KR20100034206A - ｓｐｒ1709 유전자가 손상된 변이주를 이용한 폐렴구균을 치료하기 위한 약독화 백신 및 이의 진단방법 - Google Patents

ｓｐｒ1709 유전자가 손상된 변이주를 이용한 폐렴구균을 치료하기 위한 약독화 백신 및 이의 진단방법 Download PDF

Info

Publication number
KR20100034206A
KR20100034206A KR1020080093229A KR20080093229A KR20100034206A KR 20100034206 A KR20100034206 A KR 20100034206A KR 1020080093229 A KR1020080093229 A KR 1020080093229A KR 20080093229 A KR20080093229 A KR 20080093229A KR 20100034206 A KR20100034206 A KR 20100034206A
Authority
KR
South Korea
Prior art keywords
pneumococcal
gene
mutant
spr1709
infection
Prior art date
Application number
KR1020080093229A
Other languages
English (en)
Inventor
이동권
권민경
김은혜
Original Assignee
성균관대학교산학협력단
대한민국(관리부서 질병관리본부장)
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 성균관대학교산학협력단, 대한민국(관리부서 질병관리본부장) filed Critical 성균관대학교산학협력단
Priority to KR1020080093229A priority Critical patent/KR20100034206A/ko
Publication of KR20100034206A publication Critical patent/KR20100034206A/ko

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
    • C12Q1/689—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for bacteria
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2561/00—Nucleic acid detection characterised by assay method
    • C12Q2561/113—Real time assay
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/112—Disease subtyping, staging or classification

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Analytical Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Organic Chemistry (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Microbiology (AREA)
  • Immunology (AREA)
  • Molecular Biology (AREA)
  • Biotechnology (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)

Abstract

본 발명은 폐렴구균이 인간 폐 세포 감염 시 발현되는 spr1709 유전자의 돌연변이체를 이용한 백신 및 폐렴구균 진단 방법에 대한 것이다. 본 발명에 따라 이들 유전자 돌연변이체를 항원으로 사용하여 생쥐에 접종하였을 때 인후감염뿐만 아니라 전신감염 모델에서도 현저히 약독화 됨을 관찰할 수 있었다. 또한 본 발명에서 개발된 백신은 인후 접종하였을 때에 폐렴구균 질환을 예방할 수 있었다. 따라서 본 발명의 spr1709 유전자의 돌연변이체는 신규한 폐렴구균 백신 및 진단, 치료제 개발에 이용될 수 있다.
폐렴구균, 백신, 약독화, spr1709, 돌연변이체

Description

ｓｐｒ1709 유전자가 손상된 변이주를 이용한 폐렴구균을 치료하기 위한 약독화 백신 및 이의 진단방법{Attenuated vaccine and diagnostic method thereof for treating Streptococcus pneumonia using mutant including mutated spr1709 gene}
본 발명은 폐렴구균(Streptococcus pneumoniae)의 인간 폐 세포 감염시 발현되는 spr1709유전자가 손상된 돌연변이체를 이용한 약독화 백신 및 이의 진단방법에 관한 것이다.
폐렴구균(Streptococcus pneumoniae)은 형질전환 가능한 그램양성 세균으로서 사람 및 동물에서 다양한 감염증, 예를 들어 세균성 폐렴, 중이염, 균혈증, 및 수막염을 일으킨다[Willett, H. P. 1992. Streptococcus pneumoniae. In Zinsser Microbiology. Joklik, W.K., Willet, H.P., Amos, D.B. and Wilfert, C.M., (eds). Prentice-Hall International, London, pp. 432-442]. 폐렴구균에 의한 감염은 다제내성균의 등장으로 항생제에 의한 치료가 어려운 실정이다. 폐렴구균 감염증을 예방하기 위하여 현재 시판되고 있는 23가 다당류 백신[Pneumovax 23 (Merck) 및 Pnu-Imune 23 (Wyeth-Lederle)]은 협막 다당류(APS)를 유효 항원으로 하고 있으나 영·유아에서는 항체 생성율이 낮아 효과가 없고 기억 반응(memory response)이 없다는 단점이 있다. 이러한 23가 백신의 단점을 해결하기 위해 개발된 7가 콘쥬게이트 백신[Prevnar (Wyeth-Lederle사)]은 7종의 캡슐형 다당류(CPS)를 담체 단백질에 콘쥬게이션하여 제조한 것이나, 고가이고 95개 이상의 폐렴구균 중에서 단지 7가지 타입의 폐렴구균에 대해서만 방어 효과가 있으므로 폐렴구균 감염증의 예방 백신으로서 사용이 매우 제한적이다.
또한 현재 사용되는 폐렴구균 백신은 모두 피하 주사용(혈청 내 IgG 유도)이므로 인후 점막으로 침투하는 폐렴구균을 초기에 효과적으로 방어할 수 없다.
따라서, 폐렴구균 감염증을 예방하기 위해 점막 백신이나 항원성이 높은 단백질을 이용한 백신을 개발하려는 시도가 이루어지고 있다. 폐렴구균의 독성 인자로서 숙주 세포의 콜레스테롤과 결합하여 구멍을 내는 뉴모라이신(pneumolysin: Ply) 톡소이드가 알려져 있으며, 약독화된 뉴모라이신(PdB)을 백신으로 개발하려는 시도가 있었다. 그러나, 뉴모라이신은 생체내 및 시험관내에서 독성이 매우 강하고, PdB 단독으로는 효과가 없어 다른 독성 인자들인 폐렴구균 표면 단백질 A(PspA), 콜린 결합 단백질(CbpA), 폐렴구균 표면 부착소 A(PsaA), LytA 등과 같이 투여하는 경우에만 폐렴구균 감염증에 대한 생존율이 증가하였다[Ogunniyi, A. D. et al., 2000, Immunization of mice with combinations of pneumococcal virulence proteins elicits enhanced protection against challenge with Streptococcus pneumoniae. Infect. Immun. 68:3028-3033]. 이와 같이, 기존의 폐렴구균 감염증 예방 백신의 후보 항원 단백질들이 면역원성이 낮거나 모든 혈청형 에 대하여 방어효능을 갖지 못하며 주사용이므로 현재까지 인후 점막에 작용하는 백신은 없는 상태이다. 따라서 감염초기에 인후 점막에서 균의 침입을 방어할 수 있는 단백질 후보물질 또는 약독화 백신 개발이 요구된다.
폐렴구균은 건강한 개체의 비인두에 존재하며, 이것은 폐렴구균 감염증에 대한 주된 저장소이다. 폐렴구균은 생체내에서 다양한 환경적 스트레스를 받는다. 폐렴구균이 비인두에서 혈류로 침투하는 것과 같이, 숙주에서 환경적인 적소(niche)의 변화는 유전자 발현의 변화뿐만 아니라 급격한 형태적인 변화를 유발한다(상변이: Phase variation). 예를 들어, 비인두의 폐렴구균은 주로 투명한 콜로니 표현형이며 소량의 협막 및 다량의 콜린 결합 단백질 A(CbpA)를 발현시키는 경향이 있는 것으로 입증되었다. 한편, 혈류 중의 폐렴구균은 주로 불투명한 콜로니 형태이며 다량의 협막 및 소량의 CbpA를 생성시키는 경향이 있다[Kim, J. O. et al., 1998, Association of intrastrain phase variation in quantity of capsular polysaccharide and teichoic acid with the virulence of Streptococcus pneumoniae. J. Infect. Dis. 177:368-377].
