KR20030012280A - Transformed potato for using vaccination on Porcine epidemic diarrhea virus and method for preparation thereof - Google Patents

Abstract

PURPOSE: A process of preparing a transformed potato capable of expressing a spike S1 subunit coding gene SS1 and a membrane protein coding gene ME is provided, mass-producing the plant-induced vaccine against porcine epidemic diarrhea virus. CONSTITUTION: The method for producing a transformed potato comprises the steps of: separating a spike S1 subunit coding gene SS1 or a membrane protein coding gene ME using PCR; constructing a potato expression vector which is capable of being cloned into a plasmid of Agrobacterium to express the gene; transforming Agrobacterium by introducing the expression vector thereinto; producing a transformed potato by culturing the transformed Agrobacterium and potato plant tissues and inserting the coat protein gene into the chromosome of the potato plant; analyzing the expression characteristic of the transformed potato; and redifferentiating the transformed potato.

Description

Transformed potato for using vaccination on Porcine epidemic diarrhea virus and method for preparation according to swine epidemic diarrheal virus

The present invention is a transformation capable of expressing a gene SS1 encoding a spike protein S1 subunit of Porcine epidemic diarrhea virus (PEDV) or a gene ME encoding a membrane protein. A method of making potatoes and a mixture of these transformed potatoes is used as a plant-derived vaccine to induce an immune effect against swine epidemic diarrheal virus in pigs.

In 1971, when Oldham reported an infectious disease (Oldham, J: Pig farming [Oct suppl], 72-73, 1972) characterized by acute diarrhea in growing pigs in the United Kingdom, the presence of a disease other than infectious gastroenteritis Gradually it became clear.

As the pig major viral diarrhea in woninche currently porcine epidemic diarrhea virus (Porcine epidemic diarrhea virus; PEDV) , infectious gastroenteritis virus (Transmissible gastroenteritis virus; TGEV), respiratory coronavirus; and the like (Porcinerespiratory coronavirus PRCV), double PEDV And TGEV occur every year in Korea, causing enormous damage to the pig industry. In particular, PEDV causes diarrhea in pigs of all ages, including mammalian pigs and raised pigs, and shows a serious mortality rate of 50-100% in the case of mammalian pigs, and urgent measures are required.

To prevent swine epidemic diarrhea, swine epidemic diarrheal virus attenuated strain of pig epidemic diarrheal virus attenuated pigs, which has been attenuated by serial passage over 90 generations in animal cell Vero cell line, is inoculated in piglets. In addition, there is a method for protecting the swine epidemic diarrheal virus by inhibiting the adhesion and infection of PEDV to the small intestine.

However, the preventive medicine against PEDV is not easily used in the field due to poor domestic environment or lack of recognition of pig farmers, so it is still suffering from PEDV. In addition, the conventional method of transferring the antibody formed by inoculation of the virus to the new piglets through the colostrum of sows may cause a non-free state such as the antibody level of the sow during pregnancy, the inoculation time of the preventive drug, the specification and nutritional management level, and other E. coli or mastitis There are many restrictions on the prevention of various diseases such as the presence of various diseases and the colostrum secretion of sows and the ability of the piglets to postpartum so that it is difficult to present a clear countermeasure in the occurrence of diarrheal disease caused by PEDV.

Therefore, the present inventors have been studied to develop a more effective vaccine that can eliminate the above-mentioned problems, and as a result, the gene SS1 and membrane protein (Spik S1 submit) encoding the spike protein S1 subunit of the swine epidemic diarrheal virus After preparing each of the transgenic potatoes capable of expressing the gene ME encoding the membrane protein), when using a mixture thereof as a vaccine it was found that the above object can be achieved and completed the present invention.

Accordingly, an object of the present invention is to provide a transgenic potato for plant-derived vaccine into which the gene SS1 encoding the S1 subunit of the spike protein of the swine epidemic diarrheal virus and the gene ME encoding the membrane protein are introduced, respectively.

Another object of the present invention is to provide a method for producing the transformed potato.

Still another object of the present invention is to use a plant-derived vaccine against swine epidemic diarrheal disease by mixing the transformed potato into which the SS1 gene is introduced and the transformed potato into which the ME gene is introduced. It is to provide a way to trigger.

