% of extract, 5.4% of fat, acid hydrolysis, 4.7% of crude fiber, 6% of ash, 0.80% of calcium and 0.62% of phosphate.

The present invention also provides a composition for preventing or treating PEDV or rotavirus infection comprising the transformant of the present invention, the protein extract of the transformant or the recombinant protein isolated from the transformant, .

The feed additive composition of the present invention can be prepared in various forms known in the art, and preferably comprises a PEDV antigen and a part of a rotavirus gene transformed with a transformant. Lt; / RTI >

The feed additives according to the present invention can be used individually and can be used in combination with conventionally known feed additives and can be used sequentially or simultaneously with conventional feed additives. And can be administered singly or multiply. It is important to take into account all of the above factors and to administer the amount in which the maximum effect can be obtained in a minimal amount without adverse effect, and can be easily determined by those skilled in the art.

The individual to which the feed composition of the present invention can be applied is not particularly limited, and any form can be applied. For example, the present invention is applicable to animals such as chicken, pig, monkey, dog, cat, rabbit, guinea pig, rat, mouse, cattle, sheep, goat, The diarrhea index was decreased, the antibody titer to PEDV was increased, and the PEDV infection symptom was alleviated even by visual inspection through dissection.

In another aspect, the present invention provides a method for producing a recombinant vector comprising the steps of: (1) preparing a recombinant vector operably linked to a gene encoding a porcine epidemic diarrhea virus (PEDV) epitope protein of the present invention and a rotavirus gene; (2) introducing the expression vector of step (1) into Agrobacterium; And (3) transforming Agrobacteria and plant cells of step (2) above.

The terms " PEDV ", " epitope protein " and " rotavirus gene "

Also, the term " operably linked " in the present invention is as described above.

The above step (1) relates to a step of producing a recombinant vector in which a gene coding for porcine epidemic diarrhea virus (PEDV) epitope protein of the present invention and a rotavirus gene are operably linked. The gene coding for the PEDV (porcine epidemic diarrhea virus) epitope protein can be selected without limitation as long as it contains a sequence having PEDV antigenicity, preferably a nucleotide sequence shown in SEQ ID NO: 2, The gene may be that the 148th base is guanine, and the 151th base is a cytosine. In addition, the rotavirus gene may be suitably modified and selected by a person skilled in the art if it is a sequence having the antigenicity of rotavirus, and may preferably be a rotavirus VP8 gene or a BVP5 gene. More preferably, 5, and the BVP5 gene may comprise the nucleotide sequence of SEQ ID NO: 6.

Wherein step (2) and step (3) comprise introducing the expression vector of step (1) into Agrobacterium; And transforming the Agrobacterium and the plant cell with a PEDV vaccine.

The method of transforming the expression vector of the present invention into Agrobacterium can be suitably modified by those skilled in the art by a method known in the art. Preferably, the recombinant vector of the present invention is introduced into Agrobacterium tumefaciens GV3101 freeze-thaw method. In addition, the vaccine may be prepared by adding the antigen composition of the present invention to the vaccine composition in an appropriate weight%, preferably 1 to 10% by weight based on the total weight of the vaccine composition, And preferably less than 5% by weight.

The PEDV epitope protein of the present invention and the plant transformant transformed with the rotavirus antigen can be used as an oral vaccine to induce antibody formation having neutralizing activity against PEDV and rotavirus, thereby preventing infection with PEDV or rotavirus And at the same time, it can be effectively used for controlling diarrhea when infected. In addition, since the tissue is still before the formation of the tissue, there is an advantage that the problem that can be influenced by the plant growth by the introduced foreign gene is solved. In addition, the oral vaccine of the present invention is safe because it is low in possibility of contamination with animal virus, and it is possible to store and transplant the plant transformant for a long period of time, so that the vaccine can be easily manufactured and the cost of the inoculation by injection can be drastically reduced .