최근 STM(signature-tagged mutagenesis), 마이크로어레이(microarray) 및 게놈 기반 독력 유전자(genome-based virulence gene) 연구에서 폐렴구균을 복강내로 주사하거나 정맥내로 주사하여 유발되는 전신감염과 인후 점막을 통해 감염시킬 경우에 각각 다른 유전자들이 발현되며[Hava & Camilli, 2002; Orihuela et al.,　 2003; Adamou et al.,　 2001; Paton et al.,　 2001; Polissi et al., 1998; Wizemann et al.,　 2001; Throup et al.,　 2000], 폐렴구균이 침투할 때 경유하 는 조직 (인후- 폐 - 혈액- 뇌)에 따라서 특이한 유전자가 발현되었다[Orihuela et al., 2004; Hava & Camilli, 2002]. 또한 폐렴구균 감염시 혈액내에서 발현되는 유전자와 조직 내에서 발현되는 유전자가 다르며[Oggioni et al., 2006], 폐렴구균이 인간 폐 세포주를 침입할 때 혈청형에 무관하게 다당류 협막이 없어지고[Hammerschmidt S et al. 2005, Illustration of pneumococcal polysaccharide capsule during adherence and invasion of epithelial cells. Infect Immun 73:4653-67], 숙주세포에 부착하여 침입하기 위해 세포표면의 두꺼운 협막이 얇아지고 여러 인자들의 발현이 유도되었다[Bergmann S, Hammerschmidt S. 2006, Versatility of pneumococcal surface proteins. Microbiology. 152(Pt 2):295-303].
폐렴구균(Streptococcus pneumoniae) 은 인후부에서는 투명형(transparent type)으로 존재하지만 일단 혈액안으로 침투하면 불투명형(opaque type)으로 상전환을 한다. 불투명형과 투명형은 지방산 조성에 차이가 있으며[Aricha 등, 2004], 불투명형에서는 PspA 가 다량 발현되지만 투명형에서는 CbpA 와 LytA 가 다량 발현된다[Kim and Weiser, 1998 Rosenow 등, 1997; Weiser 등, 1996]. 불투명형에서는 연장인자(elongation factor) Ts 의 발현이 증가되지만 펩티딜-프롤릴 시스/트랜스 이성질화효소(peptidyl-prolyl cis / trans isomerase) 에 속하는 프로테이나아제 성숙 단백질(proteinase maturation protein) PrtM 과 피루브산 산화효소(pyruvate oxidase) SpxB 발현은 억제되었다[Overweg 등, 2000]. 한편 투명형에서는 프로테이 나아제 성숙 단백질 A(PpmA) 단백질 발현이 증가하여 폐렴구균의 표면에 존재하여 표면단백질 또는 분비되는 단백질의 성숙에서 중요한 역할을 한다. spxB-결핍 돌연변이체는 인후부에서 콜로니형성능이 감소되는데[Spellerberg B., Cundell D. R., Sandros J., Pearce B. J., Idanpaan-Heikkila I., Rosenow C., and Masure H. R., 1996. Mol. Microbiol. 19:803-813, 1996] 그 이유는 인후부의 폐렴구균(투명형) 생장에 SpxB 가 필요하며 이때 SpxB를 이용하여 과산화수소를 생성하며 생활하기 때문이다[Overweg 등, 2000]. 그러나 현재까지 폐 세포 침입시 관련된 유전자 검색은 보고된바 없다. 따라서 본 연구는 폐렴구균이 인간 폐세포 침입시 유도되는 유전자를 검색하고 이들 유전자 돌연변이주가 in vivo 에서 독성이 현저히 감소됨을 입증한 최초의 보고이다. 폐 감염시 유도되는 유전자는 폐렴구균이 폐 세포를 침입할 때 상변이가 유도되어 다당류 협막이 없어지고[Infect Immun 2005;73:4653-67] 다른 여러 가지 인자들의 발현이 변화되므로 [Microbiol 2006;152: 295-303], 폐 세포 감염 시 유도되는 유전자 들은 상변이에 관여할 것으로 예상된다.
따라서, 본 발명자들은 폐렴구균이 인간 폐세포에 침입시에 유도되는 인자들을 발굴하여 이들 인자를 폐렴구균 질환 진단마커 개발, 이들 인자의 억제에 의한 폐렴구균 치료제 검색, 변이주를 약독화된 백신으로 개발하기 위하여 본 연구에 착수하였다. 먼저 폐렴구균이 인간 폐세포에 침입시에 유도되는 인자들을 마이크로어레이(microarray) 검색으로 발굴하였다. 또한 이들 유전자의 발현을 역전사(RT)-PCR 로 재확인한 후 이들 유전자의 변이주를 구축하여 생장 특성, 데옥 시콜레이트(deoxycholate) 및 항생제에 의한 용혈반응(용균)을 측정하였다. 또한 실험관내에서 인간 폐세포주에 대한 세포독성 및 용혈반응을 측정하여 약독화됨을 확인하였으며 생쥐를 이용한 전신 및 인후 감염 모델에서 약독화됨을 재확인하였고 변이주에 의한 면역화가 독성 폐렴구균에 의한 인후 시험감염(challenge)에 대해 마우스를 보호할 수 있는지 여부를 평가함으로써 본 발명을 완성하였다.
본 발명은 약독화된 생백신으로서 폐렴구균의 손상된 1709 유전자를 포함하는 돌연변이체를 제공하는 것이다.
본 발명의 또 다른 목적은 또한 폐렴구균 spr1709에 의해 암호화되는 단백질 및 돌연변이체를 약독화된 생백신을 면역학적 유효량으로 사람 또는 동물에 투여하여 사람 또는 동물을 폐렴구균 감염증에 대해 면역화시키는 방법을 제공하는 것이다.
본 발명의 또 다른 목적은 spr1709유전자의 발현 여부를 확인하여 폐렴구균 감염 여부를 진단하는 키트 및 이의 방법을 제공하는 것이다.
상기와 같은 목적을 달성하기 위해, 본 발명은 서열번호 1로 표시되는 spr1709(GenBank accession number NP_359301) 유전자의 기능을 손상시키는 폐렴구균 돌연변이 유발용 DNA 및 돌연변이 유발용 DNA를 제조하기 위한 서열번호 2 내지 7로 표시되는 프라이머 세트를 제공한다.
또한, 상기 돌연변이 유발용 DNA가 도입되어 형질전환된 폐렴구균 돌연변이체를 제공한다.
상기 돌연변이체는 폐렴구균 전체 유전자의 1681098부터 1682261까지, spr1709의 155부터 1359까지 결실되는 것이 바람직하며, 돌연변이체 제작를 위한 폐렴구균은 D39를 사용할 수 있다.
본 발명의 다른 목적을 달성하기 위해, 상기 돌연변이체를 유효성분으로 하고, 약제학적으로 허용되는 담체를 포함하는 폐렴 구균 치료용 백신 조성물을 제공한다.
상기 백신으로 사용하기 위해 spr1709유전자로 코딩되어 있는 펩타이드를 제공한다.
상기 백신 조성물은 복강 또는 인후 점막을 통해 투여할 수 있다.
인후 점막을 통한 백신화는 에어로졸 또는 점적 전달 시스템 형태를 사용할 수 있다.
상기 백신 조성물은 세균성 폐렴, 중이염, 균혈증 또는 수막염 등의 폐렴구균 감염증의 면역화에 사용하는 것이 바람직하다.
본 발명의 다른 목적을 달성하기 위해, 본 발명은 spr1709 유전자의 단편, 이들로부터 유래되는 펩타이드 및 펩타이드에 대한 항체로 구성되는 군에서 선택되는 어느 하나를 포함하는, 폐렴구균 진단용 키트를 제공한다.
또한, 폐렴구균 감염시 발현량이 증가하는 것이 특징인, 폐렴구균 감염 진단용 바이오 마커 spr1709 유전자를 제공한다.
또한, 사람 또는 동물로부터 채취한 세포에 대하여 spr1709 유전자 가 발현 여부를 확인하여 폐렴구균 감염여부를 진단하는 방법을 제공한다.
상기 폐렴구균 감염여부를 진단하기 위해서 웨스턴 블롯, RT-PCR 및 실시간 PCT(real PCR)방법을 사용할 수 있다.
