KR20110057969A - Method for diagnosis of stroke using snps and haplotypes of syntrophin gamma 2 as biomarker - Google Patents

Abstract

PURPOSE: A polymorphism marker for predicting stroke and a method for predicting stroke using the same are provided to treat stroke. CONSTITUTION: A kit for predicting stroke risk contains a primer pair having a polynucleotide containing 20-100 serial bases containing G or A as a 27th base sequence in rs4971407 of sequence number 1, which is a part of syntrophin gamma 2(SNTG2) gene or complementary polynucleotide thereof. A method for predicting stroke risk comprises: a step of extracting genome DNA from a blood sample; a step of confirming polynucleotide of sequence number 1 and/or 2 from the genome DNA; and a step of determining stroke risk form the result.

Description

Method for diagnosis of stroke using SNPs and haplotypes of Syntrophin gamma 2 as biomarker}

The present invention relates to a polymorphic marker for stroke risk prediction, and a stroke risk prediction method using the polymorphic marker.

The identification of genetic factors affecting stroke is important as it provides many clues related to the etiology of stroke on racial and regional backgrounds. This knowledge offers the opportunity to develop prophylactic or therapeutic drugs based on new personalized or ethnicity for stroke.

Syntrophin is a cytoplasmic terminal protein that has a C - terminal domain that binds dystrophin and binds to other dystrophin - associated proteins that are one of the components of dystrophin glycoproteins (Piluso et. al ., J. Biol . Chem ., 2000; 275: 15851). To date, five subtypes of sintropin have been identified (alpha l, beta 1, beta 2, gamma 1 and gamma 2) (Inoue M et. al ., Nagoya J Med Sci . 2008; 70 (3-4): 117-126).

Consists of 539 amino acids and has a molecular weight of 61.1 KD new Trojan pin gamma 2 (SNTG2) has two flex trim (pleckstrin homology; PH) - like domain, C, which mediates the binding PDZ domain and a dystrophin-terminal "new Trojan pin Unit (SU) 'domain. It also has the ATP.GTP - binding site motif A (p loop) and several sites for phosphorylation. Of the central nervous system in rats The situ hybridization and immunohistostaining analyzes showed the wide distribution of SNTG2 across several cerebral and spinal regions. Transcripts for SNTG2 were located in the perikaryon and proximal portions of the neural pathway. In addition, SNTG2 was detected in sarcolemma of all human muscle fibers in immunohistostaining assay (Piluso et. al ., 2000). Other studies have reported that the PDZ domain, which bisects the first PH domain of SNTG, directly binds to the C - terminus of SCN5A, alters the enzymatic activity of SCN5A and decreases Na ⁺ utility (Ou Y). et al., J Biol Chem . 2003, 17; 278 (3): 1915-1923)

The association between SNTG2 and stroke is not yet clear, but only a few studies have reported the possibility that alterations in the expression or structure of SNTG2 may be related to stroke. For example, the expression of water - specific channel protein, aquaporin 4 (AQP4), which is increased in some neurological diseases such as stroke, was significantly lower in dystrophin mdx mice. This suggests that low expression levels of AQP4 mRNA in mdx mice are functionally linked to AQP4 and dystrophin [Shibuya S et al ., Tohoku J Exp Med . 2008; 215 (4): 313-319.

Thus, the present inventors completed the present invention by confirming the association between the ischemic stroke of two older Koreans and the two SNPs in the intron of SNTG2.

It is an object of the present invention to provide a method for predicting the risk of stroke using two rs4971418, rs4971407 single nucleotide polymorphisms and their haplotypes present in the intron region of SNTG2 (Syntrophin gamma 2).

In order to achieve the above object, the present invention comprises a primer pair capable of amplifying the following polynucleotide, or a complementary polynucleotide thereof, which is a part of intron 6 of the Syntrophin gamma 2 (SNTG2) gene. Provides a kit for predicting stroke risk:

The polynucleotide of rs4971407 having the nucleotide sequence set forth in SEQ ID NO: 1, comprising G or A as the 27th base, and consisting of 20 to 100 consecutive bases.

The present invention also provides a kit for predicting stroke risk comprising a primer pair capable of amplifying the following polynucleotides, or complementary polynucleotides thereof, which are part of Intron 7 of the Cyntropin gamma 2 gene:

The polynucleotide of rs4971418 having the nucleotide sequence set forth in SEQ ID NO: 2, comprising A or G as the 27th base, and consisting of 20 to 100 consecutive bases.

In addition, the present invention simultaneously comprises a pair of primers capable of amplifying a polynucleotide of i) and ii), or a complementary polynucleotide thereof, which is a portion of intron 6 and a portion of intron 7 of the scintopin gamma 2 gene. Provides a kit for predicting stroke risk:

i) a polynucleotide comprising r as the 27th base in rs4971407 having the nucleotide sequence set forth in SEQ ID NO: 1 and consisting of 20 to 100 consecutive bases; And,

Ii) A polynucleotide comprising r as the 27th base and having 20 to 100 consecutive bases in rs4971418 having the nucleotide sequence set forth in SEQ ID NO: 2.

In addition, the present invention simultaneously comprises a pair of primers capable of amplifying a polynucleotide of i) and ii), or a complementary polynucleotide thereof, which is a portion of intron 6 and a portion of intron 7 of the scintopin gamma 2 gene. Provides a kit for predicting stroke risk:

i) a polynucleotide comprising r as the 27 th base in rs4971407 having the nucleotide sequence set forth in SEQ ID NO: 1 and consisting of 20 to 100 consecutive bases; And,

Ii) the polynucleotide comprising A as the 27th base and consisting of 20 to 100 consecutive bases in rs4971418 having the nucleotide sequence set forth in SEQ ID NO: 2.

