KR20110045975A - A recombinant vector introduced with gene which effectively degrade cellulose, a transformant comprising the vector and a method for producing ethanol using the same - Google Patents

Abstract

PURPOSE: A yeast transformant containing a chimera endoglucanase gene and small cellulose-binding protein gene is provided to develop feed and probiotics. CONSTITUTION: A recombinant vector, pADHcCelEmCbpA contains: a chimera gene in which dockerin module is linked to a Clostridium sp.-derived endoglucanase active site gene; and mCbpA gene which is a part of cellulose-binding protein-A derived from Clostridium sp. The endoglucanase active site contains an amino acid sequence of sequence number 1.

Description

A recombinant vector introduced with gene which effectively degrade cellulose, a transformant comprising the transformant containing a gene capable of effectively breaking down fibrin, a transformant including the recombinant vector, and a transformant comprising the transformant vector and a method for producing ethanol using the same}

The present invention relates to a yeast transformant capable of effectively decomposing fibrin provided as a substrate in yeast, which is a production strain, in bioethanol. More specifically, endo-beta-1,4- separated from Clostridium thermocells. Endo-β-1,4-glucanaseE (1,4-β-D-glucan glucanohydrolase, carboxymethylcellulase, CMCase; EC 3.2.1.4) and the endo-derived from Clostridium cellulose Chimeric genes linked to dockerine modules of beta-1,4-glucanase-ratio (endo-β-1,4-glucanaseB, 1,4-β-D-glucan glucanohydrolase, carboxymethylcellulase, CMCase; EC 3.2.1.4) And a recombinant vector into which a small cellulose-binding protein-A gene derived from Clostridium cellulose boron is inserted and the yeast transformant and the cellulose-binding module (CBM) and cellulose introduced therein. Protein used It relates to the purification process.

Recently, as concerns over soaring oil prices and depletion of energy have increased, interest in alternative energy production is growing. Bioethanol is the most active material for transportation fuel among alternative energy. This is still in the early stage of development until the development stage of the electric or hydrogen vehicle, which is the final technical goal of the automobile, and therefore, an alternative energy of alternative type is needed to replace it. Currently, bioethanol can be used in combination with gasoline, so it is a representative renewable energy along with biodiesel. Carbon dioxide generated during bioethanol combustion has an exception in the greenhouse gas calculation prescribed in the Kyoto Protocol, which has a greenhouse gas reduction effect. In addition, unlike other clean fuels that require the establishment of a separate infrastructure (gas station, etc.), it can be distributed in the existing infrastructure, which facilitates early commercialization.

Currently, bioethanol can be produced mainly from sugar-based biomass represented by sugar cane and corn, cellulose biomass such as wood, and lignocellulosic biomass such as waste wood resources, surplus agricultural products and herbaceous crops. Starch sugar cane and corn are currently the representative bioethanol production materials. In Brazil, based on rich sugar cane cultivation, they successfully commercialized ethanol, and in 2004, accounted for about 30% of total vehicle fuel consumption. Succeeded in replacing with bio ethanol. In the US, we will accumulate significant commercialization technology for bioethanol production using abundant corn, and will replace 20% of the total transportation energy demand with bioethanol by 2017.

In the case of sugar-based biomass, especially corn, which has been used in the past, it has been negatively evaluated in terms of raw material supply and price competitiveness due to the effects of aglation caused by soaring grain prices in early 2008. Woody or lignocellulosic biomass is one. Unlike the existing sugar system, there are no limitations on supply or ethical issues, and various studies have been attempted to produce bioethanol using these materials. However, the major components of these raw materials are mostly composed of cellulose, which requires sufficient saccharification in order to be used for direct ethanol fermentation. However, even after the saccharification process, most of them remain in the form of undecomposed oligomer or polymer.

Yeast Saccharomyces cerevisiae , a representative ethanol producing strain, is used in various bioprocessing fields utilizing starch or fiber, which is a vegetable raw material. However, yeast has a disadvantage in that it can not break down the fibrous substrate at all by producing and secreting a small amount of starch degrading enzyme. Therefore, new breeding of fibrinolytic yeast using genetic recombination technology can be applied to brewing, baking, alcohol production, probiotic development, and especially to producing bioethanol, renewable energy. have. Yeast is also used as an excellent strain for extracellular secretion of heterologous proteins. Currently, the research for producing a recombinant yeast secreting fibrinolytic enzymes is active or inadequate. For this purpose, it is necessary to secure a fibrinolytic gene having high thermal stability or excellent activity.

Meanwhile, Clostridium thermoseleum thermocellum ) is an anaerobic, thermophilic, hydrolyzing cellulose and ethanol-producing bacterium. It is known to produce various cellulase and cellulosome enzyme complexes. Combined with the properties of bacteria that can grow at very high temperatures, microorganisms also have outstanding advantages as target materials for developing processes for producing hydrogen and ethanol industrially from cellulosic biomass resources. In addition, effective degradation of crystalline fibrin includes at least three fibrinases, endoglucanase, exoglucanase (or cellobiohydrolase) and beta-glucosidase And synergistic effects on crystalline cellulose degradation between cellulosomal cellulases from Clostridium cellulovorans.J. Bacteriol 184 (18), 5088-5095 .; B Schwarz, 2001.The cellulosome and cellulose degradation by anaerobic bacteria.Appl Microbiol Biotechnol 56 (5-6), 634-649 .; Shoham, Y., Lamed, R., Bayer, EA, 1999. The cellulosome concept as an efficient microbial strategy for the degradation of insoluble polysaccharides.Trends Microbiol 7 (7), 275-281).

On the other hand, Clostridium cellulose boron ( Clostridium cellulovorans ) is an anaerobic mesophilic bacterium, which is known to produce various cellulase and cellulosomes, enzyme complexes. The basic structure of the cellulosomal complex in these anaerobic bacteria is based on the primary scaffolding subunit, which contains one cellulose binding module (CBM), which is the enzyme of the cellulase or hemicellulase having a catalytic module. Enzyme Subunits are made up of pieces. To achieve this structure, nine Cohesin modules in the base scaffold subunit are strongly bound to protein-protein interactions to the Dockerin module in each enzyme subunit.

The present invention solves the above problems, and the object of the present invention is to provide a recombinant vector capable of effectively decomposing the fibrin provided as a substrate in yeast production strain in the production of bioethanol .

Another object of the present invention to provide a transformant comprising the recombinant vector.