본 발명에 따른 폐렴구균 spr1709 유전자를 이용한 백신은 감염시 폐렴구균에서 유도되는 단백질을 표적으로 돌연변이체를 제작하여, 모든 폐렴구균형에 적용 가능한 백신이며, 인후 점막으로 침투하는 폐렴구균을 초기에 효과적으로 방어할 수 있는 인후 점막에 작용하는 백신이다. 또한 폐렴구균 감염시 과발현되는 spr1709 를 포함하는 유전자 및 이들로부터 유래되는 펩타이드 및 이러한 펩타이드의 항체는 폐렴구균의 진단에 이용될 수 있다.
이하, 실시예에 의거하여 본 발명을 보다 더 상세하게 설명한다. 단, 하기 실시예는 본 발명을 예시하기 위한 것이며, 본 발명의 범위가 이하 실시예에 의해 한정되는 것은 아니다. 또한, 본 발명에 기술된 참고문헌은 본 발명에 참고로서 통합된다.
하기 실시예의 실험결과에 대한 통계학적 분석은 student's t-test(paired or unpaired Student's t-test) 을 사용하여 통계적 분석을 수행하였다. 제시된 데이터는 2개 내지 4개의 독립 실험에 대한 평균 ± 표준 편차이다. 군간의 평균 생존 시간의 차이는 만-휘트니 U 검정(양측) (2-tailed)에 의해 분석하였고, 군간의 전체적인 생존율의 차이는 피셔의 정확 검정 (Fisher Exact test)에 의해 분석하였다. (P < 0.05;*, P < 0.01; **, P < 0.001; ***)).
실시예
실시예 1: 폐렴구균 감염시 유도되는 과발현 유전자 검색
i) 세균, 세포주, 실험동물 및 형질전환
본 실시예에서 사용된 폐렴균은 표 1 에 명시된 균주들을 사용하여 실험하였다. 폐렴구균 균주 D39(타입 2) 및 이로부터 유래된 돌연변이체를 토드 휴이트 (Todd Hewitt: THY) 브로쓰에서 배양했다.
D39 균주의 형질전환을 위해 카시톤-트립톤(Casitone-Tryptone: CAT) 기본 배지에서 지수성장기의 중간 단계까지 배양했다: CAT 기본배지 1L는 10 g 효소 카세인 가수분해물(enzymatic casein hydrolysate) (Difco Laboratories, USA), 5 g 트립토판(Difco Laboratories), 1 g 효모 추출물 (Difco Laboratories), 5 g NaCl, 5 mg 콜린(choline) (Sigma, USA), 0.2 % 글루코오스(Sigma, USA), 16.6 mM 디포타슘 포스페이트(dipotassium phosphate)(Sigma, USA) 를 함유하였다. CAT 브로쓰에 리터당 147 mg의 CaCl2 및 2 g의 우태아 혈청(분획 V; Sigma)을 첨가하여 완전한 형질전환 배지를 제조하였다. 컴피턴스(competence)를 컴피턴스 특이적 펩티드의 첨가에 의해 조절하고 종래 문헌[Havarstein, L. S.et al., 1995,An unmodified heptadecapeptide pheromone induces competence for genetic transformation in Streptococcus pneumoniae. Proc. Natl. Acad. Sci. U.S.A. 92:11140-11144]에 기술된 바와 같이 배양 배지에서 세포를 DNA에 노출시킨 후 수득한 에리스로마이신 저항성 형질전환체로서 정량화하였다. 협막 균주 D39(타입 2)를 뇌 심장 주입 브로쓰(Difco Laboratories, USA) 또는 토드 휴이트(Todd Hewitt) 브로쓰(Difco Laboratories, USA) 에서 성장시키고 종래 문헌[Bricker, A. L. et al., Transformation of a type 4 encapsulated strain of Streptococcus pneumoniae. FEMS Microbiol. Lett.172:131-135]에 기재된 바와 같이 형질전환시켰다. 폐렴구균 형질전환체를 선별하기 위하여, 에리스로마이신 을 성장 배지에 각각 2.5㎍/ml 의 농도로 첨가하였다.
ii ) 인간 폐 세포배양
인간 폐 상피암종 A549(ATCC CCL-185) 세포주(ATCC TIB-71)를 아메리칸 타입 컬쳐 컬렉션(American Type Culture Collection)으로부터 구입하고 이들을 37℃에서 5% CO2하에 배양시켰다. A549 세포를 글루코오스 4.5㎍/L, 10% 우태아 혈(FBS; Gibco BRL, Gaithersburg, Md.), 및 페니실린 G 100U/ml, 및 스트렙토마이신 100 ㎍/ml를 함유하는 둘베코 변형 이글 배지(DMEM)(Gibco BRL, Gaithersburg, Md)에서 배양시켰다. 감염실험에 사용된 생쥐는 4주령의 ICR mouse(Orient, Korea) 수컷을 사용 하였다.
iii ) 독성 시험
독성이 매우 강한 협막 타입 2 균주(D39) 및 이의 동종유전자형 돌연변이체 로 복강내(i.p.) 또는 인후 시험감염을 수행하여 폐렴구균의 독성에 미치는 표적 유전자의 돌연변이의 영향을 평가하였다. 세균을 10% [vol/vol] 말혈청을 가한 뇌 심장 주입 한천(Difco Laboratories, USA) 또는 토드 휴이트(Todd Hewitt) 한천(Difco Laboratories, USA)(필요에 따라 에리스로마이신 보충)상에서 밤새 37℃에서 배양한 다음 혈청 브로쓰(10% [vol/vol] 말혈청을 가한 뇌 심장 주입 브로쓰(Difco Laboratories, USA) 또는 토드 휴이트Todd Hewitt) 브로쓰(Difco Laboratories, USA)) 에서 37℃에서 3시간 동안 성장시켜 약 108 CFU/ml의 세균 배양물을 수득했다 [Ogunniyi, A. D.et al., 2000]. 다음 각 세균 배양물을 혈청 브로쓰로 희석하거나 농도를 조절하여 10마리의 CD1 마우스군을 0.1 ml 부피의 D39, 또는 돌연변이체로 복강내 감염시키거나 10 ul 의 D39 또는 돌연변이체로 인후 감염시켰다. 시험감염된 마우스의 생존여부를 처음 5일 동안은 1일 4회, 다음 5일 동안은 1일 2회, 시험감염후 21일째까지는 매일 모니터링하였다.
표 1. 본 발명에 사용된 폐렴구균 계통
계통 관련특성 공급원 또는 문헌
CP1200 △hrcA MalM511 str1 △lacZ :: ermB Em r Kim　 et al ., 2001
D39 Encapsuled, type2 parent, S type Avery et al ., 1944
MK1709R D39 △gftA :: ermB Em r
※ Emr : 에리스로마이신 내성 (Erythromycin resistance)
※ ermB 카세트(cassette) 삽입 방향 ; R, 역방향 ; S, 동일방향
iv ) RNA 분리 및 Microarray 분석
Orihuela 등 (2004)의 방법을 사용하여 폐렴구균으로 감염된 A549 세포로부터 세균의 RNA 를 분리 하였다. 즉 DMEM 배지에서 배양한 4 x108　 CFU/mL 폐렴구균을 인간 폐세포주 A549(4 x106, MOI 100:1)에 감염시킨 다음 37 °C에서 10 분 또는 2 시간 배양하였다. 일정시간 후에 세포에 부착되지 않은 균을 세척하여 제거하고 세균 RNA를 보호하기 위해 RNAprotect™(Qiagen, Valencia, Calif.)액을 첨가한 상태에서 세포를 수확하여 5 분간 초음파 세척기(Sonorex ultrasonic cleaners Model RK52H, Bandelin, Germany)를 사용하여 세균은 깨지지 않고 세포만 깨진 상태로 만든다. 이 세포 용해액을 800 g에서 5 분간 원심 분리하여 세포의 잔해를 제거하고 4,600g에서 10분 원심분리하여 세균을 수확한다. RNeasy minikit™(Qiagen)을 사용하여 펠렛(bacterial/eukaryotic pellet)으로부터 RNA를 분리한다. 진핵 유래 RNA(Eukaryotic RNA)를 제거하기 위해 펠렛으로부터 MICROBEnrich™(Ambion, Austin, Tex.)를 사용하여 세균 RNA을 증폭(enrich)하고 여기서 분리된 RNA를 OD260 에서 O.D를 측정하여 정량 한 후 아가로스 겔(agarose gel)에서 전기 영동하여 RNA의 상태를 점검하였다.