In order to achieve the above object, the method for producing a transgenic potato as a plant-derived vaccine of the present invention, 1) gene encoding the S1 subunit of the spike protein using PCR from the swine epidemic diarrheal virus (spike s1 subunit) separating the coding gene) SS1 or the membrane protein coding gene ME , respectively; 2) constructing a potato expression vector capable of cloning into a plasmid of Agrobacterium to express the gene in potato; 3) transforming Agrobacterium by introducing the expression vector into Agrobacterium ; 4) culturing the transformed Agrobacterium and potato plant tissue together, inserting the gene in the plant expression vector in Agrobacterium into the chromosomes of the potato plant to produce a transformed potato; 5) analyzing the expression characteristics of the transformed potato; And 6) regenerating the transformed potato by culturing the germinated tissue sections of the potato whose expression characteristics have been assayed.

Hereinafter, the present invention will be described in more detail.

Porcine epidemic diarrhea virus (PEDV) is a single-stranded RNA virus belonging to the genus Coronavirus of the family Coronavirdae. The virus is infected mainly by feces of infected pigs, whose base is a single strand of positive sense RNA and is 28,033 bp in size (Bridgen, A. et. Al. (1933) J. Gen. Virol 74:. Pt9, 1795-1804) .

The genome of the virus consists of RNA polymerase 1, Spike Protein Coding Region (20638-24789), ORF3 (base sequence; 24789-25463), and envelope protein Coding Region (25444-25674), which have not yet been characterized. ), Membrane protein (Membrain Protein Coding Region; 25682-26362) and nucleocapsid Protein Coding Region (Duarte, M. et. Al . (1994) Virology 198 (2) : 466-476).

In the present invention, it binds to the receptor of the host cell among these six proteins and plays an important role in viral invasion into the host cell (Collins, AR et. Al. (1982) Virology 119 (2) 358-371, Vennema, H. et. Al. (1990) J. Virology 64: 339-346), the size of the glycoproteins varying in size from 150 kDa to 180 kDa, and in the Golgi apparatus, by the proteolytic cells of the host cell, amino terminal ends of approximately similar size ( Among the spike proteins that are divided into amino-terminal S1 and Carboxyl terminal S2 subunits, which form a spike round head (Frana, MF et al, (1985) J. Virology 56: 912-920; Luyties, W. et. al (1987) J. Virology 71: 949-955) The gene SS1 , which encodes the spike protein S1 subunit, is used for the preparation of a vaccine of the swine epidemic diarrheal virus.

In addition, the site of the transmembrane consists of about 20 hydrophobic and then hydrophilic amino acids followed by 11 to 23 amino acids (Boyd, D. et. Al. . (1990) Cell 62: 1031-1033 ), a variant of this site uses the ME gene coding for a membrane protein on the basis that the loss of the ability to break the protein spike in the production of porcine epidemic diarrhea virus vaccine.

The vaccine of the present invention against the swine epidemic diarrheal virus using the SS1 and ME genes is to prepare a transgenic potato into which these genes are introduced, and then mix the prepared potato. Therefore, specifically describing the method for producing a transgenic potato,

1) separating the spike s1 subunit coding gene SS1 or the membrane protein coding gene ME from the swine pandemic diarrheal virus using PCR;

2) constructing a potato expression vector capable of cloning into a plasmid of Agrobacterium to express the gene in potato;

3) transforming Agrobacterium by introducing the expression vectors into Agrobacterium ;

4) culturing the transformed Agrobacterium and potato plant tissue together, inserting the gene in the plant expression vector in Agrobacterium into the chromosomes of the potato plant to produce a transformed potato;

5) analyzing the expression characteristics of the transformed potato; And

6) re-differentiating the transformed potato by culturing the germinated tissue section of the potato whose expression characteristics have been assayed.

On the other hand, the method of transforming potatoes of the present invention, in order to more effectively induce the expression of these spike protein S1 subunit or membrane protein in transgenic potatoes, SS1 gene using PCR from the swine epidemic diarrheal virus in step 1) Alternatively, when the ME gene is separated, a ER retension singnal peptide encoding the vesicle residual signal peptide on the 3′-terminal side may be separated into a gene to which it is attached, and used as a gene for expression in potatoes.

In addition, in order to analyze the expression characteristics of the potato transformed in step 4), it can be analyzed using a monoclonal antibody to the proteins, as well as Southern blot analysis and Northern blot analysis.

