KR20110118084A - Multipotent adult stem cells derived from tympanic membrane tissue, preparation method thereof and differentiated cells from the stem cells - Google Patents

Abstract

The present invention relates to a multipotent adult stem cell derived from tympanic tissue, a method for preparing the same, and a cell differentiated from the same. More specifically, the step of culturing human tympanic tissue in DMEM medium without serum; Incubating with 0.2-0.3% trypsin-EDTA followed by 8-12 ug / ml of protease or DNase, followed by centrifugation to remove supernatant; After culture by adding 0.2-0.3% of trypsin-EDTA to the pellet from which the supernatant was removed, pipetting the same by adding the same amount of fetal calf serum (FBS) and then centrifuging ; And pellets obtained after centrifugation by adding 15-25 ng of bFGF at intervals of 2 to 3 days while incubating on inert fetal bovine serum and antibiotic containing minimal essential medium (MEM-a) medium for 5 to 12 days. A method for producing multipotent adult stem cells derived from human tympanic tissue, comprising the step of culturing and culturing the adult stem cells in a medium for culturing the target differentiated cells and the target differentiated cells expressing markers of the target differentiated cells during the culturing. It relates to a method for producing differentiated cells from multipotent adult stem cells derived from human tympanic tissue comprising the step of separating.

Description

Multipotent adult stem cells derived from tympanic membrane tissue, preparation method about and differentiated cells from the stem cells}

The present invention relates to multipotent adult stem cells derived from tympanic tissue, methods for preparing the same, and cells differentiated therefrom. More specifically, the method for producing multipotent adult stem cells from human tympanic tissue and the adult stem cells It relates to a method for differentiating into neural cell precursors, hair cells and neurons.

Recently, when cells are destroyed or damaged by disease, cell replacement therapy that supplies cells from the outside has been suggested as an effective treatment, especially stem cells capable of proliferation and differentiation into tissues requiring regeneration. cell) is in the spotlight.

As interest in stem cell research increased, pluripotent stem cells with the ability to form all organs through proliferation and differentiation were recognized as being able to fundamentally solve organ damage as well as treat most diseases. The application of stem cells has been suggested in a variety of ways, from the treatment of almost all organ regeneration to the treatment of Parkinson's disease, which was incurable disease, various cancers, diabetes and spinal cord injury.

Stem cells are cells that have the ability to self-replicate and differentiate into two or more cells, totipotent stem cells, pluripotent stem cells, and c. It can be classified as multipotent stem cells.

Pluripotent stem cells are pluripotent cells that can develop into a complete individual. Cells up to 8 cell stages after fertilization of eggs and sperm have these properties. If you transplant it into a single, complete entity. Pluripotent stem cells are cells that can develop into a variety of cells and tissues derived from ectoderm, mesoderm, and endodermal layer. Internal lumps of blastocyst appear 4 to 5 days after fertilization. It originates from the inner cell mass, called embryonic stem cells, and differentiates into a variety of other tissue cells, but does not form new life. Multipotent stem cells are stem cells that can only differentiate into specific cells that form the tissues and organs that contain them.

In particular, pluripotent stem cells were first isolated from adult bone marrow (Y. Jiang et al., Nature , 418: 41, 2002) and subsequently identified in several other adult tissues (CM Verfaillie, Trends Cell Biol ., 12: 502, 2002) Bone marrow is used as the most widely known source of stem cells. However, stem cells in adult tissues such as bone marrow are very rare, and these cells are difficult to induce differentiation and culture, making them difficult to culture without specifically screened media. That is, it is very difficult to separate stem cells and preserve them in vitro.

In recent years, adipose tissue has been found to be a new source of pluripotent stem cells (B. Cousin et al., BBRC . , 301: 1016, 2003; A. Miranville et al., Circulation, 110: 349, 2004; S. Gronthos et al., J. Cell Physiol . , 189: 54), ie, human adipose tissue obtained by liposuction contains undifferentiated cell populations, which in the laboratory are cells that have differentiation potential to adipocytes, osteoblasts, myoblasts and chondrocytes Reported (PAZuk et al., Tissue Eng . , 7: 211, 2001; AM Rodriguez et al., BBRC ., 315: 255, 2004). Therefore, recent studies have shown that adipose tissue-derived cells have the ability to promote muscle regeneration and neurovascular differentiation through animal model experiments, thereby emerging as a new source of stem cells.

Human stem cells, on the other hand, are totipotential or pluripotential precursor cells capable of generating a variety of adult cell lineages. This ability serves as the basis for the differentiation and specialization of cells required for organ and tissue development. Recently, the success of such stem cell transplantation has provided new clinical tools for reconstructing or replenishing bone marrow after myeloablation due to exposure to disease, toxic chemicals or radiation. Additional evidence has been reported to demonstrate that stem cells can be used to repopulate many, but not all, tissues and restore physiological and anatomical function. In addition, the application of stem cells in tissue engineering, gene therapy and cell therapies is rapidly progressing.

Therefore, as the interest in stem cells having high therapeutic utility increases, there is an urgent need for development and manufacture of stem cells from various tissues.

It is therefore an object of the present invention to provide a method for producing multipotent adult stem cells derived from human tympanic tissue having the ability to differentiate into various cells from human tympanic tissue.

In addition, another object of the present invention is a method for producing a cell differentiated from human multi-maturity adult stem cells derived from human tympanic tissue comprising the step of culturing multi-differentiated adult stem cells derived from human tympanic tissue in the culture medium for the purpose of differentiating cells. To provide.

In addition, another object of the present invention is to provide a composition for the prevention or treatment of ear diseases comprising the cells differentiated by the method of the present invention as an active ingredient.

In addition, another object of the present invention is to provide a cell therapy agent for the formation of ear tissue containing the tympanic tissue-derived multipotent adult stem cells according to the present invention as an active ingredient.