분리된 RNA를 마이크로어레이(microarray)분석하기 위해 A549 세포에 감염시키지 않은 폐렴균을 대조군으로 사용하여 독성이 있는 폐렴구균 D39 을 인간 폐 세포주 A549에 10분, 2시간 감염시킬 때 발현 변화되는 폐렴구균 전사체를 폐렴구균 유전자 칩 마이크로어레이(Genomic Tree, Korea )를 이용하여 분석하였다.
실시예 2: 폐렴구균 돌연변이체의 제작
Rubin 등(2004)의 방법을 사용하여 폐렴구균 염색체 DNA를 D39 균주와 hrcA 균주로부터 분리하였다. PCR에 의한 돌연변이를 일으키는 DNA 절편(mutagenic DNA fragment)을 작성하기 위하여, 폐렴구균 표적 유전자의 일부를 탈락시키고 대신 ermB(에리스로마이신(erythromycin)에 저항성인 유전자 카세트)로 치환시킨 DNA 절편을 PCR 방법으로 작성하고 이렇게 작성된 DNA 절편을 폐렴구균에 형질전환시켜 돌연변이체를 얻었다. 즉 폐렴구균 유전자의 중간부분을 제거하고 대신 에리스로마이신 저항성 유전자(ermB)가 삽입된 돌연변이체를 본 연구실에서 이미 구축된 Tripartite PCR 방법[Kwon 등, 2003; Lau 등, 2002]으로 제작하였다. 이를 위해 폐렴구균 염색체 DNA를 주형으로 사용하여 타겟 유전자의 중간부위를 제외한 왼쪽 팔(left arm)과 오른쪽 팔(right arm)부위를 증폭시키고 ermB 유전자가 발현되는 hrcA 돌연변이체의 염색체 DNA를 주형으로 사용하여 ermB 유전자(860 bp)를 증폭시켰다(표 2). 이때 사용되는 타겟 유전자 왼쪽 팔 DNA 절편의 3’말단의 프라이머는 ermB의 5’말단 프라이머 시퀀스를 완전히 포함하도록 제작하였으며 타겟 유전자 오른쪽 팔 DNA 절편의 5’말단 의 프라이머는 ermB의 3’말단 프라미어 시퀀스를 완전히 포함하도록 제작하여 1 차 PCR 반응결과 얻어진 DNA 절편은 타겟 유전자 왼쪽 팔 DNA 절편의 3’말단과 ermB　 5’말단이 서로 오버랩되어서, ermB 3' 말단 과 타겟 유전자 오른쪽 팔 DNA 절편의 5' 말단이 서로 중첩되는 구조물이 얻어지도록 하였다. 따라서 두 번째 PCR 반응은 3 개의 DNA절편, 즉 타겟 유전자 왼쪽 팔, ermB, 타겟 유전자 오른쪽 팔 DNA 절편을 하나의 튜브에 넣고 이미 사용했던 타겟 유전자 왼쪽 팔 DNA 절편을 확보하는데 사용했던 5' 프라이머와　오른쪽 팔 DNA 절편을 확보하는데 사용했던 3’프라이머를 다시 이용하여 PCR 반응을 함으로써 3개의 DNA 절편이 하나로 연결되게 제작하였다 (도 1, 표 3).
작성된 돌연변이성 DNA 템플레이트(template)를 컴피턴스　 스티뮬레이팅 펩타이드-1(competence stimulating peptide-1)을 이용한 Havarstein 등의 방법 (1995)으로 폐렴구균에 형질전환하여 에리스로마이신 1 ug/ml 포함된 CAT 아가(agar)에서 에리스로마이신 저항성인 콜로니를 선별하였다. 선별된 에리스로마이신 저항성인 돌연변이체가 올바른 결실 부분을 함유하고 있는지 확인하기 위해 콜로니(colony) PCR 을 실시하였다. 참고로, 제작된 돌연변이체는 한국생명공학연구원 생물자원센터에 기탁하였다(기탁번호: KCTC 11376 BP).
표 2. ermB 카세트(cassette) 증폭산물(amplicon) 시퀀스
ermB　 orientation Direction: 5’ → 3’ 서열번호 또는 Ref.
Reverse orientation　 F ACGCACGAACCTGTCGGATCAA Kim et al ., 2001
Reverse orientation　 R CTCAGACTTTTCAGGAGTTGTTTC Kim et al ., 2001
Same orientation　 F AGTCGGCAGCGACTCATAGAAT 　2
Same orientation　 R CCGGGCCCAAAATTTGTTTGAT 　3
※ F, Forward primer; R, Reverse primer
　표 3. 돌연변이체 제작을 위한 프라이머 시퀀스
Primer sequence (5’ → 3’)/ MK1709R 서열번호
L up ttgcgccagt tgactacga 4
L dn attctatgag tcgctgccga ctgccaagtg ctgaatggtc ttac 5
R up atcaaacaaa ttttggcccc ggcctactat tcagcgcttg ga 6
R dn caatgctgtg agctgttggt gtc 7
※밑줄친 부분은 에리스로마이신(ErmB) 카세트 위치의 상보적인 뉴클레오티드 시퀀 스임. L, 왼쪽 팔 프라이머; R, 오른쪽 팔 프라이머
실시예 3: 돌연변이체의 특성 측정
1) 돌연변이체의 특성 측정 방법
적혈구 용혈능 측정 [ Lock RA et al ., 1996]
돌연변이체의 적혈구 용혈능을 측정하여 야생형에 비해 독성이 어느 정도 약화되었는지 Lock 등의 방법(1996)으로 측정하였다. 즉 돌연변이체를 THY 브로쓰에 OD550 0.3에 도달할 때까지 배양후 원심분리하여 모아진 균체를 라이시스 버퍼(용균 buffer) (50 mM Tris-Cl, 1 mM DTT, 0.1% Triton X-100)로 현탁시키고 1 mM PMSF와 0.1 % 데옥시콜릭 산 (DOC)를 가하고 37 °C에서 5 분간 배양 후, 초음파처리하여 세포를 부순다. 샘플을 원심분리한 후에, 상층액을 회수하고 연속적으로 희석시켰다. 96웰 마이크로타이터 플레이트에 1.5%의 세척된 양(sheep) 또는 말(horse) 적혈구의 등량과 함께 인큐베이션하여 용혈 활성을 결정하였다. 용혈 역가는 540 nm에서 적혈구 50%가 용해되는 추정 희석도의 역수로 결정하였다[Lock, R. A. et al., 1996, Sequence variation in the Streptococcus pneumoniae pneumolysin gene affecting haemolytic activity and electrophoretic mobility of the toxin. Microb. Pathog. 21:71-83].
MTT 분석에 의한 세포독성 측정 [ Smirnov , 1999]
돌연변이체에 의한 세포독성을 측정하기 위해 살아있는 세포의 미토콘드리아 탈수소효소(mitochondrial dehydrogenase)와 MTT 시약이 반응을 하여 푸른 색(formazan)을 형성하는 원리를 이용하는 MTT 어세이(assay) [Smirnov, 1999]를 이용하였다. 즉 96 웰(well)에 A549 세포(human lung cell)을 1 x 104 세포을 함유하도록 시딩(seeding)하여 모노레이어 (monolayer)가 형성되면 항생제가 함유되지 않은 DMEM 배지로 교체하고 1 x 106 CFU의 폐렴균으로 감염(MOI 100: 1) 시킨다. 감염 4시간 후 항생제가 함유된 DMEM배지로 교체한 후 ELISA 리더기(Reader)를 사용하여 540 nm에서 흡광도를 측정하였다.