Another object of the present invention is to produce ethanol using the transformant.

In order to achieve the above object, the present invention is a genotype of Clostridium sp . And the chimeric gene and Clostridium genus connecting the dockerin module of Clostridium sp . Recombinant vector pADHcCelEmCbpA with an mCbpA gene which is part of cellulose-binding protein-A derived from Clostridium sp .

In one embodiment of the invention, the Clostridium genus ( Clostridium sp . Endoglucanase active site derived from) is preferably the amino acid sequence of SEQ ID NO: 1, the endo of the present invention through mutations such as one or more substitutions, deletions, inversions, additions to the peptides of SEQ ID NO: 1 as well as these peptides All variant peptides with glucanase activity are included.

In one embodiment of the present invention, the endoglucanase active site gene preferably has the nucleotide sequence set forth in SEQ ID NO: 2, but 80% of the nucleotide sequence set forth in SEQ ID NO: 2 in consideration of the degeneracy of the genetic code Genes having homology, preferably 85% homology, more preferably 90% homology, and most preferably 95% homology, are also included in the endoglucanase active site gene of the present invention.

Genus Clostridium in the present invention (Clostridium sp . The endoglucanase active site derived from c) refers to a substantial site of action of an endoclucanase enzyme that has the ability to break down and degrade beta-1,4-binding of crystalline cellulose (Crystalline cellulose).

In one embodiment of the present invention, the dockerine module of the genus Clostridial is preferably an amino acid sequence of SEQ ID NO: 3, one or more substitutions, deletions, inversions, in addition to the peptides of SEQ ID NO: 3, It includes all variant peptides having dockerin module activity of the present invention through mutations such as addition and the like.

In one embodiment of the present invention, the dockerine module gene preferably has a nucleotide sequence set forth in SEQ ID NO: 4, in consideration of the degeneracy of the genetic code of the base sequence set forth in SEQ ID NO: 4 80% of the image Genes having homology, preferably 85% homology, more preferably 90% homology, and most preferably 95% homology, are also included in the dockerine module gene of the present invention.

In the present invention, a dockerine module of a strain of the genus Clostridial is a module of a cellulase (Cellulosomal cellulase) protein that forms a cellulosome by interacting with a cohesion module that is a part of the cellulosic-binding protein of the genus Clostridium. it means.

In one embodiment of the present invention, mCbpA which is a part of the cellulose-binding protein-A preferably has an amino acid sequence as set forth in SEQ ID NO: 5, but not only peptides of SEQ ID NO: 5 but also one or more substitutions, deletions, All mutation peptides having the activity of the cellulose-binding protein-A of the present invention through mutations such as inversion, addition and the like are included.

In one embodiment of the present invention, the mCbpA gene, which is a part of the cellulose-binding protein-A, preferably has the nucleotide sequence set forth in SEQ ID NO: 6, but is described in SEQ ID NO: 6 in consideration of the degeneracy of the genetic code. Genes with 80% homology, preferably 85% homology, more preferably 90% homology, and most preferably 95% homology with the nucleotide sequence are also cellulose-binding protein-A of the present invention. It is included in the mCbpA gene that is part of.

In the present invention, mCbpA, which is a part of cellulose-binding protein-A, is one of the cellulose-binding protein-A (CbpA), which is one of the cellulose-binding proteins in Clostridium, and a cellulose binding module (CBM) and two By small cellulose-binding protein with Cohesin module.

In one preferred embodiment of the present invention, the recombinant vector of the present invention preferably has a cleavage map of Figure 2b, but is not limited thereto.

The present invention also provides a transformant transformed with the recombinant vector of the present invention.

In one embodiment of the present invention, the transformant is a transformant yeast Saccharomyces cerevisiae YPH499 / deposited on October 7, 2009 with the accession number KCCM 11041P to the Korea Microorganism Conservation Center, Seodaemun-gu, Seoul, Korea Preferably, the transformant is pADHcCelEmCbpA, but is not limited thereto.

In another aspect, the present invention provides a method of obtaining the endoglucanase by culturing the transformant of the present invention.

The present invention also provides a method of obtaining the small cellulose binding protein by culturing the transformant of the present invention. In a preferred embodiment of the present invention, the method is preferably performed by adding cellulose, but is not limited thereto.

In another aspect, the present invention provides a composition for producing ethanol comprising the transformant of the present invention.

The composition for producing ethanol of the present invention includes, for example, a polypeptide, broth, cell lysate, purified or unpurified enzyme extract or polypeptide, etc. suitable for culturing the transformant to produce ethanol.

The present invention also provides a method for producing ethanol from cellulose comprising culturing the transformant of the present invention in a medium to which cellulose is added.

In the case of using the yeast as a host in the present invention, as the expression vector, for example, YEp13, YCp50, pRS-based, pYEX-based vectors and the like can be used. As a promoter, a GAL promoter, an AOD promoter, etc. can be used, for example. As a method of introducing recombinant DNA into yeast, for example, the electroporation method (Method Enzymol., 194, 182-187 (1990)), the spheroplast method (Proc. Natl. Acad. Sci. USA, 84, 1929-1933 (1978)), lithium acetate method (J. Bacteriol., 153, 163-168 (1983)), and the like.

In the recombinant vector, fragments for suppressing expression having various functions for suppressing or amplifying or inducing expression, markers for selection of transformants, resistance genes against antibiotics, or secreted out of the cells It is also possible to have a gene for encoding a signal for the purpose of.

The production of the endoglucanase or the small cellulose binding protein of the present invention may be achieved by, for example, culturing a transformant obtained by transforming a host with a recombinant vector having a gene encoding the same, and culturing a culture (culturing organism or In the culture supernatant), endoglucanase or small cellulose-binding protein, which is a gene product, is produced and accumulated and obtained from the culture.

As a method for culturing the transformant of the present invention, any conventional method used for culturing a host may be used.

As the culture method, any method used for culturing ordinary microorganisms, such as batch type, flow batch type, continuous culture, and reactor type, can be used. As a medium for culturing, medium or synthetic medium such as LB medium, NB medium and the like can be given. Incidentally, the culture temperature is cultured in the above-mentioned temperature range to accumulate and recover endoglucanase or small cellulose binding protein in cells.