The invention also provides a kit for predicting stroke risk comprising a microarray comprising the following polynucleotide, or a complementary polynucleotide thereof, which is part of Intron 6 of the Cyntropin gamma 2 gene:

The polynucleotide of rs4971407 having the nucleotide sequence set forth in SEQ ID NO: 1, comprising G or A as the 27th base, and consisting of 20 to 100 consecutive bases.

The present invention also provides a kit for predicting stroke risk comprising a microarray comprising the following polynucleotide, or a complementary polynucleotide thereof, which is part of Intron 7 of the Cyntropin gamma 2 gene:

The polynucleotide of rs4971418 having the nucleotide sequence set forth in SEQ ID NO: 2, comprising A or G as the 27th base, and consisting of 20 to 100 consecutive bases.

The present invention is also intended for stroke risk prediction comprising a microarray comprising a polynucleotide of i) and ii) or a complementary polynucleotide thereof, which is a part of intron 6 and a part of intron 7 of the Cintropin gamma 2 gene Provide the kit:

i) a polynucleotide comprising r as the 27th base in rs4971407 having the nucleotide sequence set forth in SEQ ID NO: 1 and consisting of 20 to 100 consecutive bases; And,

Ii) A polynucleotide comprising r as the 27th base and having 20 to 100 consecutive bases in rs4971418 having the nucleotide sequence set forth in SEQ ID NO: 2.

The present invention is also intended for stroke risk prediction comprising a microarray comprising a polynucleotide of i) and ii) or a complementary polynucleotide thereof, which is a part of intron 6 and a part of intron 7 of the Cintropin gamma 2 gene Provide the kit:

i) a polynucleotide comprising r as the 27 th base in rs4971407 having the nucleotide sequence set forth in SEQ ID NO: 1 and consisting of 20 to 100 consecutive bases; And,

Ii) the polynucleotide comprising A as the 27th base and consisting of 20 to 100 consecutive bases in rs4971418 having the nucleotide sequence set forth in SEQ ID NO: 2.

In addition,

1) extracting genomic DNA from blood samples isolated from the subject;

2) identifying the base of the polynucleotide set forth in SEQ ID NO: 1 and / or SEQ ID NO: 2 in the genomic DNA of step 1); And

3) From the confirmation result of step 2)

Iii) when the genotype of the allele of the polynucleotide of SEQ ID NO: 1 is GA or AA, the individual at high risk of stroke;

Ii) when the genotype of the allele of the polynucleotide of SEQ ID NO: 4 is AG or AA, the individual having a low risk of stroke;

Iii) when the 27th base of the polynucleotide of SEQ ID NO: 4 is A, the individual having a low risk of stroke;

Iii) when the 27th base of the polynucleotide represented by SEQ ID NO: 1 is G and the 27th base of the polynucleotide described by SEQ ID NO: 2 is G, the individual having a low risk of stroke; And,

Iii) if the 27th base of the polynucleotide represented by SEQ ID NO: 1 is A and the 27th base of the polynucleotide represented by SEQ ID NO: 2 is A, determining that the individual is at high risk for stroke Provides a method of predicting stroke risk.

The incidence of allele A or AG / AA genotype of rs4971418, the polymorphism of the intron 7 region of syntrophin gamma 2 (SNTG2), was less common in stroke patients, and the GA / s of rs4971407, the polymorphism of the intron 6 region, was lower in stroke patients. The present invention relates to a method of predicting the risk of stroke using the polymorphism and its haplotype as a marker for stroke by confirming that the frequency of AA genotypes is higher in a stroke patient than in a normal person. Therefore, the risk of stroke can be predicted, and thus can be usefully used in the field of treatment for stroke.

Hereinafter, the present invention will be described in detail.

The present invention relates to a polynucleotide comprising rs4971407, part of intron 6 of the Syntrophin gamma 2 (SNTG2) gene, comprising a 27th base and consisting of 20 to 100 consecutive bases, or a complementary polynucleotide thereof. Provided is a single nucleotide polymorphism (SNP) marker for predicting stroke risk.

In addition, the present invention is rs4971418, which is a part of intron 7 of the syntropin gamma 2 gene, for stroke risk prediction comprising a polynucleotide comprising the 27th base and composed of 20 to 100 consecutive bases or a complementary polynucleotide thereof. Provide a monobasic polymorphic marker.

In the present invention, after the collected venous targeting ischemic stroke patients and normal subjects, purified genomic DNA, and then, a single from the purified genomic DNA-base extension reaction - performing (single base extension reaction) to the genotype of rs4971407 and rs4971418 Decided.

In the present invention, in order to determine the association between rs4971407 or rs4971418 polymorphism and stroke, the association was analyzed using multiple logistic regression in ischemic stroke patients and normal people. As a result, the minor allele A of rs4971418 showed significantly lower frequency in stroke patients. In addition, the number of subjects with AG + AA genotype in the dominant model decreased in the stroke patients. In addition, the number of subjects with the GA + AA genotype of rs4971407 in the dominant model increased in the stroke patients.

In addition, in the present invention, in order to determine whether the association between rs4971407 and rs4971418 polymorphism and stroke is affected by various clinical factors, multiple logistic regression analysis was performed as described above after applying various clinical factors. As a result, the genetic association between rs4971407 or rs4971418 and ischemic stroke was remarkable after application to multiple factors such as sex, age, hypertension, hyperlipidemia, ischemic heart disease, smoking, drinking, waist circumference, TC, HDL, etc. As a result of analyzing the distribution of the two polymorphisms, two SNPs were associated, and among the haplotypes of the two polymorphisms, ht1 [GG] was lower in the stroke patient group than in the control group, and ht2 [AA] was in the stroke patient group. The frequency was higher than that of the control group.