데옥시콜레이트 ( DOC , Deoxycholate ) 및 항생제에 의한 자가분해(자가분해)
흡광도가 0.3 ~ 0.4 인 돌연변이체 배양액에 0.05 % 데옥시콜릭 산(deoxycholic acid) 또는 항생제를 첨가하여 배양할 때 550nm에서 흡광도 변화 또는 생균수를 측정하였다.
ELISA 어세이( assay )
항체의 역가를 측정하기 위해 효소 결합 면역 흡착 검정(ELISA) 어세이(assay)를 하였다. 즉 돌연변이체로 면역화 시킨 마우스의 혈청 또는 타액을 군별로 풀링하고 D39 또는 돌연변이체 의 전체 세포 용해물(cell lysate)로 코팅된 ELISA 플레이트를 이용하여 역가를 측정한다. 즉 돌연변이체 세포융해체(cell lysate)를 500 ng/ml의 농도로 TPBS와 혼합하여 96 웰에 코팅하고 37 °C 인큐베이터에서 1시간 동안 1 % BSA로 블로킹(blocking)하고 세척 후, 1차 항체를 다단희석 하여 37 °C 인큐베이터에서 1시간 배양후 다시 세척하고 2차 항체인 IgG-HRP 와 반응시킨 다음 발색 시약인 TMB를 가하여 반응시켰을 때 나타나는 흡광도를 540 nm에서 ELISA 리더기(Softmax, USA)로 측정하였다.
2) 돌연변이체의 특성 측정 결과
i) 인간 폐세포 감염시 유도되는 폐렴구균 유전자 돌연변이체의 생장 특성
인간 폐세포주 A549 에 D39 야생형 균주를 감염시키고, 10분, 2시간 후 RNA를 각각 분리 하여 마이크로어레이를 수행하였을 때 대조군에서는 발현되지 않고 D39에 감염되었을 때 발현되는 유전자 중 3 배 이상 발현이 증가된 유전자(표 4)를 선택하였다.
표 4. 마이크로어레이에 의해 선택된 A549세포에 감염시 발현되는 폐렴구균 유전자
유전자 명칭 　 10분 감염 2 시간 감염 기능
spr1709 (gtfA) 3.61 5.83 덱스트란수크레이즈(Dextransucrase, 수크로오스 6-글루코실트랜스퍼레이즈)
각각의 돌연변이체의 생장 곡선을 측정하였을 때, MK1709R은 야생형보다 정지기(stationary phase)가 약 2시간 이상 연장되어 정지기에서도 자가분해가 지연되었다 (도. 2).
ii ) 항생제에 의한 용균
일부 돌연변이체 는 정지기에 도달후에도 사멸이 지연되었으므로 이를 재차 확인하기 위해 항생제 첨가시의 자가분해를 측정하였다. 즉 폐렴구균은 항생제 페니실린(penicillin) G에 의해 자가분해가 유도되므로 페니실린 G　 첨가시 생장곡선을 측정하였으며 (도 3), 이를 재차 확인하기 위해 D39 야생형 균주를 세팔로스포린(Cephalosporin) 계열 항생제인 세포탁심(cefotaxime)을 첨가하였을 때 용균 되는 속도를 측정하였다. 배양액에 세포탁심을 첨가 후 흡광도를 측정하였을 때 흡 광도가 절반으로 감소되는 시간은 D39의 경우 90분이고, MK1709R는 60분이었다.(도 4).
　 iii ) 데옥시콜릭 산( DOC ) 에 의한 자가분해
폐렴구균은 DOC 에 민감하게 자가분해 되므로 항생제에 의한 자가분해 저항성을 재확인하기 위해 0.05% DOC 첨가시, 균 용해 속도를 측정하였다. DOC 첨가 후 흡광도가 절반으로 감소되는데 소요되는 시간을 측정하였을 때 야생형 240초, MK1709R은 DOC 에 저항성을 나타내어 절반으로 감소되는 시간이 920 초였다(도 5).
또한 DOC를 첨가하고 생균수를 측정하였을 때, 야생형 D39는 DOC처리 5분 후 10개가 관찰되었고, MK1709R 돌연변이체 는 DOC처리 40분 후에도 1 X 103개 이상의 생균수가 관찰 되어DOC 에 대한 저항성을 나타내었다(도 6).
　 iv ) 돌연변이체의 적혈구 용혈능 측정
돌연변이체 가 약독화되었는지 규명하기 위해 적혈구 용혈능을 측정하였다. 감염시 심한 세포손상을 유도하는 야생형의 경우 세포손상으로 인해 많은 헤모글로빈이 방출되어 흡광도가 증가되어 OD550에서 0.29 를 나타내었다. 이에 반해, MK1709R 돌연변이체 균주의 경우 용혈능력이 현저히 감소되었음을 확인할 수 있었다(도7).
v) MTT 어세이(assay)를 이용한 세포독성 측정
돌연변이체 균주의 인간 폐 세포(human lung cell) A549 에 대한 세포독성을 측정하기 위해 살아있는 세포의 미토콘드리아 탈수소효소가 MTT 시약과 반응하여 푸른색(formazan)을 형성하는 원리를 이용하여 세포 독성을 정량하였다(도 8). D39는 다른 돌연변이체 균주보다 독성이 강해 흡광도가 0.477로 나타났다. 그러나 MK1709R은 38 % 증가되어 세포독성이 감소되었음을 나타내었다.
vi ) 각 돌연변이체 의 LD 50
돌연변이체의 백신 안전성을 확보하기 위해 각각의 돌연변이체의 생쥐에 대한 치사량을 측정하였다. 전신감염 모델(복강 주사) 및 인후 감염 모델에서 50% 치사량은 표 5와 같다. 인후 감염일 경우 야생형 D39보다 MK1709R 은 독성이 50배 이상 감소 되었고, 전신 감염의 경우 104 배 이상 독성이 감소되었다. 특히 MK1709R균주의 경우, 너무 약독화 되어 LD50를 측정시 1 X 109 CFU 이상으로 투여해야 하기 때문에 정확한 치사량 측정이 불가능하였다.
표 5. 돌연변이체의 LD50
돌연변이체 명칭 Injection type LD50 Fold attenuation
MK1709R (△gtfA) 인후 접종 >1 X 109 >50
복강내 접종 >1 X 108 >104
D39 인후 접종 2 X 107 1
복강내 접종 104 1
※Fold attenuation : 돌연변이체의 LD50　/ 야생형의 LD50　
실시예 4: 백신 효과 측정
1) 백신 효과 측정 방법
전신감염 모델에서 백신효과 측정
마우스를 종래 문헌[Ogunniyi, A. D. et al, 2000]에 기재된 바에 따라 복강내 면역시켰다. 약독화 된 돌연변이체균주를 2주에 한번 LD10정도의 균수(대략 1 X 106 ∼ 1 X 107)로 3회 복강내 면역시켰다. 3차 접종이 끝나고 2 주 후 면역화 된 mouse 의 안와후방 출혈에 의해 마우스로부터 혈청을 채취하였다. 최종 면역후 2주째에 면역된 마우스를 매우 독성인 협막성 타입 2 균주 (D39)로 복강내 시험감염시켰다. 시험감염 실시 전에, 면역 세균을 혈액 한천상에서 밤새 37℃에서 성장시킨 다음, 육류 추출 브로쓰(뇌 심장 주입 브로쓰, Difco Laboratories, USA) 또는 토드 휴이트 (Todd Hewitt) 브로쓰(Difco Laboratories, USA))에 10% (v/v) 양 혈청을 첨가한 혈청 브로쓰에 접종시켰다. 다음, 세균을 37℃에서 3시간 동안 정적으로 성장시켜 약 108 CFU/ml의 세균을 얻고, 접종물을 시험감염 용량당 1 X 104 CFU로 조정하였다. 혈청타입 특이적 협막 생성은 슈타텐스 세럼인스티튜트(Statens Seruminstitut, Copenhagen, Denmark)로부터 구입한 항혈청을 사용하여 팽창 반응(quellung reaction)에 의해 확인하였다. 시험감염 실시 후에, 마우스를 처음 7일 동안 4시간 마다 모니터링한 다음, 21일까지는 매일 모니터링하였고, 각 마우스의 생존 시간을 기록하였다.
