KR20110057969A - Method for diagnosis of stroke using snps and haplotypes of syntrophin gamma 2 as biomarker - Google Patents
Method for diagnosis of stroke using snps and haplotypes of syntrophin gamma 2 as biomarker Download PDFInfo
- Publication number
- KR20110057969A KR20110057969A KR1020090114616A KR20090114616A KR20110057969A KR 20110057969 A KR20110057969 A KR 20110057969A KR 1020090114616 A KR1020090114616 A KR 1020090114616A KR 20090114616 A KR20090114616 A KR 20090114616A KR 20110057969 A KR20110057969 A KR 20110057969A
- Authority
- KR
- South Korea
- Prior art keywords
- polynucleotide
- seq
- base
- stroke
- intron
- Prior art date
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6813—Hybridisation assays
- C12Q1/6827—Hybridisation assays for detection of mutation or polymorphism
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6813—Hybridisation assays
- C12Q1/6834—Enzymatic or biochemical coupling of nucleic acids to a solid phase
- C12Q1/6837—Enzymatic or biochemical coupling of nucleic acids to a solid phase using probe arrays or probe chips
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6858—Allele-specific amplification
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2563/00—Nucleic acid detection characterized by the use of physical, structural and functional properties
- C12Q2563/107—Nucleic acid detection characterized by the use of physical, structural and functional properties fluorescence
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Landscapes
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Life Sciences & Earth Sciences (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Microbiology (AREA)
- Biochemistry (AREA)
- Physics & Mathematics (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Biophysics (AREA)
- Analytical Chemistry (AREA)
- Immunology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
Description
본 발명은 뇌졸중 위험 예측용 다형성 마커, 및 상기 다형성 마커를 이용한 뇌졸중 위험 예측 방법에 관한 것이다.The present invention relates to a polymorphic marker for stroke risk prediction, and a stroke risk prediction method using the polymorphic marker.
뇌졸중에 영향을 주는 유전 인자의 동정은 인종 및 지역적 배경에서 뇌졸중의 병인론과 관련된 많은 단서를 제공하는 것으로서 중요하다. 이런 지식은 뇌졸중에 대한 새로운 맞춤의학적 또는 민족성을 기초로 하는 예방 또는 치료 약물을 개발하는데 기회를 제공한다. The identification of genetic factors affecting stroke is important as it provides many clues related to the etiology of stroke on racial and regional backgrounds. This knowledge offers the opportunity to develop prophylactic or therapeutic drugs based on new personalized or ethnicity for stroke.
신트로핀(syntrophin)은 디스트로핀(dystrophin)과 결합하는 C-말단 도메인을 가지고 있어 디스트로핀 글리코단백질의 성분 중 하나인 다른 디스트로핀-연관 단백질에 결합하는 세포질 말단 단백질이다(Piluso et al ., J. Biol . Chem ., 2000; 275: 15851). 지금까지 신트로핀의 5가지 아형(alpha l, beta 1, beta 2, gamma 1 및 gamma 2)이 발견되었다(Inoue M et al ., Nagoya J Med Sci. 2008;70(3-4):117-126).Syntrophin is a cytoplasmic terminal protein that has a C - terminal domain that binds dystrophin and binds to other dystrophin - associated proteins that are one of the components of dystrophin glycoproteins (Piluso et. al ., J. Biol . Chem ., 2000; 275: 15851). To date, five subtypes of sintropin have been identified (alpha l, beta 1, beta 2, gamma 1 and gamma 2) (Inoue M et. al ., Nagoya J Med Sci . 2008; 70 (3-4): 117-126).
539개 아미노산으로 구성되고 61.1 KD의 분자량을 가지는 신트로핀 감마2(SNTG2)는 2개의 플렉스트린(pleckstrin homology; PH)-유사 도메인, PDZ 도메인 및 디스트로핀 결합을 매개하는 C-말단 ‘신트로핀 단위(SU)' 도메인으로 구성된다. 또한, ATP.GTP-결합 부위 모티프 A(p loop) 및 몇몇의 인산화 예상 부위도 가진다. 쥐의 중추 신경계의 in situ 혼성화 및 면역조직염색 분석은 여러 대뇌 및 척추 영역에 걸쳐 널리 SNTG2가 분포되어 있는 것을 보여주었다. SNTG2에 대한 전사체는 신경 경로의 세포체(perikaryon) 및 근위부(proximal portion)에 위치하였다. 또한, 면역조직염색 분석에서 SNTG2는 모든 인간 근육 섬유의 근섬유내초(sarcolemma)에서 SNTG2가 탐지되었다(Piluso et al ., 2000). 다른 연구에서 SNTG의 첫 번째 PH 도메인을 양분하는 상기 PDZ 도메인이SCN5A의 C-말단에 직접 결합하여 SCN5A의 효소활성을 변화시키고, Na+ 효용을 감소시키는 것이 보고된 바 있다(Ou Y et al., J Biol Chem . 2003, 17;278(3):1915-1923)Consists of 539 amino acids and has a molecular weight of 61.1 KD new Trojan pin gamma 2 (SNTG2) has two flex trim (pleckstrin homology; PH) - like domain, C, which mediates the binding PDZ domain and a dystrophin-terminal "new Trojan pin Unit (SU) 'domain. It also has the ATP.GTP - binding site motif A (p loop) and several sites for phosphorylation. Of the central nervous system in rats The situ hybridization and immunohistostaining analyzes showed the wide distribution of SNTG2 across several cerebral and spinal regions. Transcripts for SNTG2 were located in the perikaryon and proximal portions of the neural pathway. In addition, SNTG2 was detected in sarcolemma of all human muscle fibers in immunohistostaining assay (Piluso et. al ., 2000). Other studies have reported that the PDZ domain, which bisects the first PH domain of SNTG, directly binds to the C - terminus of SCN5A, alters the enzymatic activity of SCN5A and decreases Na + utility (Ou Y). et al., J Biol Chem . 2003, 17; 278 (3): 1915-1923)
SNTG2 및 뇌졸중의 연관관계는 아직 확실하지 않으나, 다만 몇몇의 연구에서 SNTG2의 발현 또는 구조의 변형이 어쩌면 뇌졸중과 연관이 있을 것이라는 가능성에 대해 보고된 바 있다. 예를 들면, 뇌졸중과 같은 몇몇의 신경학적 질병에서 발현이 증가되는 물-특이적 채널 단백질, 아쿠아포린(aquaporin 4; AQP4)의 발현이 디스트로핀 mdx 마우스에서 유의하게 낮았다. 상기 사실은 mdx 마우스에서 AQP4 mRNA의 발현 수준이 낮은 것은 AQP4 및 디스트로핀의 기능적으로 연결되어 있음을 시사한다[Shibuya S et al ., Tohoku J Exp Med . 2008; 215(4):313-319].The association between SNTG2 and stroke is not yet clear, but only a few studies have reported the possibility that alterations in the expression or structure of SNTG2 may be related to stroke. For example, the expression of water - specific channel protein, aquaporin 4 (AQP4), which is increased in some neurological diseases such as stroke, was significantly lower in dystrophin mdx mice. This suggests that low expression levels of AQP4 mRNA in mdx mice are functionally linked to AQP4 and dystrophin [Shibuya S et al ., Tohoku J Exp Med . 2008; 215 (4): 313-319.
이에, 본 발명자들은 한국 고연령자들의 허혈성 뇌졸중(ischaemic stroke)과 SNTG2의 인트론에 있는 두 가지 SNP의 연관성을 확인함으로써 본 발명을 완성하였다. Thus, the present inventors completed the present invention by confirming the association between the ischemic stroke of two older Koreans and the two SNPs in the intron of SNTG2.
본 발명의 목적은 SNTG2(Syntrophin gamma 2)의 인트론 부위에 존재하는 두 개의 rs4971418, rs4971407의 단일염기 다형성 및 이들의 일배체형을 이용하여 뇌졸중의 위험을 예측하는 방법을 제공하는 것이다.It is an object of the present invention to provide a method for predicting the risk of stroke using two rs4971418, rs4971407 single nucleotide polymorphisms and their haplotypes present in the intron region of SNTG2 (Syntrophin gamma 2).
상기 목적을 달성하기 위하여, 본 발명은 신트로핀 감마 2(Syntrophin gamma 2; SNTG2) 유전자의 인트론 6의 일부분인, 하기의 폴리뉴클레오티드, 또는 그의 상보적 폴리뉴클레오티드를 증폭시킬 수 있는 프라이머 쌍을 포함하는 뇌졸중 위험 예측용 키트를 제공한다:In order to achieve the above object, the present invention comprises a primer pair capable of amplifying the following polynucleotide, or a complementary polynucleotide thereof, which is a part of intron 6 of the Syntrophin gamma 2 (SNTG2) gene. Provides a kit for predicting stroke risk:
서열번호 1로 기재되는 염기서열을 갖는 rs4971407에 있어서 27번째 염기로서 G 또는 A를 포함하고 20 내지 100개의 연속 염기로 구성되는 폴리뉴클레오티드.The polynucleotide of rs4971407 having the nucleotide sequence set forth in SEQ ID NO: 1, comprising G or A as the 27th base, and consisting of 20 to 100 consecutive bases.
