KR20110120254A - Compositions for improving skin conditions comprising human placental lactogen as an active ingredient - Google Patents

Abstract

PURPOSE: A composition for improving skin condition, containing human placental lactogen is provided to treat atopic dermatitis and to improve anti-wrinkling, skin elasticity, and anti-aging. CONSTITUTION: A composition for improving skin condition contains human placental lactogen(hPL) as an active ingredient. The skin condition improvement is treatment of acne or atopic dermatitis, anti-wrinkling, skin whitening, dark spot elimination, skin elasticity, hair growth promotion, anti-aging, or skin moisturizing. The composition is a cosmetic composition or pharmaceutical composition.

Description

Composition for Improving Skin Conditions Comprising Human Placental Lactogen as an Active Ingredient}

The present invention relates to a composition for improving skin condition comprising human placental lactogen as an active ingredient and a method for improving skin condition using the same.

Polymers (about 22 kDa), such as human Placental Lactogen (hPL), require high-cost, high-volume, mass-produced and purified purification processes, and are also used as liquid preparations for skin application due to instability in solution after purification. It is necessary to overcome various industrial technical and economic difficulties before applying it to develop cosmetics or medicines that exert cosmetic and medical effects by the action of human placental lactogen.

Liposomes have been used to improve the stability in liquid phase while maintaining the bioactivity of polymer proteins such as human placental lactogen. When proteins are wrapped in liposomes and applied to the skin, in normal skin, liposomes can be an efficient carrier for delivering proteins to hair follicles, and in damaged skin, the sustained-release carriers of proteins wrapped in liposomes are protected from proteolytic enzyme attack. It can be used to efficiently exercise the efficacy of relatively long time protein. The transfer efficiency of liposomes to the skin has not been known yet, and there are many empirical parts. However, even when the protein is enclosed in liposomes and delivered, the types of phospholipids that form liposomes including pH and charge state inside and outside the liposomes, the types of proteins attached to the phospholipids or the proteins surrounded by the phospholipids and the components of various constituent tissues forming pores However, the complex interaction of these three elements seems to determine the transfer efficiency empirically rather than following the general law.

Human placental lactogen (hPL) is a polypeptide placental hormone, also called human chorionic somatomammotropin (hCS). The structure and function of hPL is known to be similar to human growth hormone, and it alters the metabolic state of the mother to promote energy supply to the fetus during pregnancy. HPL is also an anti-insulin that lowers the activity of insulin. hPL consists of 191 amino acids linked by two disulfide bonds and is secreted from the syncytiotrophoblast during pregnancy. The molecular weight of hPL is 22,125 Da and the half life is about 15 minutes. hPL is present only in relation to fetal and placental growth only during gestation, the maximum value is about 5-7 mg / ml, and higher levels are observed in patients with multiple gestation.

In bioassay experiments, hPL has been shown to function similar to prolactin, but it is not yet clear what it does in human lactation. hPL affects the metabolic system of the maternal organs, which reduces maternal insulin sensitivity, increasing maternal blood glucose levels, but reducing maternal glucose use to provide adequate nutrients to the fetus. Chronic hypoglycemia raises the level of hPL, which induces lipolysis that releases free fatty acids and is used as an energy source in maternal organs, helping the fetus use more glucose. In addition, ketones produced from free fatty acids can cross the placenta and be used by the fetus. This function helps the fetus to receive nutrition even when the mother is under malnutrition. hPL has some similarities to growth hormone and similar chemical structure in causing the formation of protein tissue, but the amount required to promote growth is different in several ways, such as requiring about 100 times more than growth hormone. (Guyton and hall (2005) (in en) .Textbook of Medical Physiology (11 ed.). Philadelphia: Saunders.pp. 1033. ISBN 81-8147-920-3. "This hormone has weak actions similar to those of growth hormone, causing the formation of protein tissues in the same way that growth hormone.).

The present invention is to improve the atopic skin of human placental lactogen by applying cosmetics to the normal skin surface, which is not directly contacted with blood, but not in the manner of transferring the efficacy of human placental lactogen through blood. It is the first report to show that it can show cosmetic medical effects on the skin such as improvement of skin damage by ultraviolet rays, improvement of wrinkles, improvement of acne, improvement of dry skin and the like.

Numerous papers and patent documents are referenced and cited throughout this specification. The disclosures of cited papers and patent documents are incorporated herein by reference in their entirety, and the level of the technical field to which the present invention belongs and the contents of the present invention are more clearly explained.

The present inventors earnestly researched to develop a substance that can improve the skin condition. As a result, the present inventors have completed the present invention by discovering that human placental Lactogen can be greatly improved on the skin. Was done.

Accordingly, it is an object of the present invention to provide a composition for improving skin conditions.

Another object of the present invention is to provide a method for improving skin conditions.

Other objects and advantages of the present invention will become apparent from the following detailed description, claims and drawings.

According to one aspect of the invention, the present invention provides a composition for improving skin conditions (conditions) comprising human placental lactogen (Human Placental Lactogen) as an active ingredient.

According to another aspect of the present invention, the present invention provides a method for improving skin conditions, comprising applying to the skin a composition comprising human placental lactogen as an active ingredient.

As a result of research efforts to find new uses of human placental lactogen, the present inventors have found that the application of human placental lactogen to the skin can greatly improve the skin condition.