인후 감염 모델에서 백신효과 측정
약독화된 돌연변이체 균주를 2주에 한번씩 LD10정도의 균수(대략 1 X 107 ∼ 1 X 108)로 3번 인후 점막에 감염시켜 면역화 하고 마지막 접종 2 주후에 독성이 있는 D39 균주를 3 X 107 CFU로 인후 감염하였을 때 상기와 같이 생존시간을 측정하였다.
2) 백신 효과 측정
i) 각 돌연변이체의 in vivo 약독화 측정
각각의 돌연변이체 가 약독화 되었는지 재확인하기 위해 돌연변이체감염 후 생쥐의 생존시간을 측정하였다. 즉 D39와 돌연변이체를 1 X 104 CFU로 복강 주사하고 생존시간을 측정하였을 때 MK1709R, 돌연변이체의 경우 한 마리도 죽지 않아 1 X 104 CFU 에서 독성이 현저히 감소되었음을 확인하였다(P<0.0001) (도 9).
*전신감염모델로 사용된 복강 내 접종은 폐렴구균의 정상적인 감염경로가 아니므로[Salyers AA and Whitt DD, 1994] 폐렴구균을 2 X 107으로 인후 접종후 생쥐의 생존률을 측정하였다. D39 는 생존시간이 111시간이었고 MK1709R은 현저히 약독화되어 감염 후 2주 동안 모두 한 마리도 죽지 않아 독성이 현저히 감소됨을 나타냈다(P<0.001) (도 10).
ii ) 전신 면역화( Intraperitoneal immunization ) 후의 항체 역가 및 방어
In vitro 와 in vivo실험 결과 약독화된 균주 MK1709R를 10마리 생쥐를 한 군으로 하여 복강 내로 1 X 106∼1 X 107 CFU로 2주 간격으로 3번 면역화하고, IgG 항체 역가를 측정하였을 때, MK1709R은3200 이었다.
마지막 접종 후 10 일째에 독성이 있는 D39를 2 X 104 CFU로 전신 시험감염(intraperitoneal challenge)하였을 때 D39는 생존시간이 30 시간, MK1709R는 34시간(P=0.024)으로 야생형보다 생존시간이 유의성 있게 증가되었다(도 11).
iii ) 인후 면역화(Intranasal immunization)후의 항체역가 및 방어
인후 감염에 대한 백신 효과를 측정하기 위해 약독화된 MK1709R을 1 X 107 ∼1 X 108 CFU 로 2 주 간격으로 3 회 인후 접종하고, 마지막 3번째 접종일로부터 10일 후 독성이 있는 야생형 인 D39균주를 3 X 107 CFU로 인후 시험감염(intranasal challenge)하였을 때 MK1709R(gtfA) 돌연변이체로 면역화된 생쥐는 평균 생존율이 현저히 증가되었다(P<0.01) (도 12).
gtfA(spr1709) 는 상부(upstream) spr1708과 138 bp 의 비암호화 시퀀스(noncoding sequence)가 있으며, 하부(downstream) spr1710과는 358bp의 비암호화 시퀀스가 존재 하므로 오페론 을 형성할 것 같지 않다. BLAST 검색 결과 D39 균주(type 2)의 핵산 염기서열과 R6 핵산 서열은 100% 일치하며 Hungary19A-6, TIGR4(type 4)와도 매우 높은 유사성을 나타내어 99% 가 동일하였다. 따라서 다른 혈청형 폐렴구균 에서도 이 유전자는 유사성이 높을 것으로 예상된다.
gtfA 돌연변이체 는 In vitro 용혈능이 야생형 보다 약 45 % 감소되고, 세포독성 역시 38 % 감소되었다. In vivo 독성 실험에서도 야생형 의 LD50 인 1 X 104 CFU 를 복강 감염시 2 주 이상 생존하였다. 또한 인후 감염시에도 LD50인 2 X 107 CFU 로 감염시켰을 때 2 주 이상 생존함으로써 현저히 약독화되었음을 확인하였다.
폐렴구균은 DOC 에 의해 자가분해 효소 LytA 발현을 유도하여 자가분해 되어[Chastanet A et al., 2001] lytA 의존적으로 뉴모라이신(pneumolysin)을 방출하므로[Mitchell TJ et al., 1997], 야생형 보다 MK1709R(gftA 유전자 탈락) 돌연변이체가 용균이 느리게 진행되는 것은 이들 유전자 돌연변이에 의해서 자가분해가 억제됨을 나타내고 있다. 특히 인 비트로(in vitro )에서 DOC 처리 5 분 후 야생형은 모두 용혈 되지만 MK1709R 돌연변이체 는 40 분 후에도 103 CFU 의 생균수를 나타내어 균의 용해가 현저히 느리게 일어남을 입증하고 있다. 폐렴구균이 용균(lysis) 되면 폐렴구균의 주된 독소인 뉴모라이신을 비롯한 세포내 여러 가지 성분 이 방출되어 숙주세포를 파괴할 뿐만 아니라 세포벽 성분인 리포테이코익산(lipoteichoic acid)는 염증을 유발한다[Jedrzejas MJ, 2001]. 따라서 이들 돌연변이체 에서 용균이 억제되는 것은 생쥐 감염모델에서 현저히 독성이 감소되는 결과와 일치한다.
MK1709R 돌연변이체 는 LD50를 측정할 수 없을 만큼 약독화 되어 1 X 108 으 로 복강 주사하여도 모두 생존하였다. 따라서 이들 돌연변이체를 약독화 균주로 사용하여 3 차례 복강 내 접종하였을 때 IgG 항체가 생성되었으나 낮은 방어효과를 나타내었다. 그러나 MK1709R 돌연변이체를 인후 접종시에는 유의성 있게 방어효과를 나타냈다. 이런 현상은 MK1709R 돌연변이체를 복강내 접종(전신감염) 시에 유도된 IgG 항체에는 복강내로 challenge 된 D39 에 대한 방어 항체 성분이 함유되지 않았지만 MK1709R 돌연변이체를 인후 접종시에 생성된 항체 성분에는 D39 에 대해 방어 성분이 함유되어 방어효과를 나타낸 것을 제시한다. 따라서 이런 결과는 다음과 같은 가설로 설명될 수 있을 것이다: D39 를 THY 액체배지에서 배양하면 대부분이 불투명형으로 존재하며 복강내로 시험감염하더라도 바로 혈액내로 유입되어 불투명형으로 계속 생존하게 되므로 상변이가 유도되지 않는다. 그러나 D39 균주를 인후 감염시키면 인후부에서는 투명형으로 존재하다가 일단 혈액내로 침투하면 불투명형으로 상변이가 유도된다. 따라서 인후 감염은 상변이 관련 단백질 발현을 유도하지만 전신(복강내) 감염은 상변이를 유도하지 않을 것이다. 본 연구에서 폐 세포 감염시 유도되는 유전자들은 아마도 상 변이에 관련된 유전자일 가능성이 있으며 따라서 이들 유전자 돌연변이체는 상변이가 일어나지 않아 불투명형(또는 투명형) 상태로 계속 생장하여 용균에 저항성을 나타내면서 세포안으로는 침투하지 못하게 된다. 또한 이들 돌연변이체 에 대한 항체는 모두 불투명형(또는 투명형) 에 대해 작성된 것이므로 인후감염시 혈액안으로 침투한 불투명형(또는 투명형) 폐렴구균을 효과적으로 방어하지만 투명형(또는 불투명형)은 직접 방어하지 못할 것으로 생각된다.