FIG. 1 shows the result of electrophoresis of the COE antigen gene (430 bp) obtained by PCR reaction (A). It also indicates whether the PCR product is inserted into the topo-vector (B).
Figure 2 shows the alignment of the COE antigen gene amplified by NCBI blast detection.
Figure 3 is a diagram showing multiple alignments of amino sequences in PEDV by expasy.
FIG. 4 shows the results of the amplification of the locus-specific mutant COE (mCOE) antigen gene by 1% agarose gel electrophoresis and pENTR / D / TOPO-COE plasmid DNA, followed by the GPRLQPY amino acid sequence (mCOEGY) antigen gene (469 bp) recombinant (A). Fig. (B) showing the insertion of mCOE into the topo-vector (gateway) of the two products of 2.7 Kb and 0.28 Kb digested with Bgl II and EcoR v. (C) showing insertion of mCOE into topo-vector (gateway) of two products of 2.7 Kb and 0.32 Kb cut with Not I and Bgl II.
FIG. 5 shows the results of electrophoresis of the COE antigen gene (430 bp) obtained by PCR reaction (A). It also indicates whether the PCR product is inserted into the topo-vector (B).
Figure 6 shows agarose gel electrophoresis results of 974 bp and PER05 (mCOEGY :: BVP5) of PER08 (mCOEGY :: VP8) amplified by recombinant PCR (A). (B) of 0.47 and 3.1 Kb DNA fragments of pENTR / D / TOPO-PER08 digested with BglII and HindIII. M; 1 Kb + DNA marker, # 1-10; In the TOP10 colony, pENTR / D / TOPO-PER08. The detection of pENTR / D / TOPO-PER05 by PCR in TOP10 colonies was confirmed. M; 1 Kb + DNA marker, # 1-10; In the TOP10 colony, pENTR / D / TOPO-PER05. The red circle (O) represents the entire sequence.
FIG. 7 shows the results of confirming that PERO8 was inserted into pK2GW7.0 by treating Spe I with restriction enzyme, and confirmed bands of 0.6 Kb and 0.15 Kb.
8 is a diagram showing the results of colony PCR of the structural gene of Agrobacterium tumefaciens GV3101. Insertion result of PER05 (952bp).
Figure 9 shows the results of the expression of mCOEGY antigen in E. coli. The band of 4.2 Kb and 0.9 Kb was confirmed in pENTR / SD / D-topo (gateway) by treating the restriction enzyme Mlu I.
Fig. 10 shows the result of confirming the expression of mCOEGY in the pDEST expression system of Escherichia coli (A). The antiserum of mCOEGY was identified by Western analysis (B).
Fig. 11 shows the structure of VP4 antigen expression in E. coli. The band of 3.8 Kb and 265 bp was confirmed in pENTR / SD / D-topo (gateway) by treating the restriction enzyme EcoRv.
12 shows the results of confirming the expression of VP4 in the pDEST expression system of Escherichia coli (A). The antiserum of VP4 was confirmed by Western analysis (B).
13 shows a model of an antigen gene introduced from carrot callus transformed by genomic DNA PCR. PER08 (mCOEGY :: VP8) 973 bp.
Figure 14 shows results of RT-PCR analysis of carrot callus genes transformed with PERO8 (mCOEGY :: VP8).

Hereinafter, the present invention will be described in more detail with reference to the following examples. These embodiments are only for illustrating the present invention, and the scope of the present invention is not construed as being limited by these embodiments.

Example 1: Cloning of PEDV single antigen gene

1-1) Extraction of virus RNA and cDNA synthesis

RNA was extracted from the PEDV's virulence vaccine (KPEDV-9, Koryo Biotech) using QIAamp MinEluteVirus Spin Kit (Qiagen). 2 μl of extracted 1 μg RNA and 50 pmol Anchored-oligo (dT) ₁₈ primer and sterile distilled water were mixed to make a total of 13 μl of the solution, followed by reaction at 65 ° C for 10 minutes. Then, 4 μl of 5X reverse transcriptase reaction buffer, 0.5 μl of 40 U protease inhibitor, 2 μl of 10 mM dNTP (Deoxynucleotide) mix and 0.5 μl of 20 U reverse transcriptase (Transcriptor First Strand cDNA Synthesis Kit, Roche) CDNA was synthesized by PCR at 85 ° C for 5 minutes.

1-2) Primer Synthesis

(COD-26K fragment equivalent, 15KDa), which is part of the pandemic influenza virus (PEDV) spike protein and known to be antigenic, and the amino acid sequence (GPRLQPY) at the c-terminal of the spike protein are selected as antigens and NCBI Primers (SEQ ID NOS: 8 to 15) were prepared based on the gene bank search of National Center for Biotechnology Information, www.ncbi.nlm.gov/ (Table 1).

1-3) PCR Cloning

PCR was performed under the following conditions to obtain COE (CO 26K equivalent) gene from PEDV cDNA; 1 μg PEDV cDNA, 5 μl of 10 × pfu reaction buffer, 1 μl of 10 mM dNTP, 1 μl of 100 pmol PEDs 5 'primer (SEQ ID NO: 8), 1 μl of 100 pmol PEDs 3' primer solgent); 95 ° C for 2 minutes, 95 ° C for 20 seconds, 60 ° C for 40 seconds, 72 ° C for 2 minutes, 72 ° C for 5 minutes, 35 cycles.

The obtained PCR product was confirmed by electrophoresis using 1% TAE agarose gel (FIG. 1A). The resulting band was inserted into pENTR ^TM / D-TOPO (Invitrogen) and transformed into TOP10. Plasmid DNA was isolated and the expected sizes of 252 bp and 2752 bp in three colonies were confirmed using Bgl II and EcoR I restriction enzymes (Fig. 1B). Sequence analysis of the 3 confirmed plasmid DNAs was performed to confirm the nucleotide sequence information of the COE gene of KPEDV-9 strain. Based on the nucleotide sequence information of KPEDV-9 COE gene, NCBI BLAST showed 95% or more homology with other PEDV virus strains. In addition, the amino acid sequences of the KPEDV-9 COE gene and the other viral spike protein regions were aligned and analyzed to confirm the variable region (FIGS. 2 and 3).

In order to mutate the ATTTA sequence which makes the COE gene mRNA unstable to position-specific mutation with GTTCA in accordance with the carrot codon preference, PCR was carried out under the following conditions; 5 μl of 10 nM dNTP, 1 μl of 100 pmol PEDs 5 'primer (SEQ ID NO: 8), 1 μl of 100 pmol PEDs (mut) 5' primer (SEQ ID NO: 10) 1 mu l of 100 pmol PEDs (mut) 3 'primer (SEQ ID NO: 9), 1 mu l of 100 pmol PEDs 3' primer (SEQ ID NO: 11) and 0.5 mu l of 2.5 U pfu polymerase; 95 ° C for 2 minutes, 95 ° C for 20 seconds, 58 ° C for 40 seconds, 72 ° C for 2 minutes, 72 ° C for 5 minutes, 35 cycles.