Human placental Lactogen (hPL) used as an active ingredient in the present invention can be used any polypeptide that exhibits human placental lactogen activity, for example, mature hPL, Met-hPL, hPL variants, Either modified-hPL, hPL fragments or hPL analogue can be used. Preferably, it is mature hPL or Met-hPL. mature hPL refers to human placental lactogen with amino acid sequence of major human placental lactogen present in human blood, Met-hPL refers to human placental lactogen with methionine added at the N-terminus of mature hPL HPL variants refer to human placental lactogens with amino acid sequences of human placental lactogen other than the main human placental lactogen present in the human body, and modified hPL to one or more amino acid residues of human placental lactogen Human placental lactogens modified by attachment of additives such as pegylation or glycation, etc. hPL fragments indicate human growth hormone obtained by removing a part of the amino acid sequence of human placental lactogen by genetic or biochemical methods, and hPL analogue is an amino acid sequence of human placental lactogen that has similar properties by genetic engineering method. Refers to human placental lactogen modified by heat. The human placental lactogen of the present invention can be specified by one of two methods. One can be specified by whether it binds to human placental lactogen binding protein or human placental lactogen receptor and the other can be specified by a method for measuring the biological activity of human placental lactogen.

According to a preferred embodiment of the present invention, the composition of the present invention has a liposome composition. That is, human placental lactogen as an active ingredient is preferably surrounded by liposomes and applied to the skin. According to a more preferred embodiment of the present invention, the composition of the present invention has a composition of nanoliposomes. As used herein, the term “nanoliposomes” refers to liposomes having an average particle diameter of 20-1000 nm as having the form of conventional liposomes. According to a preferred embodiment of the present invention, the average particle diameter of the nanoliposomes is 50-500 nm, more preferably 50-350 nm, most preferably 100-250 nm.

Liposomes are defined as spherical phospholipid becycloes of colloidal particles that associate themselves. Liposomes composed of amphiphilic molecules with water-soluble heads (hydrophilic groups) and insoluble tails (hydrophobic groups) spontaneously bind and form an ordered structure by their interaction. It is classified into Small Unilamellar Vesicle (SUV), Large Unilamellar Vesicle (LUV) and Multi Lamellar Vesicle (MLV) according to its size and lamellarity.

  Such liposomes exhibiting various laminations have a double membrane structure similar to that of cell membranes.

The (nano) liposomes in the present invention can be prepared using phospholipids, polyols, surfactants, fatty acids or / and water.

Phospholipids used in the preparation of the (nano) liposomes of the present invention are used as amphoteric lipids, including natural phospholipids (eg, egg yolk lecithin or soy lecithin, sphingomyelin) and synthetic phospholipids (eg dipalmitoyl). Phosphatidylcholine or hydrogenated lecithin), preferably lecithin. More preferably, the lecithin is naturally occurring unsaturated lecithin or saturated lecithin extracted from soybean or egg yolk.

The polyols that can be used in the (nano) liposomes of the present invention are not particularly limited, preferably propylene glycol, dipropylene glycol, 1,3-butylene glycol, glycerin, methylpropanediol, isoprene glycol, pentylene glycol, Erythritol, xyitol and sorbitol.

Surfactants that can be used in the preparation of the (nano) liposomes of the present invention can be any known in the art, for example, anionic surfactants such as alkylacylglutamate, alkylphosphates, alkyllactylates, Dialkylphosphates and trialkylphosphates), cationic surfactants, amphoteric and nonionic surfactants (e.g. alkoxylatedalkylethers, alkoxylatedalkylesters, alkylpolyglycosides, polyglyceryl esters and sugar esters) Can be used.

Fatty acids that can be used to prepare the (nano) liposomes of the present invention are higher fatty acids, preferably saturated or unsaturated fatty acids of C _12-22 alkyl chains, for example, lauric acid, myristic acid, palmitic acid, stearic acid. Oleic acid and linoleic acid.

The water used to prepare the (nano) liposomes of the present invention is generally deionized distilled water.

According to a preferred embodiment of the present invention, the nano (liposomes) of the present invention are prepared only with phospholipids and water, specific examples of which are described in the following examples.

According to a preferred embodiment of the invention, the hPL-containing nanoliposomes of the invention are prepared via a process comprising the following steps: (a) Phospholipids (preferably egg yolk lecithin or soy lecithin) capable of forming liposomes ) Is dissolved in an aqueous solution containing human placental lactogen; And (b) repeatedly passing an aqueous solution containing human placental lactogen and phospholipids into a high pressure homogenizer, and gradually increasing the content of phospholipids and the pressure of the high pressure homogenizer according to the number of passages, thereby containing human placental lactogen. Preparing nano liposomes.

An aqueous solution containing human placental lactogen is preferably a buffer (eg sodium phosphate buffer) at pH 6-8, preferably about pH 7. If sodium phosphate buffer is used, the concentration is 5-100 mM, more preferably 5-60 mM, even more preferably 10-30 mM, most preferably about 20 mM.

In the method of the present invention, the most specific aspect is to pass the mixture of phospholipid and hPL-containing aqueous solution several times through a high pressure homogenizer, in which the amount of phospholipid and the pressure of the homogenizer are sequentially increased as the number of passage increases. According to a preferred embodiment of the invention, the pressure of the homogenizer is sequentially increased to 0-1000 bar, preferably 0-800 bar. The output can be increased by 50 bar or 100 bar, preferably by 100 bar. According to a preferred embodiment of the invention, the amount of phospholipids is sequentially increased to 5-40 w / v (%), 5-30 w / v (%).

Through this high pressure homogeneous process with sequential phospholipid content and pressure increase, hPL-containing nanoliposomes are prepared, preferably liquid hPL-containing nanoliposomes.