At this time, the production method of the monoclonal antibody, the step of separating the SS1 gene or ME gene from the swine epidemic diarrheal virus using PCR; Inserting the gene into an insect cell expression vector; Producing a recombinant baculovirus through homologous recombination of the baculovirus and the insect cell expression vector; Transfecting the recombinant baculovirus to insect cells; Purifying RPEDV (SS1) protein encoded by the SS1 gene or RPEDV (ME) encoded by the ME gene from recombinant insect cells; Immunizing the purified protein with a mouse and isolating splenocytes from the immunized mouse; After fusion of the isolated splenocytes with myeloma cells, monoclonal antibodies are obtained from the fusion cells.

The monoclonal antibodies obtained above confirm the expression of RPEDV (SS1) protein or RPEDV (ME) protein in the transgenic potato, respectively, for example, can be used for Western blot analysis and the like.

On the other hand, the transformed potato prepared in the present invention by feeding it to the pig feed, it can induce the formation of antibodies to the swine epidemic diarrheal virus in pigs ingested it can induce an immune effect against the swine epidemic diarrheal virus. At this time, the potato transformed with the SS1 gene and the potato transformed with the ME gene should be mixed to induce immunity to the swine epidemic diarrheal virus.

On the other hand, since the S1 subunit of the spike protein and the membrane protein can induce an immune effect in pigs without any involvement in the activity of the swine epidemic diarrheal virus, it is superior in terms of safety than the attached virus vaccine.

In addition, since the transformed potato is used as a feed, the general public can easily use it to induce immunization of the pig, and also have the effect of continuously administering the vaccine in the pig, which is safer than the conventional inactivated virus vaccine. Do.

Hereinafter, the present invention will be described in more detail with reference to Examples, but the present invention is not limited thereto.

EXAMPLE

(1) Primer preparation and sequencing

To synthesize a portion of the spike s1 subunit coding gene SS1 and the membrane protein coding gene ME of the swine pandemic diarrheal virus, RNA of the PEDV was synthesized by reverse transcriptase and First cDNA was synthesized using Reverse Transcriptase-Polymerase Chain Reaction (RT-PCR) using a reverse 5'-primer.

The gene segments were then synthesized using primary cDNA, forward 5′-primer and reverse 5′-primer (SAIKI, RK, et al. (1988) Science 239 : 487-491).

The primer sequence used at this time is Duarte, M.et. al. (1994)Virology, 198 (2):466-476 and Kocherhans, R.et al.(1998)Adv. Exp. Med. Biol. 440 : The sequencing of the swine epidemic diarrheal virus virus, published at 781-786, was made.

Each primer for amplifying these genes contains an underlined Xba I restriction enzyme recognition site in the forward 5′-primer and contains a translational start codon. The reverse 5'-primer also contains an underlined Sac I restriction enzyme recognition site and a translation end codon. The sequence of such primers is as follows.

① SS1 amplification primer pair (base sequence 20630 ~ 21381 site amplification)

Forward 5´-primer (spf1): 5´-G GAGTCT ATGAGGTCTTTAATTTACTTCTGG-3´

Reverse 5´-primer (spr1): 5´-G GAGCTC TTTGAACAAATTATGGTATATGGCCATTGGA-3´

② Primer pair for ME amplification (for amplification of base sequence 25682 ~ 26362)

Forward 5´-primer (mpf1): 5´-G GAGTCT ATGTCTAACGGTTCTATTCCCGTT-3´

Reverse 5´-primer (mpr1): 5´-G GAGCTC TTTGAACAAATTAGACTAAATGAAGCACTT-3´

Each cDNA fragment amplified using the primer was cloned into a pGEM-T vector (purchased from Promega), a gene transfer plasmid. Then, the vector was transformed into transforming Escherichia coli DH5 (purchased by GibcoBRL Life Techologies) to amplify the cDNA fragments. The nucleotide sequence of the cloned plasmid was confirmed. pGEM-T vectorXbaI andSacI Swine pandemic diarrheal virus identified by treatment with restriction enzymesSS1AndMEGene fragments were isolated.

(2) Construction of vector pBIPEDV-SS1 and pBPHEDV-ME expressible in plants

A plant expression vector pBI121 (Clontech) containing a 35S promoter for enhancing plant expression efficiency, a kanamycin resistance gene npt II for selecting transgenic potatoes, and multiple cloning sites required for external gene insertion in Agrobacterium Ti-plasmid ) Was used as a vector for transforming Agrobacterium (Wicher, DR et. Al. (1988) Mol Breed 4 : 301-312).