또한, 본 발명은 신트로핀 감마 2 유전자의 인트론 7의 일부분인, 하기의 폴 리뉴클레오티드, 또는 그의 상보적 폴리뉴클레오티드를 증폭시킬 수 있는 프라이머 쌍을 포함하는 뇌졸중 위험 예측용 키트를 제공한다:The present invention also provides a kit for predicting stroke risk comprising a primer pair capable of amplifying the following polynucleotides, or complementary polynucleotides thereof, which are part of Intron 7 of the Cyntropin gamma 2 gene:
서열번호 2로 기재되는 염기서열을 갖는 rs4971418에 있어서 27번째 염기로서 A 또는 G를 포함하고 20 내지 100개의 연속 염기로 구성되는 폴리뉴클레오티드.The polynucleotide of rs4971418 having the nucleotide sequence set forth in SEQ ID NO: 2, comprising A or G as the 27th base, and consisting of 20 to 100 consecutive bases.
또한, 본 발명은 신트로핀 감마 2 유전자의 인트론 6의 일부분 및 인트론 7의 일부분인, 하기 i) 및 ii)의 폴리뉴클레오티드, 또는 그의 상보적 폴리뉴클레오티드를 증폭시킬 수 있는 프라이머 쌍을 동시에 포함하는 뇌졸중 위험 예측용 키트를 제공한다:In addition, the present invention simultaneously comprises a pair of primers capable of amplifying a polynucleotide of i) and ii), or a complementary polynucleotide thereof, which is a portion of intron 6 and a portion of intron 7 of the scintopin gamma 2 gene. Provides a kit for predicting stroke risk:
i) 서열번호 1로 기재되는 염기서열을 갖는 rs4971407에 있어서 27번째 염기로서 G를 포함하고 20 내지 100개의 연속 염기로 구성되는 폴리뉴클레오티드; 및,i) a polynucleotide comprising r as the 27th base in rs4971407 having the nucleotide sequence set forth in SEQ ID NO: 1 and consisting of 20 to 100 consecutive bases; And,
ⅱ) 서열번호 2로 기재되는 염기서열을 갖는 rs4971418에 있어서 27번째 염기로서 G를 포함하고 20 내지 100개의 연속 염기로 구성되는 폴리뉴클레오티드.Ii) A polynucleotide comprising r as the 27th base and having 20 to 100 consecutive bases in rs4971418 having the nucleotide sequence set forth in SEQ ID NO: 2.
또한, 본 발명은 신트로핀 감마 2 유전자의 인트론 6의 일부분 및 인트론 7의 일부분인, 하기 i) 및 ii)의 폴리뉴클레오티드, 또는 그의 상보적 폴리뉴클레오티드를 증폭시킬 수 있는 프라이머 쌍을 동시에 포함하는 뇌졸중 위험 예측용 키트를 제공한다:In addition, the present invention simultaneously comprises a pair of primers capable of amplifying a polynucleotide of i) and ii), or a complementary polynucleotide thereof, which is a portion of intron 6 and a portion of intron 7 of the scintopin gamma 2 gene. Provides a kit for predicting stroke risk:
i) 서열번호 1로 기재되는 염기서열을 갖는 rs4971407에 있어서 27번째 염기로서 A를 포함하고 20 내지 100개의 연속 염기로 구성되는 폴리뉴클레오티드; 및,i) a polynucleotide comprising r as the 27 th base in rs4971407 having the nucleotide sequence set forth in SEQ ID NO: 1 and consisting of 20 to 100 consecutive bases; And,
ⅱ) 서열번호 2로 기재되는 염기서열을 갖는 rs4971418에 있어서 27번째 염기로서 A를 포함하고 20 내지 100개의 연속 염기로 구성되는 폴리뉴클레오티드.Ii) the polynucleotide comprising A as the 27th base and consisting of 20 to 100 consecutive bases in rs4971418 having the nucleotide sequence set forth in SEQ ID NO: 2.
또한, 본 발명은 신트로핀 감마 2 유전자의 인트론 6의 일부분인, 하기 폴리뉴클레오티드 또는 그의 상보적 폴리뉴클레오티드를 포함하는 마이크로어레이를 포함하는 뇌졸중 위험 예측용 키트를 제공한다:The invention also provides a kit for predicting stroke risk comprising a microarray comprising the following polynucleotide, or a complementary polynucleotide thereof, which is part of Intron 6 of the Cyntropin gamma 2 gene:
서열번호 1로 기재되는 염기서열을 갖는 rs4971407에 있어서 27번째 염기로서 G 또는 A를 포함하고 20 내지 100개의 연속 염기로 구성되는 폴리뉴클레오티드.The polynucleotide of rs4971407 having the nucleotide sequence set forth in SEQ ID NO: 1, comprising G or A as the 27th base, and consisting of 20 to 100 consecutive bases.
또한, 본 발명은 신트로핀 감마 2 유전자의 인트론 7의 일부분인, 하기 폴리뉴클레오티드 또는 그의 상보적 폴리뉴클레오티드를 포함하는 마이크로어레이를 포함하는 뇌졸중 위험 예측용 키트를 제공한다:The present invention also provides a kit for predicting stroke risk comprising a microarray comprising the following polynucleotide, or a complementary polynucleotide thereof, which is part of Intron 7 of the Cyntropin gamma 2 gene:
서열번호 2로 기재되는 염기서열을 갖는 rs4971418에 있어서 27번째 염기로서 A 또는 G를 포함하고 20 내지 100개의 연속 염기로 구성되는 폴리뉴클레오티드.The polynucleotide of rs4971418 having the nucleotide sequence set forth in SEQ ID NO: 2, comprising A or G as the 27th base, and consisting of 20 to 100 consecutive bases.
또한, 본 발명은 신트로핀 감마 2 유전자의 인트론 6의 일부분 및 인트론 7의 일부분인, 하기 i) 및 ii)의 폴리뉴클레오티드 또는 그의 상보적 폴리뉴클레오티드를 포함하는 마이크로어레이를 포함하는 뇌졸중 위험 예측용 키트를 제공한다:The present invention is also intended for stroke risk prediction comprising a microarray comprising a polynucleotide of i) and ii) or a complementary polynucleotide thereof, which is a part of intron 6 and a part of intron 7 of the Cintropin gamma 2 gene Provide the kit:
i) 서열번호 1로 기재되는 염기서열을 갖는 rs4971407에 있어서 27번째 염기로서 G를 포함하고 20 내지 100개의 연속 염기로 구성되는 폴리뉴클레오티드; 및,i) a polynucleotide comprising r as the 27th base in rs4971407 having the nucleotide sequence set forth in SEQ ID NO: 1 and consisting of 20 to 100 consecutive bases; And,
ⅱ) 서열번호 2로 기재되는 염기서열을 갖는 rs4971418에 있어서 27번째 염기로서 G를 포함하고 20 내지 100개의 연속 염기로 구성되는 폴리뉴클레오티드.Ii) A polynucleotide comprising r as the 27th base and having 20 to 100 consecutive bases in rs4971418 having the nucleotide sequence set forth in SEQ ID NO: 2.
또한, 본 발명은 신트로핀 감마 2 유전자의 인트론 6의 일부분 및 인트론 7의 일부분인, 하기 i) 및 ii)의 폴리뉴클레오티드 또는 그의 상보적 폴리뉴클레오티드를 포함하는 마이크로어레이를 포함하는 뇌졸중 위험 예측용 키트를 제공한다:The present invention is also intended for stroke risk prediction comprising a microarray comprising a polynucleotide of i) and ii) or a complementary polynucleotide thereof, which is a part of intron 6 and a part of intron 7 of the Cintropin gamma 2 gene Provide the kit:
i) 서열번호 1로 기재되는 염기서열을 갖는 rs4971407에 있어서 27번째 염기로서 A를 포함하고 20 내지 100개의 연속 염기로 구성되는 폴리뉴클레오티드; 및,i) a polynucleotide comprising r as the 27 th base in rs4971407 having the nucleotide sequence set forth in SEQ ID NO: 1 and consisting of 20 to 100 consecutive bases; And,
ⅱ) 서열번호 2로 기재되는 염기서열을 갖는 rs4971418에 있어서 27번째 염기로서 A를 포함하고 20 내지 100개의 연속 염기로 구성되는 폴리뉴클레오티드.Ii) the polynucleotide comprising A as the 27th base and consisting of 20 to 100 consecutive bases in rs4971418 having the nucleotide sequence set forth in SEQ ID NO: 2.