The compositions of the present invention can be used to improve various skin conditions. Preferably, the composition of the present invention is for the treatment or improvement of atopic skin, wrinkle improvement, whitening improvement, removal of blotch, skin elasticity improvement, acne treatment, hair growth, skin aging prevention, skin moisturization and skin epidermal stem cell activation It can be used, and more preferably it is effective in improving atopic skin, improving wrinkles and improving skin elasticity.

The composition of the present invention may be prepared as a cosmetic composition or a pharmaceutical composition.

The components included in the cosmetic composition of the present invention include components conventionally used in cosmetic compositions in addition to hPL-containing liposomes (Lipo-hPL) as active ingredients, and include, for example, conventional agents such as stabilizers, solubilizers, vitamins, pigments and perfumes. Phosphorus aids, and carriers.

The cosmetic composition for protecting the skin of the present invention may be prepared in any formulation commonly prepared in the art, for example, solutions, suspensions, emulsions, pastes, gels, creams, lotions, powders, soaps, surfactants- Containing cleansing, oils, powder foundations, emulsion foundations, wax foundations, sprays and the like, but is not limited thereto. More specifically, it can be manufactured in the form of a soft lotion, a nutritional lotion, a nutritional cream, a massage cream, an essence, an eye cream, a cleansing cream, a cleansing foam, a cleansing water, a pack, a spray or a powder.

When the formulation of the present invention is a paste, cream or gel, animal oils, vegetable oils, waxes, paraffins, starches, trachants, cellulose derivatives, polyethylene glycols, silicones, bentonites, silicas, talc or zinc oxide may be used as carrier components. Can be.

In the case where the formulation of the present invention is a powder or a spray, lactose, talc, silica, aluminum hydroxide, calcium silicate or polyamide powder may be used as a carrier component. Especially, in the case of a spray, a mixture of chlorofluorohydrocarbons, propane / Propane or dimethyl ether.

When the formulation of the present invention is a solution or an emulsion, a solvent, a dissolving agent or an emulsifying agent is used as a carrier component, and examples thereof include water, ethanol, isopropanol, ethyl carbonate, ethyl acetate, benzyl alcohol, benzyl benzoate, , 3-butyl glycol oil, glycerol aliphatic ester, polyethylene glycol or sorbitan fatty acid esters.

When the formulation of the present invention is a suspension, liquid carrier diluents such as water, ethanol or propylene glycol, suspending agents such as ethoxylated isostearyl alcohol, polyoxyethylene sorbitol ester and polyoxyethylene sorbitan ester, microcrystals Soluble cellulose, aluminum metahydroxy, bentonite, agar or tracant and the like can be used.

When the formulation of the present invention is a surfactant-containing cleansing, the carrier component is an aliphatic alcohol sulfate, an aliphatic alcohol ether sulfate, a sulfosuccinic acid monoester, isethionate, an imidazolinium derivative, a methyltaurate, a sarcosinate, a fatty acid amide. Ether sulfates, alkylamidobetaines, aliphatic alcohols, fatty acid glycerides, fatty acid diethanolamides, vegetable oils, lanolin derivatives or ethoxylated glycerol fatty acid esters and the like can be used.

When the composition of the present invention is prepared as a pharmaceutical composition, it may include a pharmaceutically acceptable carrier, for example, lactose, dextrose, sucrose, sorbitol, mannitol, starch, acacia rubber, calcium phosphate, alginate Gelatin, calcium silicate, microcrystalline cellulose, polyvinylpyrrolidone, cellulose, water, syrup, methyl cellulose, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate and / or mineral oils can do. In addition to the above components, the pharmaceutical composition of the present invention may further include a lubricant, a humectant, a sweetener, a flavoring agent, an emulsifier, a suspending agent, a preservative, and the like. Suitable pharmaceutically acceptable carriers and formulations are described in detail in Remington's Pharmaceutical Sciences (19th ed., 1995).

The pharmaceutical composition of the present invention was developed for the purpose of skin administration.

Suitable dosages of the pharmaceutical compositions of the present invention may vary depending on factors such as the formulation method, mode of administration, age, weight, sex, morbidity, condition of food, time of administration, route of administration, rate of excretion and response to response of the patient. Can be. Meanwhile, the skin dosage of the pharmaceutical composition of the present invention is preferably 0.001-2000 ng / cm ² (skin surface area) per day, more preferably 0.01-200 ng / cm ² , most preferably 0.1-20 ng / cm ² .

The pharmaceutical compositions of the present invention may be prepared in unit dose form by formulating with a pharmaceutically acceptable carrier and / or excipient according to methods which can be easily carried out by those skilled in the art. Or may be prepared by incorporation into a multi-dose container. The formulation is most preferably in the form of a solution containing nanoliposomes.

The features and advantages of the present invention are summarized as follows.

(Iii) The present invention provides a composition for improving skin condition comprising human placental lactogen as an active ingredient and a method for improving skin condition using the same.

(Ii) The composition of the present invention acts on skin cells to improve the skin damaged by ultraviolet rays and wrinkles due to aging, improve skin elasticity, and to treat atopic dermatitis and to maintain skin moisture. . Overall, the compositions of the present invention can greatly improve skin conditions. In addition, the composition of the present invention is not only very safe for the human body, but also excellent in stability when prepared with nanoliposomes.