종합 해보면 폐렴균에서의 spr1709(gtfA)돌연변이는 오토라이신(autolysin)발현에 양성 조절자(positive regulator)로써 작용하여, 돌연변이가 일어난 균주에서는 용균 가 억제되어서 세포독성(cytotoxicity)이 감소된 것으로 생각된다.
본 발명에 따른 폐렴구균 감염시 유도되는 유전자는 폐렴구균 감염 진단 시약 바이오마커(biomarker)로 사용될 수 있으며 이들 유전자를 돌연변이 시키면 약독화되므로 약독화 백신으로 사용 가능하다. 또한 이들 유전자 산물의 구조를 확인하면 특이적인 억제제의 개발이 가능하여 새로운 치료제 개발이 가능하다. 특히 현재까지의 모든 백신은 주사용이지만 본 연구결과는 주사의 통증이 없이 인후 점막에서 균을 방어할 수 있어서 효과적으로 폐렴구균 감염증에 대한 면역 보호효과를 나타낼 수 있다.
[참고문헌]
1. Adamou JE , Heinrichs JH , Erwin AL , Walsh W, Gayle T, Dormitzer M, Dagan R, Brewah YA, Barren P, Lathigra R, Langermann S, Koenig S, Johnson S. (2001) Identification and characterization of a novel family of pneumococcal proteins that are protective against sepsis. Infect Immun 69: 949-958.
2. Alpar HO , Papanicolaou I, Bramwell VW. (2005) Strategies for DNA vaccine delivery. Expert Opin Drug Deliv. 2(5):829-42.
3. Avery OT , Macleod CM , McCarty M. (1944) Study on the chemical nature of the substance inducing transformation of pneumococcal types. J.of Experimental medicine 79(2):137-160.
4. Bartilson M, Marra A, Christine J, Asundi JS , Schneider WP , Hromockyj AE. (2001) Differential fluorescence induction reveals Streptococcus pneumoniae loci regulated by competence stimulatory peptide. Mol Microbiol. 39(1):126-35.
5. Bergeron Y, Ouellet N, Deslauriers AM , Simard M, Olivier M, Bergeron MG. (1998) Cytokine kinetics and other host factors in response to pneumococcal pulmonary infection in mice. Infect. Immun. 66, 912-22.
6. Bernatoniene J, Finn A. (2005) Advances in pneumococcal vaccines: advantages for infants and children. Drugs. 65(2):229-55.
7. Bitko V, Musiyenko A, Shulyayeva O, Barik S. (2005) Inhibition of respiratory viruses by nasally administered siRNA. Nat Med. 11(1):50-5.
8. Black S, Lieu TA , Ray GT , Capra A, Shinefield HR. (2000) Assessing costs and cost effectiveness of pneumococcal disease and vaccination within Kaiser Permanente. Vaccine. 19 Suppl 1:S83-6.
9. Bogaert D, Hermans PW , Adrian PV , Rumke HC , de Groot R. (2004) Pneumococcal vaccines: an update on current strategies. Vaccine. 22(17-18):2209-20.
10. Bohr VA , Rasmussen N. (1988) Neurological sequelae and fatality as prognostic measures in 875 cases of bacterial meningitis. Dan Med Bull 35(1):92-95.
11. Braun JS , Novak R, Gao G, Murray PJ , Shenep JL. (1999) Pneumolysin, a protein toxin of Streptococcus pneumoniae, induces nitric oxide production from macrophages. Infect Immun 67(8):3750-3756.
12. Braun JS , Sublett JE , Freyer D, Mitchell TJ , Cleveland JL , Tuomanen EI , Weber JR. (2002) Pneumococcal pneumolysin and H(2)O(2) mediate brain cell apoptosis during meningitis. J Clin Invest 109(1):19-27.
13. Briles DE .(2004) Protection of the elderly from pneumococcal pneumonia with a protein-based vaccine. Mech Ageing Dev. 125(2):129-31.
14. Briles DE , Ades E, Paton JC , Sampson JS , Carlone GM , Huebner RC , Virolainen A, Swiatlo E, Hollingshead SK. (2000a) Intranasal immunization of mice with a mixture of the pneumococcal proteins PsaA and PspA is highly protective against nasopharyngeal carriage of Streptococcus pneumoniae. Infect Immun. 68(2):796-800.
15. Briles DE , Hollingshead S, Brooks - Walter A, Nabors GS , Ferguson L, Schilling M, Gravenstein S, Braun P, King J, Swift A. (2000b) The potential to use PspA and other pneumococcal proteins to elicit protection against pneumococcal infection. Vaccine. 18(16):1707-1711.
16. Canvin JR , Marvin AP , Sivakumaran M, Paton JC , Boulnois GJ , Andrew PW , Mitchell TJ.(1995) The role of pneumolysin and autolysin in the pathology of pneumonia and septicemia in mice infected with a type 2 pneumococcus. J Infect Dis 172(1):119-123.
17. Carlos JO , Radin JN , Sublett JE , Gao G, Kaushal D, Tuomanen EI . (2004) Microarray analysis of pneumococcal gene expression during invasive disease.
Infect.Imm.oct.p.5582-5596.
18. Chastanet A, Prudhomme M, Claverys JP , Msadek T. (2001) Regulation of Streptococcus pneumoniae clp genes and their role in competence development and stress survival. J. Bacteriol. 183: 7295-7307.
19. Choi IH , Shim JH , Kim SW , Kim SN . Pyo SN , Rhee DK . (1999) Limited stress response in Streptococcus pneumoniae. Microbiol Immunol 43(8): 807-812.
20. Conway T, Schoolnik GK .(2003) Microarray expression profiling : capturing a genome-wide portrait of the transcriptome . M.Microbiology 47 (4),879-889.
21. Cui Z. (2005) DNA vaccine. Adv Genet. 54:257-89.
22. Durand ML , Calderwood SB , Weber DJ , Miller SI , Southwick FS , Caviness VS Jr, Swartz MN. (1993) Acute bacterial meningitis in adults. A review of 493 episodes. N Engl J Med 328(1):21-28.
23. Espinosa A, Yan L, Zhang Z, Foster L, Clark D, Li E, Stanley SL Jr . (2001) The bifunctional Entamoeba histolytica alcohol dehydrogenase2 (EhADH2) protein is necessary for amoebic growth and survival and requires an intact C-terminal domain for both alcohol dehydrogenase and acetaldehyde dehydrogenase activity. J. Biol. Chem. 276:20136-20143.
24. Ess SM , Schaad UB , Gervaix A, Pinosch S, Szucs TD .(2003) Cost-effectiveness of a pneumococcal conjugate immunisation program for infants in Switzerland. Vaccine. 21(23):3273-81.
25. Ferreira DM , Areas AP , Darrieux M, Leite LC , Miyaji EN. (2006) DNA vaccines based on genetically detoxified derivatives of pneumolysin fail to protect mice against challenge with Streptococcus pneumoniae. FEMS Immunol Med Microbiol. 46(2):291-7.
26. Figura N.(1997) Identifiable Helicobacter pylori strains or factors important in the development of duodenal ulcer disease. Helicobacter. 1: S3-12.
27. Flores BM , Stanley SL Jr , Yong TS , Ali M, Yang W, Diedrich DL , Torian BE. (1996) Surface localization, regulation, and biologic properties of the 96-kDa alcohol/aldehyde dehydrogenase (EhADH2) of pathogenic Entamoeba histolytica. J Infect Dis.173(1):226-231.