The pBI121 vectorXbaI AndSacTreated with I, β-glucuronidase;gus) The gene was removed and then the site was isolated from (1).SS1Gene andMEGene fragments were inserted, respectively, to prepare recombinant plant expression vectors pBIPEDV-SS1 and pBIPEDV-ME.

Meanwhile, the sequence of the plant expression vector pBI121 and the expression vector into which the genes are inserted is as follows.

pBI121 Vector:-RB-NOS- npt II-NOS-CaMV- GUS -NOS-LB-

pBIPEDV-SS1 or pBIPEDV-ME vector: CaMV (XbaI)-SS1orME -Closing Codon -(SacI) NOS

Where RB / LB is the right / left boundary, NOS is the promoter of the gene that makes nopaline, a specific amino acid available to Agrobacterium , and CaMV is the Cauliflower Mosaic Virus promoter ( 35S promoter).

(3) Production of vectors to increase protein expression efficiency in potatoes

To insert DNA sequences encoding residual signal peptides (Ser-Glu-Lys-Asp-Glu-Leu; -SEKDEL) in the endoplasmic reticulum into the spike protein S1 subunit of the swine pandemic diarrheal virus and the back of the membrane protein, respectively, The method was carried out. First, by performing PCR using the forward 5'-primers of spf1 and mpf1 described in (1) above and the reverse 5'-primers of ERpr5-1 and ERpr5-2 described below, a slight modification from that produced in (1) Spike protein S1 subunit and membrane protein cDNA fragments were obtained.

5´-primer (ERpr5-1): 5´-GAAGGG AAGCTT CTGTTTTGCGGGTGCCACAA-3´

5´-primer (ERpr5-2): 5´-GAAGGG AAGCTT CTCTTTAGAGGGGAGCTCAC-3´

Then, Haq, AT et. al. (1995) After denature at 94 ° C. in TEA buffer using the following forward 5′-primer (Hindpf6) and reverse 5′-primer (Hindpr6) according to the method described in Science 268: 714-715. By culturing at 37 ° C, an oligo DNA (Hindp) having a sequence encoding an antifoam residual signal peptide was synthesized.

5´-primer (Hindpf6): 5´- AGCTT TCTGAGAAAGATGAGCTATAA GAGCT-3

5´-primer (Hindpr6): 5´-CTCATAGCTCATCTTTCTCAGAA-3´

The products amplified by the reverse 5′-primers ERpr5-1 and ERpr5-2 were treated with restriction enzyme HindIII, and then incubated for 12 hours at 16 ° C. with a conjugated enzyme and a buffer solution, respectively. Conjugation.

The PCR products produced by the ERpr5-1 and ERpr5-2 conjugated with Hindp were introduced into the GUS gene region of pBI121 and cloned. The plant expression vectors were named as pBERPEDV-SS1 and pBERPEDV-ME, respectively.

(4) Insect cell expression vector production

In order to express the swine pandemic diarrheal virus SS1 gene and ME gene in insect cells ( Spodoptera frugierda, sf9 cells, Pharmingen), the following four primers were expressed by Vet. Microbiol. (2000) 74 (3) : It produced by the method as described in 207-216.

①PEDV-SS1 (for base sequence 20638 ~ 21381 site amplification)

psfPEDVSSf: 5´-GGAATTCATGAGGTCTTTAATTTACTTCTGGTTGCT-3

psfPEDVSSr: 5´-GGAGCTCTTATGGTATATGGCCATTGGAATCAGTGG-3

②PEDV-ME (for base sequence 25682-26362 amplification)

psfPEDVMEf: 5´-GGAATTCATGTCTAACGGTTCTATTCCCGTTGATGAG-3´

psfPEDVMEr: 5´-GGAGCTCTTAGACTAAATGAAGCACTTTCTCACTATC-3´

PCR using this primerSS1AndMEAfter amplifying the gene, it was cloned into the pGEM-T vector with a conjugated enzyme and a buffer solution, and then the genes were amplified in the transforming host cell DH5.SS1AndMEGene fragmentsEcoRI AndSacI Restriction Enzyme Treatment of Swine Pandemic Diarrheal VirusSS1AndMEGene was isolated.