That is, the frequency of the minor allele A or genotype AG + AA of rs4971418, the polymorphism of the intron 7 site of TSNTG2, the frequency of genotype GA + AA of the rs4971407 polymorphism of the intron 6 site, and ht1 and of the four haplotypes of the two polymorphisms. It was confirmed that ht2 was statistically significant difference between the control group and the ischemic stroke patient.

Therefore, it can be seen that the rs4971407 and rs4971418 gene polymorphisms and haplotypes of the present invention affect the sensitivity to stroke, which can be used as a polymorphic marker for predicting the risk of stroke.

The present invention also provides a microarray for predicting stroke risk comprising a polynucleotide constituting the polymorphic marker of the present invention or a complementary polynucleotide thereof.

Since the polymorphic markers of the present invention, consisting of the rs4971407 and rs4971418 gene polymorphisms and haplotypes thereof of the present invention, show significant differences in normal and stroke patients, the microarrays of the present invention comprising the polymorphic markers predict the risk of stroke. It can be usefully used.

The microarrays according to the present invention comprise the polynucleotides of rs4971407 and / or rs4971418, each comprising a 27th base and consisting of 20 to 100 contiguous bases or complementary polynucleotides thereof, and polynucleotides hybridizing with them. It may be prepared by conventional methods known to those skilled in the art.

For example, the polynucleotide is an amino-silane (amino-silane), poly-L-lysine (poly-L-lysine) and has an active group selected from the group consisting of aldehyde (aldehyde) can be fixed on the coated substrate. In addition, the substrate may be selected from the group consisting of silicon wafer, glass, quartz, metal and plastic. As a method of immobilizing the polynucleotide on a substrate, a micropipetting method using a piezoelectric method, a method using a pin-shaped spotter, etc. may be used.

The present invention also provides a kit for predicting stroke risk comprising a primer pair capable of amplifying the following polynucleotide, or a complementary polynucleotide thereof, which is part of Intron 6 of the Cyntropin gamma 2 gene:

The polynucleotide of rs4971407 having the nucleotide sequence set forth in SEQ ID NO: 1, comprising G or A as the 27th base, and consisting of 20 to 100 consecutive bases.

The present invention also provides a kit for predicting stroke risk comprising a primer pair capable of amplifying the following polynucleotides, or complementary polynucleotides thereof, which are part of Intron 7 of the Cyntropin gamma 2 gene:

The polynucleotide of rs4971418 having the nucleotide sequence set forth in SEQ ID NO: 2, comprising A or G as the 27th base, and consisting of 20 to 100 consecutive bases.

In addition, the present invention simultaneously comprises a pair of primers capable of amplifying a polynucleotide of i) and ii), or a complementary polynucleotide thereof, which is a portion of intron 6 and a portion of intron 7 of the scintopin gamma 2 gene. Provides a kit for predicting stroke risk:

i) a polynucleotide comprising r as the 27th base in rs4971407 having the nucleotide sequence set forth in SEQ ID NO: 1 and consisting of 20 to 100 consecutive bases; And,

Ii) A polynucleotide comprising r as the 27th base and having 20 to 100 consecutive bases in rs4971418 having the nucleotide sequence set forth in SEQ ID NO: 2.

In addition, the present invention simultaneously comprises a pair of primers capable of amplifying a polynucleotide of i) and ii), or a complementary polynucleotide thereof, which is a portion of intron 6 and a portion of intron 7 of the scintopin gamma 2 gene. Provides a kit for predicting stroke risk:

i) a polynucleotide comprising r as the 27 th base in rs4971407 having the nucleotide sequence set forth in SEQ ID NO: 1 and consisting of 20 to 100 consecutive bases; And,

Ii) the polynucleotide comprising A as the 27th base and consisting of 20 to 100 consecutive bases in rs4971418 having the nucleotide sequence set forth in SEQ ID NO: 2.

The present invention also provides a kit for predicting stroke risk comprising a microarray comprising the following polynucleotide, or a complementary polynucleotide thereof, which is part of Intron 6 of the Cintropin gamma 2 gene:

The polynucleotide of rs4971407 having the nucleotide sequence set forth in SEQ ID NO: 1, comprising G or A as the 27th base, and consisting of 20 to 100 consecutive bases.

The present invention also provides a kit for predicting stroke risk comprising a microarray comprising the following polynucleotide, or a complementary polynucleotide thereof, which is part of Intron 7 of the Cyntropin gamma 2 gene:

The polynucleotide of rs4971418 having the nucleotide sequence set forth in SEQ ID NO: 2, comprising A or G as the 27th base, and consisting of 20 to 100 consecutive bases.

The present invention is also intended for stroke risk prediction comprising a microarray comprising a polynucleotide of i) and ii) or a complementary polynucleotide thereof, which is a part of intron 6 and a part of intron 7 of the Cintropin gamma 2 gene Provide the kit:

i) a polynucleotide comprising r as the 27th base in rs4971407 having the nucleotide sequence set forth in SEQ ID NO: 1 and consisting of 20 to 100 consecutive bases; And,

Ii) A polynucleotide comprising r as the 27th base and having 20 to 100 consecutive bases in rs4971418 having the nucleotide sequence set forth in SEQ ID NO: 2.