The carbon source is required for the growth of microorganisms, and for example, sugars such as glucose, fructose, sucrose, maltose, galactose, and starch; Lower alcohols such as ethanol, propanol and butanol; Polyhydric alcohols such as glycerol; Organic acids such as acetic acid, citric acid, succinic acid, tartaric acid, lactic acid and gluconic acid; Fatty acids such as propionic acid, butanoic acid, pentanic acid, hexanoic acid, heptanoic acid, octanoic acid, nonanoic acid, decanoic acid, undecanoic acid and dodecanoic acid can be used.

Examples of the nitrogen source include ammonium salts such as ammonia, ammonium chloride, ammonium sulfate and ammonium phosphate, as well as those derived from natural products such as peptone, meat juice, yeast extract, malt extract, caseinate and corn steep liquor. Moreover, as an inorganic substance, 1 potassium phosphate, dipotassium phosphate, magnesium phosphate, magnesium sulfate, sodium chloride, etc. are mentioned, for example. You may add antibiotics, such as kanamycin, ampicillin, tetracycline, chloramphenicol, and streptomycin, to a culture liquid.

In addition, when the promoter cultures the microorganism transformed using an inducible expression vector, an inducer suitable for the type of promoter may be added to the medium. For example, isopropyl- (beta) -D-thiogalactopyranoside (IPTG), tetracycline, indole acrylic acid (IAA), etc. are mentioned as an inducer.

Endoglucanase or small cellulose binding protein is obtained by centrifuging the cells or supernatants from the cultures obtained, followed by cell disruption, extraction, affinity chromatography, cation or anion exchange chromatography, and gel filtration alone. Or by appropriately combining them.

Confirmation that the obtained purified substance is the target enzyme can be performed by a conventional method, for example, SDS-polyacrylamide gel electrophoresis, western blotting or the like.

In addition, the culture of transformants using microorganisms as a host, the production of endoglucanase or small cellulose binding-protein by the transformant and accumulation in the cells, and the endoglucanase or small cellulose binding-protein from the cells The recovery is not limited to the above method.

Hereinafter, the present invention will be described in detail.

Cellulose (cellulose) is a major component of the cell wall of higher plants and occupies most of the wood, and is broken down by cellulase, a fibrinolytic enzyme. Fibrinase, which is secreted by microorganisms parasitic in the stomach in the case of herbivore when ingesting fiber, includes endoglucanase, xylanase, exoglucanase, and beta-glucosidase. ). Among them, endoglucanase hydrolyzes β-D-glucan.

In the present invention, a chimera that connects a dockerine module of EngB, a cellulosome-forming subunit enzyme from a Clostridium strain, to an active site gene of CelE, a fibrinolytic enzyme, from a Clostridium strain known to maintain activity even at room temperature. It was confirmed that the recombinant yeast strain prepared by introducing the gene into yeast expresses and secretes high levels of chimeric CelE.

In one embodiment of the present invention, a dockerine module is obtained through a PCR reaction using the CelE active site gene and Clostridium cellulose boron EngB gene as a template obtained by PCR reaction with the genomic DNA of the Clostridium thermocell. extending's peulrayiseu overlapping genes (SOE: Splice overlap extension) to obtain a chimeric gene CelE connected by a technique, the yeast genes obtained after the sub-in E. coli shuttle vectors (yeast- E. coli shuttle vector) cloning a recombinant vector Produced. Then, the yeast host cell was transformed using the recombinant vector into which the chimeric CelE was inserted. Then, in order to investigate that the protein expressed from the gene is endoglucanase, endoglucanase activity was measured by culturing recombinant yeast transformants into which chimeric CelE was introduced. As a result, it was confirmed that the recombinant yeast transformant into which the chimeric CelE according to the present invention had a significantly higher endoglucanase activity than the wild type S. cerevisiae YPH499 strain. As a result, it was confirmed that the chimeric CelE gene, which was recombined and transformed according to the present invention, expresses endoglucanase.

Further, one embodiment of the invention the Clostridium cellulose Robo lance of genomic gained mCbpA gene obtained via a PCR reaction as a template DNA, the gene for yeast obtained after Escherichia coli shuttle vectors (yeast- E. coli shuttle vector) to produce a recombinant vector. Then, the yeast host cell was transformed using the recombinant vector into which the chimeric CelE was inserted. Then, in order to investigate that the protein expressed from the gene is a small cellulose-binding protein, mCbpA-introduced recombinant yeast transformants were cultured to measure the interaction with cellulose. As a result, the recombinant yeast transformant introduced mCbpA according to the present invention has a small cellulose-binding protein A having a cellulose binding module (CBM) that interacts with cellulose. Expression was confirmed. As a result, it was confirmed that the mCbpA gene recombinant and transformed according to the present invention expresses a small cellulose-binding protein.

In addition, as a result of investigating the production capacity of ethanol by degrading the crystalline fiber of the recombinant yeast transformant, the endoglucanase and cellulose-binding protein are actively secreted from the yeast, and the recombinant small cellulosome is formed to decompose the fiber It can be confirmed that the function is performed very efficiently. Therefore, this yeast transformant was deposited with the accession number KCCM 11041P as described above, and the yeast transformant effectively formed recombinant small cellulosomes, which effectively increased the ethanol production and the cellulose-binding module (CBM). The present invention was completed by confirming that the protein can be easily purified using the interaction between cellulose and cellulose.

In other words, the present inventors have a method for cloning an endoglucanase-its active site gene derived from Clostridium thermocell to express designer recombinant mini-cellulosomes in yeast in vivo. Chimeric protein genes linking the endoglucanase-secreted docker genes derived from Tridium cellulose boranth and cellulose-binding protein-A, the primary scaffolding subunit derived from Clostridium cellulose boranth Among the cellulose-binding protein A), a recombinant cellulose-binding module (CBM) and a small cellulose-binding protein A gene having two cohesin modules are inserted. A vector and a yeast transformant transformed with the vector were developed and deposited with the Korea Microorganism Conservation Center under accession number KCCM 11041P. It was suspended. In addition, the yeast transformants effectively secrete recombinant small cellulosomes to efficiently increase ethanol production, and easily utilize the interaction between the cellulose-binding module (CBM) and cellulose. The present invention has been completed by confirming that the protein can be purified.