In order to achieve the object of the present invention as described above, the present invention,

Culturing human eardrum tissue in DMEM medium without serum;

Cultured by adding 0.2-0.3% trypsin-EDTA, followed by 8-12 ug / ml of protease or DNase, and then centrifuging to remove supernatant;

After culture by adding 0.2-0.3% of trypsin-EDTA to the pellet from which the supernatant was removed, pipetting the same by adding the same amount of fetal calf serum (FBS) and then centrifuging ; And

The pellets obtained after centrifugation were incubated on inactivated fetal bovine serum and antibiotics containing minimal essential medium alpha (MEM-a), and cultured for 5-12 days by adding 15-25ng of bFGF at 2-3 days intervals. It provides a method for producing multipotent adult stem cells derived from human tympanic tissue, comprising the steps of:

In addition, the present invention comprises the steps of culturing the multipotent adult stem cells prepared by the method of the present invention in a medium for culturing the target differentiating cells and separating the target differentiated cells expressing a marker of the target differentiating cells during the culturing. Provided are methods for producing differentiated cells from multipotent adult stem cells derived from human tympanic tissue.

In one embodiment of the present invention, the target differentiated cells may be neuronal cell precursors, neurons or hair cells.

In one embodiment of the present invention, the neuronal cell precursor comprises the adult stem cells with DMEM: F12 of 1: 1-5: 1, 0.01-0.03ml / ml of B-27 supplement, L-glutamine 1 to 3mM, 5-15ng / ml EGF, 15-25ng / ml bFGF and 0.5-1.5% antibiotics may be differentiated by culturing in culture medium for neural cell precursor differentiation.

In one embodiment of the present invention, the neurons or hair cells are B-27 supplement 0.01 ~ 0.03ml / ml, L- glutamine 1 ~ 3mM, neuroblast-derived neurons in neuronal culture medium (neurobasal medium) Growth factor (Grial-derived neurotprophin factor (GDNF) 5 ~ 15ng / ml, Brain-derived neutrophin factor (BDNF) 5 ~ 15ng / ml and Neurotrophin-3 (Neurotrophin-3: NT- 3) may be differentiated by culturing in a culture medium for neuron or hair cell differentiation containing 5 ~ 15ng / ml and 0.5 ~ 1.5% antibiotics.

In one embodiment of the present invention, the culturing may be to incubate at a temperature of 36 ~ 38 ℃ and 4 ~ 6% carbon dioxide conditions for 5 to 15 days.

In one embodiment of the present invention, the neuronal cell precursor expresses a marker of a target differentiated cell selected from the group consisting of nestin, GFAP, myosin VIIA, TRPA1, BMP4 and BMP7; The neurons express markers of target differentiated cells selected from the group consisting of NF, GFAP, S-100, Nestin, BMP4, BMP7, tubulin and MAP2; And the hair cells may express a marker of the target differentiation cells selected from the group consisting of nestin (nestin), myosin VIIA, BMP4, BMP7 and myosin VIIA.

In addition, the present invention provides a composition for the prevention or treatment of ear diseases comprising neuronal cell precursors, neurons or hair cells differentiated from multipotent adult stem cells derived from human tympanic tissue as an active ingredient.

In one embodiment of the present invention, the ear disease may be selected from the group consisting of tinnitus, deafness, otitis media and vertigo.

In another aspect, the present invention provides a cell therapy agent for the formation of ear tissue containing a multi-differentiated adult stem cells derived from tympanic tissue according to the present invention having the characteristics of differentiating into neural cell precursors, neurons or hair cells.

Adult stem cells derived from the tympanic tissue according to the present invention, when cultured in differentiation induction medium containing different neuronal growth factors, have a differentiation capacity that can be differentiated into neuronal cell precursors, neurons and hair cells, respectively. , The adult stem cells derived from the tympanic tissue and the neural cell precursors, neurons and hair cells of the present invention differentiated from the adult stem cells have an effect that can be used in the field of cell replacement therapy and regenerative medicine for the treatment of ear diseases, Not only can it be used as a material for developing new drugs for the treatment of ear diseases, but it can also be widely used in the basic research fields related to ear diseases.

Figure 1 shows the microscopic observation of the shape of adult stem cells derived from the tympanic membrane by incubating cells isolated from human tympanic tissue for 5 days in MEM-alpha medium containing 10% FBS.
Figure 2 shows a photograph of the adult stem cells derived from tympanic tissue tissue cultured in the medium for inducing neuronal differentiation 15 days after differentiation of the differentiated neurons through a microscope.
Figure 3 shows the microscopic observation of the precursor cell cultured in the media for the differentiation of adult stem cells derived from the tympanic tissue precursors for each culture period, 3a shows the cells observed on the 7th day of culture, 3b shows the appearance of the cells on day 14 of culture and 3c and 3d on day 21 of culture.
4 is a photograph showing fluorescence microscopy of BrdU-labeled cells in cells differentiated into neural cell precursors, (a) is visualized with ALEXA 555, and (b) is DAPI, cells through staining. It shows that the nucleus of the precursor was dyed, and (c) merged the pictures of (a) and (b).
5 shows a photograph observed through fluorescence microscopy whether the specific marker marker of each cell is expressed in differentiated cells, (a) shows a cell precursor expressing the neuron precursor marker Nestin, (b) represents myocytic 7a, a hair cell marker, (c) represents TRPA1, (d) represents GFAP, a glial cell marker, (e) S-100, and (f) neuronal marker Phosphorus beta III-tubulin, (g) shows a picture observing the expression of NF.
FIG. 6 is a photograph showing an analysis of the morphology of cells expressing markers in cells differentiated from neural stem cells by immunochemical method. (A) shows neural precursor cells labeled with Nestin. (b) neurons labeled with beta III-tubulin, (c) neurons labeled with NF, (d) Glial cells labeled with GFAP, (e) labeled S-100 The photograph shows the morphology of glial cells.
Figure 7 shows the results of analysis of the morphology of the hair cells differentiated from neural stem cells by immunochemical method, the top three pictures of Figure 7 is a photomicrograph showing the hair cells labeled with TRPA1 by fluorescence microscope, the bottom 3 The photograph of the dog shows the fluorescence microscope of the hair cells labeled with myosin 7a.
FIG. 8 shows the results of confirming the expression level of Nestin, BMP4, BMP7, and myosin VIIa in differentiated neuronal cell precursors by culturing adult stem cells derived from tympanic tissue in a media for inducing neural cell precursor differentiation through RT-PCR. It is shown.
FIG. 9 shows RT-expression of nestin, BMP4, BMP7, S-100, GFAP, tubulin, and MAP2 in differentiated neurons by culturing adult stem cells derived from tympanic tissue in a medium for inducing differentiation of neurons. It shows the result confirmed by PCR.
FIG. 10 shows the results obtained by culturing adult stem cells derived from tympanic tissue in a medium for inducing hair cell differentiation, and expressing the expression levels of nestin, BMP4, BMP7, and myosin VIIa in differentiated hair cells by RT-PCR. .
Figure 11 shows the results confirmed by RT-PCR expression of myosin VIIa in differentiated hair cells in one embodiment of the present invention, the left figure shows the culture for 7 days, the right side was cultured for 14 days Where Sp is a cell precursor culture medium and Ne is a neuronal cell culture medium.