1 is a diagram showing the amino acid sequence of human placental Lactogen (hPL). 1-25 amino acid sequences of the hPL amino acid sequences are signal peptide moieties, and 26-216 amino acid sequences represent mature hPL proteins.
2 shows a DNA sequence (CDS) encoding human placental lactogen. The black 1-8 bp portion of the DNA sequence is exon 1, the blue 9-168 bp portion is exon 2, the red 169-288 bp portion is red exon 3, green 289-453 bp portion is Exon 4 and purple 456-651 bp portion represents exon 5. In addition, the underlined portion (1-75 bp) of the sequence is a signal peptide portion.
Figure 3 is a diagram showing the results of culture after transforming the expression vector (pUC-narK-Met-hPL) to strain Rz4500.
4 is a diagram showing the results of purification of recombinant human placental lactogen using gel filtration chromatography.
5 is a diagram of the wrinkle improvement effect by human placental lactogen (hPL).
6 is a diagram showing the skin elasticity enhancement effect by human placental lactogen (hPL).
7 is a diagram showing the effect of inhibiting water loss by human placental lactogen (hPL).
8 is a diagram showing changes in skin tissue after UV irradiation by human placental lactogen (hPL).
9 is a diagram of visual observation of skin changes of atopic dermatitis induced Nc / Nga mouse according to the coating agent applied for a short time.
10 is a diagram showing the skin damage of atopic dermatitis induced Nc / Nga mouse following a short-term application of Lipo-hPL.
FIG. 11 is a diagram of visual observation of skin changes in atopic dermatitis induced Nc / Nga mice following long-term application of Lipo-hPL. FIG.
12 is a diagram showing changes in skin damage of atopy-induced Nc / Nga mouse according to the application of Lipo-hPL for a long time.
FIG. 13 is a diagram showing changes in skin damage of atopy-induced Nc / Nga mice following prolonged application of Lipo-hPL. FIG.
FIG. 14 is a diagram showing skin tissue H & E staining of atopy-induced Nc / Nga mice following application of Lipo-hPL for a short period of time.
FIG. 15 is a diagram observed after H & E staining of skin tissue change of atopic dermatitis induced Nc / Nga mouse following prolonged application of Lipo-hPL. FIG.
16 is a diagram showing the skin thickness change of atopic dermatitis induced Nc / Nga mouse by the application of Lipo-hPL for a long time.

Hereinafter, the present invention will be described in more detail with reference to Examples. These examples are only for illustrating the present invention in more detail, it will be apparent to those skilled in the art that the scope of the present invention is not limited by these examples in accordance with the gist of the present invention. .

Example

Example I Acquisition of Human Placental Lactogen (hPL) Protein

1. Acquisition of human placental lactogen gene

The hPL protein is an abbreviation of human placental lactogen and consists of 191 amino acids and is a hormone secreted from approximately the fifth week of pregnancy (FIG. 1). The main role of hPL is hormones that are involved in carbohydrate and fat metabolism during pregnancy and also to prepare for lactation by growing and stimulating the mammary gland. To clone the hPL gene, we first use genomic DNA as a template from the HEK 293T (Human embryonic Kidney) cell line (ATCC CRL-11268) to obtain exon DNA fragments encoding human placental lactogen (hPL). PCR was performed. In order to connect each exon DNA fragment, some bases of the linking sites were designed to be base paired with each other, and all PCRs used Stratagene pfu DNA polymerase (Stratagene, cat. Number 600154-81, USA). Used.

The basic PCR method for amplifying exons constituting the human placental lactogen (hPL) gene is as follows. PCR (35 cycles; 98) using hPL 1U primers (IDT, USA; all oligomers used below are manufactured by IDT) and hPL 2D primer pairs containing exon 1 using genomic DNA extracted from HEK 293T cell line as a template. 1 min, 55 ° C. 1 min, 72 ° C. 2 min) Exon 1 and 2 polymers of size were obtained. In the same way, 150 bp of exon 3 using hPL 3U and hPL 4D primer pairs, 200 bp of exon 4 using hPL 5U and hPL 6D primer pairs, and 219 bp using hPL 7U and hPL 8D primer pairs. Exon 5 was obtained.

In the second PCR, exons 1 and 2 polymers and exons 3 obtained by the above-described method were used as templates, and the hPL 1U and hPL 4D primer pairs were added and PCR (35 cycles; 98 ° C 1 minute, 55 ° C 1 minute, 72 ° C 2 min) to obtain amplification of exon 1, 2, 3 polymer. In the same manner, exon 4 and 5 polymers were obtained using exon 4 and exon 5 as templates using hPL 5U and hPL 8D primer pairs.

In the tertiary PCR, PCR was performed using exon 1, 2, 3 polymers and exon 4, 5 polymers as templates, using the same method as described above using hPL 1U and hPL 8D primer pairs to generate hPL containing a signal peptide. Genes were obtained (FIG. 2). The hPL gene fragment containing the signal peptide obtained in the third PCR reaction was used as a template to obtain a mature hPL gene using the same method described above using hPL 9U and hPL 8D primer pairs.

The base sequences of the primers hPL 1U, hPL 2D, hPL 3U, hPL 4D, hPL 5U, hPL 6D, hPL 7U, hPL 8D and hPL 9U are shown in Table 1.