As described above, in the present invention, a chimeric gene and a small cellulose-binding protein gene connecting the endoglucanase active site gene obtained from the Clostridium spp. Strain and the Dockerin module of the Clostridium spp. Strain were introduced into the yeast strain. Thereafter, the chimeric endoglucanase gene and the small cellulose-binding protein gene were expressed at high levels in the yeast strain and secreted to form a recombinant small cellulose. According to the present invention, a yeast transformant into which a chimeric endoglucanase gene and a small cellulose-binding protein gene derived from a strain of the genus Clostridium are introduced, and a recombinant small cellulosome expressed from the gene is used for brewing, baking and alcohol production. It is expected to be a very useful invention for co-saccharification and fermentation (SSF, simulated saccharification and fermentation or consolidated bioprocessing), which can be useful for feed production and probiotic development.

Hereinafter, the present invention will be described in detail by way of examples. However, the following examples are merely to illustrate the present invention, the content of the present invention is not limited by the following examples.

Example 1: Amplification of the promoter and signal peptide gene of yeast alcohol dehydrogenase, endoglucanase gene and small cellulose-binding protein gene

To clone the promoter and signal peptide genes for effectively secreting enzymes outside the yeast, the sequence of the promoter portion of the alcohol dehydrogenase and the α-factor signal peptide from the genome DNA of Saccharomyces cerevisiae (BY4741) Restriction enzyme BamH1 for 5 of forward primer, restriction enzyme EcoR1 recognition sequence for 5 of reverse primer, and overlapping sequence for 5 'of overlapping primer The primers (ADHα P1 GCGCGGATCCAAGAAATGATGGTAAATGAAATAGG (SEQ ID NO: 7); ADHα P2 GAAATCTCATGAAAAGAGCGCGGA (SEQ ID NO: 8); ADHα P3 CGCTCTTTTCATGAGATTTCCTTCAATT (SEQ ID NO: 9); ADHGA P4CAGT) Then, PCR was performed by using a Splice Overlap Extension (SOE) technique using the synthesized primer. As a result, PCR bands containing 962 bp overlapping extension genes linked to a 707 bp yeast alcohol dehydrogenase promoter and a 255 bp yeast signal peptide gene were identified and are shown in FIG. 1 (A).

In order to clone the chimeric CelE gene that connects the CelE active region gene of Clostridium-derived Thermocelum and the dockerine module of EngB gene from Clostridium, it is referred to as a base primer excluding the signal peptide. 5) of the restriction enzyme Spe1 recognition sequence and 5 'of the overlapping primer (cCelE P1 ATATGCGGCCGCATCGGGAACAAAGCTTTTG (SEQ ID NO: 11)). cCelE P2 TTTGTTAACATCACCGTACAAAATATTGCTGTC (SEQ ID NO: 12); cCelE P3 ATTTTGTACGGTGATGTTAACAAAGATGGAAAGG (SEQ ID NO: 13); cCelE P4 GCGCACTAGTGCTAAAAGCATTTTTTTAAGAACAG (SEQ ID NO: 14)). Thereafter, PCR was performed by using a Splice Overlap Extension (SOE) technique using the synthesized primer. As a result, a PCR band containing 1299 bp chimeric CelE linked to the CelE active region gene of Thermostemum derived from Clostridium of 1140 bp and the Dockerin module gene of 159 bp EngB gene was shown, which is shown in Figure 1 (B). It was.

Cellulose binding module (CBM) and two cohydration modules of Cellulose-binding protein A, the primary scaffolding subunit of Clostridium cellulose. In order to clone a small cellulose-binding protein A gene with a Cohesin module, 5 of the forward primers are referred to as nucleotide sequences, and the restriction enzyme Not1 and the reverse primer ) Was synthesized primers (mCbpA_f ATATGCGGCCGCGCAGCGACATCATCAAT (SEQ ID NO: 15); mCbpA_r GCGCACTAGTGCTATAGGATCTCCAATATTTATT (SEQ ID NO: 16)) each inserted with the restriction enzyme Spe1 recognition sequence. As a result, the PCR band containing the mCbpA gene, which is part of the cellulose-binding protein-A gene of cellulose boron derived from Clostridium of 1647 bp, was identified and shown in FIG. 1 (C).

In order to clone the Bgl1 gene of S. pylorigera derived from Saccharomycocci, the base sequence excluding the signal peptide moiety is referred to, and the restriction enzyme Not1 is expressed in 5 of the forward primer, and the restriction enzyme is expressed in the reverse primer. Primers (Bgl1_f GGCGAATTCAAGTCCCAATTCAAAACTATAC (SEQ ID NO: 17); Bgl1_r ATATGCGGCCGCAATAGTAAACAGGACAGATGT (SEQ ID NO: 18)) having respective Spe1 recognition sequences were synthesized. As a result, the PCR band containing the Bgl1 gene of fibuligera derived from Saccharomycocci of 2577 bp was identified, which is shown in FIG. 1 (D).

Example 2 Cloning of the Overlapping Gene of the Yeast Alcohol Dehydrogenase Promoter and the Signal Peptide and the Chimeric CelE Gene and the Small Cellulose-Binding Protein Gene mCbpA Gene and Bgl1 Gene

The overlapping genes of the alcohol dehydrogenase promoter and the signal peptide and the chimeric CelE, mCbpA and Bgl1 gene amplification products obtained in Example 1 were electrophoresed on 0.8% agarose gel, and the DNA fragments on the agarose gel were biospin gel extraction kit ( Recovery using Bioflux).

Subsequently, in the case of overlapping genes of the yeast alcohol dehydrogenase promoter and the signal peptide, BamHI, EcoRI, chimeric CelE and mini-CbpA and Bgl1 were cleaved with NotI and SpeI, and then the yeast-E. Coli shuttle vector (yeast- E.coli). It was ligated to pESC-trp (Clontech), a shuttle vector), and transformed into Escherichia coli (E. coli) DH5α (Real biotech corporation). The ligation of recombinant plasmid DNA was then isolated from the transformants. The recombinant vectors were named pADH-a-cCelE, pADH-α-mCbpA and pADH-a-Bgl1, respectively. Subsequently, pADH-α-cCelE was used as a template to amplify the alcohol dehydrogenase promoter, the enzyme signal peptide, the endoglucanase, and the alcohol dehydrogenase terminator, and ligated to the Xho1 and Sal1 sites of pADH-a-mCbpA. Escherichia coli DH5α was transformed. The ligated recombinant plasmid DNA was then isolated from the transformants. The recombinant vector was named pADHcCelEmCbpA and is shown in FIG. 2. Then, the recombinant vectors were used to transform yeast host cells according to the experimental method provided by Clontech's yeast maker yeast transformation kit (YEASTMAKER yeast transformation kit2).