아울러, 본 발명은In addition,
1) 피검체로부터 분리된 혈액 시료로부터 게놈 DNA를 추출하는 단계;1) extracting genomic DNA from blood samples isolated from the subject;
2) 단계 1)의 게놈 DNA에서 서열번호 1 및/또는 서열번호 2로 기재되는 폴리뉴클레오티드의 염기를 확인하는 단계; 및2) identifying the base of the polynucleotide set forth in SEQ ID NO: 1 and / or SEQ ID NO: 2 in the genomic DNA of step 1); And
3) 단계 2)의 확인 결과로부터 3) From the confirmation result of step 2)
ⅰ) 상기 서열번호 1로 기재되는 폴리뉴클레오티드의 대립 유전자의 유전자형이 GA 또는 AA인 경우, 뇌졸중 발생 위험이 높은 개체로;Iii) when the genotype of the allele of the polynucleotide of SEQ ID NO: 1 is GA or AA, the individual at high risk of stroke;
ⅱ) 상기 서열번호 4로 기재되는 폴리뉴클레오티드의 대립 유전자의 유전자형이 AG 또는 AA인 경우, 뇌졸중 발생 위험이 낮은 개체로;Ii) when the genotype of the allele of the polynucleotide of SEQ ID NO: 4 is AG or AA, the individual having a low risk of stroke;
ⅲ) 상기 서열번호 4로 기재되는 폴리뉴클레오티드의 27번 째 염기가 A인 경우, 뇌졸중 발생 위험이 낮은 개체로;Iii) when the 27th base of the polynucleotide of SEQ ID NO: 4 is A, the individual having a low risk of stroke;
ⅳ) 서열번호 1로 기재되는 폴리뉴클레오티드의 27번 째 염기가 G이고, 서열번호 2로 기재되는 폴리뉴클레오티드의 27번 째 염기가 G인 경우, 뇌졸중 발생 위험이 낮은 개체로; 및,Iii) when the 27th base of the polynucleotide represented by SEQ ID NO: 1 is G and the 27th base of the polynucleotide described by SEQ ID NO: 2 is G, the individual having a low risk of stroke; And,
ⅴ) 서열번호 1로 기재되는 폴리뉴클레오티드의 27번 째 염기가 A이고, 서열번호 2로 기재되는 폴리뉴클레오티드의 27번 째 염기가 A인 경우, 뇌졸중 발생 위험이 높은 개체로 판정하는 단계를 포함하는 뇌졸중 위험 예측 방법을 제공한다.Iii) if the 27th base of the polynucleotide represented by SEQ ID NO: 1 is A and the 27th base of the polynucleotide represented by SEQ ID NO: 2 is A, determining that the individual is at high risk for stroke Provides a method of predicting stroke risk.
신트로핀 감마 2(Syntrophin gamma 2; SNTG2)의 인트론 7 부위의 다형성인 rs4971418의 대립유전자 A 또는 AG/AA 유전자형의 빈도가 정상인에 비해 뇌졸중 환자에서 적고, 인트론 6 부위의 다형성인 rs4971407의 GA/AA 유전자형의 빈도가 정상인에 비해 뇌졸중 환자에서 높은 것을 확인함으로써 상기 유전자 다형성 및 이의 일배체(haplotype)를 뇌졸중에 대한 마커로 이용하여 뇌졸중의 위험을 예측 하는 방법에 관한 것으로써, 본 발명의 방법에 따라 뇌졸중의 위험을 예측할 수 있으므로, 뇌졸중을 위한 치료 분야에 유용하게 이용될 수 있다.The incidence of allele A or AG / AA genotype of rs4971418, the polymorphism of the intron 7 region of syntrophin gamma 2 (SNTG2), was less common in stroke patients, and the GA / s of rs4971407, the polymorphism of the intron 6 region, was lower in stroke patients. The present invention relates to a method of predicting the risk of stroke using the polymorphism and its haplotype as a marker for stroke by confirming that the frequency of AA genotypes is higher in a stroke patient than in a normal person. Therefore, the risk of stroke can be predicted, and thus can be usefully used in the field of treatment for stroke.
이하, 본 발명을 상세히 설명한다.Hereinafter, the present invention will be described in detail.
본 발명은 신트로핀 감마 2(Syntrophin gamma 2; SNTG2) 유전자의 인트론 6의 일부분인 rs4971407에 있어서, 27번째 염기를 포함하고 20 내지 100개의 연속 염기로 구성되는 폴리뉴클레오티드 또는 그의 상보적 폴리뉴클레오티드로 이루어진 뇌졸중 위험 예측용 단일염기다형성(Single Nucleotide Polymorphism; SNP) 마커를 제공한다. The present invention relates to a polynucleotide comprising rs4971407, part of intron 6 of the Syntrophin gamma 2 (SNTG2) gene, comprising a 27th base and consisting of 20 to 100 consecutive bases, or a complementary polynucleotide thereof. Provided is a single nucleotide polymorphism (SNP) marker for predicting stroke risk.
또한, 본 발명은 신트로핀 감마 2 유전자의 인트론 7의 일부분인 rs4971418에 있어서, 27번째 염기를 포함하고 20 내지 100개의 연속 염기로 구성되는 폴리뉴클레오티드 또는 그의 상보적 폴리뉴클레오티드로 이루어진 뇌졸중 위험 예측용 단일염기다형성 마커를 제공한다. In addition, the present invention is rs4971418, which is a part of intron 7 of the syntropin gamma 2 gene, for stroke risk prediction comprising a polynucleotide comprising the 27th base and composed of 20 to 100 consecutive bases or a complementary polynucleotide thereof. Provide a monobasic polymorphic marker.
본 발명에서는 허혈성 뇌졸중 환자와 정상인을 대상으로 정맥혈을 채취한 후, 게놈 DNA를 정제한 다음, 정제된 게놈 DNA로부터 단일-염기 연장 반응(single-base extension reaction)을 수행하여 rs4971407 및 rs4971418의 유전자형을 결정하였다. In the present invention, after the collected venous targeting ischemic stroke patients and normal subjects, purified genomic DNA, and then, a single from the purified genomic DNA-base extension reaction - performing (single base extension reaction) to the genotype of rs4971407 and rs4971418 Decided.
본 발명에서는 rs4971407 또는 rs4971418의 다형성과 뇌졸중의 연관성을 알아보기 위해, 허혈성 뇌졸중 환자와 정상인을 대상으로 다중 로지스틱 회귀분석(Multiple logistic regression)을 이용하여 연관성을 분석하였다. 그 결과, rs4971418의 소수 대립유전자 A가 뇌졸중 환자에서 유의적으로 보다 더 낮은 빈도를 나타내었다. 또한, 우성 모형(dominant model)에서 AG+AA 유전자형을 갖는 대상의 수가 뇌졸중 환자군에서 감소하였다. 아울러, 우성 모형(dominant model)에서 rs4971407의 GA+AA 유전자형을 갖는 대상의 수가 뇌졸중 환자 군에서 증가하였다. In the present invention, in order to determine the association between rs4971407 or rs4971418 polymorphism and stroke, the association was analyzed using multiple logistic regression in ischemic stroke patients and normal people. As a result, the minor allele A of rs4971418 showed significantly lower frequency in stroke patients. In addition, the number of subjects with AG + AA genotype in the dominant model decreased in the stroke patients. In addition, the number of subjects with the GA + AA genotype of rs4971407 in the dominant model increased in the stroke patients.
또한, 본 발명에서는 rs4971407 및 rs4971418 다형성과 뇌졸중의 연관성이 여러 임상적 인자에 의해 영향을 받는지 알아보기 위해, 여러 임상적 인자를 적용한 후 상기와 같이 다중 로지스틱 회귀분석을 수행하였다. 그 결과, rs4971407 또는 rs4971418과 허혈성 뇌졸중의 유전적 연관성은 성, 연령, 고혈압, 고지혈증, 허 혈성 심질환, 흡연, 음주, 허리 둘레, TC, HDL 등의 다중 인자에 대한 적용 후에 현저히 나타났다. 상기 두 다형성의 연관 분포를 분석한 결과, 두 SNP가 연관되어 있고, 상기 두 다형성의 일배체 중에서 ht1[GG]은 뇌졸중 환자 그룹에서 대조군에 비해 빈도가 낮았고, ht2[AA]는 뇌졸중 환자 그룹에서 대조군에 비해 빈도가 높았다. In addition, in the present invention, in order to determine whether the association between rs4971407 and rs4971418 polymorphism and stroke is affected by various clinical factors, multiple logistic regression analysis was performed as described above after applying various clinical factors. As a result, the genetic association between rs4971407 or rs4971418 and ischemic stroke was remarkable after application to multiple factors such as sex, age, hypertension, hyperlipidemia, ischemic heart disease, smoking, drinking, waist circumference, TC, HDL, etc. As a result of analyzing the distribution of the two polymorphisms, two SNPs were associated, and among the haplotypes of the two polymorphisms, ht1 [GG] was lower in the stroke patient group than in the control group, and ht2 [AA] was in the stroke patient group. The frequency was higher than that of the control group.
즉, TSNTG2의 인트론 7 부위의 다형성인 rs4971418의 소수 대립유전자 A 또는 유전자형 AG+AA의 빈도, 인트론 6 부위의 다형성인 rs4971407의 유전자형 GA+AA의 빈도 및, 두 다형성의 4 가지 일배체 중 ht1 및 ht2가 대조군과 허혈성 뇌졸중 환자 사이에 통계학적으로 유의적인 차이가 있음을 확인하였다. That is, the frequency of the minor allele A or genotype AG + AA of rs4971418, the polymorphism of the intron 7 site of TSNTG2, the frequency of genotype GA + AA of the rs4971407 polymorphism of the intron 6 site, and ht1 and of the four haplotypes of the two polymorphisms. It was confirmed that ht2 was statistically significant difference between the control group and the ischemic stroke patient.
따라서 본 발명의 rs4971407 및 rs4971418 유전자 다형성 및 이의 일배체가 뇌졸중에 대한 민감도에 영향을 주는 것을 알 수 있으며, 이를 뇌졸중의 위험을 예측하는 다형성 마커로 이용할 수 있음을 알 수 있다.Therefore, it can be seen that the rs4971407 and rs4971418 gene polymorphisms and haplotypes of the present invention affect the sensitivity to stroke, which can be used as a polymorphic marker for predicting the risk of stroke.