Primer Sequence primer Sequence (5'-3 ') hPL 1U gggaattccatatggctccaggctcaaaccgttccc hPL 2D ataggtttcttcaaactcctggtaggtgtcaatg hPL 3U taccaggagtttgaagaaacctatatcccaaagg hPL 4D cagctctagattggatttctgttgcgtttcctc hPL 5U caacagaaatccaatctagagctgctccgcatc hPL 6D gtcttccagcctccccatcagcgtttggatg hPL 7U acgctgatggggaggctggaagacggcagc hPL 8D cggggtaccctagaagccacagctgccc hPL 9U gggaattccatatggtccaaaccgttcccttatc

2. Preparation of expression vector containing Nark promoter and hPL

Gene encoding Met-human placental lactogen (Met-hPL) protein and pNK mut plasmid (including narK promoter mutated with -10 signal sequence, Ligeron, Inc., see Republic of Korea Patent Application Publication No. 2006-0089086 Was cleaved into Nde I and Kpn I, ligated with T4 DNA ligase, and transformed into Top10F 'strain. After culturing at 37 ° C. for 15 hours, eight colonies were randomly selected and cultured, plasmids were obtained by alkali lysis method, and then electrophoresed on a 1% agarose gel to confirm the size and sequence analysis. Plasmids were selected (pUC-narK-Met-hPL).

3. Purification of Human Placental Lactogen Protein

The prepared expression vector was transformed into an expression strain Rz4500 (Korea Research Institute of Biotechnology, Korea) and cultured in a 7 liter fermenter (FIG. 3). E. coli, including the expressed recombinant hPL protein, was recovered by centrifugation, suspended in distilled water, and disrupted by using ultrasonic waves. The precipitate was recovered using high-speed centrifugation, stirred with 0.5% Triton X 100 solution, and then recovered again by high-speed centrifugation, which is an inclusion body. The inclusion body was stirred with a soluble solution (25 mM NaOH) to dissolve the protein, neutralized with 10% acetic acid, and then impurities were removed using high-speed centrifugation. Next, the recombinant hPL protein was purified using supernatant gel filtration chromatography (FIG. 4).

Example II Preparation of Human Placental Lactogen-Containing Liposomes (Lipo-hPL)

Phospholipids used in the preparation of Lipo-hPL include soybean lecithin (Shindongbang, Korea), Metarin P (Degussa Texturant Systems Deutschland GmbH & Co. KG), Nutripur S (Degussa Texturant Systems Deutschland GmbH & Co. KG). Or Emultop (Degussa Texturant Systems Deutschland GmbH & Co. KG).

High pressure homogenizer equipped with a heat exchanger (max. Output 5 L / hr, maximum pressure 1200 bar, Model HS-1002, Hwaseong Machinery (Korea)) so that the temperature of the equipment outlet does not exceed 30 ℃ The hPL solution obtained in Example I above at a concentration of 1 mg / ml dissolved in a buffer solution (20 mM NaH 2 PO 4 pH 6.5-7.5, 1 mM EDTA) was prepared by rinsing the inside of the apparatus with distilled water. To the phospholipid was added at a 10 w / v% ratio and sufficiently hydrated and stirred, which was passed through the homogenizer three times or more at low pressure 0 bar using a homogenizer at room temperature. Subsequently, to the solution passed through the homogenizer, phospholipid was added to a ratio of 14 w / v%, sufficiently hydrated and stirred, and passed through the homogenizer three times or more at 100 bar. Then, to the solution passed through the homogenizer, phospholipid was added at a ratio of 18 w / v%, sufficiently hydrated and stirred, and passed through the homogenizer three times or more at 200 bar. Then, to the solution passed through the homogenizer, phospholipid was added at a ratio of 20 w / v%, sufficiently hydrated and stirred, and passed through the homogenizer three times or more at 300 bar. Subsequently, to the solution passed through the homogenizer, phospholipid was added at a ratio of 22 w / v%, sufficiently hydrated and stirred, and passed through the homogenizer three times or more at 400 bar. Then, to the solution passed through the homogenizer, phospholipid was added at a ratio of 24 w / v%, sufficiently hydrated and stirred, and passed through the homogenizer three times or more at 500 bar. Then, to the solution passed through the homogenizer, phospholipid was added to a ratio of 26 w / v%, sufficiently hydrated and stirred, and passed through the homogenizer three times or more at 600 bar. Subsequently, phospholipid was added to a solution having undergone the homogenizer in a ratio of 28 w / v%, sufficiently hydrated and stirred, and passed through the homogenizer three times or more at 700 bar. Then, the solution passed through the homogenizer was passed through the homogenizer three times or more at 800 bar, the solution was discharged from the homogenizer, and the supernatant was separated by high-speed centrifugation at 15,000 xg for 30 minutes. At this time, human growth hormone not contained in liposomes was removed by gel permeation chromatography (GE Healthcare, USA) to obtain liquid liposomes.

Example III Preparation of Lipo-hPL-Containing Cream Cosmetic Prototype

A cosmetic prototype of a cream formulation comprising Lipo-hPL obtained in Example II was prepared.

ingredient Content (% by weight) Lipo-hpl 2.0 Meadowfoam oil 3.0 Cetearyl alcohol 1.5 Stearic acid 1.5 Glyceryl Stearate 1.5 Floating paraffin 10.0 Beeswax 2.0 Polysorbate 60 0.6 Solbitan Sesquioleate 2.5 Squalane 3.0 1,3-butylene glycol 3.0 glycerin 5.0 Triethanolamine 0.5 Tocopheryl acetate 0.5 Preservative, pigment Quantity incense Quantity Purified water Balance Sum 100

Example IV: Wrinkle / skin elasticity / moisture loss / epidermal thickness evaluation using a hairless nude mouse

1. Experimental design

Group No. One 2 3 4 5 6 7 UV - + + + + + + sample _ _ EtOH
(15%) RA Liposomes (2%) Lipo-hpl Lipo-his-hpl volume
(Μl) - - 100 100 300 300 300

Note: His-hPL: hPL with 6 His insertions after N-terminal Met of hPL

2. Preparation of experimental animals

The experimental animals were purchased from Dooyeol Biotech, female SKH-1 hairless mice, 4 weeks old (Sungnam, Korea). The experimental animals were raised under the condition that the temperature was 24 ± 2 ℃, the relative humidity was 50 ± 10%, and the light and dark circulation was controlled in 12 hours. The animals were incubated for 2 weeks and then divided into 7 groups.