The mCOE (mutated COE) PCR product was electrophoresed on 1% TAE agarose gel and DNA was obtained using HiYield ^™ Gel / PCR DNA extraction kit (RBC). The DNA was obtained from pENTR / D / TOPO (Invitrogen) After ligation, Not I and Bgl II restriction enzymes were cleaved and confirmed by electrophoresis. Subsequently, mutagenized nucleotide sequences were identified through alignment (http://www.expasy.ch/) by asking for the nucleotide sequence analysis in Cosmogin Tech.

In order to recombine GPCRQPY (GGTCCTAGACTTCAACCTTAC; SEQ ID NO: 5) in the mCOE gene, PCR was carried out under the following conditions; (SEQ ID NO: 13), 100 μl of COE (fus) 3 'primer (SEQ ID NO: 13), 1 μl of 10 mM dNTP, 1 μl of 100 pmol COE (c-ter) 5 'primer (SEQ ID NO: 14), 1 μl of 100 pmol COE (c-ter) 3' primer (SEQ ID NO: 15) and 0.5 μl of 2.5 U pfu polymerase; 95 2 minutes, 95 ° C for 20 seconds, 58 ° C for 40 seconds, 72 ° C for 2 minutes, 72 ° C for 5 minutes, 35 cycles.

The PCR product was electrophoresed on 1% TAE agarose gel and DNA was obtained using HiYield ^™ Gel / PCR DNA Extraction Kit (RBC). The DNA was obtained from pENTR / D / TOPO (Invitrogen / After cleavage with Bgl II and EcoR V restriction enzymes, it was confirmed by electrophoresis (FIG. 4A). Then, the sequence of the GPRLQPY amino acid sequence (SEQ ID NO: 3) was confirmed by alignment (http://www.expasy.ch/).

The mCOE and mCOEGY genes isolated from the agarose gel were inserted into the pENTR / D / TOPO vector and TOP10 was transformed. The plasmid DNA was extracted from the colonies selected in the antibiotic medium. PENTR / D / TOPO-mCOE was digested with BglII and EcoRV restriction enzyme After the treatment, the expected 289 bp and 2717 bp bands were identified and the sequence number 9 was finally selected (FIG. 4B).

pENTR / D / TOPO-mCOEGY was treated with NotI and BglII restriction enzymes to confirm the predicted bands of 320 bp and 2725 bp, and three colonies were finally selected (FIG. 4C).

Example 2: PEDV and rotavirus antigen gene fusion and cloning

2-1) Primer Synthesis

Primers (SEQ ID NOS: 16 to 21) were prepared to fuse the mCOEGY gene and the antigens of the rotavirus VP8 and BVP5 (bridge VP5) by recombinant PCR, respectively, in order to prepare a fusion oral vaccine of PEDV and rotavirus causing enteritis in pigs (Table 2).

2-2) Recombinant PCR cloning

In order to fuse mCOEGY and VP8, mCOEGY and BVP5, four PCRs were performed under the following conditions. In addition, a hinge (GPGP) was added to allow flexibility of antigen and antigen proteins.

1 μl of 10 nM pENTR / D / TOPO-mCOEGY, 10 × fu reaction buffer, 1 μl of 10 mM dNTP, 1 μl of 100 pmol COE (fus) 5 'primer, 1 μl of 100 pmol mCOEGY :: VP8 3' primer, 2.5 U pfu polymerase 0.5 / RTI >

5 μl of 20 ng pENTR / D / TOPO-VP8, 10 × fu reaction buffer, 1 μl of 10 mM dNTP, 1 μl of 100 pmol mCOEGY :: VP8 5 'primer, 1 μl of 100 pmol syn :: VP8 3' primer, 2.5 U pfu polymerase 0.5 / RTI >

3 μl of a 100 pmol mCOEGY :: BVP5 3 'primer, 2.5 μl of pfu polymerase 0.5 (1 μl), 1 μl of 10 mM dNTP, 1 μl of a 100 pmol COE (fus) / RTI >

5 μl of 10 mM dNTP, 1 μl of 100 pmol mCOEGY :: BVP5 5 'primer, 1 μl of 100 pmol syn BVP5 3' primer, 0.5 μl of 2.5 U pfu polymerase; 95 ° C for 2 minutes, 95 ° C for 30 seconds, 60 ° C for 30 seconds, 72 ° C for 30 seconds, 72 ° C for 5 minutes, 30 cycles. The obtained PCR products were electrophoresed on 1% TAE agarose gel and DNA was obtained using HiYield ^™ Gel / PCR DNA extraction kit (RBC).

5 μl of 10 × fu reaction buffer, 1 μl of 100 pmol COE (fus) 5 'primer, 1 μl of 100 pmol syn VP8 3' primer and 0.5 μl of 2.5 U pfu polymerase using the DNA of the ① and ② extracted from the gel as templates, PERO8 (mCOEGY :: VP8) was synthesized by 95 ° C for 2 minutes, 95 ° C for 30 seconds, 60 ° C for 30 seconds, 72 ° C for 30 seconds, and 72 ° C for 5 minutes.