또한, 본 발명은 본 발명의 다형성 마커를 구성하는 폴리뉴클레오티드 또는 그의 상보적 폴리뉴클레오티드를 포함하는 뇌졸중 위험 예측용 마이크로어레이를 제공한다. The present invention also provides a microarray for predicting stroke risk comprising a polynucleotide constituting the polymorphic marker of the present invention or a complementary polynucleotide thereof.
본 발명의 rs4971407 및 rs4971418 유전자 다형성 및 이의 일배체로 이루어진 본 발명의 다형성 마커는 정상인 및 뇌졸중 환자에서 유의적인 차이를 나타내므로, 상기 다형성 마커를 포함하는 본 발명의 마이크로어레이는 뇌졸중의 위험을 예측하는데 유용하게 이용할 수 있다.Since the polymorphic markers of the present invention, consisting of the rs4971407 and rs4971418 gene polymorphisms and haplotypes thereof of the present invention, show significant differences in normal and stroke patients, the microarrays of the present invention comprising the polymorphic markers predict the risk of stroke. It can be usefully used.
본 발명에 따른 마이크로어레이는 rs4971407 및/또는 rs4971418에 있어서, 각각의 27번째 염기를 포함하고 20 내지 100개의 연속 염기로 구성되는 폴리뉴클레오티드 또는 그의 상보적 폴리뉴클레오티드, 그들과 혼성화하는 폴리뉴클레오티드를 이용하여 당업계의 통상의 지식을 가진 자에게 알려져 있는 통상적인 방법에 의해 제조될 수 있다.The microarrays according to the present invention comprise the polynucleotides of rs4971407 and / or rs4971418, each comprising a 27th base and consisting of 20 to 100 contiguous bases or complementary polynucleotides thereof, and polynucleotides hybridizing with them. It may be prepared by conventional methods known to those skilled in the art.
예컨대, 상기 폴리뉴클레오티드는 아미노-실란(amino-silane), 폴리-L-라이신(poly-L-lysine) 및 알데히드(aldehyde)로 이루어진 군에서 선택되는 활성기가 코팅된 기판 상에 고정될 수 있다. 또한, 상기 기판은 실리콘 웨이퍼, 유리, 석영, 금속 및 플라스틱으로 이루어진 군에서 선택될 수 있다. 상기 폴리뉴클레오티드를 기판에 고정화시키는 방법으로는 파이조 일렉트릭(piezoelectric) 방식을 이용한 마이크로피펫팅(micropipetting) 법, 핀(pin) 형태의 스폿터(spotter)를 이용한 방법 등을 사용할 수 있다.For example, the polynucleotide is an amino-silane (amino-silane), poly-L-lysine (poly-L-lysine) and has an active group selected from the group consisting of aldehyde (aldehyde) can be fixed on the coated substrate. In addition, the substrate may be selected from the group consisting of silicon wafer, glass, quartz, metal and plastic. As a method of immobilizing the polynucleotide on a substrate, a micropipetting method using a piezoelectric method, a method using a pin-shaped spotter, etc. may be used.
또한, 본 발명은 신트로핀 감마 2 유전자의 인트론 6의 일부분인, 하기의 폴리뉴클레오티드, 또는 그의 상보적 폴리뉴클레오티드를 증폭시킬 수 있는 프라이머 쌍을 포함하는 뇌졸중 위험 예측용 키트를 제공한다:The present invention also provides a kit for predicting stroke risk comprising a primer pair capable of amplifying the following polynucleotide, or a complementary polynucleotide thereof, which is part of Intron 6 of the Cyntropin gamma 2 gene:
서열번호 1로 기재되는 염기서열을 갖는 rs4971407에 있어서 27번째 염기로서 G 또는 A를 포함하고 20 내지 100개의 연속 염기로 구성되는 폴리뉴클레오티드.The polynucleotide of rs4971407 having the nucleotide sequence set forth in SEQ ID NO: 1, comprising G or A as the 27th base, and consisting of 20 to 100 consecutive bases.
또한, 본 발명은 신트로핀 감마 2 유전자의 인트론 7의 일부분인, 하기의 폴리뉴클레오티드, 또는 그의 상보적 폴리뉴클레오티드를 증폭시킬 수 있는 프라이머 쌍을 포함하는 뇌졸중 위험 예측용 키트를 제공한다:The present invention also provides a kit for predicting stroke risk comprising a primer pair capable of amplifying the following polynucleotides, or complementary polynucleotides thereof, which are part of Intron 7 of the Cyntropin gamma 2 gene:
서열번호 2로 기재되는 염기서열을 갖는 rs4971418에 있어서 27번째 염기로서 A 또는 G를 포함하고 20 내지 100개의 연속 염기로 구성되는 폴리뉴클레오티드.The polynucleotide of rs4971418 having the nucleotide sequence set forth in SEQ ID NO: 2, comprising A or G as the 27th base, and consisting of 20 to 100 consecutive bases.
또한, 본 발명은 신트로핀 감마 2 유전자의 인트론 6의 일부분 및 인트론 7의 일부분인, 하기 i) 및 ii)의 폴리뉴클레오티드, 또는 그의 상보적 폴리뉴클레오티드를 증폭시킬 수 있는 프라이머 쌍을 동시에 포함하는 뇌졸중 위험 예측용 키트를 제공한다:In addition, the present invention simultaneously comprises a pair of primers capable of amplifying a polynucleotide of i) and ii), or a complementary polynucleotide thereof, which is a portion of intron 6 and a portion of intron 7 of the scintopin gamma 2 gene. Provides a kit for predicting stroke risk:
i) 서열번호 1로 기재되는 염기서열을 갖는 rs4971407에 있어서 27번째 염기로서 G를 포함하고 20 내지 100개의 연속 염기로 구성되는 폴리뉴클레오티드; 및,i) a polynucleotide comprising r as the 27th base in rs4971407 having the nucleotide sequence set forth in SEQ ID NO: 1 and consisting of 20 to 100 consecutive bases; And,
ⅱ) 서열번호 2로 기재되는 염기서열을 갖는 rs4971418에 있어서 27번째 염기로서 G를 포함하고 20 내지 100개의 연속 염기로 구성되는 폴리뉴클레오티드.Ii) A polynucleotide comprising r as the 27th base and having 20 to 100 consecutive bases in rs4971418 having the nucleotide sequence set forth in SEQ ID NO: 2.
또한, 본 발명은 신트로핀 감마 2 유전자의 인트론 6의 일부분 및 인트론 7의 일부분인, 하기 i) 및 ii)의 폴리뉴클레오티드, 또는 그의 상보적 폴리뉴클레오티드를 증폭시킬 수 있는 프라이머 쌍을 동시에 포함하는 뇌졸중 위험 예측용 키트를 제공한다:In addition, the present invention simultaneously comprises a pair of primers capable of amplifying a polynucleotide of i) and ii), or a complementary polynucleotide thereof, which is a portion of intron 6 and a portion of intron 7 of the scintopin gamma 2 gene. Provides a kit for predicting stroke risk:
i) 서열번호 1로 기재되는 염기서열을 갖는 rs4971407에 있어서 27번째 염기로서 A를 포함하고 20 내지 100개의 연속 염기로 구성되는 폴리뉴클레오티드; 및,i) a polynucleotide comprising r as the 27 th base in rs4971407 having the nucleotide sequence set forth in SEQ ID NO: 1 and consisting of 20 to 100 consecutive bases; And,
ⅱ) 서열번호 2로 기재되는 염기서열을 갖는 rs4971418에 있어서 27번째 염기로서 A를 포함하고 20 내지 100개의 연속 염기로 구성되는 폴리뉴클레오티드.Ii) the polynucleotide comprising A as the 27th base and consisting of 20 to 100 consecutive bases in rs4971418 having the nucleotide sequence set forth in SEQ ID NO: 2.
또한, 본 발명은 신트로핀 감마 2 유전자의 인트론 6의 일부분인, 하기 폴리 뉴클레오티드 또는 그의 상보적 폴리뉴클레오티드를 포함하는 마이크로어레이를 포함하는 뇌졸중 위험 예측용 키트를 제공한다:The present invention also provides a kit for predicting stroke risk comprising a microarray comprising the following polynucleotide, or a complementary polynucleotide thereof, which is part of Intron 6 of the Cintropin gamma 2 gene:
서열번호 1로 기재되는 염기서열을 갖는 rs4971407에 있어서 27번째 염기로서 G 또는 A를 포함하고 20 내지 100개의 연속 염기로 구성되는 폴리뉴클레오티드.The polynucleotide of rs4971407 having the nucleotide sequence set forth in SEQ ID NO: 1, comprising G or A as the 27th base, and consisting of 20 to 100 consecutive bases.