The vector pAcHLT-A (purchased from Pharmingen, 1999, Baculovirus Expression Vector System Manual 6th Edition) for baculovirus transferEcoRI AndSacI After treatment with restriction enzymes,SS1AndMEBy inserting the gene, the insect cell expression vector pAcHLT-PEDV (SS1) And pAcHLT-PEDV(ME)Was prepared.

(5) Insect cell transfection and expression by baculovirus vector

Kid, I.M.et. al., (1993) Applied Biochemistry and Biotechology.42According to the method described in: 137-159, the expression vector pAcHLT-PEDV (SS1) or pAcHLT-PEDV(ME)ToBsuThe linearized baculovirus DNA treated with the restriction enzyme 361 was incubated in Grace's medium for 3 hours at 27 ° C using bacfectin buffer solution with insect cells (sf9 cells, Pharmingen). Transfection kit was used from Pharmingen. After incubation for 12 hours, recombinant infected cells were transferred to fresh Grace medium containing 10% fetal bovine serum and antibiotics, and then cultured at 27 ° C. for 7 days. After 7 days, the culture medium was transferred to a sterile 50 ml tube before the insect cells were completely destroyed, and the cell membrane was completely destroyed with the lysis solution. Centrifugation of various cell lysates and pAcHLT-PEDV (SS1) And pAcHLT-PEDV(ME)Extracted from the affinity matrix, and then treated with thrombin, and then the swine epidemic diarrheal virus recombinant protein RPEDV (SS1) with agarose beads. Each of RPEDV (ME) was purified, confirmed by SDS-PAGE, and stored at -70 ° C.

(6) recombinant protein (RPEDV (SS1) And Monoclonal Antibody (Anti-RPEDV (SS1) in Mice Using RPEDV (ME)) And Production of Anti-RPEDV (ME)

The recombinant protein isolated above was used as an immunogen for the production of monoclonal antibodies to confirm the transformation of transgenic potatoes.

On the day of immunization, a solution obtained by mixing RPEDV (SS1) and RPEDV (ME) antigen-recombinant protein and Floint's complete adjuvant (FCA, purchased from Gibco BRL life Techologies LTd) by piston motion was well mixed with rats (Balb / C females; purchased from the Bio Link Laboratory Animal Center for Immunization) and immunized, and a mixture of the antigenic protein and Floint's incomplete adjuvent was applied to the soles, tails and abdominal cavity of the rats. Injection further induced second to fourth immunity. Then, before securing the splenocytes of immunized rats, blood was drawn to obtain polyclonal antibodies. Splenocytes and myeloma cells (SP2 / 0) of 6-week-old Balb / C mice were fused using polyethylene glycol (Polyethlyleneglycol (PEG)) and then fused cells were grown in 96-well plates. Then, hybridoma cells were selected according to the method used by Nigel Jenkins (Nigel Jenkins, 1999. Animal cell Biotechology 73-98). The monoclonal antibodies produced in hybridoma cells were then used for Western blot testing in later experiments.

(7) Agrobacterium ( Agrobacterium tumefaciences Transformation of LBA4404)

The vector pBERPEDV-SS1 or pBERPEDV-ME prepared in (3) was introduced into Agrobacterium tumefacises LBA4404 by electroporation, transformed, and inoculated in LB medium containing kanamycin. , 28 ℃, suspension cultured at 250rpm. After 48 hours of incubation, transformed Agrobacterium was selected, and An, G. et. al. (1988) In Plant Molecular Biology Manual A3 : 1-19, according to the method described in Kluwer Academic Publisher, the DNA isolated from Agrobacterium was treated with restriction enzymes, and then the transformation vector was inserted by electrophoresis and PCR. It was confirmed.

(8) Agrobacterium ( A.tumefaciences Transformation of Potatoes with LBA4404)

Transformation experiments were carried out using the transformed Agrobacterium selected in (7) as a test material using a Sumi varieties with good cultivation adaptability as Yl, Jung-Yoon, et. al . (1998) Korean J. Plant Tissue Culture 25: 109-113.