5 μl of 10 × fu reaction buffer, 1 μl of 100 pmol COE (fus) 5 'primer, 1 μl of 100 pmol syn BVP5 3' primer and 0.5 μl of 2.5 U pfu polymerase using ③ and ④ DNA extracted from the gel as templates, PERO5 (mCOEGY :: BVP5) was synthesized (Figure 5) by 95 ° C for 2 minutes, 95 ° C for 30 seconds, 60 ° C for 30 seconds, 72 ° C for 30 seconds, and 72 ° C for 5 minutes.

Was confirmed by: (//www.expa sy ch / http. ) And the combined PERO8 PERO5 be confirmed by EcoR V, Hind III and ligated in the pENTR / D / TOPO and request analyzing sequences to Tec triangular course this alignment .

 Through electrophoresis, a predicted band of 974 bp for PERO8 and 952 bp for PERO5 was confirmed (Fig. 6A). The identified band was separated from the gel and inserted into pENTR / D / TOPO and transformed into TOP10. Plasmid DNA was extracted from the transformed colonies. The pantR / D / TOPO-PERO8 DNA was digested with BglII and HindIII restriction enzymes, and the expected bands of 469 bp and 3080 bp were identified and sequenced 8 was finally selected (Fig. 6B).

PCR was performed using TOP10 colonies transformed with pENTR / D / TOPO-PERO5 as a template. As a result, it was confirmed that 952 bp of PERO5 gene was inserted. Finally, 2 colonies were selected through sequencing (FIG. 6C) .

Example  3: For plant transformation  Vector construction and Agrobacteria  Transformation

Antigen genes (PERO8, PERO5) contained in the pENTR / D / TOPO vector were LR-reacted and inserted into the pK2GW7.0 plant transformation vector and transformed into TOP10 and selected in the antibiotic medium. Plasmid DNa was extracted from the formed colony and subjected to restriction enzyme treatment to confirm cloning (FIG. 7). The pK2GW7 clone vector confirmed by restriction enzyme treatment was designated as Agrobacterium tumefaciens GV3101, and inserted into a 50-fold diluted template colony selected from the antibiotic medium (Fig. 8A and B).

Example  4: Agrobacteria Carrot transformation using

For the transformation of carrots, five cultivars of Chochun (J Jongmyo, H Jongmyo) and 5 Chunghong (S Jongmyo) varieties were used. The carrot seeds were washed 3 times with 70% EtOH, disinfected with 4% finite rock for 30 minutes, and then washed 5 ~ 6 times with sterilized water. The tooth shape of a carrot disinfecting seed in 0.8% Agar medium after cutting the hypocotyl were germinated seven days at 25 ℃ dark conditions with 0.3 ~ 0.5㎝ intervals MS ⁺ medium (4.4g / ℓ MS salt w / vitamin (Duchefa Co.), 0.1 mg / l 2iP, 1 mg / l 2,4-D, 3% sucrose) for 1 to 2 days. 2 days of M9 medium _{(6g / ℓ Na 2 HPO 4} , 3g / ℓ KH 2 PO 4, 0.5g / ℓ NaCl, 1g / ℓ NH 4 Cl, 0.5g / ℓ MgSO 4, 2g / ℓ glucose, 0.015g / ℓ CaCl ₂₎ the antibiotic (100㎍ / ㎖ spectinomycin) to the re-suspended to 2 days co-culture a carrot a 5 ~ 10 minutes at hypocotyl and dark conditions incubated after the plant fragments Agrobacteria grown in culture medium was added to MS ⁺ medium After transferring to sterilized species and air-drying, the cells were transferred to solid MS ⁺ medium containing 400 μg / ml of carbenicillin and 100 μg / ml of kanamycin in a liquid suspension of MS ⁺ medium for one day (25 ° C., 100 rpm, Callus.

The transformed Agrobacteria GV3101 was co-cultured with the sections of two different carrots, and callus was induced in the primary selection medium and total 53 in the secondary selection medium to remove the remaining Agrobacteria in the carrot slice PERO8 26 system, PERO8 CT system 27). Analysis of the transformation efficiency of carrot cultivars showed that the transformation of Chochun cultivar was high (Table 3).

Example  5: PEDV Antigen protein ( mCOEGY Production and antibody production

5-1) Antigen protein  Construction of expression vector

MCOEGY, an antigen gene, was cloned into pENTRTM / SD / D-TOPO (Invitrogen) using a gateway system with ribosome binding site (RBS) and LR clonase II (Invitrogen) Was inserted into the expression vector GatewayDEST14TMvector and transformed into BL21-AlTM (Invitrogen) and confirmed as a restriction enzyme (Fig. 9A). Plasmid DNA was extracted from the identified colonies and subjected to LR reaction to the destination vector pDEST14 vector. The plasmid was then transformed into TOP10 and BL21, and the plasmid was extracted from the colonies selected from the antibiotics. Cloning was confirmed using restriction enzymes (FIGS. 9B and C).