또한, 본 발명은 신트로핀 감마 2 유전자의 인트론 7의 일부분인, 하기 폴리뉴클레오티드 또는 그의 상보적 폴리뉴클레오티드를 포함하는 마이크로어레이를 포함하는 뇌졸중 위험 예측용 키트를 제공한다:The present invention also provides a kit for predicting stroke risk comprising a microarray comprising the following polynucleotide, or a complementary polynucleotide thereof, which is part of Intron 7 of the Cyntropin gamma 2 gene:
서열번호 2로 기재되는 염기서열을 갖는 rs4971418에 있어서 27번째 염기로서 A 또는 G를 포함하고 20 내지 100개의 연속 염기로 구성되는 폴리뉴클레오티드.The polynucleotide of rs4971418 having the nucleotide sequence set forth in SEQ ID NO: 2, comprising A or G as the 27th base, and consisting of 20 to 100 consecutive bases.
또한, 본 발명은 신트로핀 감마 2 유전자의 인트론 6의 일부분 및 인트론 7의 일부분인, 하기 i) 및 ii)의 폴리뉴클레오티드 또는 그의 상보적 폴리뉴클레오티드를 포함하는 마이크로어레이를 포함하는 뇌졸중 위험 예측용 키트를 제공한다:The present invention is also intended for stroke risk prediction comprising a microarray comprising a polynucleotide of i) and ii) or a complementary polynucleotide thereof, which is a part of intron 6 and a part of intron 7 of the Cintropin gamma 2 gene Provide the kit:
i) 서열번호 1로 기재되는 염기서열을 갖는 rs4971407에 있어서 27번째 염기로서 G를 포함하고 20 내지 100개의 연속 염기로 구성되는 폴리뉴클레오티드; 및,i) a polynucleotide comprising r as the 27th base in rs4971407 having the nucleotide sequence set forth in SEQ ID NO: 1 and consisting of 20 to 100 consecutive bases; And,
ⅱ) 서열번호 2로 기재되는 염기서열을 갖는 rs4971418에 있어서 27번째 염기로서 G를 포함하고 20 내지 100개의 연속 염기로 구성되는 폴리뉴클레오티드.Ii) A polynucleotide comprising r as the 27th base and having 20 to 100 consecutive bases in rs4971418 having the nucleotide sequence set forth in SEQ ID NO: 2.
또한, 본 발명은 신트로핀 감마 2 유전자의 인트론 6의 일부분 및 인트론 7의 일부분인, 하기 i) 및 ii)의 폴리뉴클레오티드 또는 그의 상보적 폴리뉴클레오티드를 포함하는 마이크로어레이를 포함하는 뇌졸중 위험 예측용 키트를 제공한다:The present invention is also intended for stroke risk prediction comprising a microarray comprising a polynucleotide of i) and ii) or a complementary polynucleotide thereof, which is a part of intron 6 and a part of intron 7 of the Cintropin gamma 2 gene Provide the kit:
i) 서열번호 1로 기재되는 염기서열을 갖는 rs4971407에 있어서 27번째 염기 로서 A를 포함하고 20 내지 100개의 연속 염기로 구성되는 폴리뉴클레오티드; 및,i) a polynucleotide comprising r as the 27th base and consisting of 20 to 100 consecutive bases in rs4971407 having the nucleotide sequence set forth in SEQ ID NO: 1; And,
ⅱ) 서열번호 2로 기재되는 염기서열을 갖는 rs4971418에 있어서 27번째 염기로서 A를 포함하고 20 내지 100개의 연속 염기로 구성되는 폴리뉴클레오티드.Ii) the polynucleotide comprising A as the 27th base and consisting of 20 to 100 consecutive bases in rs4971418 having the nucleotide sequence set forth in SEQ ID NO: 2.
본 발명의 rs4971407 및/또는 rs4971418의 소수 대립유전자의 빈도, 유전자형의 빈도 및 일배체의 비율은 정상인과 뇌졸중 환자에서 유의한 차이를 나타내었으므로, 본 발명의 다형성 마커를 증폭시킬 수 있는 프라이머 쌍 또는 본 발명의 다형성 마커를 포함하는 마이크로어레이를 포함하는 키트를 뇌졸중의 위험을 예측하는데 유용하게 사용할 수 있다.Since the frequency, genotype frequency, and haplotype ratio of the minor alleles of rs4971407 and / or rs4971418 of the present invention showed a significant difference in normal and stroke patients, primer pairs or amplification of the polymorphic markers of the present invention or Kits comprising microarrays comprising the polymorphic markers of the invention can be usefully used to predict the risk of stroke.
본 발명의 다형성 마커 중 rs4971407에 대한 프라이머 쌍은 서열번호 3 및 서열번호 4으로 기재되는 폴리뉴클레오티드, rs4971418에 대한 프라이머 쌍은 서열번호 6 및 서열번호 7으로 기재되는 폴리뉴클레오티드인 것이 바람직하나, 상기 프라이머 쌍은 상기 다형성 부위를 특이적으로 증폭할 수만 있다면 크기 및 주형에 결합하는 위치가 제한되지 않으며, 당업자라면 통상의 프라이머 선정용 소프트웨어를 이용하여 용이하게 프라이머의 고안이 가능하다. Among the polymorphic markers of the present invention, the primer pair for rs4971407 is a polynucleotide described by SEQ ID NO: 3 and SEQ ID NO: 4, and the primer pair for rs4971418 is preferably a polynucleotide described by SEQ ID NO: 6 and SEQ ID NO: 7, The pair is not limited in size and position binding to the template as long as it can specifically amplify the polymorphic site, and a person skilled in the art can easily design a primer using conventional primer selection software.
본 발명에 따른 키트는 추가적으로 형광물질을 포함할 수 있으며, 형광물질은 스트렙타비딘-알칼리 탈인화효소 접합물질(strepavidin-like phosphatease conjugate), 화학형광물질(chemiflurorensce) 및 화학발광물질(chemiluminescent)로 이루어진 군으로부터 선택되는 것이 바람직하나 이에 한정되는 것은 아니다. Kits according to the invention may comprise a further fluorescent material, a fluorescent material is streptavidin-to-(like phosphatease conjugate strepavidin), chemical fluorophore (chemiflurorensce) and chemiluminescent substances (chemiluminescent) alkali deionized prints enzyme bonding material It is preferably selected from the group consisting of, but is not limited thereto.
본 발명에 따른 키트는 추가적으로 반응 시약을 포함할 수 있으며, 반응 시약은 혼성화에 사용되는 완충용액, RNA로부터 cDNA를 합성하기 위한 역전사효소, cNTPs 및 rNTP(사전 혼합형 또는 분리 공급형), 형광 염색제의 화학적 유도제와 같은 표식시약, 세척 완충용액 등으로 구성될 수 있으나 이에 한정된 것은 아니다.Kits according to the invention may additionally comprise reaction reagents, the reaction reagents of which are used for hybridization, reverse transcriptase for synthesizing cDNA from RNA, cNTPs and rNTPs (premixed or separated feed), fluorescent dyes Labeling reagents such as chemical inducing agents, washing buffer solution, etc., but may not be limited thereto.
아울러, 본 발명은In addition,
1) 피검체로부터 분리된 혈액 시료로부터 게놈 DNA를 추출하는 단계;1) extracting genomic DNA from blood samples isolated from the subject;
2) 단계 1)의 게놈 DNA에서 서열번호 1 및/또는 서열번호 2로 기재되는 폴리뉴클레오티드의 염기를 확인하는 단계; 및2) identifying the base of the polynucleotide set forth in SEQ ID NO: 1 and / or SEQ ID NO: 2 in the genomic DNA of step 1); And
3) 단계 2)의 확인 결과로부터 3) From the confirmation result of step 2)
ⅰ) 상기 서열번호 1로 기재되는 폴리뉴클레오티드의 대립 유전자의 유전자형이 GA 또는 AA인 경우, 뇌졸중 발생 위험이 높은 개체로;Iii) when the genotype of the allele of the polynucleotide of SEQ ID NO: 1 is GA or AA, the individual at high risk of stroke;
ⅱ) 상기 서열번호 4로 기재되는 폴리뉴클레오티드의 대립 유전자의 유전자형이 AG 또는 AA인 경우, 뇌졸중 발생 위험이 낮은 개체로;Ii) when the genotype of the allele of the polynucleotide of SEQ ID NO: 4 is AG or AA, the individual having a low risk of stroke;
ⅲ) 상기 서열번호 4로 기재되는 폴리뉴클레오티드의 27번 째 염기가 A인 경우, 뇌졸중 발생 위험이 낮은 개체로;Iii) when the 27th base of the polynucleotide of SEQ ID NO: 4 is A, the individual having a low risk of stroke;
ⅳ) 서열번호 1로 기재되는 폴리뉴클레오티드의 27번 째 염기가 G이고, 서열번호 2로 기재되는 폴리뉴클레오티드의 27번 째 염기가 G인 경우, 뇌졸중 발생 위험이 낮은 개체로; 및,Iii) when the 27th base of the polynucleotide represented by SEQ ID NO: 1 is G and the 27th base of the polynucleotide described by SEQ ID NO: 2 is G, the individual having a low risk of stroke; And,
ⅴ) 서열번호 1로 기재되는 폴리뉴클레오티드의 27번 째 염기가 A이고, 서열번호 2로 기재되는 폴리뉴클레오티드의 27번 째 염기가 A인 경우, 뇌졸중 발생 위험이 높은 개체로 판정하는 단계를 포함하는 뇌졸중 위험 예측 방법 을 제공한다.Iii) if the 27th base of the polynucleotide represented by SEQ ID NO: 1 is A and the 27th base of the polynucleotide represented by SEQ ID NO: 2 is A, determining that the individual is at high risk for stroke Provides a method of predicting stroke risk.