Saccharomyces cerevisiae YPH499 ( S. cerevisiae YPH499, ura3-52lys2-801amberade2-101ochretrp1-Δ63 his3-Δ200 leu2-Δ1) was used as the yeast host cell. Subsequently, the transformants were selected using tryptophan deficient SD medium (0.67% yeast nitrogen base, 2% glucose, 0.067% yeast nigrogen base w / o trp, 2% agar), and the vector pADHcCelEmCbpA transformant was selected as saccharoma. The transformant of vector pADH-a-bgl1 with Isis cerevisiae YPH499 / pADHcCelEmCbpA was designated Saccharomyces cerevisiae YPH499 / pADH-a-bgl1.

Example  3: yeast transformants Endoglucanase  Active measurement

In order to confirm the enzyme protein expression of the transformant obtained in Example 2, enzyme halo was measured on the medium.

By inducing the expression of YPH499 / pADHcCelEmCbpA to secrete the chimeric CelE enzyme protein into the culture solution, the culture supernatant was prepared by condensation at 30 ° C. for 48 hours and centrifuged (Millipore, amicon 10kDa cut off). Obtained protein.

To confirm the enzyme activity (halo), 0.3% CMC (carboxy methyl cellulose) was dissolved in YPD agar medium and used as a substrate for the enzyme reaction. Colonies of transformed yeast were inoculated on YPD agar medium (yeast extract, peptone, glucose) and incubated at 30 ° C. for 48 hours, and 5 μl of the culture medium incubated at 30 ° C. for 48 hours in YPD liquid medium was used as substrate (CMC, Carboxymethylcellulose, SIGMA) was added to the agar containing the medium and the reaction was carried out at 50 ℃ for 24 hours. After staining with 0.25% Congo-Red for 20 minutes and rinsing with 1 mole sodium chloride several times, the enzyme activity band was confirmed and the results are shown in FIGS. 3a and 3b, respectively.

Example  4: small size of yeast transformants Cellulose Binding Protein Expression

In order to confirm the expression of the small cellulose-binding protein of the transformant obtained in Example 2, the protein purification using the interaction between the cellulose-binding module (CBM) and cellulose of the small cellulose-binding protein Was run.

By inducing the expression of the YPH499 / pADHcCelEmCbpA to secrete the chimeric CelE enzyme protein into the culture medium, the supernatant was prepared and concentrated by shaking culture at 30 ° C. for 48 hours and centrifuged (Millipore, amicon 10kDa cut off) to mCbpA small cellulose. -Binding protein was obtained.

Cellulose (Sigmacell Type 50, SIGMA) was added and reacted at room temperature for 1 hour for protein purification using the interaction between cellulose-binding module (CBM) and cellulose. After the reaction, the mixture was rinsed three times with 1 mol sodium chloride 0.02 mol Tris buffer (pH 8.0) and eluted with 0.05 mol Tris buffer (pH 12.5). SDS-PAGE electrophoresed the enzyme protein using 10% poly-acrylamide gel. As a result, the protein band was confirmed at the 58 kDa position. This result is shown in FIG.

Example  5: Production of Bioethanol Using Yeast Transformants

YPH499 / pADHcCelEmCbpA and YPH499 / pADH-a-YPH499 / pADHcCelEmCbpA and YPH499 / pADH-a, respectively. In the fermentation medium containing 10g / l CMC (carboxymethylcellulose) as a substrate with YPH499 / pADH-a-bgl1, the absorbance is measured to be 20 when measured at 600 nm wavelength. The fermentation broth was incubated at 30 ° C. and 100 rpm, and the ethanol produced was measured by performing gas chromatography by taking a culture solution at a predetermined time. According to the above method, the ethanol production yield in YPH499 / pADHcCelEmCbpA into which the small cellulose-binding protein gene was inserted was determined to be higher than that of YPH499 / pADHcCelE, and the results are shown in FIG. 5.

1 is a diagram showing a PCR product by performing agarose gel electrophoresis in the present invention, Figure 1 (A) is a nested gene of the promoter and signal peptide of yeast alcohol dehydrogenase (A) Lane 1, 1kb DNA markers; Lane 2, ADH promoter PCR product, Lane 3, alpha factor PCR product; Lane 4, promoter alpha factor Overlap PCR product; 1 (B) is a chimeric endo-beta-1,4-glucanase-di gene and in (B) a Lane 1, 1 kb DNA marker; Lane 2, CelE Catalytic Domain PCR product; Lane 3, EngB Dokerin Module PCR product; Lane 4, Chimeric CelE Overlap PCR product, FIG. 1 (C) is a small cellulose-binding protein gene, and (C) lane 1, 1 kb DNA marker; Lane 2, mCbpA PCR product, Figure 1 (D) is a picture confirming the PCR product of the beta-glucosidase gene in (D) Lane 1, 1kb DNA marker; Lane 2, Bgl1 PCR product.

2A and 2B are schematic diagrams of the recombinant vector pADHcCelEmCbpA in which the chimeric endo-beta-1,4-glucanase-this gene and the small cellulose-binding protein gene presented in the present invention are inserted.

Figure 3 shows the enzymatic secretion of the recombinant vector pADHcCelEmCbpA-inserted yeast transformant in the present invention showing the enzymatic activity in the culture medium, (A) is plate culture recombinant S. cerevisiae YPH499 Strains, [1] YPH499 / pADH-a-cCelE [2] YPH499 / pADHa control, [3] YPH499 / pADHcCelEmCbpA [4] YPH499 / pADH-a-mCbpA, [5] YPH499 / pADHa Control [6] YPH499 / pADH-a-Bgl1, (B) is the supernatant of the recombinant Supernatant of Recombinant S. cerevisiae YPH499 strain by plate culture, and [1] YPH499 / pADHa control [2] YPH499 / pADHcCelEmCbpA.

4 is a small cellulose-binding protein expression expressed in the present invention confirmed by the purification method using the interaction between the cellulose-binding module (Cellulse binding module (CBM) and cellulose, Lane1. Protein markers (Fermentas); Lane2. Wash1; Lane3. Wash2; Lane4. Wash3; Lane5; SDS-PAGE staining of Elution of mCbpA eluate with Coomassie Blue is shown.

5 is a graph confirming the formation of a conjugated small cellulosome from the production of bioethanol using a yeast transformant, a graph showing the time course of ethanol fermentation from 10g / l CMC as a single carbon source by the recombinant yeast strain. closed diamond, YPH499 / pADHa control; closed square, YPH499 / pADH-a-CelE and YPH499 / pADH-a-Bgl1; And closed triangle, YPH499 / pADHcCelEmCbpA and YPH499 / pADH-a-Bgl1.