5-2) Expression and isolation of Escherichia coli antigen

A single colony of BL21 with pDEST14-mCOEGY was inoculated into 5 ml of LB containing antibiotics (100 μg / μl of ampicillin) overnight, re-inoculated in 50 ml of LB medium at 1/25 ratio to 20% L-arabinose was treated to a final concentration of 0.2% and grown for 4 hours. Escherichia coli cultured for 4 hours was centrifuged at 5000 rpm, and only the precipitate was harvested. 40 ml of 2X sample buffer was added, boiled for 10 minutes, and confirmed by SDS-PAGE.

The mass-produced proteins were separated by size through SDS-PAGE, and the 16.6 kDa band was finely pulverized using a mortar and placed in a diffusion buffer (50 mM Tris-Cl pH 8.0, 0.1% SDS) Lt; 0 > C for 2 days to allow proteins to come out of the gel. After centrifugation at 4 ° C and 5000 rpm for 30 minutes, only the supernatant was recovered. The supernatant was recovered by adding 4 times acetone at -20 ° C for more than 3 hours and then centrifuged again to dissolve the precipitate in PBS (Phosphate-Buffer Saline) buffer. The obtained protein was quantified by BCA method (Bicinchoninic Acid Protein Assay Kit, Sigma). As a result, mCOEGY protein expression of 16.6 KDa was confirmed (FIG. 10A).

5-3) Polyclonal  Antibody production

After mixing 70 μg mCOEGY protein purified from SDS-PAGE gel with 1: 1 volume of Freud`s adjuvant, intramuscular injection and subcutaneous injection of complete Freud's adjuvant once into the rabbit were performed twice and incomplete Freund`s adjuvant Were mixed and injected in the same amount. Blood was collected before the inoculation. After 3 inoculations, the rabbits were anesthetized and cardiac blood was collected. The obtained blood was stored at room temperature for one day, and then the serum was isolated, freeze-dried and stored at -70 ° C.

Anticipated mCOEGY protein was detected at 10 ug and 1 ug of purified mCOEGY at 16.6KDa only in the antiserum of rabbit after inoculation with Western blotting using anti-serum and anti-serum of rabbits before inoculation. (Fig. 10B).

Example 6 Production of Rotavirus Antigen Protein and Production of Antibody

6-1) Antigen protein  Construction of expression vector

The antigen gene VP4 (including both BVP5 and VP8) was cloned into pENTR ^™ / SD / D-TOPO (Invitrogen) using a gateway system with ribosome binding site (RBS) and LR clonase II (Invitrogen) And inserted into the E. coli expression vector GatewayDEST14 ^TM vector, which was transformed into BL21-Al ^™ (Invitrogen) and identified as a restriction enzyme.

The rotavirus antigen protein VP4 was inserted into pENTR / SD / D-TOPO and ligated to TOP10, followed by cloning with a restriction enzyme (Fig. 11A). Plasmid DNA was extracted from the identified colonies, and the plasmid was transformed into BL21 after the LR reaction with the destination vector pDEST14. The plasmid was extracted from the colonies selected from the antibiotics and cloned using restriction enzymes (FIG. 11B) .

6-2) Expression and isolation of Escherichia coli antigen

A single colony of BL21 with pDEST14-VP4 was inoculated into 5 ml of LB containing antibiotics (100 μg / ml ampicillin), incubated overnight, and re-inoculated in 50 ml LB medium at 1/25 ratio until OD600 nm = ~ 0.4 20% L-Arabinose was treated at a final concentration of 0.2% and grown for 4 hours. Escherichia coli cultured for 4 hours was centrifuged at 5000 rpm, and only the precipitate was harvested, and 40 ml of 2 × sample buffer was added, boiled for 10 minutes, and confirmed by SDS-PAGE.

The mass-produced proteins were separated by size using SDS-PAGE, and then the 16.6 kDa band was finely pulverized using a mortar and then placed in a diffusion buffer (50 mM Tris-Cl pH 8.0, 0.1% SDS) The protein was released from the gel by shaking. After centrifugation at 4 ° C and 5000 rpm for 30 minutes, only the supernatant was recovered. The precipitate was dissolved in PBS (Phosphate-Buffer Saline) buffer by centrifuging again at -20 ° C for 3 hours. The obtained protein was quantified by BCA method (Bicinchoninic Acid Protein Assay Kit, Sigma).

6-3) Polyclonal  Antibody production

SDS-PAGE gels were mixed with 70 μg of VP4 protein and Freud's adjuvant in 1: 1 volume, followed by intramuscular injection and subcutaneous injection of complete Freud's adjuvant once in rabbits, followed by 2 incomplete Freud's adjuvant Were mixed and injected in the same amount. Blood was collected before the inoculation. After 3 inoculations, the rabbits were anesthetized and cardiac blood was collected. The obtained blood was stored at room temperature for one day, and then the serum was isolated, freeze-dried and stored at -70 ° C.

pDEST14-VP4 in BL21 was expressed in E. coli using E. coli expression system. After 3 hours of L-Arabinose treatment, E. coli proteins were extracted and subjected to SDS-PAGE to confirm the expression of VP4 protein at 15 and 30 kDa (FIG. 12A).

Mass expression of mCOEGY protein was dissolved in PBS by gel elution, and BCA was quantitated. Blood was obtained by injecting 70 ug of mCOEGY protein and Freud 'adjuvant into the subcutaneous and intramuscular rabbits at intervals of 2 weeks. Only antiserum was collected from the blood. The antisera of the rabbits before and after inoculation and the antiserum of the rabbits after the inoculation showed that the VP4 15KDa or VP4 30KDa protein was detected in purely isolated VP4 at 15 and 30KDa only in the rabbit aniserum after inoculation, (Fig. 12B).