상기 방법에 있어서, 개체는 인간, 원숭이, 개, 염소, 돼지 또는 쥐 등 모든 동물을 의미한다. In this method, an individual means any animal, such as human, monkey, dog, goat, pig or rat.
상기 단계 2)의 폴리뉴클레오티드의 염기는 시퀀싱 분석, 파이로시퀀싱, 마이크로어레이에 의한 혼성화, PCR 연장 분석, 실시간 PCR 분석, FRET 분석 및 MALDI-TOF를 이용한 서열 분석(MALDI-TOF based mini-sequencing assay)으로 구성된 군으로부터 선택되는 어느 하나의 방법으로 수행될 수 있으나, 이에 제한되는 것은 아니며 SNP의 서열 분석에 사용되는 당업계의 통상적인 방법이라면 모두 가능하다. Bases of the polynucleotide of step 2) is sequencing analysis, sequencing, a pie, a hybridization of the microarray, PCR extension analysis, and real-time PCR analysis, FRET analysis and MALDI - sequence analysis using a TOF (MALDI - TOF based mini - sequencing assay It can be carried out by any one method selected from the group consisting of), but is not limited thereto, and any conventional method used in the art used for sequencing the SNP.
본 발명의 rs4971407 및/또는 rs4971418의 소수 대립유전자의 빈도, 유전자형의 빈도 및 일배체의 비율은 정상인과 뇌졸중 환자에서 유의한 차이를 나타내었으므로, 본 발명의 다형성 마커의 서열을 분석함으로써 뇌졸중의 위험을 예측할 수 있다. The frequency of the minor alleles of rs4971407 and / or rs4971418 of the present invention, the frequency of genotypes, and the proportion of haplotypes showed significant differences in normal and stroke patients, and therefore the risk of stroke by analyzing the sequences of the polymorphic markers of the present invention. Can be predicted.
이하 본 발명을 실시예에 의해 상세히 설명한다. Hereinafter, the present invention will be described in detail by way of examples.
단, 하기 실시예는 본 발명을 예시하는 것일 뿐 본 발명을 한정하는 것은 아니다.However, the following Examples are only for illustrating the present invention and do not limit the present invention.
<< 실시예Example 1> 실험 대상의 선정 1> Selection of test subject
본 발명자들은 실험 대상으로 유전적으로 관련이 없는 뇌경색(cerebral infarction, CI) 환자군(n=661) 및 대조군(n=490)을 대한민국 12개의 병원으로부터 모집하였다. 모든 환자들은 기본적인 건강검진 및 CT/MRI 검사를 받았다. 뇌졸중(stroke) 징후를 가진 사람들은 대조군에서 제외시켰다. 또한, 당뇨병을 가진 환자들은 위험인자의 효과와 혼동하는 것을 최소화하기 위해, 대조군과 뇌경색 환자군 모두에서 제외시켰다. 성별에 따른 차이는 존재하지 않았으며, 모든 환자들로부터 서면 동의서를 받았다. 실험 프로토콜은 한국한의학연구원의 기관감사위원회(Institutional Review Board)와 환자들을 모집한 지역 병원에 의해 승인받았다.The present inventors recruited from 12 hospitals in Korea, a genetically unrelated cerebral infarction (CI) patient group (n = 661) and a control group (n = 490). All patients underwent basic medical examination and CT / MRI examination. People with stroke signs were excluded from the control group. In addition, patients with diabetes were excluded from both control and cerebral infarction patients to minimize confusion with the effect of risk factors. No gender differences existed and all patients received written informed consent. The experimental protocol was approved by the Institutional Review Board of the Korean Institute of Oriental Medicine and the local hospital recruiting patients.
<< 실시예Example 2> 실험 대상의 통계학적 및 임상적 특성 분석 2> Statistical and clinical characteristics analysis of the subject
본 발명자들은 실험 대상의 통계학적 및 임상적 특성을 분석하였다. 구체적으로, 임상적 분석에 있어서, 공복혈당(fasting blood sugar, FBS) 및 혈청 지질[예를 들면, 총 콜레스테롤(TC), 트리글리세라이드(triglyceride, TG) 및 HDL]은 자동화된 생화학 분석기(biochemical analyzer)를 이용하여 획득하였다. Friedwald 공식[LDL-C = TC-(HDL-C + TG/5)]은 대상의 트리글리세라이드 수준이 400 mg/dL 이하인 경우에만 적용하였다. We analyzed the statistical and clinical characteristics of the subject. Specifically, in clinical analysis, fasting blood sugar (FBS) and serum lipids (eg, total cholesterol (TC), triglyceride (TG) and HDL) are automated biochemical analyzers. Obtained using It was applied only if the triglyceride levels are less than 400 mg / dL in the target Friedwald formula [- (C + TG / 5 HDL -) LDL - C = TC].
통계학적 분석에 있어서, 데이터는 SAS 소프트웨어 버전 9.1.3(SAS Institute Inc, NC, U.S.A)을 이용하였다. 범주형 변수(categorical variable)는 카이스퀘어 테스트(Chi-square test)로 비교하였다. 모든 연속변수(continuous variable)는 Kolmogorov-Smirnov 정규분포성 테스트(normality test)를 수행하였 다. 연속변수의 차이는 모수적 테스트(Parametric test)(Student's t-test 및 분산분석법[ANOVA]) 또는 비모수적 테스트(non-parametric test)(Wilcoxonrank-sum test 및 Kruskal-Wallistest)를 이용하여 결정하였다. 이하, 실험에서 통계학적 분석은 이와 동일한 방법으로 수행하였다.For statistical analysis, data was used for SAS software version 9.1.3 (SAS Institute Inc, NC, USA). Categorical variables were compared by Chi - square test. All continuous variables were subjected to the Kolmogorov - Smirnov normality test. Differences in continuous variables were determined using a parametric test (Student's t- test and ANOVA) or a non - parametric test (Wilcoxonrank - sum test and Kruskal - Wallistest). Hereinafter, statistical analysis in the experiment was performed in the same manner.
그 결과, 하기 표 1에 기재된 바와 같이, 뇌졸중 환자군이 대조군에 비해 남성과 연장자를 더 많이 포함하였다. 전형적인 뇌졸중 위험인자인 고혈압, 고지혈증, 허혈성 심질환, 흡연 및 음주 상태는 뇌졸중 환자군이 대조군에 비해 더 높았다. 또한, 환자 그룹의 체질량 지수(BMI)는 소폭 낮았으나, 비만지표인 허리둘레 및 WHR은 뇌졸중 환자군이 대조군에 비해 유의성 있게 더 높았다. 또한, 뇌경색 환자군은 대조군에 비해 더 낮은 TC 및 HDL 수준을 보여주었다. 그러나 대조군과 뇌경색 환자군의 모든 지질 수준은, 지질학 및 동맥경화증에 대한 한국 권장 지질 수준 지침에 따른 정상 혈중 지질 범위에 있었다. As a result, as shown in Table 1 below, the stroke patient group included more males and elders than the control group. The typical stroke risk factors, hypertension, hyperlipidemia, ischemic heart disease, smoking and drinking status, were higher in the stroke group than in the control group. In addition, the body mass index (BMI) of the patient group was slightly lower, but the obesity index waist and WHR were significantly higher in the stroke group than in the control group. In addition, the group of cerebral infarction showed lower TC and HDL levels than the control group. However, all lipid levels in the control and cerebral infarction patients were in the normal blood lipid range according to the recommended lipid level guidelines for geology and atherosclerosis.
/28(5.70)192 (39.40) / 267 (54.80)
/ 28 (5.70)
/196(29.70)359 (54.50) / 104 (15.80)
/ 196 (29.70)
/154(31.70)301 (61.90) / 31 (6.40)
/ 154 (31.70)
/243(36.90)360 (54.60) / 56 (8.50)
/ 243 (36.90)
a, 사례별 수(%) 및 c2 -검증에 의한 P 값을 나타내었다. a, be (%), and c 2 by case - shows the P value obtained from the verified.
b test(평균 표준편차) 및 스튜던트 t-검정에 의한 P 값을 나타내었다. P values by b test (mean standard deviation) and Student's t − test are shown.