The present invention is also intended for stroke risk prediction comprising a microarray comprising a polynucleotide of i) and ii) or a complementary polynucleotide thereof, which is a part of intron 6 and a part of intron 7 of the Cintropin gamma 2 gene Provide the kit:

i) a polynucleotide comprising r as the 27th base and consisting of 20 to 100 consecutive bases in rs4971407 having the nucleotide sequence set forth in SEQ ID NO: 1; And,

Ii) the polynucleotide comprising A as the 27th base and consisting of 20 to 100 consecutive bases in rs4971418 having the nucleotide sequence set forth in SEQ ID NO: 2.

Since the frequency, genotype frequency, and haplotype ratio of the minor alleles of rs4971407 and / or rs4971418 of the present invention showed a significant difference in normal and stroke patients, primer pairs or amplification of the polymorphic markers of the present invention or Kits comprising microarrays comprising the polymorphic markers of the invention can be usefully used to predict the risk of stroke.

Among the polymorphic markers of the present invention, the primer pair for rs4971407 is a polynucleotide described by SEQ ID NO: 3 and SEQ ID NO: 4, and the primer pair for rs4971418 is preferably a polynucleotide described by SEQ ID NO: 6 and SEQ ID NO: 7, The pair is not limited in size and position binding to the template as long as it can specifically amplify the polymorphic site, and a person skilled in the art can easily design a primer using conventional primer selection software.

Kits according to the invention may comprise a further fluorescent material, a fluorescent material is streptavidin-to-(like phosphatease conjugate strepavidin), chemical fluorophore (chemiflurorensce) and chemiluminescent substances (chemiluminescent) alkali deionized prints enzyme bonding material It is preferably selected from the group consisting of, but is not limited thereto.

Kits according to the invention may additionally comprise reaction reagents, the reaction reagents of which are used for hybridization, reverse transcriptase for synthesizing cDNA from RNA, cNTPs and rNTPs (premixed or separated feed), fluorescent dyes Labeling reagents such as chemical inducing agents, washing buffer solution, etc., but may not be limited thereto.

In addition,

1) extracting genomic DNA from blood samples isolated from the subject;

2) identifying the base of the polynucleotide set forth in SEQ ID NO: 1 and / or SEQ ID NO: 2 in the genomic DNA of step 1); And

3) From the confirmation result of step 2)

Iii) when the genotype of the allele of the polynucleotide of SEQ ID NO: 1 is GA or AA, the individual at high risk of stroke;

Ii) when the genotype of the allele of the polynucleotide of SEQ ID NO: 4 is AG or AA, the individual having a low risk of stroke;

Iii) when the 27th base of the polynucleotide of SEQ ID NO: 4 is A, the individual having a low risk of stroke;

Iii) when the 27th base of the polynucleotide represented by SEQ ID NO: 1 is G and the 27th base of the polynucleotide described by SEQ ID NO: 2 is G, the individual having a low risk of stroke; And,

Iii) if the 27th base of the polynucleotide represented by SEQ ID NO: 1 is A and the 27th base of the polynucleotide represented by SEQ ID NO: 2 is A, determining that the individual is at high risk for stroke Provides a method of predicting stroke risk.

In this method, an individual means any animal, such as human, monkey, dog, goat, pig or rat.

Bases of the polynucleotide of step 2) is sequencing analysis, sequencing, a pie, a hybridization of the microarray, PCR extension analysis, and real-time PCR analysis, FRET analysis and MALDI - sequence analysis using a TOF (MALDI - TOF based mini - sequencing assay It can be carried out by any one method selected from the group consisting of), but is not limited thereto, and any conventional method used in the art used for sequencing the SNP.

The frequency of the minor alleles of rs4971407 and / or rs4971418 of the present invention, the frequency of genotypes, and the proportion of haplotypes showed significant differences in normal and stroke patients, and therefore the risk of stroke by analyzing the sequences of the polymorphic markers of the present invention. Can be predicted.

Hereinafter, the present invention will be described in detail by way of examples.

However, the following Examples are only for illustrating the present invention and do not limit the present invention.

< Example  1> Selection of test subject

The present inventors recruited from 12 hospitals in Korea, a genetically unrelated cerebral infarction (CI) patient group (n = 661) and a control group (n = 490). All patients underwent basic medical examination and CT / MRI examination. People with stroke signs were excluded from the control group. In addition, patients with diabetes were excluded from both control and cerebral infarction patients to minimize confusion with the effect of risk factors. No gender differences existed and all patients received written informed consent. The experimental protocol was approved by the Institutional Review Board of the Korean Institute of Oriental Medicine and the local hospital recruiting patients.

< Example  2> Statistical and clinical characteristics analysis of the subject

We analyzed the statistical and clinical characteristics of the subject. Specifically, in clinical analysis, fasting blood sugar (FBS) and serum lipids (eg, total cholesterol (TC), triglyceride (TG) and HDL) are automated biochemical analyzers. Obtained using It was applied only if the triglyceride levels are less than 400 mg / dL in the target Friedwald formula [- (C + TG / 5 HDL -) LDL - C = TC].

For statistical analysis, data was used for SAS software version 9.1.3 (SAS Institute Inc, NC, USA). Categorical variables were compared by Chi - square test. All continuous variables were subjected to the Kolmogorov - Smirnov normality test. Differences in continuous variables were determined using a parametric test (Student's t- test and ANOVA) or a non - parametric test (Wilcoxonrank - sum test and Kruskal - Wallistest). Hereinafter, statistical analysis in the experiment was performed in the same manner.