The present invention is characterized by providing a method for producing adult stem cells having a multipotent ability to differentiate into various cells from human tympanic tissue.

As used herein, the multipotent (or pluripotent) refers to having the ability to grow in any subset of about 260 cell types of the mammalian body, wherein multipotent stem cells include these cells. Stem cells that can only differentiate into cells specific to the tissues and organs present in the tissues and organs, and are capable of maintaining the homeostasis and regeneration of adult tissues as well as the growth and development of individual tissues and organs in prenatal, neonatal and adulthood. Tissue-specific pluripotent cells are collectively called adult stem cells, and adult stem cells are cells that have already been collected from various organs of the human body and have developed stem cells.

In addition, the differentiation refers to a phenomenon in which structures or functions are specialized to each other during cell division, proliferation, and growth, that is, cells or tissues of an organism change shape or function in order to perform a task given to each other. A simple system is the separation of two or more qualitatively different sub systems.

On the other hand, the present inventors have recently obtained stem cells, which have been spotlighted for cell therapeutic use, from tympanic tissue that has not been found so far. In general, the tympanic membrane is a thin, transparent 0.1 mm thick membrane located at the boundary between the outer and middle ear. It is known to play a role of vibrating the transmitted sound waves. The tympanic membrane consists of three layers of skin layer, middle layer, and mucosal layer, and the sound waves transmitted to the scavenging bone through these membranes are transferred to the cochlea of the inner ear.

In addition, the tympanic membrane ruptures due to acute otitis media or external shock, which usually results in natural healing. However, if otitis media becomes chronic, the eardrum may remain ruptured, causing hearing loss or hearing loss.

In the present invention, as a new source of stem cells used a tympanic membrane having the characteristics as described above, the tympanic tissue that can be used in the present invention can be used as long as mammalian tympanic tissue, preferably human tympanic tissue Can be.

The method for producing multipotent adult stem cells derived from human tympanic tissue according to the present invention preferably comprises culturing human tympanic tissue in DMEM medium without serum; Incubating with 0.2-0.3% trypsin-EDTA followed by 8-12 ug / ml of protease or DNase, followed by centrifugation to remove supernatant; After culture by adding 0.2-0.3% of trypsin-EDTA to the pellet from which the supernatant was removed, pipetting the same by adding the same amount of fetal calf serum (FBS) and then centrifuging ; And pellets obtained after centrifugation by adding 15-25 ng of bFGF at intervals of 2 to 3 days while incubating on inert fetal bovine serum and antibiotic containing minimal essential medium (MEM-a) medium for 5 to 12 days. It may include culturing.

In one embodiment of the present invention, the tympanic tissue is used as a tympanic tissue collected under the consent of the patient, preferably using a homogenizer, mortar, blender, surgical mass, injection paper, forceps or ultrasound device. The eardrum tissue can be finely cut and used by means.

In addition, the centrifugation may be performed at a temperature of 4 ℃ for 3 to 7 minutes at a speed of 800 ~ 1200rpm.

As a medium for isolating and culturing adult stem cells from the isolated human tympanic tissue, a minimal essential medium alpha (MEM-a) medium containing inactivated fetal bovine serum and antibiotics may be used, wherein the inactivated bovine Fetal serum is a fetal bovine serum that has been deactivated by heat treatment, and preferably fetal bovine serum deactivated by heat treatment for 20 to 40 minutes at a temperature of 50 to 60 ° C.

As the antibiotic, any antibiotic for mammalian cell culture that is commonly used may be used, and preferably penicillin or streptomycin may be used.

In addition, while culturing the cells of human tympanic tissue isolated using the minimum essential medium alpha (MEM-a) culture, it can be cultured for 5 to 12 days by adding 15 to 25ng of bFGF every 2-3 days. After culturing, the floating layer is removed and only the cells adhered to the bottom are separated and passaged to obtain adult stem cells derived from human tympanic tissue. At this time, the passage culture can be passaged up to 3 to 5 generations, in one embodiment of the present invention by passage passage up to 3 generations to obtain adult stem cells.

On the other hand, adult stem cells derived from human tympanic tissue according to the present invention is pluripotent and thus can be differentiated into various types of cells constituting the human body.

The method of differentiating stem cells into specific types of cells can differentiate stem cells according to the present invention into cells of a desired type (hereinafter referred to as target differentiation cells) based on methods known in the art.

Preferably, the method of differentiating the multipotent adult stem cells derived from tympanic tissue into the differentiated cells of interest according to the present invention comprises the steps of culturing the adult stem cells in a medium for culturing the target differentiated cells and a marker of the target differentiated cells during the culture. Isolating the desired differentiated cells to be expressed.

In addition, whether or not the cells in culture are preferably differentiated into target differentiated cells can be analyzed by confirming the presence of marker expression of the differentiated cells of interest, the analysis is not limited thereto, RT-PCR, Western blot, immune Chemical staining and ELISA can be used.