<110> KOREAN UNIVERSITY RESEARCH AND BUSINESS FOUNDATION <120> A recombinant vector introduced with gene which effectively          degrade cellulose, a transformant comprising the vector and a          method for producing ethanol using the same <160> 18 <170> KopatentIn 1.71 <210> 1 <211> 426 <212> PRT <213> Artificial Sequence <220> <223> Active region <400> 1 Ser Gly Thr Lys Leu Leu Asp Ala Ser Gly Asn Glu Leu Val Met Arg   1 5 10 15 Gly Met Arg Asp Ile Ser Ala Ile Asp Leu Val Lys Glu Ile Lys Ile              20 25 30 Gly Trp Asn Leu Gly Asn Thr Leu Asp Ala Pro Thr Glu Thr Ala Trp          35 40 45 Gly Asn Pro Arg Thr Thr Lys Ala Met Ile Glu Lys Val Arg Glu Met      50 55 60 Gly Phe Asn Ala Val Arg Val Pro Val Thr Trp Asp Thr His Ile Gly  65 70 75 80 Pro Ala Pro Asp Tyr Lys Ile Asp Glu Ala Trp Leu Asn Arg Val Glu                  85 90 95 Glu Val Val Asn Tyr Val Leu Asp Cys Gly Met Tyr Ala Ile Ile Asn             100 105 110 Leu His His Asp Asn Thr Trp Ile Ile Pro Thr Tyr Ala Asn Glu Gln         115 120 125 Arg Ser Lys Glu Lys Leu Val Lys Val Trp Glu Gln Ile Ala Thr Arg     130 135 140 Phe Lys Asp Tyr Asp Asp His Leu Leu Phe Glu Thr Met Asn Glu Pro 145 150 155 160 Arg Glu Val Gly Ser Pro Met Glu Trp Met Gly Gly Thr Tyr Glu Asn                 165 170 175 Arg Asp Val Ile Asn Arg Phe Asn Leu Ala Val Val Asn Thr Ile Arg             180 185 190 Ala Ser Gly Gly Asn Asn Asp Lys Arg Phe Ile Leu Val Pro Thr Asn         195 200 205 Ala Ala Thr Gly Leu Asp Val Ala Leu Asn Asp Leu Val Ile Pro Asn     210 215 220 Asn Asp Ser Arg Val Ile Val Ser Ile His Ala Tyr Ser Pro Tyr Phe 225 230 235 240 Phe Ala Met Asp Val Asn Gly Thr Ser Tyr Trp Gly Ser Asp Tyr Asp                 245 250 255 Lys Ala Ser Leu Thr Ser Glu Leu Asp Ala Ile Tyr Asn Arg Phe Val             260 265 270 Lys Asn Gly Arg Ala Val Ile Ile Gly Glu Phe Gly Thr Ile Asp Lys         275 280 285 Asn Asn Leu Ser Ser Arg Val Ala His Ala Glu His Tyr Ala Arg Glu     290 295 300 Ala Val Ser Arg Gly Ile Ala Val Phe Trp Trp Asp Asn Gly Tyr Tyr 305 310 315 320 Asn Pro Gly Asp Ala Glu Thr Tyr Ala Leu Leu Asn Arg Lys Thr Leu                 325 330 335 Ser Trp Tyr Tyr Pro Glu Ile Val Gln Ala Leu Met Arg Gly Ala Gly             340 345 350 Val Glu Pro Leu Val Ser Pro Thr Pro Thr Pro Thr Leu Met Pro Thr         355 360 365 Pro Ser Pro Thr Val Thr Ala Asn Ile Leu Tyr Gly Ser Gly Thr Lys     370 375 380 Leu Leu Asp Ala Ser Gly Asn Glu Leu Val Met Arg Gly Met Arg Asp 385 390 395 400 Ile Ser Ala Ile Asp Leu Val Lys Glu Ile Lys Ile Gly Trp Asn Leu                 405 410 415 Gly Asn Thr Leu Asp Ala Pro Thr Glu Thr             420 425 <210> 2 <211> 1140 <212> DNA <213> Artificial Sequence <220> <223> active region <400> 2 tcgggaacaa agcttttgga tgcaagcgga aacgagcttg taatgagggg catgcgtgat 60 atttcagcaa tagatttggt taaagaaata aaaatcggat ggaatttggg aaatactttg 120 gatgctccta cagagactgc ctggggaaat ccaaggacaa ccaaggcaat gatagaaaag 180 gtaagggaaa tgggctttaa tgccgtcaga gtgcctgtta cctgggatac gcacatcgga 240 cctgctccgg actataaaat tgacgaagca tggctgaaca gagttgagga agtggtaaac 300 tatgttcttg actgcggtat gtacgcgatc ataaatcttc accatgacaa tacatggatt 360 atacctacat atgccaatga gcaaaggagt aaagaaaaac ttgtaaaagt ttgggaacaa 420 atagcaaccc gttttaaaga ttatgacgac catttgttgt ttgagacaat gaacgaaccg 480 agagaagtag gttcacctat ggaatggatg ggcggaacgt atgaaaaccg agatgtgata 540 aacagattta atttggcggt tgttaatacc atcagagcaa gcggcggaaa taacgataaa 600 agattcatac tggttccgac caatgcggca accggcctgg atgttgcatt aaacgacctt 660 gtcattccga acaatgacag cagagtcata gtatccatac atgcttattc accgtatttc 720 tttgctatgg atgtcaacgg aacttcatat tggggaagtg actatgacaa ggcttctctt 780 acaagtgaac ttgatgctat ttacaacaga tttgtgaaaa acggaagggc tgtaattatc 840 ggagaattcg gaaccattga caagaacaac ctgtcttcaa gggtggctca tgccgagcac 900 tatgcaagag aagcagtttc aagaggaatt gctgttttct ggtgggataa cggctattac 960 aatccgggtg atgcagagac ttatgcattg ctgaacagaa aaactctctc atggtattat 1020 cctgaaattg tccaggctct tatgagaggt gccggcgttg aacctttagt ttcaccgact 1080 cctacaccta cattaatgcc gaccccctcg cccacggtga cagcaaatat tttgtacggt 1140                                                                         1140 <210> 3 <211> 53 <212> PRT <213> Artificial Sequence <220> <223> module <400> 3 Asp Val Asn Lys Asp Gly Lys Val Asn Ala Ile Asp Tyr Ala Val Leu   1 5 10 15 Lys Ser Ile Leu Leu Gly Thr Asn Thr Asn Val Asp Leu Ser Val Ser              20 25 30 Asp Met Asn Lys Asp Gly Lys Val Asn Ala Leu Asp Leu Ala Val Leu          35 40 45 Lys Lys Met Leu Leu      50 <210> 4 <211> 159 <212> DNA <213> Artificial Sequence <220> <223> module <400> 4 gatgttaaca aagatggaaa ggtaaatgct atcgattatg cagtgcttaa atcaattctt 60 ttaggtacaa atactaacgt tgatttatca gtatcagaca tgaataagga tggtaaagta 120 aatgctttgg atttagctgt tcttaaaaaa atgctttta 159 <210> 5 <211> 549 <212> PRT <213> Artificial Sequence <220> <223> mCbpA <400> 5 Ala Ala Thr Ser Ser Met Ser Val Glu Phe Tyr Asn Ser Asn Lys Ser   1 5 10 15 Ala Gln Thr Asn Ser Ile Thr Pro Ile Ile Lys Ile Thr Asn Thr Ser              20 25 30 Asp Ser Asp Leu Asn Leu Asn Asp Val Lys Val Arg Tyr Tyr Tyr Thr          35 40 45 Ser Asp Gly Thr Gln Gly Gln Thr Phe Trp Cys Asp His Ala Gly Ala      50 55 60 Leu Leu Gly Asn Ser Tyr Val Asp Asn Thr Ser Lys Val Thr Ala Asn  65 70 75 80 Phe Val Lys Glu Thr Ala Ser Pro Thr Ser Thr Tyr Asp Thr Tyr Val                  85 90 95 Glu Phe Gly Phe Ala Ser Gly Arg Ala Thr Leu Lys Lys Gly Gln Phe             100 105 110 Ile Thr Ile Gln Gly Arg Ile Thr Lys Ser Asp Trp Ser Asn Tyr Thr         115 120 125 Gln Thr Asn Asp Tyr Ser Phe Asp Ala Ser Ser Ser Thr Pro Val Val     130 135 140 Asn Pro Lys Val