As a result, as shown in Table 1 below, the stroke patient group included more males and elders than the control group. The typical stroke risk factors, hypertension, hyperlipidemia, ischemic heart disease, smoking and drinking status, were higher in the stroke group than in the control group. In addition, the body mass index (BMI) of the patient group was slightly lower, but the obesity index waist and WHR were significantly higher in the stroke group than in the control group. In addition, the group of cerebral infarction showed lower TC and HDL levels than the control group. However, all lipid levels in the control and cerebral infarction patients were in the normal blood lipid range according to the recommended lipid level guidelines for geology and atherosclerosis.

characteristic Control group (N = 490) Patient (N = 661) p value Last name (M / F) ^a 214 (43.70) / 276 (56.30) 351 (53.10) / 310 (46.90) 0.002 Age ^b 490 (61.33 ± 9.43) 660 (66.12 ± 11.52) <0.001 Record TIA (Yes / No) ^a 12 (2.50) / 471 (97.50) 35 (5.40) / 612 (94.60) 0.016 HT (Yes / No) ^a 68 (13.90) / 420 (86.10) 369 (56.30) / 286 (43.70) <0.001 Hyperlipidemia (Yes / No) ^a 24 (4.90) / 462 (95.10) 52 (8.00) / 594 (92.00) 0.041 Heart disease (yes / no) ^a 9 (1.90) / 477 (98.10) 38 (5.90) / 609 (94.10) 0.001 Body measurement characteristics Smoking (None / Pause / Yes) ^a 192 (39.40) / 267 (54.80)
/ 28 (5.70) 359 (54.50) / 104 (15.80)
/ 196 (29.70) <0.001 Drinking alcohol (don't stop / stop) ^a 301 (61.90) / 31 (6.40)
/ 154 (31.70) 360 (54.60) / 56 (8.50)
/ 243 (36.90) 0.041 Weight (kg) ^b 476 (62.05 ± 9.22) 591 (61.00 ± 10.76) 0.087 Height (cm) ^b 474 (159.79 ± 8.67) 569 (160.68 ± 8.45) 0.094 BMI (kg / m ² ) ^b 474 (24.28 ± 2.79) 565 (23.57 ± 3.18) <0.001 Waist circumference (cm) ^b 417 (83.93 ± 8.42) 524 (86.02 ± 9.36) <0.001 Hip circumference (cm) ^b 401 (96.05 ± 6.75) 500 (92.29 ± 8.21) <0.001 whr ^b 401 (0.877 ± 0.060) 499 (0.934 ± 0.059) <0.001 Blood variables GOT (U / ml) ^b 490 (26.95 ± 18.72) 661 (25.47 ± 13.64) 0.119 GPT (U / ml) ^b 490 (25.30 ± 18.68) 661 (23.66 ± 19.18) 0.147 Total Cholesterol (TC) (mg / dL) ^b 489 (201.56 ± 38.83) 653 (190.21 ± 39.98) <0.001 Triglyceride (TG) (mg / dL) ^b 490 (144.47 ± 78.33) 644 (145.03 ± 87.83) 0.911 HDL - Cholesterol (mg / dL) ^b 490 (52.53 ± 12.75) 643 (42.90 ± 12.99) <0.001 Fasting Blood Sugar (mg / dL) ^b 490 (99.38 ± 10.26) 661 (99.94 ± 15.09) 0.452

^a, be (%), and c ² by case - shows the P value obtained from the verified.

P values by ^b test (mean standard deviation) and Student's t − test are shown.

< Example  3> DNA  Purification and genotype ( genotyping ) analysis

We collected venous whole blood from a venous blood collection tube containing EDTA (BD Biosciences, Franklin Lakes, USA) from an overnight fast. Plasma was isolated from the whole blood by centrifugation at 1,500 g for 15 minutes. Then, genomic DNA was purified from the buffy coat containing lymphocytes using the GeneAll genomic isolation kit (GeneAll co., Korea) according to the manufacturer's instructions. G in rs4971407> A SNP (SEQ ID NO: 1: 5 '- ATAGCTTACAATTCAGAATGAGGTGA [A / G] TGGATGTAAAGTACATTCTGAAGTG - 3') , and G in rs4971418> A SNP (SEQ ID NO: 2: 5 '- CCCATTCCACTTAGATCTCTACAAAC [A / G] CCCAGTTCTCTGGCATGTGTCCTAC - 3' ) Were genotyped using the single - base amplification reaction of MassARRAY ™ (Sequenom, USA) according to the manufacturer's instructions. Primers used for amplification of SNP sites and gene specific sites around rs4971407 and rs4971418 are shown in Table 2. In order to confirm the accuracy of genotyping, 52 SNP sites, which account for 5% of the participants, were sequenced.

SNP Primer ID order rs4971407 PCR 5 '- ACGTTGGATGTGAGCACTTCAGAATGTACT - 3' (SEQ ID NO: 3) 5 '- ACGTTGGATGAGACACAGCGTGCTGAAAAC - 3' (SEQ ID NO: 4) Genotyping 5'-TTCAGAATGTACTTTACATCCA-3 '(SEQ ID NO: 5) rs4971418 PCR 5 '- ACGTTGGATGTCCCATTCCACTTAGATCTC - 3' (SEQ ID NO: 6) 5 '- ACGTTGGATGAGATCTTAAACACGTGGCCC - 3' (SEQ ID NO: 7) Genotyping 5'-CCACTTAGATCTCTACAAAC-3 '(SEQ ID NO: 8)

In addition, the Hardy-a was estimated that the p-value by - (Weinberg equilibrium, Hardy HWE) having at least 0.01, HapAnalyzer software version .1.0.1 (http://hap.ngri.go.kr/) bar Berg equilibrium The frequency of minor alleles of rs4971407G> A and rs4971418G> A in the control group was 0.427 and 0.457, respectively, which was consistent with HWE (chi square value = 0.127, P - value> 0.05) (FIG. 1A).