Adult stem cells derived from tympanic tissue according to the present invention are differentiated into neural cell precursors, neurons or hair cells by culturing in a culture medium for differentiation of the target cells containing different nerve growth factors capable of inducing differentiation into specific cells. You can.

That is, the differentiation of adult stem cells into neural cell precursors may be a medium containing a neural growth factor of EGF or bFGF, preferably DMEM: F12 is contained 1: 1 to 5: 1, B-27 Cultured in different media for neuronal cell progenitor differentiation containing 0.01 to 0.03 ml / ml supplement, 1 to 3 mM L-glutamine, 5 to 15 ng / ml EGF, 15 to 25 ng / ml bFGF, and 0.5 to 1.5% antibiotics It can differentiate by making it.

The epidermal growth factor (EGF), which is a growth factor used for differentiation into neural cell precursors, is derived from submaxillary glands and bruners gland, and mesenchymal stem cells and glial cells. It is known to enhance the differentiation of the back. In addition, bFGF, a stromal fibroblast growth factor that can be obtained in most of the human body, is known to promote wound healing and cell differentiation.

In addition, the differentiation into the neurons or hair cells may be used a medium containing a nerve growth factor of GDNF, BDNF or NT-3, preferably B-27 supplement 0.01 in a neurobasal medium (neurobasal medium) ~ 0.03ml / ml, L-glutamine 1 ~ 3mM, GlF-Grial-derived neurotprophin factor (GDNF) 5 ~ 15ng / ml, Brain-derived neutrophin factor (BDNF) 5-15 ng / ml and neurotrophin-3 (Neurotrophin-3: NT-3) can be differentiated by culturing in a medium for neuronal or hair cell differentiation containing 5-15 ng / ml and 0.5-1.5% of antibiotics. have.

At this time, the nerve cell culture medium (neurobasal medium) can be used as long as the usual nerve cell culture medium sold in the market, in one embodiment of the present invention was used to purchase a neurobasal ^TM medium sold by GIBCO.

Brain-derived neutrophin factor (BDNF), a growth factor used for differentiation into neurons or hair cells, is neurotrophin, which is most abundantly distributed in the brain, to promote the growth of neurons. It is known to act to regulate the synthesis, metabolism, release and neuronal activity of neurotransmitters. The glia-derived neurotprophin factor (GDNF) and neurotrophin-3 (NT-3) are known to act to promote the growth of glial cells, astrocytes and neurons. .

In the method according to the present invention, the culture for differentiation into neural cell precursors, hair cells and neurons may be cultured at 36-38 ° C. and 4-6% carbon dioxide conditions for 5 to 15 days.

On the other hand, the present inventors differentiated in a medium containing a specific nerve growth factor in one embodiment of the present invention in order to determine whether the target cells are well differentiated from adult stem cells derived from tympanic tissue through the method according to the present invention. Differentiated cells were identified by expression of marker proteins for specific cells in each of the cells, and RT-PCR and immunization were performed on cells differentiated in a medium containing neuronal growth factor of EGF or bFGF. Fluorescence staining revealed that GFAP, a glial cell marker, and myosin, VIIA and TRAP1, were expressed, including nestin, a marker of neural stem cells.

In addition, as a result of confirming the differentiation into neurons, the neuronal marker NF was expressed, and in addition, the neuroglial markers GFAP and S-100 were expressed by immunofluorescence staining.

In addition, as a result of confirming the differentiation into hair cells, it was confirmed that myosin VIIA, which is a marker of hair cells, was expressed, and thus, stem cells derived from the tympanic membrane could be differentiated into specific hair cells of the inner ear.

Therefore, the neuronal cell precursors, neurons and hair cells differentiated from the adult stem cells derived from the tympanic membrane tissues are characterized by expressing markers of the differentiated cells, respectively. Can express markers of target differentiated cells selected from the group consisting of stin, GFAP, myosin VIIA, TRPA1, BMP4 and BMP7, wherein the neurons are NF, GFAP, S-100, nestin, BMP4, BMP7, tubulin and MAP2 can express a marker of the target differentiation cell selected from the group consisting of, the hair cells are selected from the group consisting of nestin (mystin, myosin VIIA, BMP4, BMP7 and myosin VIIA) The marker of the differentiated cells of interest can be expressed.

As described above, the present inventors have found that multipotent adult stem cells isolated from human tympanic tissue can be well differentiated into neuronal cell precursors, neurons and hair cells, respectively. It was found that the differentiated cells can be used for cell therapy.

In general, in the case of stem cells, when tissues or organs are damaged or fail to function due to the disease, they can be used to treat diseases by differentiating them into cells of interest and transplanting them in desired areas. They can be used to treat a variety of diseases because they can differentiate into all types of cells, but they are difficult to obtain and are not used in clinical practice due to ethical problems. Therefore, the development of adult stem cells in recent years to replace this situation is active. Therefore, the present invention can provide a composition for the prevention or treatment of otic diseases comprising neuronal cell precursors, neurons or hair cells differentiated from multipotent adult stem cells derived from human tympanic tissue, as well as neuronal cell precursors. It can provide a cell therapeutic agent for the formation of ear tissue containing the tympanic tissue-derived multipotent adult stem cells of the present invention having the characteristics of differentiating into neurons or hair cells as an active ingredient.

The type of the ear disease in the present invention is not limited thereto, but may be tinnitus, hearing loss, otitis media and vertigo.

In addition, the composition for preventing or treating ear diseases, including the multi-functional adult stem cells derived from the tympanic tissue of the present invention or neuronal cell precursors, neurons or hair cells differentiated from the adult stem cells as an active ingredient, It can also be used for treatment, reconstructing or regenerating osseous bone, and for tympanic substitutes.

The cell therapeutic agent used in the present invention is a cell and tissue prepared by separating, culturing and special treatment from humans, and are used as a medicine used for the purpose of treatment, diagnosis, and prevention. Or it refers to a drug that is used for the purpose of treatment, diagnosis and prevention through a series of actions, such as proliferation and selection of heterogeneous cells in vitro or by altering the biological properties of the cells in other ways. Cell therapy may be classified into somatic cell therapy and stem cell therapy, depending on the degree of cell differentiation.