UV irradiator was used VLX-3W stimulator (Vilber Lourmat, Marne la Vallee, France). UVB irradiation was conducted three times a week for a total of 11 weeks. The dose was 30 mJ / cm2 for 1-2 weeks, 40 mJ / cm2 for 3-4 weeks, 50 mJ / cm2 for 5-9 weeks, and 60 mJ / cm2 for 10-11 weeks. Treatment of the protein and vehicle groups was applied 300 μl each 5 times a week for a total of 11 weeks. EtOH (Merck) group and retinoic acid (retinoic acid, Sigma) group was treated with 100ul each. In the case of UV treatment, the sample was applied one hour before UV irradiation. For application, the sample prepared in advance was spread evenly over the back using a No. 3 brush for art (Hwasung, Chuncheon, Korea). Each protein treatment concentration is as follows.

Protein Processing Concentration by Group group Protein Processing Concentration Group 1 Untreated, UV (-) Group 2 Untreated, UV (+) Group 3 100 μl 15% EtOH, UV (+) Group 4 0.01% retinoic acid dissolved in EtOH (final 15%), UV (+) Group 5 2% liposomes, UV (+) Group 6 Lipo-hPL (20 μg / ml), UV (+) Group 7 Lipo-his-hPL (4 μg / ml), UV (+)

3. Analysis of wrinkle improvement efficacy of Lipo-hPL using hairless mice

It is well known that thick, deep wrinkles occur in SKH-1 hairless mice when sustained UV irradiation over a long period of time. The criteria for the evaluation of the skin wrinkles in this experiment were also evaluated based on the generation of deep wrinkles formed by UV irradiation and the following criteria after 11 weeks of UV and sample treatment.

-: Not observed

*: Mild thick and deep wrinkle

**: Mild to Morderate thick and deep wrinkle

***: Morderate thick and deep wrinkles

****: Order to severe thick and deep wrinkles

*****: Severely thick and deep wrinkles

As a result of the experiment, moderate or higher wrinkles were found in groups 2 to 3 and group 5, but in groups 4 and 6 to 7, wrinkles of thickness and depth less than moderate or moderate were observed (FIG. 5).

UV (-) UV (+) UV (+) Liposome only UV (+) Lipo-hPL UV (+) Lipo-His-hPL UV (+) EtOH UV (+) Retinoic acid - ***** **** ** ** ***** **

 4. Efficacy analysis of skin elasticity and water loss of Lipo-hPL using hairless mice

Skin elasticity and water loss were measured after stabilizing the test animals for 20 minutes in a constant temperature and humidity room (temperature 22 ± 2 ℃, humidity 50 ± 10%) after 11 weeks of UV and sample treatment. Using the Multi Probe Adaptor systems, MPA580 (Courage + Khazaka, Germany), which is widely used for the evaluation of skin efficacy devices, moisture loss was measured using the Texameter, TM300 probe (Courage + Khazaka, Germany) and elasticity. The results are the average of three measurements each with a Cutometer SEM 575 probe (Courage + Khazaka, Germany) (Pressure: 500 mbar, Probe aperture: 2 mm, On-time: 1 seconds, Off-time: 1 seconds , Repetitions: 5).

Experimental results showed that the effect of Lipo-hPL on the skin elasticity was negligible, but when compared to the results of other experiments (moisture loss, wrinkle improvement, H & E staining, artificial skin test), the number of hairless mice was increased or applied in the long term. It is thought to increase skin elasticity (FIG. 6). However, in terms of water loss, the Lipo-hPL group (group 6) and Lipo-His-hPL (group 7) compared to the EtOH group (group 3), UV (+) group (group 2) and liposome group (group 5). The group showed a clear water loss prevention effect (FIG. 7).

5. Effect of UV-induced Skin Damage Inhibition of Lipo-hPL Using Hairless Mouse

Skin epidermal thickness measurement by tissue analysis was performed for 11 weeks in the back skin tissue of female SKH-1 hairless mouse treated with UV and each coating agent, and soaked in 0.1M phosphate fixative with 4% paraformaldehyde at 4 ° C. After O / N treatment, the tissue was dehydrated and embedded in paraffin to prepare blocks. Next, the tissue was cut into sections having a thickness of 3 μm using a Leica microtome, and then a slice slide was made, followed by deparaffinization and hydrolysis, followed by Herris's hematoxylin (Hematoxylin, Sigma, USA) and eosin (eosin, Alpha Chem, Inc, UK). Then, after observation with a Zeiss Axiostar Plus microscope, the image was taken using an AxioCam MR camera and the epidermal thickness was measured using Axiovision software.

Many of the substances known to be effective in improving wrinkles in experimental animals in which wrinkles are induced by UV irradiation have been reported to prevent skin epidermis thickening by UV irradiation. As shown in FIG. 8, skin wrinkles caused by UV irradiation were markedly improved with Lipo-hPL or Lipo-His-hPL treatment and histologically reduced skin epidermal thickening. Perhaps skin epidermal thickening, which is a result of abnormal processes of replication, differentiation, and detachment of basal cells by UV irradiation, is normally performed by placental lactogen to prevent homeostasis of skin epidermal basal cells. It is considered to be.