< Example  4> rs4971407G > A and rs4971418G > A link between clinical factors

The present inventors analyzed using multiple logistic regression to determine the association between rs4971407G> A and rs4971418G> A in stroke patients and controls. In multiple logistic regression, the association between rs4971407G> A and rs4971418G> A with stroke disease status and odds ratio (OR) was calculated at 95% confidence intervals (CI), and the statistical significance was p <0.05. Was set.

As a result, as shown in Table 3, the multiple regression model to which sex, age, smoking, drinking, hypertension, hyperlipidemia, heart disease, waist circumference, TC and HDL - C were applied to the A allele of rs4971418 located at intron 7 frequency is significantly lower than the control group (OR [95% CI], 1.440 [1.110 - 1.869], p = 0.006), AG / AA type of object in the group is less than in the control group (OR [95% CI], 1.831 [ 1.210 - 2.769], p = 0.0042 ). In addition, GA / AA type of rs4971407 in intron 6, was found to be significantly increased with CI in the dominant model (OR [95% CI], 1.548 [1.033 - 2.318], p = 0.0341). The association distribution between the two SNPs was r ² = 0.526, which shows that the two SNPs are related and that four haplotypes of the two SNPs are conducted (FIGS. 1B and C). Of the four haplotypes, ht1 [GG] was associated with a decrease in CI. Allele frequencies of ht1 [GG] In the group of patients is significantly lower than the 49.49% of the controls to 45.16% (OR [95% CI ], 0.756 [0.583 - 0.979], p = 0.0343), the ht1ht1 type in the recessive model the percentage of patients also were lower than the control group (OR [95% CI], 0.586 [0.375 - 0.916], p = 0.0191). On the other hand, ht2 [AA] allele and the frequency of ht2 the objects are significantly increased in patients (OR [95% CI], 1.369 , respectively [1.051 - 1.783], p = 0.02; and a, OR [95% CI], 1.69 [1.148 - 2.49], p = 0.0079)

Allele frequency Control group CI p value OR (95% CI) rs4971407 A 418 (42.65) 614 (46.44) 0.093 1.249 (0.964 to 1.619) G 562 (57.35) 708 (53.56) rs4971418 A 447 (45.71) 660 (49.92) 0.006 1.440 (1.110 to 1.869) G 531 (54.29) 662 (50.08) ht1 - 494 (50.51) 725 (54.84) 0.0343 0.756 (0.583 to 0.979) ht`1 484 (49.49) 597 (45.16) ht2 - 607 (62.07) 773 (58.47) 0.02 1.369 (1.051 to 1.783) ht2 371 (37.93) 549 (41.53) ht3 - 902 (92.23) 1211 (91.60) 0.3731 1.257 (0.760 to 2.077) ht3 76 (7.77) 111 (8.40) ht4 - 931 (95.19) 1257 (95.08) 0.1548 0.658 (0.370 to 1.171) ht4 47 (4.81) 65 (4.92) model genotype Control group CI p value OR (95% CI) Do rs4971407 GG 161 (32.86) 181 (27.38) 0.0341 1.548 (1.033 to 2.318) GA + AA 329 (67.14) 480 (72.62) rs4971418 GG 150 (30.67) 162 (24.51) 0.0042 1.831 (1.21 to 2.769) GA + AA 339 (69.33) 499 (75.49) ht1 - + - 128 (26.18) 190 (28.74) 0.2354 0.779 (0.516 to 1.177) - / ht1 + ht1ht1 361 (73.82) 471 (71.26) ht2 - + - 187 (38.24) 217 (32.83) 0.0079 1.69 (1.148 to 2.49) - / ht2 + ht2ht2 302 (61.76) 444 (67.17) ht3 - + - 414 (84.66) 558 (84.42) 0.4095 1.253 (0.733 to 2.14) - / ht4 + ht4ht4 75 (15.34) 103 (15.58) ht4 - + - 443 (90.59) 597 (90.32) 0.1346 0.632 (0.347 to 1.153) - / ht4 + ht4ht4 46 (9.41) 64 (9.68) Rec rs4971407 GG + GA 401 (81.84) 527 (79.73) 0.5775 1.139 (0.721 to 1.797) AA 89 (18.16) 134 (20.27) rs4971418 GG + GA 381 (77.91) 500 (75.64) 0.1152 1.426 (0.917 to 2.216) AA 108 (22.09) 161 (24.36) ht1 , - + - ht1 366 (74.85) 535 (80.94) 0.0191 0.586 (0.375 to 0.916) ht1ht1 123 (25.15) 126 (19.06) ht2 , - + - ht2 420 (85.89) 556 (84.11) 0.3364 1.281 (0.773 to 2.124) ht2ht2 69 (14.11) 105 (15.89) ht3 , - + - ht3 488 (99.8) 653 (98.79) 0.5496 2.355 (0.142 to 38.945) ht3ht3 1 (0.2) 8 (1.21) ht4 , - + - ht4 488 (99.8) 660 (99.85) 0.9067 1.272 (0.023 to 71.326) ht4ht4 1 (0.2) 1 (0.15)

Data is expressed in percent.

^* OR is data after applying sex, age, smoking, drinking, hypertension, hyperlipidemia, heart disease, waist circumference, TC and HDL.

^† Do and R represent dominant and recessive, respectively.

Statistically significant p-values are shown in bold.