<< 실시예Example 3> 3> DNADNA 정제 및 유전자형( Purification and genotype ( genotypinggenotyping ) 분석) analysis
본 발명자들은 하룻밤 동안 금식시킨 실험 대상으로부터 EDTA(BD Biosciences, FranklinLakes, 미국)가 포함된 정맥혈 검체 용기(Venous Blood Collection Tube)를 이용하여 정맥 전혈을 채취하였다. 상기 전혈로부터 15분 동안 1,500 g에서 원심분리하여 혈장을 분리하였다. 그런 다음, 제조사의 지시에 따라 GeneAll genomic isolation kit(GeneAll co., 한국)를 이용하여 림프구를 포함하는 연막(buffy coat)으로부터 게놈 DNA를 정제하였다. rs4971407의 G>A SNP(서열번호 1: 5'-ATAGCTTACAATTCAGAATGAGGTGA[A/G]TGGATGTAAAGTACATTCTGAAGTG-3') 및 rs4971418의 G>A SNP(서열번호 2: 5'-CCCATTCCACTTAGATCTCTACAAAC[A/G]CCCAGTTCTCTGGCATGTGTCCTAC-3')를 MassARRAYTM (Sequenom, 미국)의 단일-염기 증폭 반응을 사용하여 제조업체의 설명서에 따라 유전자형을 분석하였다. rs4971407 및 rs4971418 주변의 SNP 부위 및 유전자 특이적 부위의 증폭을 위해 사용한 프라이머는 표 2에 나타내었다. 유전자형분석의 정확도를 확인하기 위해 참여자의 5%를 차지하는 52명의 두 개 SNP 부위에 대한 서열 분석을 실시하였다.We collected venous whole blood from a venous blood collection tube containing EDTA (BD Biosciences, Franklin Lakes, USA) from an overnight fast. Plasma was isolated from the whole blood by centrifugation at 1,500 g for 15 minutes. Then, genomic DNA was purified from the buffy coat containing lymphocytes using the GeneAll genomic isolation kit (GeneAll co., Korea) according to the manufacturer's instructions. G in rs4971407> A SNP (SEQ ID NO: 1: 5 '- ATAGCTTACAATTCAGAATGAGGTGA [A / G] TGGATGTAAAGTACATTCTGAAGTG - 3') , and G in rs4971418> A SNP (SEQ ID NO: 2: 5 '- CCCATTCCACTTAGATCTCTACAAAC [A / G] CCCAGTTCTCTGGCATGTGTCCTAC - 3' ) Were genotyped using the single - base amplification reaction of MassARRAY ™ (Sequenom, USA) according to the manufacturer's instructions. Primers used for amplification of SNP sites and gene specific sites around rs4971407 and rs4971418 are shown in Table 2. In order to confirm the accuracy of genotyping, 52 SNP sites, which account for 5% of the participants, were sequenced.
또한, 하디-바인베르크 평형(Hardy-Weinberg equilibrium, HWE)에 의해 p값이 0.01 이상을 갖는 것으로 예측하였고, HapAnalyzer 소프트웨어 버전.1.0.1(http://hap.ngri.go.kr/)을 이용하여 결정한 대조군에서의 rs4971407G>A 및 rs4971418G>A의 소수 대립 유전자의 빈도는 각각 0.427 및 0.457이었으며, 이는 HWE(chi square value=0.127, P-value>0.05)와 일치하였다(도 1a). In addition, the Hardy-a was estimated that the p-value by - (Weinberg equilibrium, Hardy HWE) having at least 0.01, HapAnalyzer software version .1.0.1 (http://hap.ngri.go.kr/) bar Berg equilibrium The frequency of minor alleles of rs4971407G> A and rs4971418G> A in the control group was 0.427 and 0.457, respectively, which was consistent with HWE (chi square value = 0.127, P - value> 0.05) (FIG. 1A).
<< 실시예Example 4> 4> rs4971407Grs4971407G >A 및 > A and rs4971418Grs4971418G >A와 임상 인자와의 연관성 조사> A link between clinical factors
본 발명자들은 뇌졸중 환자군과 대조군에서 rs4971407G>A 및 rs4971418G>A에 대한 연관성을 알아보기 위해, 다중 로지스틱 회귀분석(Multiple logistic regression)을 이용하여 분석하였다. 다중 로지스틱 회귀분석에 있어서, rs4971407G>A 및 rs4971418G>A와 뇌졸중 질환 상태 및 위험률(odds ratio, OR)의 연관성은 95% 신뢰구간(confidence intervals, CI)으로 산출하였으며, 통계학적 유의성은 p<0.05로 정하였다.The present inventors analyzed using multiple logistic regression to determine the association between rs4971407G> A and rs4971418G> A in stroke patients and controls. In multiple logistic regression, the association between rs4971407G> A and rs4971418G> A with stroke disease status and odds ratio (OR) was calculated at 95% confidence intervals (CI), and the statistical significance was p <0.05. Was set.
그 결과, 하기 표 3에서 보는 바와 같이, 성별, 연령, 흡연, 음주, 고혈압, 고지혈증, 심장질환, 허리둘레, TC 및 HDL-C가 적용된 다중 회귀 모형은 인트론 7에 위치한 rs4971418의 A 대립 유전자의 빈도는 대조군보다 유의하게 낮았고(OR[95% CI], 1.440[1.110-1.869], p=0.006), 환자군에서 AG/AA 타입인 개체는 대조군에 비해 적었다(OR[95% CI], 1.831[1.210-2.769], p=0.0042). 또한, 인트론 6의 rs4971407의 GA/AA 타입은 우성 모델에서 CI와 함께 유의하게 증가되는 것으로 나타났다(OR[95% CI], 1.548[1.033-2.318], p=0.0341). 두 SNP 사이의 연관 분포는 r2=0.526이었는데, 이는 두 SNP가 연관되어 있고, 상기 두 SNP의 4가지 일배체(haplotype)가 실시되는(conducted) 것을 보여준다(도 1B 및 도 C). 4개 일배체 중에서, ht1[GG]은 CI의 감소와 연관되어 있었다. 환자 그룹에서 ht1[GG]의 대립 유전자 빈도는 45.16%으로 대조군의 49.49%에 비해 유의하게 낮았고(OR[95% CI], 0.756[0.583-0.979], p=0.0343), 열성모형에서 ht1ht1 타입인 환자의 비율도 대조군보다 낮았다(OR[95% CI], 0.586[0.375-0.916], p=0.0191). 한편, ht2[AA] 대립 유전자 및 ht2인 개체의 빈도는 환자에서 유의하게 증가하였다(각각 OR[95% CI], 1.369[1.051-1.783], p=0.02; 및, OR[95% CI], 1.69[1.148-2.49], p=0.0079) As a result, as shown in Table 3, the multiple regression model to which sex, age, smoking, drinking, hypertension, hyperlipidemia, heart disease, waist circumference, TC and HDL - C were applied to the A allele of rs4971418 located at intron 7 frequency is significantly lower than the control group (OR [95% CI], 1.440 [1.110 - 1.869], p = 0.006), AG / AA type of object in the group is less than in the control group (OR [95% CI], 1.831 [ 1.210 - 2.769], p = 0.0042 ). In addition, GA / AA type of rs4971407 in intron 6, was found to be significantly increased with CI in the dominant model (OR [95% CI], 1.548 [1.033 - 2.318], p = 0.0341). The association distribution between the two SNPs was r 2 = 0.526, which shows that the two SNPs are related and that four haplotypes of the two SNPs are conducted (FIGS. 1B and C). Of the four haplotypes, ht1 [GG] was associated with a decrease in CI. Allele frequencies of ht1 [GG] In the group of patients is significantly lower than the 49.49% of the controls to 45.16% (OR [95% CI ], 0.756 [0.583 - 0.979], p = 0.0343), the ht1ht1 type in the recessive model the percentage of patients also were lower than the control group (OR [95% CI], 0.586 [0.375 - 0.916], p = 0.0191). On the other hand, ht2 [AA] allele and the frequency of ht2 the objects are significantly increased in patients (OR [95% CI], 1.369 , respectively [1.051 - 1.783], p = 0.02; and a, OR [95% CI], 1.69 [1.148 - 2.49], p = 0.0079)
데이터는 빈도(%)로 나타내었다.Data is expressed in percent.
*OR은 성별, 연령, 흡연, 음주, 고혈압, 고지혈증, 심장질환, 허리둘레, TC 및 HDL을 적용한 후의 데이터이다. * OR is data after applying sex, age, smoking, drinking, hypertension, hyperlipidemia, heart disease, waist circumference, TC and HDL.
†Do 및 R은 각각 우성(dominant) 및 열성(recessive)를 나타낸다. † Do and R represent dominant and recessive, respectively.
통계적으로 유의한 p값을 굵은 글씨로 표시하였다.Statistically significant p-values are shown in bold.
<< 실시예Example 5> 5> rs4971407Grs4971407G >A 및 > A and rs4971418Grs4971418G >A와 > A and CICI 아형의 연관성 조사 Association of Subtypes
CI 환자 그룹은 TOAST 분류에 따른 대동맥 동맥경화(LAA)인 115명 및 소혈관 폐색(SVO)인 467명을 포함한다. 본 발명자들은 TOAST 분류에 따른 CI 아형(LAA 및 SVO)에서 SNTP2 SNP 및 그들의 일배체의 영향을 찾기 위해, 대조군 및 CI 아형 사이에서의 그들의 분포를 확인하였다.The CI patient group included 115 patients with aortic atherosclerosis (LAA) and 467 patients with small vessel occlusion (SVO) according to the TOAST classification. We identified their distribution between control and CI subtypes to find the effect of SNTP2 SNPs and their haplotypes on CI subtypes (LAA and SVO) according to the TOAST classification.
CI 그룹과 유사하게, rs4971418의 GA/AA 타입의 대립 유전자는 SVO 환자에서 유의하게 증가되었으며(각각, p=0.0052, p=0.012), ht2[AA] 또한 우성 모델에서 SVO의 증가와 연관되어 있었다(p=0.0163). 한편, ht1[GG]의 빈도는 SVO 환자에서 낮았다(p=0.0372). 하지만 모든 SNP 및 일배체가 LAA와는 연관되어 있지 않았다(표 4). Similar to the CI group, the GA / AA type allele of rs4971418 was significantly increased in SVO patients (p = 0.0052, p = 0.012, respectively), and ht2 [AA] was also associated with an increase in SVO in the dominant model. (p = 0.0163). On the other hand, the frequency of ht1 [GG] was low in SVO patients (p = 0.0372). However, not all SNPs and haplotypes were associated with LAA (Table 4).