Example  7: PEDV And Rotavirus Antigen Gene Fusion Gene Transformant Carrot Analysis

7-1) Carrots Callus genomic DNA  extraction

The callus tissues selected by antibiotic resistance were ground in a plastic pestle at room temperature by adding 0.5 cm ² tissue into a 1.5 ml tube, and then extracted with DNA extraction buffer (0.1 M Tris-HCl, pH 7.5, 0.5 M NaCl, 50 mM EDTA , 0.5% SDS) to extract genomic DNA (Kang et al., 2004).

Genomic DNA was extracted from the cell lines in the antibiotic selection medium to confirm the introduction of the genes, and PCR was performed using primers corresponding to the respective genes (see Materials and Methods). As a result, it was confirmed that the gene was inserted into four cell lines in a total of 11 cell lines (Fig. 13).

7-2) Carrots Callus RNA  Extraction and cDNA synthesis

After 50 ~ 100 mg of callus tissue was homogenized, 1 mL of T RI REAGENT (MRC) was added and incubated for 5 minutes at room temperature. After 0.2 mL of chloroform was added, the mixture was vigorously shaken for 15 seconds at room temperature for 15 minutes. Followed by centrifugation for 10 minutes. The supernatant was transferred to a new tube and reacted with 0.5 ml of isopropanol for 10 minutes and then centrifuged at 13,000 rpm for 10 minutes at 4 ° C to obtain a precipitate. 1 ml of 75% EtOH was added, centrifuged at 12,000 rpm for 5 min at 4 ° C, and then ethanol was removed and air-dried for 5 min and dissolved in DEPC-treated water.

RNA was extracted from carrot transformants selected by genomic DNA PCR analysis, cDNA was synthesized, and RT-PCR analysis was performed at transcript level. As a result, it was confirmed that two cell lines were expressed at a transcript level in a total of four cell lines (Fig. 14).