< Example  5> rs4971407G > A and rs4971418G > A and CI  Association of Subtypes

The CI patient group included 115 patients with aortic atherosclerosis (LAA) and 467 patients with small vessel occlusion (SVO) according to the TOAST classification. We identified their distribution between control and CI subtypes to find the effect of SNTP2 SNPs and their haplotypes on CI subtypes (LAA and SVO) according to the TOAST classification.

Similar to the CI group, the GA / AA type allele of rs4971418 was significantly increased in SVO patients (p = 0.0052, p = 0.012, respectively), and ht2 [AA] was also associated with an increase in SVO in the dominant model. (p = 0.0163). On the other hand, the frequency of ht1 [GG] was low in SVO patients (p = 0.0372). However, not all SNPs and haplotypes were associated with LAA (Table 4).

Allele frequency Control group CI p value OR (95% CI) rs4971407 A 418 (42.65) 443 (47.43) 0.0976 1.269 (0.957 to 1.683) G 562 (57.35) 491 (52.57) rs4971418 A 447 (45.71) 471 (50.43) 0.0052 1.498 (1.128 to 1.989) G 531 (54.29) 463 (49.57) ht1 - 494 (50.51) 514 (55.03) 0.0372 0.741 (0.559 to 0.982) ht`1 484 (49.49) 420 (44.97) ht2 - 607 (62.07) 534 (57.17) 0.017 1.419 (1.064 to 1.89) ht2 371 (37.93) 400 (42.83) ht3 - 902 (92.23) 863 (92.4) 0.3754 1.281 (0.741 to 2.215) ht3 76 (7.77) 71 (7.6) ht4 - 931 (95.19) 891 (95.4) 0.1019 0.582 (0.304 to 1.113) ht4 47 (4.81) 43 (4.6) model genotype Control group CI p value OR (95% CI) Do rs4971407 GG 161 (32.86) 123 (26.34) 0.0747 1.49 (0.961 - 2.311) GA + AA 329 (67.14) 344 (73.66) rs4971418 GG 150 (30.67) 116 (24.84) 0.0120 1.777 (1.135 to 2.784) GA + AA 339 (69.33) 351 (75.16) ht1 - + - 128 (26.18) 136 (29.12) 0.1222 0.702 (0.448 - 1.1) - / ht1 + ht1ht1 361 (73.82) 331 (70.88) ht2 - + - 187 (38.24) 150 (32.12) 0.0163 1.676 (1.1 - 2.553) - / ht2 + ht2ht2 302 (61.76) 317 (67.88) ht3 - + - 414 (84.66) 401 (85.87) 0.4282 1.268 (0.705 to 2.278) - / ht4 + ht4ht4 75 (15.34) 66 (14.13) ht4 - + - 443 (90.59) 425 (91.01) 0.0812 0.547 (0.278 to 1.078) - / ht4 + ht4ht4 46 (9.41) 42 (8.99) Rec rs4971407 GG + GA 401 (81.84) 368 (78.8) 0.3773 1.25 (0.762 to 2.05) AA 89 (18.16) 99 (21.2) rs4971418 GG + GA 381 (77.91) 347 (74.3) 0.0456 1.623 (1.009 - 2.61) AA 108 (22.09) 120 (25.7) ht1 , - + - ht1 366 (74.85) 378 (80.94) 0.0586 0.627 (0.387 to 1.017) ht1ht1 123 (25.15) 89 (19.06) ht2 , - + - ht2 420 (85.89) 384 (82.23) 0.1707 1.457 (0.851 to 2.494) ht2ht2 69 (14.11) 83 (17.77) ht3 , - + - ht3 488 (99.8) 462 (98.93) 0.4925 2.677 (0.161 to 44.535) ht3ht3 1 (0.2) 5 (1.07) ht4 , - + - ht4 488 (99.8) 466 (99.79) 0.7782 1.838 (0.027 to 126.977) ht4ht4 1 (0.2) 1 (0.21)

Data is expressed in percent.

^* OR is data after applying sex, age, smoking, drinking, hypertension, hyperlipidemia, heart disease, waist circumference, TC and HDL.

^† Do and R represent dominant and recessive, respectively.

Statistically significant p-values are shown in bold.

BRIEF DESCRIPTION OF THE DRAWINGS Figure 1 shows the genetic map and haplotype of Syntrophin gamma 2 (SNTG2) gene: (A) Polymorphism of SNTG2; (B) an association distribution coefficient between two SNPs; (C) Haploid of SNTG2.

<110> Korea Institute of Oriental Medicine <120> Method for diagnosis of stroke using SNPs and haplotypes of          Syntrophin gamma 2 as biomarker <130> 9p-10-49 <160> 8 <170> KopatentIn 1.71 <210> 1 <211> 52 <212> DNA <213> rs4971407 SNP <220> <221> variation <222> (27) <223> n is A or G <400> 1 atagcttaca attcagaatg aggtgantgg atgtaaagta cattctgaag tg 52 <210> 2 <211> 52 <212> DNA <213> rs4971418 SNP <220> <221> variation <222> (27) <223> n is A or G <400> 2 cccattccac ttagatctct acaaacnccc agttctctgg catgtgtcct ac 52 <210> 3 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> rs4971407 sense primer <400> 3 acgttggatg tgagcacttc agaatgtact 30 <210> 4 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> rs4971407 antisense primer <400> 4 acgttggatg agacacagcg tgctgaaaac 30 <210> 5 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> rs4971407 genotyping <400> 5 ttcagaatgt actttacatc ca 22 <210> 6 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> rs4971418 sense primer <400> 6 acgttggatg tcccattcca cttagatctc 30 <210> 7 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> rs4971418 antisense primer <400> 7 acgttggatg agatcttaaa cacgtggccc 30 <210> 8 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> rs4971418 genotyping <400> 8 ccacttagat ctctacaaac 20  