The composition for preventing or treating the otic diseases according to the present invention may include a neuronal cell precursor, neurons and hair cells differentiated from a pharmaceutically effective amount of adult stem cells derived from tympanic tissue alone or may be one or more pharmaceutically acceptable. Carrier, excipient or diluent. The pharmaceutically effective amount herein refers to an amount sufficient to prevent, ameliorate and treat ear diseases.

The pharmaceutically effective amount of neural cell precursors, neurons and hair cells differentiated from the adult stem cells derived from tympanic tissue according to the present invention is 0.5 to 100 mg / day / kg body weight, preferably 0.5 to 5 mg / day / kg body weight to be. However, the pharmaceutically effective amount may be appropriately changed depending on the degree of symptoms of hearing loss, the age, weight, health condition, sex, route of administration and duration of treatment of the patient.

The pharmaceutical composition according to the present invention may further include a pharmaceutically acceptable carrier. The term "pharmaceutically acceptable" as used herein refers to a composition that is physiologically acceptable and does not normally cause an allergic reaction such as gastrointestinal disorder, dizziness, or the like when administered to humans. Pharmaceutically acceptable carriers include, for example, carriers for oral administration such as lactose, starch, cellulose derivatives, magnesium stearate, stearic acid and the like, and parenteral administration such as water, suitable oils, saline, aqueous glucose and glycols, and the like. And the like may further comprise stabilizers and preservatives. Suitable stabilizers include antioxidants such as sodium hydrogen sulfite, sodium sulfite or ascorbic acid. Suitable preservatives include benzalkonium chloride, methyl- or propyl-paraben and chlorobutanol. Other pharmaceutically acceptable carriers can be found in Remington's Pharmaceutical Sciences, 19th ed., Mack Publishing Company, Easton, Pa., 1995).

The pharmaceutical composition according to the present invention may be formulated in a suitable form according to methods known in the art together with the pharmaceutically acceptable carrier as described above. That is, the pharmaceutical composition of the present invention can be prepared in various parenteral or oral dosage forms according to known methods, and isotonic aqueous solution or suspension is preferable as an injectable formulation as a typical parenteral dosage form. Injectable formulations may be prepared according to techniques known in the art using suitable dispersing or wetting agents and suspending agents. For example, each component may be formulated for injection by dissolving in saline or buffer. In addition, formulations for oral administration include, but are not limited to, powders, granules, tablets, pills and capsules.

Pharmaceutical compositions formulated in such a manner can be administered in an effective amount via several routes including transdermal, subcutaneous, intravenous or muscle. As used herein, the term 'effective amount' refers to an amount exhibiting a prophylactic or therapeutic effect when administered to a patient. The dosage of the pharmaceutical composition according to the present invention may be appropriately selected depending on the route of administration, subject to administration, age, gender weight, individual difference and disease state. Preferably, the pharmaceutical composition of the present invention may vary the content of the active ingredient according to the degree of disease, preferably 1 to 10000 mg / weight kg / day, more preferably 10 to 1000 mg / weight kg / day It may be administered several times a day at an effective dose of. In addition, the composition for preventing or treating ear diseases according to the present invention may be administered in parallel with known compounds having the effect of preventing, improving or treating ear diseases.

Hereinafter, the present invention will be described in detail by way of examples. However, these examples are intended to illustrate the present invention in more detail, and the scope of the present invention is not limited to these examples.

< Example  1>

In the eardrum Adult stem cell  Isolation and Culture

The tympanic membrane Tissue obtained with the consent of tympanic surgery patients in compliance with IRB approval (KCMC07BR059) was stored in DMEM (Dulbecco's Modified Eagle's Medium, Gibco, Grand Island, NY) medium without serum. 10 ml of 0.25% trypsin EDTA (Gibco, Grand Island, NY) was added thereto and incubated in a water bath maintained at 37 ° C. for 2 hours. Subsequently, 10 μg / ml of DNase inhibitor (Roche, Indianapolis, IN) was added to the mixture to inhibit the action of DNase and protease, followed by reaction at room temperature for 5 minutes, followed by centrifugation while maintaining 4 ° C. at 1000 rpm for 5 minutes. It was. After centrifugation, the supernatant was removed and 10 ml of 0.25% trypsin EDTA was added and incubated for 1 hour in a water bath. For inactivation of EDTA, 10 ml of FBS (Fetal Bovine Serum, Invitrogen, Grand Island, NY) was added and pipetting was performed about 20 times, and centrifuged for 5 minutes while maintaining at 1000 rpm 4 ℃. Finally, the remaining pellet contains 10% FBS (Fetal Bovine Serum, Invitrogen, Grand Island, NY) and 1% penicillin-streptomycin (P / S, Gibco, Grand Island, NY) inactivated for 30 minutes at 56 ° C. Cells were cultured in the minimum essential medium alpha [MEM-alpha, (+) glucose, Gibco]. After incubation, 20 ng / ml of bFGF was added every 2 days, and after 10 days of incubation, the suspension layer was removed and only the cells attached to the culture dish were washed and cultured. The culture solution was changed every three days, and only stem cells passaged up to 3 generations were used in the following experiments, and the shape of the passaged cells was observed through a microscope.

As a result, as shown in Figure 1, the cells isolated and cultured in the human eardrum was found to change to fibroblast-like cells as the number of subcultures increased, the cells were aggregated It appeared to be spherical.

< Example  2>

Person Tympanic  Differentiation of Stem Cells into Neural Cell Precursors, Hair Cells, and Neurons

Stem cells derived from human tympanic tissue isolated in Example 1 were passaged three times, and treated with neurotrophin factor differently in culture medium in which the cells grow to neuronal cell precursors, hair cells, and neurons. Differentiation was induced as follows.