<110> Industry-Academic Cooperation Foundation, Dankook University <120> Trnasformants expressing epitope of porcine epidemic diarrhea          virus and rotavirus and vaccine composition containing the same <130> PA100829KR <160> 23 <170> Kopatentin 1.71 <210> 1 <211> 142 <212> PRT <213> porcine epidemic diarrhea virus <400> 1 Thr Met Val Thr Leu Pro Ser Phe Asn Asp His Ser Phe Val Asn Ile   1 5 10 15 Thr Val Ser Ala Ala Phe Gly Gly His Ser Gly Ala Asn Leu Ile Ala              20 25 30 Ser Asp Thr Thr Ile Asn Gly Phe Ser Ser Phe Cys Val Asp Thr Arg          35 40 45 Gln Phe Thr Ile Thr Leu Phe Tyr Asn Val Thr Asn Ser Tyr Gly Tyr      50 55 60 Val Ser Lys Ser Gln Asp Ser Asn Cys Pro Phe Thr Leu Gln Ser Val  65 70 75 80 Asn Asp Tyr Leu Ser Phe Ser Lys Phe Cys Val Ser Thr Ser Leu Leu                  85 90 95 Ala Gly Ala Cys Thr Ile Asp Leu Phe Gly Tyr Pro Glu Phe Gly Ser             100 105 110 Gly Val Lys Phe Thr Ser Leu Tyr Phe Gln Phe Thr Lys Gly Glu Leu         115 120 125 Ile Thr Gly Thr Pro Lys Pro Leu Glu Gly Ile Thr Asp Val     130 135 140 <210> 2 <211> 430 <212> DNA <213> porcine epidemic diarrhea virus <400> 2 caccatggtt actttgccat cattcaatga tcattctttt gttaatatta ctgtctctgc 60 ggcttttggt ggtcatagtg gtgccaacct cattgcatct gacactacta tcaatgggtt 120 tagttctttc tgtgttgaca ctagacaatt taccattaca ctgttttata acgttacaaa 180 cagttatggt tatgtgtcta agtcacagga tagtaattgc cctttcacct tgcaatctgt 240 taatgattac ctgtctttta gcaaattttg tgtttcaacc agccttttgg ctggtgcttg 300 taccatagat ctttttggtt accctgagtt cggtagtggt gttaagttta cgtcccttta 360 ttttcaattc acaaagggtg agttgattac tggcacgcct aaaccacttg aaggtatcac 420 agacgtttaa 430 <210> 3 <211> 430 <212> DNA <213> Artificial Sequence <220> <223> mutant of COE gene <400> 3 caccatggtt actttgccat cattcaatga tcattctttt gttaatatta ctgtctctgc 60 ggcttttggt ggtcatagtg gtgccaacct cattgcatct gacactacta tcaatgggtt 120 tagttctttc tgtgttgaca ctagacagtt caccattaca ctgttttata acgttacaaa 180 cagttatggt tatgtgtcta agtcacagga tagtaattgc cctttcacct tgcaatctgt 240 taatgattac ctgtctttta gcaaattttg tgtttcaacc agccttttgg ctggtgcttg 300 taccatagat ctttttggtt accctgagtt cggtagtggt gttaagttta cgtcccttta 360 ttttcaattc acaaagggtg agttgattac tggcacgcct aaaccacttg aaggtatcac 420 agacgtttaa 430 <210> 4 <211> 7 <212> PRT <213> Artificial Sequence <220> <223> C-terminal region of spike protein <400> 4 Gly Pro Arg Leu Gln Pro Tyr   1 5 <210> 5 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> C-terminal region of spike gene <400> 5 ggtcctagac ttcaacctta c 21 <210> 6 <211> 495 <212> DNA <213> Rotavirus sp. <220> <221> gene &Lt; 222 > (1) .. (495) <223> VP8 type <400> 6 atgttggatg gaccttatca accaacaact ttcaatcctc caataggata ctgggtgttg 60 tttgctccaa ccgttcaagg ggttgtggct gaaggaacaa acaacactag tagatggttg 120 gctattattt tggtcgaacc aaacgtgtct caggaaacta gaacatatac tatatttggt 180 caacaagttc agcttcaggt tgagaatgtt tcacaaacta aatggaaatt cattgatgtg 240 agtaagacta gtcaaggcgg tagttataca cagtacagca ccctcttgtc aaatacaaag 300 cttgatgctg tcataaagta tggaggtaaa gtgttcacat ataacggcga aactcctagt 360 gcaacttcag gtcaatacac aacaaccaac tatgaagcta tagttatgac tctcttctgg 420 gacttttata taattcctcg tacacaggag gaaacttgga caaattacat taaccatgga 480 cttccaccga tatag 495 <210> 7 <211> 474 <212> DNA <213> Rotavirus sp. <220> <221> gene &Lt; 222 > (1) .. (474) <223> BVP5 type <400> 7 atgcagaaca ccaggaaggt ggtgccagtt gcactttctg ctcgagatat ttcaatatct 60 aaagcaagtg ttaatgaaga cattgttgtt tctaagactt ctctttggaa agaaatgcag 120 tacaacaggg agatgaccat taggtttaag ttcgctaacc aaataattaa atctggagga 180 ttgggttata aatggtcaga aatatccttc aaaccagcaa cctaccaata tacatatatt 240 agagatggag aagaggtcat agctcatacc acttgttcag ttaacggagt gaataatttc 300 aattacaacg ggggttcact tccaacagat tttgtgatat ctagatatga agttatcaaa 360 gagaattcat atgtgtatat agattattgg gatgattctc aagcctttaa gaatatggtt 420 tacgttagag cattagctgc tgacttgaag tccattattt gtagtggcgg ctaa 474 <210> 8 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> Forward primer for PEDs <400> 8 caccatggtt actttgccat cattt 25 <210> 9 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> Reverse primer for PEDs <400> 9 ttaaacgtct gtgatacctt caagtgg 27 <210> 10 <211> 36 <212> DNA <213> Artificial Sequence <220> <223> Forward primer for PEDs (mut) <400> 10 tgtgttgaca ctagacagtt caccattaca ctgttt 36 <210> 11 <211> 36 <212> DNA <213> Artificial Sequence <220> <223> Reverse primer for PEDs (mut) <400> 11 aaacagtgta atggtgaact gtctagtgtc aacaca 36 <210> 12 <211> 39 <212> DNA <213> Artificial Sequence <220> <223> Forward primer for COE (fus) <400> 12 caccatggtt actttgccat cattcaatga tcattcttt 39 <210> 13 <211> 39 <212> DNA <213> Artificial Sequence <220> <223> Reverse primer for COE (fus) <400> 13 aagtctagga cccctacaac aacctgaaaa aacgtctgt 39 <210> 14 <211> 39 <212> DNA <213> Artificial Sequence <220> <223> Forward primer for COE (c-ter) <400> 14 acagacgttt tttcaggttg ttgtaggggt cctagactt 39 <210> 15 <211> 36 <212> DNA <213> Artificial Sequence <220> <223> Reverse primer for COE (c-ter) <400> 15 ttagtaaggt tgaagtctag gacccctaca acaacc 36 <210> 16 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> Forward primer for COEGY VP8 <400> 16 gacttcaacc ttacggacct ggacctatgt tggatggacc 40 <210> 17 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> Reverse primer for COEGY VP8 <400> 17 ggtccatcca acataggtcc aggtccgtaa ggttgaagtc 40 <210> 18 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> Forward primer for COEGY BVP5 <400> 18 gacttcaacc ttacggacct ggacctatgc agaacaccag 40 <210> 19 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> Reverse primer for COEGY BVP5 <400> 19 ctggtgttct gcataggtcc aggaccgtaa ggttgaagtc 40 <210> 20 <211> 38 <212> DNA <213> Artificial Sequence <220> <223> primer for fus VP8 <400> 20 ctatataggt ggaagtccat ggttaatgta atttgtcc 38 <210> 21 <211> 38 <212> DNA <213> Artificial Sequence <220> <223> primer for fus BVP5 <400> 21 ttagccgcca ctacaaataa tggacttcaa gtcagcag 38 <210> 22 <211> 973 <212> DNA <213> Artificial Sequence <220> <223> mCOEGY :: VP8 (PERO8) <400> 22 caccatggtt actttgccat cattcaatga tcattctttt gttaatatta ctgtctctgc 60 ggcttttggt ggtcatagtg gtgccaacct cattgcatct gacactacta tcaatgggtt 120 tagttctttc tgtgttgaca ctagacagtt caccattaca ctgttttata acgttacaaa 180 cagttatggt tatgtgtcta agtcacagga tagtaattgc cctttcacct tgcaatctgt 240 taatgattac ctgtctttta gcaaattttg tgtttcaacc agccttttgg ctggtgcttg 300 taccatagat ctttttggtt accctgagtt cggtagtggt gttaagttta cgtcccttta 360 ttttcaattc acaaagggtg agttgattac tggcacgcct aaaccacttg aaggtatcac 420 agacgttttt tcaggttgtt gtaggggtcc tagacttcaa ccttacggac ctggacctat 480 gttggatgga ccttatcaac caacaacttt caatcctcca ataggatact gggtgttgtt 540 tgctccaacc gttcaagggg ttgtggctga aggaacaaac aacactagta gatggttggc 600 tattattttg gtcgaaccaa acgtgtctca ggaaactaga acatatacta tatttggtca 660 acaagttcag cttcaggttg agaatgtttc acaaactaaa tggaaattca ttgatgtgag 720 taagactagt caaggcggta gttatacaca gtacagcacc ctcttgtcaa atacaaagct 780 tgatgctgtc ataaagtatg gaggtaaagt gttcacatat aacggcgaaa ctcctagtgc 840 aacttcaggt caatacacaa caaccaacta tgaagctata gttatgactc tcttctggga 900 cttttatata attcctcgta cacaggagga aacttggaca aattacatta accatggact 960 tccaccgata tag 973 <210> 23 <211> 952 <212> DNA <213> Artificial Sequence <220> <223> mCOEGY :: BVP5 (PERO5) <400> 23 caccatggtt actttgccat cattcaatga tcattctttt gttaatatta ctgtctctgc 60 ggcttttggt ggtcatagtg gtgccaacct cattgcatct gacactacta tcaatgggtt 120 tagttctttc tgtgttgaca ctagacagtt caccattaca ctgttttata acgttacaaa 180 cagttatggt tatgtgtcta agtcacagga tagtaattgc cctttcacct tgcaatctgt 240 taatgattac ctgtctttta gcaaattttg tgtttcaacc agccttttgg ctggtgcttg 300 taccatagat ctttttggtt accctgagtt cggtagtggt gttaagttta cgtcccttta 360 ttttcaattc acaaagggtg agttgattac tggcacgcct aaaccacttg aaggtatcac 420 agacgttttt tcaggttgtt gtaggggtcc tagacttcaa ccttacggac ctggacctat 480 gcagaacacc aggaaggtgg tgccagttgc actttctgct cgagatattt caatatctaa 540 agcaagtgtt aatgaagaca ttgttgtttc taagacttct ctttggaaag aaatgcagta 600 caacagggag atgaccatta ggtttaagtt cgctaaccaa ataattaaat ctggaggatt 660 gggttataaa tggtcagaaa tatccttcaa accagcaacc taccaatata catatattag 720 agatggagaa gaggtcatag ctcataccac ttgttcagtt aacggagtga ataatttcaa 780 ttacaacggg ggttcacttc caacagattt tgtgatatct agatatgaag ttatcaaaga 840 gaattcatat gtgtatatag attattggga tgattctcaa gcctttaaga atatggttta 900 ctttagagca ttagctgctg acttgaagtc cattatttgt agtggcggct aa 952