Example V: Experiment for Confirming Atopic Skin Improvement Efficacy of Lipo-hPL

1.Efficacy test of short term and long term atopic dermatitis damage of Lipo-hPL

(1) dermatitis animal model

-Experimental animals

Four-week-old male Nc / Nga mice were purchased from Orient Bio Co., Ltd., and were bred under day and night conditions for 12 hours at a temperature of 24 ± 2 ℃ and a humidity of 50 ± 10%. The experimental animals were incubated for one week in a laboratory environment after purchase, and then the experiment was conducted.

(2) atopic induction

Short-term atopic induction

   Nc / Nga mouse and other parts of the hair removal 5% TNCB 150ul was applied to increase the sensitivity, 1% TNCB was mixed with Olive Oil once a week for 6 weeks.

 Long-term atopic induction

5% TNCB 150ul was applied to remove hairs from Nc / Nga mouse to increase sensitivity, then mixed with Olive Oil with 1% TNCB and applied 22 times for 13 weeks.

(3) military composition

-Short term Lipo-hPL application group

group Dose (ul) Marisu Group 1: control group (TNCB and protein untreated group) 0 2 Group 2: TNCB treatment group 150 3 Group 3: Tacrolimus (FK506) treatment group 150 3 Group 4: Lipo-hPL (20 ug / ml) 150 3

Long-term Lipo-hPL application group

group Dose (ul) Marisu Group 1: control group (TNCB and protein untreated group) 0 3 Group 2: TNCB treatment group 150 2 Group 3: Tacrolimus (FK506) treatment group 150 2 Group 4: Lipo hPL (20 ug / ml) 150 2

(4) route of administration and frequency of administration

It was applied to the skin five times a week.

(5) Evaluation item

A) Evaluation of skin damage intensity

Each week, the condition of the skin was observed on the basis of the photographs taken of the back part, and scores were given in four stages according to four categories of erythema, edema, abrasion, and dryness (Table 7).

Item and Symptom Criteria Item Score Erythema 0 (no symptoms), 1 (mild), 2 (moderate), 3 (severe) Edema 0 (no symptoms), 1 (mild), 2 (moderate), 3 (severe) Abrasion 0 (no symptoms), 1 (mild), 2 (moderate), 3 (severe) Dryness, scaling 0 (no symptoms), 1 (mild), 2 (moderate), 3 (severe)

No symptoms; 0, seems to be symptomatic; 1, symptoms are obvious; 2, severe symptoms; 3

B) measurement of serum IgE levels

○ After the experiment, blood is collected from the abdominal vein, and then serum is obtained by centrifugation. Serum IgE levels were measured using an IgE ELISA kit (Goma Biotech, Korea).

C) skin histological observation

○ After the experiment was completed, the skin of the back was extracted and fixed in 4% paraformaldehyde, made with a paraffin block, cut into 10um thickness with a microtome, and then sliced with slides and stained with hematoxylin and eosin and observed under a microscope.

D) Skin thickness measurement

The thickness of H & E-stained tissue slides under the microscope was measured from the skin epidermis to the border of the fat and muscle layers using the function of the microscope software.

2) Efficacy test results for short and long term atopic dermatitis induced by Lipo-hPL

(1) Skin damage intensity assessment

A) Skin damage following short-term application of atopy-induced Nc / Nga mouse skin (FIG. 9)

Skin Symptom Measurement Results of Atopic Dermatitis in Nc / Nga Mouse Following Lipo-hPL Application Erythema edema abrasion inattention None treat 0 0 0 0 TNCB 8 4 9 6 FK506 3 0 3 3 Lipo-hpl 3 0 2 3

* Highscore; 10.

As can be seen from Table 9 and FIG. 10, when short-term application of Lipo-hPL was applied, skin damage caused by atopy was suppressed.

C) Changes in skin damage following long term Lipo-hPL application of atopic dermatitis-induced Nc / Nga mouse skin

Erythema edema abrasion inattention None treat 0 0 0 0 TNCB 2 2 4.5 6 FK506 1.5 1.5 3.5 3 Lipo-placental lactogen (L-hPL) One 0 0.5 1.5

* High score; 10 points

As can be seen from Table 10, FIG. 11 and FIG. 12, when long-term application of Lipo-hPL was applied, skin damage caused by atopy was suppressed.

(2) IgE measurement result in serum (FIG. 13)

Measurement of IgE Levels in Blood of Atopic Induced Nc / Nga Mice Following Lipo-hPL Application N IgE (ng / ml) S.D None treat 2 3.7 0.7 TNCB 5 99.9 16.9 FK506 3 107.1 10.6 Lipo-hpl 3 71.0 17.6

As can be seen from Table 11 and FIG. 13, when long-term application of Lipo-hPL was applied, skin damage caused by atopy was suppressed.