데이터는 빈도(%)로 나타내었다.Data is expressed in percent.
*OR은 성별, 연령, 흡연, 음주, 고혈압, 고지혈증, 심장질환, 허리둘레, TC 및 HDL을 적용한 후의 데이터이다. * OR is data after applying sex, age, smoking, drinking, hypertension, hyperlipidemia, heart disease, waist circumference, TC and HDL.
†Do 및 R은 각각 우성(dominant) 및 열성(recessive)를 나타낸다. † Do and R represent dominant and recessive, respectively.
통계적으로 유의한 p값을 굵은 글씨로 표시하였다.Statistically significant p-values are shown in bold.
도 1은 신트로핀 감마 2(Syntrophin gamma 2; SNTG2) 유전자의 유전자 지도 및 일배체(haplotype)를 나타낸 도이다:(A) SNTG2의 다형성; (B) 두 SNP 사이의 연관 분포 계수; (C) SNTG2의 일배체.BRIEF DESCRIPTION OF THE DRAWINGS Figure 1 shows the genetic map and haplotype of Syntrophin gamma 2 (SNTG2) gene: (A) Polymorphism of SNTG2; (B) an association distribution coefficient between two SNPs; (C) Haploid of SNTG2.
<110> Korea Institute of Oriental Medicine <120> Method for diagnosis of stroke using SNPs and haplotypes of Syntrophin gamma 2 as biomarker <130> 9p-10-49 <160> 8 <170> KopatentIn 1.71 <210> 1 <211> 52 <212> DNA <213> rs4971407 SNP <220> <221> variation <222> (27) <223> n is A or G <400> 1 atagcttaca attcagaatg aggtgantgg atgtaaagta cattctgaag tg 52 <210> 2 <211> 52 <212> DNA <213> rs4971418 SNP <220> <221> variation <222> (27) <223> n is A or G <400> 2 cccattccac ttagatctct acaaacnccc agttctctgg catgtgtcct ac 52 <210> 3 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> rs4971407 sense primer <400> 3 acgttggatg tgagcacttc agaatgtact 30 <210> 4 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> rs4971407 antisense primer <400> 4 acgttggatg agacacagcg tgctgaaaac 30 <210> 5 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> rs4971407 genotyping <400> 5 ttcagaatgt actttacatc ca 22 <210> 6 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> rs4971418 sense primer <400> 6 acgttggatg tcccattcca cttagatctc 30 <210> 7 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> rs4971418 antisense primer <400> 7 acgttggatg agatcttaaa cacgtggccc 30 <210> 8 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> rs4971418 genotyping <400> 8 ccacttagat ctctacaaac 20 <110> Korea Institute of Oriental Medicine <120> Method for diagnosis of stroke using SNPs and haplotypes of Syntrophin gamma 2 as biomarker <130> 9p-10-49 <160> 8 <170> KopatentIn 1.71 <210> 1 <211> 52 <212> DNA <213> rs4971407 SNP <220> <221> variation <222> (27) <223> n is A or G <400> 1 atagcttaca attcagaatg aggtgantgg atgtaaagta cattctgaag tg 52 <210> 2 <211> 52 <212> DNA <213> rs4971418 SNP <220> <221> variation <222> (27) <223> n is A or G <400> 2 cccattccac ttagatctct acaaacnccc agttctctgg catgtgtcct ac 52 <210> 3 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> rs4971407 sense primer <400> 3 acgttggatg tgagcacttc agaatgtact 30 <210> 4 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> rs4971407 antisense primer <400> 4 acgttggatg agacacagcg tgctgaaaac 30 <210> 5 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> rs4971407 genotyping <400> 5 ttcagaatgt actttacatc ca 22 <210> 6 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> rs4971418 sense primer <400> 6 acgttggatg tcccattcca cttagatctc 30 <210> 7 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> rs4971418 antisense primer <400> 7 acgttggatg agatcttaaa cacgtggccc 30 <210> 8 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> rs4971418 genotyping <400> 8 ccacttagat ctctacaaac 20
Claims (12)
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
KR1020090114616A KR101046344B1 (en) | 2009-11-25 | 2009-11-25 | Stroke Diagnosis Method Using SNP2 and Polymorphs as Biomarkers |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
KR1020090114616A KR101046344B1 (en) | 2009-11-25 | 2009-11-25 | Stroke Diagnosis Method Using SNP2 and Polymorphs as Biomarkers |
Publications (2)
Publication Number | Publication Date |
---|---|
KR20110057969A true KR20110057969A (en) | 2011-06-01 |
KR101046344B1 KR101046344B1 (en) | 2011-07-05 |
Family
ID=44393525
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
KR1020090114616A KR101046344B1 (en) | 2009-11-25 | 2009-11-25 | Stroke Diagnosis Method Using SNP2 and Polymorphs as Biomarkers |
Country Status (1)
Country | Link |
---|---|
KR (1) | KR101046344B1 (en) |
Families Citing this family (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
KR101485576B1 (en) | 2013-05-29 | 2015-01-21 | 고려대학교 산학협력단 | A bacterium salmonella harboring siRNA against syntrophin beta and antitumoral composition thereof |
-
2009
- 2009-11-25 KR KR1020090114616A patent/KR101046344B1/en not_active IP Right Cessation
Also Published As
Publication number | Publication date |
---|---|
KR101046344B1 (en) | 2011-07-05 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
WO2006063332A2 (en) | Markers for metabolic syndrome obesity and insulin resistance | |
KR101546058B1 (en) | SNP markers for metabolic syndrome and use thereof | |
KR20110106244A (en) | Single nucleotide polymorphism for prognosis of hepatocellular carcinoma | |
KR101046344B1 (en) | Stroke Diagnosis Method Using SNP2 and Polymorphs as Biomarkers | |
KR101023194B1 (en) | Marker for diagnosing atopic dermatitis and use thereof | |
JP2010502205A (en) | Use of SNPs for diagnosis of pain protective haplotypes in the GTP cyclohydrolase 1 gene (GCH1) | |
US20030032099A1 (en) | Methods for predicting susceptibility to obesity and obesity-associated health problems | |
JP5904501B2 (en) | Method for detecting type 2 diabetes | |
JP4956565B2 (en) | Association of EDG5 gene polymorphism V286A with type 2 diabetes and venous thrombosis / pulmonary embolism and use thereof | |
JP6788879B2 (en) | Peripheral artery disease test method and test reagent | |
KR101046343B1 (en) | Stroke diagnosis method using haploid of ELLOL2 as biomarker | |
KR100908125B1 (en) | Genetic polymorphisms associated with myocardial infarction and uses thereof | |
JP5644009B2 (en) | Determination method of inflammatory disease using single nucleotide polymorphism | |
KR102409336B1 (en) | SNP markers for Immunoglobulin A (IgA) nephropathy and IgA vasculitis diagnosis and diagnosis method using the same | |
Herrmann et al. | Polymorphisms in the genes encoding platelet-derived growth factor A and α receptor | |
KR20130027093A (en) | Method for predicting susceptibility to cardiovascular disease using snp of klotho genes | |
KR101141546B1 (en) | Polynucleotides derived from ANKRD15, HPD, PSMD9, WDR66, GPC6, PAX9, LRRC28, TNS4, AXL, and HNRPUL1 genes comprising single nucleotide polymorphisms, microarrays and diagnostic kits comprising the same, and analytic methods using the same | |
KR101046341B1 (en) | TMM5 Gene Polymorphism Marker for Stroke Prediction and Stroke Prediction Method Using the Same | |
JP4649163B2 (en) | Genetic predisposition test for bronchial asthma | |
KR101046342B1 (en) | LPI gene polymorphism marker for stroke prediction and stroke prediction method using the same | |
KR100803258B1 (en) | - Polynucleotides comprising single nucleotide polymorphism microarrays and diagnostic kits comprising the same and methods for diagnosing antibody-nonresponse to hepatitis B vaccine | |
KR100841556B1 (en) | Polynucleotides comprising single nucleotide polymorphism and diagnostic kits comprising the same | |
WO2014006231A1 (en) | Association of vascular endothelial growth factor genetic variant with metabolic syndrome | |
KR100985984B1 (en) | Composition for the diagnosis of susceptibility to chronic obstructive pulmonary disease using COL4A3 gene and method for predicting and analyzing susceptibility to chronic obstructive pulmonary disease using the same | |
JPWO2006068111A1 (en) | Method for determining phenotype associated with polymorphism of PPARγ gene |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
A201 | Request for examination | ||
E701 | Decision to grant or registration of patent right | ||
GRNT | Written decision to grant | ||
FPAY | Annual fee payment |
Payment date: 20140625 Year of fee payment: 4 |
|
FPAY | Annual fee payment |
Payment date: 20150612 Year of fee payment: 5 |
|
FPAY | Annual fee payment |
Payment date: 20160602 Year of fee payment: 6 |
|
FPAY | Annual fee payment |
Payment date: 20170412 Year of fee payment: 7 |
|
LAPS | Lapse due to unpaid annual fee |