Thr Gly Tyr Ile Gly Gly Ala Lys Val Leu Gly Thr 145 150 155 160 Ala Pro Gly Pro Asp Val Pro Ser Ser Ile Ile Asn Pro Thr Ser Ala                 165 170 175 Thr Phe Asp Lys Asn Val Thr Lys Gln Ala Asp Val Lys Thr Thr Met             180 185 190 Thr Leu Asn Gly Asn Thr Phe Lys Thr Ile Thr Asp Ala Asn Gly Thr         195 200 205 Ala Leu Asn Ala Ser Thr Asp Tyr Ser Val Ser Gly Asn Asp Val Thr     210 215 220 Ile Ser Lys Ala Tyr Leu Ala Lys Gln Ser Val Gly Thr Thr Thr Leu 225 230 235 240 Asn Phe Asn Phe Ser Ala Gly Asn Pro Gln Lys Leu Val Ile Thr Val                 245 250 255 Val Asp Thr Pro Val Glu Ala Val Thr Ala Thr Ile Gly Lys Val Gln             260 265 270 Val Asn Ala Gly Glu Thr Val Ala Val Pro Val Asn Leu Thr Lys Val         275 280 285 Pro Ala Ala Gly Leu Ala Thr Ile Glu Leu Pro Leu Thr Phe Asp Ser     290 295 300 Ala Ser Leu Glu Val Val Ser Ile Thr Ala Gly Asp Ile Val Leu Asn 305 310 315 320 Pro Ser Val Asn Phe Ser Ser Thr Val Ser Gly Ser Thr Ile Lys Leu                 325 330 335 Leu Phe Leu Asp Asp Thr Leu Gly Ser Gln Leu Ile Thr Lys Asp Gly             340 345 350 Val Phe Ala Thr Ile Thr Phe Lys Ala Lys Ala Ile Thr Gly Thr Thr         355 360 365 Ala Lys Val Thr Ser Val Lys Leu Ala Gly Thr Pro Val Val Gly Asp     370 375 380 Ala Gln Leu Gln Glu Lys Pro Cys Ala Val Asn Pro Gly Thr Val Thr 385 390 395 400 Ile Asn Pro Ile Asp Asn Arg Met Gln Ile Ser Val Gly Thr Ala Thr                 405 410 415 Val Lys Ala Gly Glu Ile Ala Ala Val Pro Val Thr Leu Thr Ser Val             420 425 430 Pro Ser Thr Gly Ile Ala Thr Ala Glu Ala Gln Val Ser Phe Asp Ala         435 440 445 Thr Leu Leu Glu Val Ala Ser Val Thr Ala Gly Asp Ile Val Leu Asn     450 455 460 Pro Thr Val Asn Phe Ser Tyr Thr Val Asn Gly Asn Val Ile Lys Leu 465 470 475 480 Leu Phe Leu Asp Asp Thr Leu Gly Ser Gln Leu Ile Ser Lys Asp Gly                 485 490 495 Val Phe Val Thr Ile Asn Phe Lys Ala Lys Ala Val Thr Ser Thr Val             500 505 510 Thr Thr Pro Val Thr Val Ser Gly Thr Pro Val Phe Ala Asp Gly Thr         515 520 525 Leu Ala Glu Val Gln Ser Lys Thr Ala Ala Gly Ser Val Thr Ile Asn     530 535 540 Ile Gly Asp Pro Ile 545 <210> 6 <211> 1647 <212> DNA <213> Artificial Sequence <220> <223> mCbpA <400> 6 gcagcgacat catcaatgtc agttgaattt tacaactcta acaaatcagc acaaacaaac 60 tcaattacac caataatcaa aattactaac acatctgaca gtgatttaaa tttaaatgac 120 gtaaaagtta gatattatta cacaagtgat ggtacacaag gacaaacttt ctggtgtgac 180 catgctggtg cattattagg aaatagctat gttgataaca ctagcaaagt gacagcaaac 240 ttcgttaaag aaacagcaag cccaacatca acctatgata catatgttga atttggattt 300 gcaagcggac gagctactct taaaaaagga caatttataa ctattcaagg aagaataaca 360 aaatcagact ggtcaaacta cactcaaaca aatgactatt catttgatgc aagtagttca 420 acaccagttg taaatccaaa agttacagga tatataggtg gagctaaagt acttggtaca 480 gcaccaggtc cagatgtacc atcttcaata attaatccta cttctgcaac atttgataaa 540 aatgtaacta aacaagcaga tgttaaaact actatgactt taaatggtaa cacatttaaa 600 acaattacag atgcaaacgg tacagctcta aatgcaagca ctgattatag tgtttctgga 660 aatgatgtaa caataagcaa agcttattta gcaaaacaat cagtaggaac aactacatta 720 aactttaact ttagtgcagg aaatcctcaa aaattagtaa ttacagtagt tgacacacca 780 gttgaagctg taacagctac aattggaaaa gtacaagtaa atgctggaga aacggtagca 840 gtaccagtta acttaacaaa agttccagca gctggtttag caacaattga attaccatta 900 acttttgatt ctgcatcatt agaagtagta tcaataactg ctggagatat cgtattaaat 960 ccatcagtaa acttctcttc tacagtaagt ggaagcacaa taaaattatt attcttagat 1020 gatacattag gaagccaatt aatcactaag gatggagttt ttgcaacaat aacatttaaa 1080 gcaaaagcta taactggaac aactgcaaaa gtaacttcag ttaaattagc tggaacacca 1140 gtagttggtg atgcgcaatt acaagaaaaa ccttgtgcag ttaacccagg aacagtaact 1200 atcaatccaa tcgataatag aatgcaaatt tcagttggaa cagcaacagt aaaagctgga 1260 gaaatagcag cagtgccagt aacattaaca agtgttccat caactggaat agcaactgct 1320 gaagcacaag taagttttga tgcaacatta ttagaagtag catcagtaac tgctggagat 1380 atcgtattaa atccaacagt aaacttctct tatacagtaa acggaaatgt aataaaatta 1440 ttattcctag atgatacatt aggaagccaa ttaattagta aagatggagt ttttgtaaca 1500 ataaacttca aagcaaaagc tgtaacaagc acagtaacaa caccagttac agtatcagga 1560 acacctgtat ttgcagatgg tacattagca gaagtacaat ctaaaacagc agcaggtagc 1620 gttacaataa atattggaga tcctata 1647 <210> 7 <211> 35 <212> DNA <213> Artificial Sequence <220> <223> P1 <400> 7 gcgcggatcc aagaaatgat ggtaaatgaa atagg 35 <210> 8 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> P2 <400> 8 gaaatctcat gaaaagagcg cgga 24 <210> 9 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> P3 <400> 9 cgctcttttc atgagatttc cttcaatt 28 <210> 10 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> P4 <400> 10 gcgcgaattc gtcttttatc caaagatacc 30 <210> 11 <211> 31 <212> DNA <213> Artificial Sequence <220> <223> cCelE P1 <400> 11 atatgcggcc gcatcgggaa caaagctttt g 31 <210> 12 <211> 33 <212> DNA <213> Artificial Sequence <220> <223> cCelE P2 <400> 12 tttgttaaca tcaccgtaca aaatattgct gtc 33 <210> 13 <211> 34 <212> DNA <213> Artificial Sequence <220> <223> cCelE P3 <400> 13 attttgtacg gtgatgttaa caaagatgga aagg 34 <210> 14 <211> 35 <212> DNA <213> Artificial Sequence <220> <223> cCelE P4 <400> 14 gcgcactagt gctaaaagca tttttttaag aacag 35 <210> 15 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> mCbpA_f <400> 15 atatgcggcc gcgcagcgac atcatcaat 29 <210> 16 <211> 34 <212> DNA <213> Artificial Sequence <220> <223> mCbpA_r <400> 16 gcgcactagt gctataggat ctccaatatt tatt 34 <210> 17 <211> 31 <212> DNA <213> Artificial Sequence <220> <223> Bgl1_f <400> 17 ggcgaattca agtcccaatt caaaactata c 31 <210> 18 <211> 33 <212> DNA <213> Artificial Sequence <220> <223> Bgl1_r <400> 18 atatgcggcc gcaatagtaa acaggacaga tgt 33  