That is, potato roots were cultured in auxin-based 2,4-D hormone-added medium, and potato root slices isolated therefrom were pretreated alone for 30 minutes in a light state to increase transformation efficiency. Then, the swine epidemic diarrhea virusSS1Gene orMETransgenic with pBERPEDV-SS1 or pBERPEDV-ME of (7) to insert the gene into chromosomal DNA of potato cellsAgrobacteriumWas further incubated at 28 ° C. for 48 hours in the dark to transfect potatoes. From inoculated potato slices,AgrobacteriumTo remove Cabenicillin was treated in the culture medium. The medium and antibiotics on the surface of the potato slices were removed using a filter paper, and after drying, the slices were co-culture medium with 2,4-D 2 mg / l added to the MS medium. Incubated for about 2 days. Sections were then placed in MS medium with kanamycin 50 mg / l, carbenicillin 1000 mg / l, zeatin 2 mg / l, alpha-naphthylacetic acid (NAA) 0.01 mg / l and gibberyllic acid ( Callus was induced in the induced medium to which 0.1 mg / l of Gibelellic Acid: GA) was added. Then, Conger, et. Al. (1983)Science 221: According to the method described in 850-851, callus was induced by adding 2,4-D 2 mg / l of auxin-based plant growth hormone at the beginning of development so that embryos were induced in somatic cells.

Mature somatic cells induced root and leaf in MS medium depleted of 2,4-D. The callus was transferred to a regeneration medium containing 0.25 mg / l benzyl adenine (BA), 0.1 mg / l gibberic acid, 100 mg / l kanamycin and 500 mg / l carbenicillin in MS medium. The re-divided potatoes were transferred to MS medium to which kanamycin was added to select transgenic potatoes.

(9) Selection of Transgenic Potatoes

Transformed potatoes were obtained from Valvekens, D. et. al. (1988) Proc. Natl. Acad. Sci. Selection was carried out according to the method described in USA 85 : 5536-5540.

That is, transgenic potatoes were selected by necrosis of potatoes having no npt II gene by adding a certain amount of kanamycin capable of selecting transgenic potatoes to the regeneration induction medium of (8). The npt II gene, which encodes the neomycin phosphotransferase, a bacterial enzyme inserted into transgenic potatoes, inactivated the antibiotic kanamycin by phosphorylation to obtain transgenic potatoes in selective media. .

(10) Transformed Potato Analysis

Identification of selected transgenic potatoes can be performed via Southern blot analysis, Northern blot analysis, Western blot analysis.

Ⓐ Southern blot analysis

To determine whether the SS1 gene or the ME gene was inserted into the chromosome of the potato and where it entered the potato chromosome, Southern, EM (1975) J. Mol. Biol . Southern blot analysis was performed according to the method described in 98 : 503-517.

Ⓑ Northern blot analysis

In order to confirm the expression level of the swine epidemic diarrheal virus SS1 gene and ME gene introduced from the transformed potato to the expression level of total cellular RNA (RNA) of the whole cytoplasm, potato stem, leaves or seeds (0.5g to 1.0g) Grind well Alwine, JC et. al. (1988) Proc. Natl. Acad. Sci. Northern blot was performed according to the method described in USA 74 : 5350-5354.

Ⓒ Western blot analysis

At the protein level, the monoclonal antibodies (Anti-RPEDV (SS1) and Anti-RPEDV (isolated) from the mouse of (6) were used to confirm the expression levels of the spike protein S1 subunit and membrane protein of the swine pandemic diarrheal virus. SDS-PAGE analysis was used to confirm the expression level of the spike protein S1 subunit and membrane protein of the swine epidemic diarrheal virus (Higgins, JV and Spencer, D. (1991) Plant Science 74: 89). -98).

(11) Determination of the degree of immunization in vivo

First, the spike protein S1 subunit (SS1) and the membrane protein (ME), which are proteins produced by the transformed potatoes, were separated by the following method.

In other words, 1.5 ml of transformed potatoes with 300-500 µl of protein extraction buffer (100 mM Tris-HCl (pH8.0), 10 mM EDTA, 5% SDS and 20% Sucrose) in a 2 ml eppen rope tube After mixing, the tube was shaken gently to be mixed well, and then stored for 20 minutes in ice, then gently stirred and mixed well, followed by centrifugation at 4 ° C. for 20 minutes at 15,000 rpm to obtain a supernatant. A portion of the supernatant (5 μl) was heat treated with 5% mercaptoethanol for about 10 minutes and electrophoresed by SDS-PAGE to identify the corresponding proteins SS1 (30KDa) and ME (28KDa).

Then, the titer of the antibody produced by subcutaneous injection of pigs by mixing a predetermined amount of the identified RPEDV (SS1) protein and RPEDV (ME) protein was tested by ELISA to determine the degree of in vivo immunization of the antigenic protein.