Claims (12)

A kit for predicting stroke risk comprising a primer pair capable of amplifying the following polynucleotides, or complementary polynucleotides thereof, which are part of Intron 6 of the Syntrophin gamma 2 (SNTG2) gene: The polynucleotide of rs4971407 having the nucleotide sequence set forth in SEQ ID NO: 1, comprising G or A as the 27th base, and consisting of 20 to 100 consecutive bases. A kit for predicting stroke risk comprising a primer pair capable of amplifying the following polynucleotides, or complementary polynucleotides thereof, which are part of Intron 7 of the Cintropin gamma 2 gene: The polynucleotide of rs4971418 having the nucleotide sequence set forth in SEQ ID NO: 2, comprising A or G as the 27th base, and consisting of 20 to 100 consecutive bases. A kit for predicting stroke risk comprising simultaneously a portion of intron 6 of a scintopin gamma 2 gene and a pair of primers capable of amplifying a polynucleotide of i) and ii) below, or a portion of intron 7, or a complementary polynucleotide thereof : i) a polynucleotide comprising r as the 27th base and having 20 to 100 consecutive bases in rs4971407 having the nucleotide sequence set forth in SEQ ID NO: 1; And, Ii) A polynucleotide comprising r as the 27th base and having 20 to 100 consecutive bases in rs4971418 having the nucleotide sequence set forth in SEQ ID NO: 2. A kit for predicting stroke risk comprising simultaneously a portion of intron 6 of a scintopin gamma 2 gene and a pair of primers capable of amplifying a polynucleotide of i) and ii) below, or a portion of intron 7, or a complementary polynucleotide thereof : i) a polynucleotide comprising r as the 27 th base in rs4971407 having the nucleotide sequence set forth in SEQ ID NO: 1 and consisting of 20 to 100 consecutive bases; And, Ii) the polynucleotide comprising A as the 27th base and consisting of 20 to 100 consecutive bases in rs4971418 having the nucleotide sequence set forth in SEQ ID NO: 2. A kit for predicting stroke risk comprising a microarray comprising the following polynucleotide, or a complementary polynucleotide thereof, which is part of Intron 6 of the Cintropin gamma 2 gene: The polynucleotide of rs4971407 having the nucleotide sequence set forth in SEQ ID NO: 1, comprising G or A as the 27th base, and consisting of 20 to 100 consecutive bases. A kit for predicting stroke risk comprising a microarray comprising the following polynucleotide, or a complementary polynucleotide thereof, which is part of Intron 7 of the Cintropin gamma 2 gene: The polynucleotide of rs4971418 having the nucleotide sequence set forth in SEQ ID NO: 2, comprising A or G as the 27th base, and consisting of 20 to 100 consecutive bases. A kit for predicting stroke risk comprising a microarray comprising a polynucleotide of i) and ii) or a complementary polynucleotide thereof, which is a portion of intron 6 and a portion of intron 7 of the scintopin gamma 2 gene: i) a polynucleotide comprising r as the 27th base in rs4971407 having the nucleotide sequence set forth in SEQ ID NO: 1 and consisting of 20 to 100 consecutive bases; And, Ii) A polynucleotide comprising r as the 27th base and having 20 to 100 consecutive bases in rs4971418 having the nucleotide sequence set forth in SEQ ID NO: 2. A kit for predicting stroke risk comprising a microarray comprising a polynucleotide of i) and ii) or a complementary polynucleotide thereof, which is a portion of intron 6 and a portion of intron 7 of the scintopin gamma 2 gene: i) a polynucleotide comprising r as the 27 th base in rs4971407 having the nucleotide sequence set forth in SEQ ID NO: 1 and consisting of 20 to 100 consecutive bases; And, Ii) the polynucleotide comprising A as the 27th base and consisting of 20 to 100 consecutive bases in rs4971418 having the nucleotide sequence set forth in SEQ ID NO: 2. The stroke risk prediction kit according to any one of claims 1 to 8, further comprising a fluorescent material. The kit for predicting stroke risk according to any one of claims 1 to 8, further comprising a reaction reagent. 1) extracting genomic DNA from blood samples isolated from the subject; 2) identifying the base of the polynucleotide set forth in SEQ ID NO: 1 and / or SEQ ID NO: 2 in the genomic DNA of step 1); And 3) From the confirmation result of step 2) Iii) when the genotype of the allele of the polynucleotide of SEQ ID NO: 1 is GA or AA, the individual at high risk of stroke; Ii) when the genotype of the allele of the polynucleotide of SEQ ID NO: 4 is AG or AA, the individual having a low risk of stroke; Iii) when the 27th base of the polynucleotide of SEQ ID NO: 4 is A, the individual having a low risk of stroke; Iii) when the 27th base of the polynucleotide represented by SEQ ID NO: 1 is G and the 27th base of the polynucleotide described by SEQ ID NO: 2 is G, the individual having a low risk of stroke; And, Iii) if the 27th base of the polynucleotide represented by SEQ ID NO: 1 is A and the 27th base of the polynucleotide represented by SEQ ID NO: 2 is A, determining that the individual is at high risk for stroke How to predict stroke risk. The method of claim 11, wherein the base of the polynucleotide of step 2) is sequenced using sequencing analysis, pyro sequencing, hybridization by microarray, PCR extension analysis, real time PCR analysis, FRET analysis and MALDI - TOF (MALDI - TOF). stroke risk prediction method, characterized in that it is confirmed by being selected from the group consisting of based mini - sequencing assay.

Images