Claims (15)

Clostridium sp . ) A glucan endo kinase active site gene Clostridium genus of the strain is also a chimeric gene and the Clostridium connect the module to the keorin (derived from Clostridium sp . Recombinant vector pADHcCelEmCbpA inserted with mCbpA gene which is part of a cellulose-binding protein-A derived from C. The method of claim 1 wherein the Clostridium genus (Clostridium sp . Endoglucanase active site derived from the recombinant vector pADHcCelEmCbpA containing the amino acid sequence set forth in SEQ ID NO: 1. The recombinant vector pADHcCelEmCbpA according to claim 1, wherein the endoglucanase active site gene derived from Clostridium sp. Contains the nucleotide sequence of SEQ ID NO: 2. The recombinant vector pADHcCelEmCbpA of claim 1, wherein the dockerine module of the genus Clostridium comprises the amino acid sequence set forth in SEQ ID NO: 3. The recombinant vector pADHcCelEmCbpA according to claim 1, wherein the dockerine module gene of the genus Clostridium contains the nucleotide sequence set forth in SEQ ID NO: 4. The recombinant vector pADHcCelEmCbpA of claim 1, wherein mCbpA, which is a part of the cellulose-binding protein-A derived from Clostridium sp. , Has the amino acid sequence set forth in SEQ ID NO: 5. The method of claim 1 wherein the Clostridium genus (Clostridium sp . MCbpA gene, which is part of the cellulose-binding protein-A derived from the recombinant vector pADHcCelEmCbpA. The recombinant vector pADHcCelEmCbpA of claim 1, wherein the recombinant vector has a cleavage map of FIG. 2B. A transformant transformed with the recombinant vector of any one of claims 1 to 8. 10. The transformant according to claim 9, wherein said transformant is transformant yeast Saccharomyces cerevisiae YPH499 / pADHcCelEmCbpA having an accession number of KCCM 11041P. A method for obtaining an endoglucanase by culturing the transformant of claim 9 or 10. A method of obtaining the small cellulose binding protein by culturing the transformant of claim 9. 13. The method of claim 12, wherein the method is performed by adding cellulose. A composition for producing ethanol comprising the transformant of claim 9 or 10. A method for producing ethanol from cellulose comprising culturing the transformant of claim 9 or 10 in a medium to which cellulose is added.

Images