(11-1) ELISA method

Seven days after subcutaneous injection of SS1 and ME proteins into the ELISA plate coated with recombinant antigen protein, blood was collected and centrifuged at 3,000 rpm for 10 minutes to separate serum, and the serum was used by John RC (1995) Methods. in Moleculor Biology 42: 131-160.

(12) Subsequent Expression and Subsequent Safety Verification

Subsequent expression and safety assays of transgenic potatoes can be performed by Medelian fashion assay analysis and determination of transgene locus in plant chromosomes using In situ technique (Angerer, LM et. Al (1987) Methods Enzymol 152: 649-661).

In other words, when the transformed potato is transferred to the next generation, the dominant factor and recessive factor ratio is 3: 1 according to the Mendel's genetic law, and the subsequent introduced traits were safely transferred.

(13) Defense test and animal test

5 days from pigs fed a mixture of two proteins produced by the transformed potato family, RPEDV (SS1) protein and RPEDV (ME) protein, pigs vaccinated with P-5 (Lifetime Co., Ltd.) and control pigs, 10 days after sensitization at 20 days and 30 days porcine epidemic diarrhea virus 10 ^5.0 TCID ₅₀ was added to an equal volume 16 sigan 37 ℃ (5% CO ₂₎ for a blood serum 50㎕ after a 96 well plate, diluting 2-fold The cells were added to porcine kidney cells (PK15 cell, purchased from veterinary quarantine) and cultured for 2 days, followed by cytopathic effect (CPE).

As a result, it was confirmed that the potato vaccine has sufficient protection against swine pandemic diarrheal virus in pigs.

On the other hand, the two proteins were inoculated into 20 pigs of 5 30-year-old pigs fed the transgenic potatoes produced for 5 days, 15 days, 20 days and 30 days, and 4 inactivated vaccine strains, 1 each as a control group. Eight pigs, two pigs one by one, pathogenic pandemic virus was inoculated with 10 ^3.0 TCID ₅₀ in 8 rats to confirm the protective ability of the swine epidemic diarrheal virus.

The transformed potato according to the present invention can produce a large amount of the transformed potato by conventional potato cultivation technology, it is possible to produce a large-scale potato feed vaccine having an immune effect against the swine epidemic diarrheal virus.

In addition, by feeding the transformed potato prepared in the present invention to pigs, it can induce the immune effect by inducing the formation of antibodies to the swine epidemic diarrheal virus in pigs ingested it. Thus, the mixture of spike protein S1 subunit and each transgenic potato expressing the membrane protein is not involved in the activity of the swine epidemic diarrheal virus and can induce an immune effect in pigs, thus inactivating an inactivated viral vaccine. It is safer than virus vaccine. In addition, because the transgenic potato can be used as a feed, the general public can easily use it to induce immunization of the pig, and it can have the effect of continuously administering the vaccine to the pig. Because there is no need to administer vaccines at intervals, high value-added returns can be expected for farmers.

Claims (3)

In the method for producing a transgenic potato, which is a plant-derived vaccine, 1) isolating the gene SS1 encoding the spike protein S1 subunit or the gene ME encoding the membrane protein from the swine pandemic diarrheal virus using PCR; 2) constructing a potato expression vector that can be cloned into Agrobacterium plasmid to express the gene in potato; 3) transforming Agrobacterium by introducing the expression vector into Agrobacterium ; 4) preparing a transgenic potato by culturing the transgenic Agrobacterium and the potato plant tissue into which the vector is introduced, and inserting the gene in the plant expression vector in the Agrobacterium into the chromosome of the potato plant; 5) analyzing the expression characteristics of the transformed potato; And 6) A method of producing a transgenic potato for plant-derived vaccine comprising culturing the germinated tissue sections of each potato whose expression characteristics have been assayed to re-differentiate the transgenic potato. The method of claim 1, wherein each of the genes of step 1) further comprises a residual signal in the endoplasmic reticulum. The transgenic potato expressing the gene SS1 encoding the spike protein S1 subunit prepared by the method of claim 1 or 2 and the transgenic potato expressing the gene ME encoding the membrane protein are mixed to obtain a feed or swine pandemic. A method of immunizing pigs by ingesting them with a plant-derived vaccine against diarrheal virus.