<2-1> Nervous system precursors ( Neurosphere Eruption

In order to confirm whether the stem cells derived from human tympanic membrane extracted in Example 1 are differentiated into neuronal cell precursors, the neuronal growth factor was treated in culture medium and the neural cell precursors were confirmed. That is, the differentiation into neural cell precursors was added to the culture medium by adding 20 ng / ml of EGF (Invitrogen) and 10 ng / ml of bFGF (Invitrogen), and then cultured for 14 days to differentiate them. 10 ng / ml of bFGF was added to the cultures three times at intervals, and the conditions for differentiation into neuronal cell precursors are as shown in Table 1 below.

<2-2> Differentiation into hair cells and neurons

Differentiation into hair cells and neurons was induced by changing the composition differently from the culture medium for differentiation into the neuronal cell precursors of <2-1>. That is, the basal medium used the neurobasal medium and the neuronal growth factor added at this time. As the growth factors of the nervous system of GDNF (Invitrogen), BDNF (Invitrogen) and NT3 (Invitrogen) were used. In addition, differentiation conditions into hair cells and neurons are as shown in Table 1 below.

Differentiation conditions into neural cell precursors, hair cells and neurons Neural System Precursor Culture Medium
(Total volume: 50 ml) Neuronal or Hair Cell Culture Media
(Total volume: 50 ml) DMEM: F12 (1: 1) Neurobasal medium B-27 supplement 1ml B-27 supplement 1ml L-Glutamine 2 mM L-Glutamine 2 mM EGF 10 ng / ml GDNF 10 ng / ml bFGF 20 ng / ml BDNF 10 ng / ml 1% Penicilin-Streptomycin NT3 10 ng / ml 1% Penicilin-Streptomycin

In the culture medium used for differentiation into neurons or hair cells in Table 1, the Neurobasal Medium used was purchased from GIBCO (Cat. No: 21103).

As a result of the experiment, as shown in FIG. 2, the stem cells derived from the eardrum were cultured under neuronal differentiation conditions. As a result, the neurons were differentiated into neurons. As a result of analyzing the degree of differentiation into neural cell precursors, as shown in FIG. 3, it was found that the cells amplified on the 21st day of culture showed the form of neural cell precursors (see FIGS. 3C and 3D). In addition, the neuronal cell precursors formed as shown in Figures 3c and 3d had the ability of self-renewal, and these precursor forms were shown to be maintained continuously during 4 passage cultures. Therefore, it was found that neural cell precursors differentiated by the method of the present invention can play a role as precursor cells having self-renewal and proliferative capacity.

<Example 3>

Expression Analysis of Neural System Precursors, Hair Cells and Neurons by Immunofluorescence Staining

Stem cells were isolated from human tympanum and cultured three times for passage in the Lab-Tec 4-well Chamber Slide (Nalgene Nunc International, Rochester, NY) by counting 1x10 ⁴ cells / well and dividing them. Differentiation was induced into neural cell precursors, hair cells and neurons under culture conditions. Subsequently, immunofluorescence staining was performed to determine whether stem cells were induced to differentiate into neural cell precursors, hair cells, and neurons. That is, BrdU (5-, known as a marker of proliferating cells to identify specific divisions). Bromo-2'-deoxy-uridine Labeling and Detection Kit, Roche, Indianapolis, IN) was used to label BrdU for 24 hours. The washing buffer used was 3% BSA (Bovine Serum Albumin, 12 Willams Ave Keilor East). , VIC 3033, Australia) was used, and the labeled cells were washed three times. Thereafter, 4% paraformaldehyde was fixed for 20 minutes and treated with 0.5% Triton X-100 (Promega Corporation, Medison, WI) for 20 minutes at room temperature. Subsequently, the primary antibody anti-BrdU working solution (1:10) was treated for 12 hours or more, washed three times with PBS containing 3% BSA, and then the second antibody, anti-mouse-Ig-Fluorescein walking. The solution (1:10) was treated at room temperature for 1 hour. In addition, the differentiation of the cells was observed by double immunocytochemistry on the cultured cells on the 7th and 14th day of culture, that is, blocking the cultured cells with 5% normal goat serum, and then each characteristically differentiated cell. Specific markers of ie, glial cells (Glial Fibrillary Acidic Protein, Abcam, Cambridge, UK), S-100 (Abcam), MBP (Myelin Basic Protein, Abcam), neuronal markers -III tubulin (Abcam), NF (Neurofilament, Abcam), MAP2 (Microtubul-Associated Protein2, Abcam), neuronal markers nestin (Abcam), hair cells markers myosin A (Abcam) and TRPA1 (Tahoe Regional Planning Agency) , Abcam) was used for double staining. At this time, the primary antibodies to double staining were all reacted overnight, washed three times with PBS containing 3% BSA. Alexa 555, a secondary antibody, was treated at room temperature for 2 hours at a ratio of 1: 100, and then expression was confirmed. In addition, for nuclear staining was mounted (mounting) with DAPI-coupled mounting medium (Vectashild, Burlingame, CA). Expression was confirmed using a Fluorescence Attached Microscope (Olympus AX70TR62A02, Tokyo, Japan) and counted by the number of cells expressed per cell number.

As a result, neural cell precursors were found to maintain the spherical shape even during mitosis, like the characteristics of stem cells, the shape of the sphere gradually increased with the incubation time, the size of the sphere is approximately 100um As observed to be the size of the neuronal cell precursors differentiated in the present invention was confirmed that the cells with self-renewal potency (see Figure 4).

In addition, a double immunofluorescence staining method was performed as described above in order to confirm that differentiation into specialized cells, which is another characteristic of stem cells, was performed. , Nestin-expressing cells were observed to be stained (see FIG. 5A), and the expression level of the hair cell markers myosin A and TRPA1 was confirmed. As shown in FIGS. 5B and 5C, the markers were expressed. As a result of observing the expression of GFAP and S-100, which are markers of glial cells, it was found that both GFAP and S-100 were expressed as shown in FIGS. 5D and 5E. As well as neuronal markers beta III-tubulin (Fig. 5f) and neurofilament (NF) (Fig. 5g) was also expressed.

In addition, the morphology of the differentiated cells in which each marker gene is expressed was shown in FIG.