(3) skin histological observation

A) Short-term application of Lipo-hPL (Fig. 14)

B) Long term application of Lipo-hPL (FIG. 15)

(4) Skin thickness change of fms atopy-induced induced Nc / Nga mouse following application of Lipo-hPL (FIG. 16)

2. Efficacy Test Results and Discussion on Atopic Dermal Skin Damage According to Lipo-hPL Application

1) Efficacy test for short and long term atopic dermatitis caused by application of Lipo-hPL

(1) Efficacy of Lipo-hPL on Atopic Skin Damage

○ Compared to the control group that did not apply any of the Nc / Nga mice to which Lipo-hPL was applied for a short period of time, the skin damage occurred in 9.0 ± 0.8 value in the TNCB group that induced atopy, and the (3.0 ± 0.3) ), Lipo-hPL application group showed a (2.7 ± 0.2) value of inhibiting skin damage. In addition, it was confirmed that the TNCB group, which had not applied anything for a long time, had skin damage with a value of 3.6 ± 0.7, and FK506 (2.4 ± 0.7) and Lipo-hPL (0.8 ± 0.4) showed inhibitory effect.

(2) Skin thickness and epidermal thickness change

○ The mean value of the normal control group was 289.5 ± 9.3mm, whereas the mean value of the TNCB group was 464.9 ± 34.8㎛, which increased the skin thickness by 1.6 times.In the FK506 (408.8 ± 23.4㎛) and Lipo-hPL (366.8 ± 24.2) groups, It was shown to decrease compared to the TNCB treatment group. In addition, normal control, FK506 and Lipo-hPL were observed with similar epidermal thickness, but TNCB group was about 10 times thicker.

(3) Blood immunoglobulin E (IgE) measurement

The value of the normal control group was the lowest (3.7 ± 0.7), and the TNCB group was high (99.9 ± 16.9). FK506, known as a steroidal immunosuppressant, was the highest among the experimental groups (107.1 ± 10.6) and Lipo-hPL was reduced to (71.0 ± 17.6).

(4) skin histological analysis

○ Compared to the normal control group, TNCB group showed abnormal infiltration of immune cells and migration of multidirectional erythrocytes. Eosinophile was slightly decreased in FK506 or Lipo-hPL group. Showed a similar level of keratin development to the normal control group.

3. Conclusion

Lipo-hPL has the effect of improving atopic dermatitis by reducing short and long term skin damage caused by atopic dermatitis agents and inhibiting abnormal thickening and keratinization of the epidermis.

Having described the specific part of the present invention in detail, it is apparent to those skilled in the art that the specific technology is merely a preferred embodiment, and the scope of the present invention is not limited thereto. Thus, the substantial scope of the present invention will be defined by the appended claims and equivalents thereof.

<110> Regeron, Inc. <120> Compositions for Improving Skin Conditions Comprising Human          Placental Lactogen as an Active Ingredient <160> 9 <170> KopatentIn 1.71 <210> 1 <211> 36 <212> DNA <213> Artificial Sequence <220> Primer Nucleotide Sequence of Human Placental Lactogen (hPL 1U) <400> 1 gggaattcca tatggctcca ggctcaaacc gttccc 36 <210> 2 <211> 34 <212> DNA <213> Artificial Sequence <220> Primer Nucleotide Sequence of Human Placental Lactogen (hPL 2D) <400> 2 ataggtttct tcaaactcct ggtaggtgtc aatg 34 <210> 3 <211> 34 <212> DNA <213> Artificial Sequence <220> Primer Nucleotide Sequence of Human Placental Lactogen (hPL 3U) <400> 3 taccaggagt ttgaagaaac ctatatccca aagg 34 <210> 4 <211> 33 <212> DNA <213> Artificial Sequence <220> Primer Nucleotide Sequence of Human Placental Lactogen (hPL 4D) <400> 4 cagctctaga ttggatttct gttgcgtttc ctc 33 <210> 5 <211> 33 <212> DNA <213> Artificial Sequence <220> Primer Nucleotide Sequence of Human Placental Lactogen (hPL 5U) <400> 5 caacagaaat ccaatctaga gctgctccgc atc 33 <210> 6 <211> 31 <212> DNA <213> Artificial Sequence <220> Primer Nucleotide Sequence of Human Placental Lactogen (hPL 6D) <400> 6 gtcttccagc ctccccatca gcgtttggat g 31 <210> 7 <211> 30 <212> DNA <213> Artificial Sequence <220> Primer Nucleotide Sequence of Human Placental Lactogen (hPL 7U) <400> 7 acgctgatgg ggaggctgga agacggcagc 30 <210> 8 <211> 28 <212> DNA <213> Artificial Sequence <220> Primer Nucleotide Sequence of Human Placental Lactogen (hPL 8D) <400> 8 cggggtaccc tagaagccac agctgccc 28 <210> 9 <211> 34 <212> DNA <213> Artificial Sequence <220> Primer Nucleotide Sequence of Human Placental Lactogen (hPL 9U) <400> 9 gggaattcca tatggtccaa accgttccct tatc 34

Claims (6)

Human placental lactogen (Human Placental Lactogen, hPL) composition for improving skin conditions (conditions) comprising as an active ingredient.
The composition for improving skin condition according to claim 1, wherein the human placental lactogen is surrounded by liposomes.
The composition for improving skin condition according to claim 2, wherein the liposome is a nanoliposome.
The method of claim 1, wherein the improvement of the skin condition is to treat or improve acne, to treat or improve atopic skin, to improve wrinkles, to whiten, to remove blotch, to improve skin elasticity, to promote hair growth, to prevent or improve skin aging, or to improve skin hydration. Composition for improving skin condition, characterized in that.
The composition for improving skin condition according to claim 4, wherein the improvement of the skin condition is treatment or improvement of atopic skin, wrinkle improvement, skin elasticity improvement, skin aging prevention or skin moisturization improvement.
The composition for improving skin condition according to claim 1, wherein the composition is a cosmetic composition or a pharmaceutical composition.

Images