Claims (13)

i) a gene encoding the porcine epidemic diarrhea virus (PEDV) epitope protein of SEQ ID NO: 1, ii) a gene encoding the amino acid sequence of SEQ ID NO: 4, and iii) a rotavirus gene of the nucleotide sequence of SEQ ID NO: 6 or 7 Lt; RTI ID = 0.0 &gt; operably linked &lt; / RTI &gt;
3. The recombinant vector according to claim 1, wherein the operably linked gene comprises the nucleotide sequence of SEQ ID NO: 22 or 23.
delete 2. The recombinant vector according to claim 1, wherein the gene encoding the epitope protein comprises the nucleotide sequence of SEQ ID NO: 2.
2. The recombinant vector according to claim 1, wherein the gene encoding the epitope protein comprises the nucleotide sequence shown in SEQ ID NO: 3.
delete A transformant transformed with the recombinant vector of any one of claims 1, 2, 4, and 5.
8. The transformant according to claim 7, wherein the transformant is Agrobacterium, Escherichia coli or a plant cell.
9. The plant cell of claim 8, wherein the plant cell is tobacco. Wherein the transformant is selected from the group consisting of Arabidopsis, potato, lettuce, radish, cabbage, tomato, beans, rice, barley, wheat, corn and carrot.
A vaccine composition of PEDV or rotavirus comprising the transformant of claim 7, a protein extract of the transformant, or a recombinant protein isolated from the transformant.
A feed composition for preventing or treating PEDV or rotavirus infection comprising the transformant of claim 7, a protein extract of the transformant, or a recombinant protein isolated from the transformant.
A composition for preventing or treating PEDV or rotavirus infection comprising the transformant of claim 7, a protein extract of the transformant, or a recombinant protein isolated from the transformant.
(1) producing the recombinant vector of claim 1;
(2) introducing the vector of step (1) into Agrobacterium; And
(3) transforming plant cells with the Agrobacterium of step (2) above.

Images