Therefore, the present inventors have found that when the stem cells isolated and cultured in human eardrum are cultured in a differentiation-inducing medium, the differentiation of each of the neural system precursors, neurons and hair cells is well induced. Could.

Furthermore, the present inventors have shown that the hair cells have a unique structure having a hair bundle structure protruding from the surface of the cell apex, and thus, by observing such a structure, it is possible to confirm whether the differentiated cells are hair cells, in particular GDNF, BDNF and NT3. As a result of observing whether the cell precursors cultured in the contained cell precursor culture medium were differentiated into the hair cells, as shown in FIG. 7, the markers expressed only in the hair cells were expressed as myosin A and TRPA1. In addition, hair cells with the same structure as ciliary bundle, which are structural features of hair cells, were observed.

<Example 4>

RT - PCR Expression of Neural System Precursors, Hair Cells and Neurons

Differentiation of the tympanic membrane-derived mesenchymal stem cells 1 × 10 ⁶ cells / well isolated and passaged three times in Example 1 was induced into neural cell precursors, hair cells, and neurons, respectively, according to the method of Example 3. Then, in order to confirm that the differentiation induction was properly performed, the degree of differentiation induction was confirmed by performing RT-PCR using primers corresponding to the characteristic genes of each cell for each differentiated cell. First, the cultured cells were isolated RNA using AXYGEN RNA miniprep kit (Axygen Scientific, Inc., Union City, CA), and the isolated RNA was prepared using RT Premix Kit (Intron Biotechnology, Sungnam, Korea). CDNA was synthesized through reverse transcription for 60 minutes at 95 ° C and 5 minutes at 95 ° C. At this time, the amount of cDNA used was quantified at 100 ng and used for PCR. The synthesized cDNA was PCR premix (Bioneer, Deajeon, Korea) using each specific cell detection gene GFAP, S100, MAP2, NF, Beta-III Tubulin , primers of nestin, BMP4 (Bone Morphology Protein 4), BMP7, myosin A, and TRPA1 were denatured at 94 ° C for 5 minutes and reacted for 30 seconds at the annealing temperature of each gene, followed by 72 ° C. DNA synthesis and extension reaction were performed for 5 minutes at. The house keeping gene GAPDH (GlycerAldehyde-3-Phosphate DeHydrogenase) was used as a control for quantitative analysis. Then, the expression was confirmed using 2% agarose gel, and the expressed genes were identified using an image analysis system ((Bio-Rad, Herculesus, CA), and the primer composition and primer sequence of each used gene were identified. Is as described in Table 2 below.

Primer Sequences and Conditions Gene name Sequence  (5'-3 ') Annealing Temp () Size
( bp ) SEQ ID NO: GAPDH F ctactggcgctgcaaaggctgt 54 357 One R gccatgaggtccaccaccctgt 2 Nestin F aacaggaccaagagacattg 56 211 3 R tttactgcctctacgctctc 4 S100 F ctttaaatgcgttcctcatc 51 156 5 R ttctgatggagttgcttttt 6 GFAP F tttctaaaggcctcttcctt 56 192 7 R ctgggtacattttgtgtgtg 8 BMP4 F agtgaaaactctgcttttcg 53 217 9 R ccagtctcgtgtccagtagt 10 BMP7 F caacgtcatcctgaagaaat 50.9 217 11 R atatgctgctcatgttttct 12 ßⅢ-Tubulin F aagttttggagagggaaatc 54.5 188 13 R agggaggtagagttggaaag 14 Myosin a F tacatcgacatccacttcaa 54.5 154 15 R tctgatcctcactcataccc 16 MAP2 F atttatcaggggagagtggt 53 177 17 R cctgatttgtcaccagagat 18 TRPA1 F ctccatctggcagcaaagaa 56.5 210 19 R tgcagtgttcccgtcttcat 20 NF F caaagaagaggggaagccac 55 258 21 R tttcatctgctgggctcaag 22

As a result, as shown in FIG. 8, RT-PCR was performed on cells differentiated with neuronal cell precursors. As a result, GFAP, a glial marker, was expressed in addition to the stem cell marker nestin. Developmental genes BMP4 and BMP7 were also expressed.

RT-PCR was performed on the cells differentiated into neurons, indicating that the stem cell marker nestin, the glial cell markers GFAP and S100, and the neuronal marker tubulin and MAP2 were expressed. And BMP7 were also expressed (see FIG. 9).

Confirmation of differentiation into hair cells, as shown in Figure 10, RT-PCR, as a result of the markers of myosin A, a marker of the hair cells were found, in addition to BMP4 and BMP7 genes of developmental stages of the inner ear Appeared to be.

Furthermore, the present inventors analyzed the expression level of myosin A in differentiated hair cells using RT-PCR in order to more clearly demonstrate the differentiation into hair cells. First, in the neural cell precursor culture medium and nerve cell culture medium, As a result of analyzing the expression level of myosin A in differentiation-induced cells by culturing for 7 days and 14 days, respectively, as shown in FIG. 11, the expression of myosin A was increased when cultured for 14 days compared to the culture for 7 days. Appeared to be.

Through the above experimental results, the present inventors found out that the stem cells derived from the tympanic membrane can be well differentiated into neural cell precursors, hair cells, and neurons. Furthermore, the present inventors have shown the ability to differentiate into each specific cell in the tympanic membrane. The branch was found to have stem cells.

So far I looked at the center of the preferred embodiment for the present invention. Those skilled in the art will appreciate that the present invention can be implemented in a modified form without departing from the essential features of the present invention. Therefore, the disclosed embodiments should be considered in an illustrative rather than a restrictive sense. The scope of the present invention is shown in the claims rather than the foregoing description, and all differences within the scope will be construed as being included in the present invention.

<110> Industry Academic Cooperation Foundation of Catholic University <120> Multipotent adult stem cells derived from tympanic membrane          tissue, preparation method according to differentiated cells from          the stem cells <160> 22 <170> KopatentIn 1.71 <210> 1 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> GAPDH F primer <400> 1 ctactggcgc tgcaaaggct gt 22 <210> 2 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> GAPDH R primer <400> 2 gccatgaggt ccaccaccct gt 22 <210> 3 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> NESTIN F primer <400> 3 aacaggacca agagacattg 20 <210> 4 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Nestin R primer <400> 4 tttactgcct ctacgctctc 20 <210> 5 <211> 20 <212> DNA <213> Artificial Sequence <220> S223 F primer <400> 5 ctttaaatgc gttcctcatc 20 <210> 6 <211> 20 <212> DNA <213> Artificial Sequence <220> S223 R primer <400> 6 ttctgatgga gttgcttttt 20 <210> 7 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> GFAP F primer <400> 7 tttctaaagg cctcttcctt 20 <210> 8 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> GFAP R primer <400> 8 ctgggtacat tttgtgtgtg 20 <210> 9 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> BMP4 F primer <400> 9 agtgaaaact ctgcttttcg 20 <210> 10 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> BMP4 R primer <400> 10 ccagtctcgt gtccagtagt 20 <210> 11 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> BMP7 F primer <400> 11 caacgtcatc ctgaagaaat 20 <210> 12 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> BMP7 R primer <400> 12 atatgctgct catgttttct 20 <210> 13 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> betaIII tubulin F primer <400> 13 aagttttgga gagggaaatc 20 <210> 14 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> betaIII tubulin R primer <400> 14 agggaggtag agttggaaag 20 <210> 15 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> myosin VIIA F primer <400> 15 tacatcgaca tccacttcaa 20 <210> 16 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> myosin VIIA R primer <400> 16 tctgatcctc actcataccc 20 <210> 17 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> MAP2 F primer <400> 17 atttatcagg ggagagtggt 20 <210> 18 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> MAP2 R primer <400> 18 cctgatttgt caccagagat 20 <210> 19 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> TRPA1 F primer <400> 19 ctccatctgg cagcaaagaa 20 <210> 20 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> TRPA1 R primer <400> 20 tgcagtgttc ccgtcttcat 20 <210> 21 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> NF F primer <400> 21 caaagaagag gggaagccac 20 <210> 22 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> NF R primer <400> 22 tttcatctgc tgggctcaag 20

Claims (10)

Culturing human eardrum tissue in DMEM medium without serum;
Incubating with 0.2-0.3% trypsin-EDTA followed by 8-12 ug / ml of protease or DNase, followed by centrifugation to remove supernatant;
After culture by adding 0.2-0.3% of trypsin-EDTA to the pellet from which the supernatant was removed, pipetting the same by adding the same amount of fetal calf serum (FBS) and then centrifuging ; And
The pellets obtained after centrifugation were incubated on inactivated fetal bovine serum and antibiotics containing minimal essential medium alpha (MEM-a), and cultured for 5-12 days by adding 15-25ng of bFGF at 2-3 days intervals. Method for producing a multipotent adult stem cells derived from human tympanic tissue, comprising the step of. Culturing the multipotent adult stem cells derived from the human tympanic tissue of claim 1 in a medium for culturing the target differentiated cells; And
A method for producing differentiated cells from multipotent adult stem cells derived from human tympanic tissue, comprising the step of separating the target differentiated cells expressing the markers of the target differentiated cells during the culture. The method of claim 2,
The target differentiated cell is a method for producing differentiated cells from multipotent adult stem cells derived from human tympanic tissue, characterized in that the neuronal cell precursors, neurons or hair cells. The method of claim 3,
The neuronal cell progenitors contain the adult stem cells in a DMEM: F12 ratio of 1: 1-5: 1, 0.01-0.03ml / ml of B-27 supplement, 1-3 mM of L-glutamine, and 5-15ng of EGF. cells differentiated from multipotent adult stem cells derived from human tympanic tissue, characterized in that cultured and differentiated in a culture medium for differentiating neuronal cell precursors containing 15-25 ng / ml of bFGF and 0.5-1.5% of antibiotics. How to manufacture. The method of claim 3,
The neurons or hair cells are 0.01-0.03 ml of B-27 supplement, 1--3 mM L-glutamine, and glia-derived neurotprophin factor (GDNF) in a neuronal culture medium (neurobasal medium). 5-15ng / ml, brain-derived neutrophin factor (BDNF) 5-15ng / ml, neurotrophin-3 (NT-3) 5-15ng / ml and antibiotic 0.5 Method for producing a cell differentiated from multipotent adult stem cells derived from human tympanic tissue, characterized in that cultured and differentiated in a medium for differentiating neurons or hair cells comprising ~ 1.5%. The method of claim 2,
The culture is a method for producing differentiated cells from multipotent adult stem cells derived from human tympanic tissue, characterized in that carried out at a temperature of 36 ~ 38 ℃ and 4 ~ 6% carbon dioxide conditions for 5 to 15 days. The method of claim 3,
The neuronal cell precursor expresses a marker of a target differentiated cell selected from the group consisting of nestin, GFAP, myosin VIIA, TRPA1, BMP4 and BMP7; The neurons express markers of target differentiated cells selected from the group consisting of NF, GFAP, S-100, Nestin, BMP4, BMP7, tubulin and MAP2; And the hair cells are differentiated from multipotent adult stem cells derived from human tympanic tissue, characterized by expressing markers of target differentiated cells selected from the group consisting of nestin (nestin), myosin VIIA, BMP4, BMP7 and myosin VIIA. To prepare the isolated cells. A composition for the prevention or treatment of otic diseases comprising neuronal cell precursors, neurons or hair cells differentiated from multipotent adult stem cells derived from human tympanic tissue as an active ingredient. The method of claim 8,
The ear disease is a composition for the prevention or treatment of ear diseases, characterized in that selected from the group consisting of tinnitus, hearing loss, otitis media and vertigo. A cell therapeutic agent for the formation of ear tissue containing the multidifferentiated adult stem cells of the tympanic tissue of claim 1 having the characteristics of differentiating into neural cell precursors, neurons or hair cells.

Images