28. Forde CB , Shi X, Li J, Roberts M.(1999) Bordetella bronchiseptica-mediated cytotoxicity to mactrophages is dependent on bvg-regulated factors, including pertactin. Infect. Immun. 67:5972-8.
29. Fischetti VA , Pancholi V, and Schneewind O. (1990) Conservation of a hexapeptide sequence in the anchor region of surface proteins from gram-positive cocci. Mol. Microbiol. 4:1603-5.
30. Gilbert RJ , Jimenez JL , Chen S, Tickle IJ , Rossjohn J, Parker M, Andrew PW, Saibil HR.(1999) Two structural transitions in membrane pore formation by pneumolysin, the pore-forming toxin of Streptococcus pneumoniae. Cell 97(5):647-655.
31. Glenting J, Wessels S. (2005) Ensuring safety of DNA vaccines. Microb Cell Fact. 4:26.
32. Gorczyca W, Gong J, Darzynkiewicz Z. (1993) Detection of DNA strand breaks in individual apoptotic cells by in situ terminal deoxynucleotidyl transferase and nick translation assays. Cancer Res. 53:1945-1951.
33. Griffith F.(1928) The significance of pneumococcal types. J Hyg. 1928;27:113-159.
34. Hammerschmidt S, Wolff S, Hocke A, Rosseau S, Muller E, Rohde M. (2005) Illustration of pneumococcal polysaccharide capsule during adherence and invasion of epitherial cells. Infect Immune. 73(8):4653-67.
35. Hava DL , Camilli A. (2002) Large-scale identification of serotype 4 Streptococcus pneumoniae virulence factors. Mol Microbiol. 45(5):1389-406.
36. Havarstein LS , Coomaraswamy G, Morrison DA. (1995) An unmodified heptadecapeptide pheromone induces competence for genetic transformation in Streptococcus pneumoniae . Proc Natl Acad Sci U S A 92(24):11140-11144.
37. Henrichsen J. (1995) Six newly recognized types of Streptococcus pneumoniae. J. Clin. Microbiol. 33:2759-62.
38. Hirst RA , Sikand KS , Rutman A, Mitchell TJ , Andrew PW , O'Callaghan C. (2000) Relative roles of pneumolysin and hydrogen peroxide from Streptococcus pneumoniaein inhibition of ependymal ciliary beat frequency. Infect Immun 68(3):1557-1562.
39. Jedrzejas MJ.(2001) Pneumococcal virulence factors : structure and function. Microbiol. Mol. Biol. Rev. 65:187-207.
40. Kelly SJ , Jedrzejas MJ. (2000) Structure and molecular mechanism of a functional form of pneumolysin: a cholesterol-dependent cytolysin from Streptococcus pneumoniae. J Struct Biol 132(1):72-81.
41. Kelz MB , Dent GW , Therianos S, Mclntosh TK , Coleman PD , Eberwine JH. (2002) Single-cell antisense RNA amplification and microarray as a tool for studying neurological degeneration and restoration. Sci.Aging knowledge Environ. 9(1):re1
42. Kim SN , Kim SW , Pyo SN , Rhee DK. (2001) Molecular cloning, and regulation of groESL operon in Streptococcus pneumoniae . Molecules and Cells 11(3):1-9.
43. Kim SW , Kim SN , Kim YH , Pyo SN , Rhee DK. (1998) Molecular cloning, expression, and characterization of dnaK in Streptococcus pneumoniae. FEMS Microbiol. Lett. 161: 217-224.
44. Kim , J. O., and J. N. Weiser . (1998) Association of intrastrain phase variation in quantity of capsular polysaccharide and teichoic acid with the virulence of Streptococcus pneumoniae. J. Infect. Dis. 177:368-377.
　
45. Kim SW , Pyo SN , and Rhee DK. (2000) Characterization of dnaK mutants in Streptococcus pneumoniae. J. Biochem. Mol. Biol. 33(1): 75-81.
46. Klein JO. (2000) The burden of otitis media. Vaccine 19(Suppl 1): S2-S8.
47. Kumar S, Tripathi LM , Sagar P. (1992) Oxido-reductive functions of Entamoeba
histolyticain relation to virulence. Ann Trop Med Parasitol. 86(3):239-248.
48. Kwon HY , Kim SW , Choi MH , Ogunniyi AD , Paton JC , Park SH , Pyo SN , and Rhee DK. (2003) Modulation of Virulence Gene Expression by Heat Shock, ClpL and ClpP in Streptococcus pneumoniae . Infect Immun, 71(7):3757-65.
49. Kwon HY , Kim SN , Pyo SN , and Rhee DK. (2005) Ca2+ - dependent expression of the CIRCE regulon in Streptococcus pneumoniae . Mol. Microbiol. 55(2): 456-468.
50. Kwon HY , Ogunniyi AD , Choi MH , Pyo SN , Rhee DK , and Paton JC. (2004) The ClpP Protease of Streptococcus pneumoniae Modulates Virulence Gene Expression and Protects Against Fatal Pneumococcal Challenge.Infect. Immun. 72 (10): 5646-5653.
51. Lau PC , Sung CK , Lee JH , Morrison DA , Cvitkovitch DG . (2002) PCR ligation mutagenesis in transformable streptococci: application and efficiency. J Microbiol Methods. 49(2):193-205.
52. Lee DG , Hahm KS , Park YK , Kim HY , Lee WT , Lim SC , Seo YK , Choi CH . (2005) Functional and structural characteristics of anticancer peptide pep27 analogues. Cancer cell international.5:21.
53. Lee NY , Song JH , Kim S, Peck KR , Ahn KM , Lee SI , Yang Y, Li J, Chongthaleong A, Tiengrim S, Aswapokee N, Lin TY, Wu JL,Chiu CH, Lalitha MK, Thomas K, Cherian T, Perera J, Yee TT, Jamal F, Warsa UC, Van PH, Carlos CC, Shibl AM, Jacobs MR, Appelbaum PC.(2001) Carriage of antibiotic-resistant pneumococci among Asian children: a multinational surveillance by the Asian Network for Surveillance of Resistant Pathogens (ANSORP). Clin Infect Dis 32(10):1463-1469.
54. Lesinski GB , Smithson SL , Srivastava N, Chen D, Widera G, Westerink MA. (2001) A DNA vaccine encoding a peptide mimic of Streptococcus pneumoniae serotype 4 capsular polysaccharide induces specific anti-carbohydrate antibodies in Balb/c mice. Vaccine. 19(13-14):1717-26.
55. Lesinski GB , Westerink MA. (2001) Vaccines against polysaccharide antigens. Curr Drug Targets Infect Disord. 1(3):325-34.
56. Lipton SA , Nicotera P. (1998) Calcium, free radicals and excitotoxins in neuronal apoptosis. Cell Calcium. 23(2-3):165-171.
57. Lock RA , Zhang QY , Berry AM , Paton JC.(1996) Sequence variation in the Streptococcus pneumoniaepneumolysin gene affecting haemolytic activity and electrophoretic mobility of the toxin. Microb. Pathog. 21(2):71-83.
58. Long JP , Tong HH , Shannon PA , DeMaria TF. (2003) Differential expression of cytokine genes and inducible nitric oxide synthase induced by opacity phenotype variants of Streptococcus pneumoniae during acute otitis media in the rat. Infect Immun. 71(10):5531-40.
59. Lyer R, Camilli A.(2007) Sucrose metabolism contributes to in vivo fitness of streotococcus pneumoniae . Mol.Microbiology 66(1):1-13.
60. Martin SJ , Reutelingsperger CP , McGahon AJ , Rader JA , van Schie RC , LaFace DM, Green DR. (1995) Early redistribution of plasma membrane phosphatidylserine is a general feature of apoptosis regardless of the initiating stimulus: inhibition by overexpression of Bcl-2 and Abl. J Exp Med. 182(5):1545-1556.
61. Matysiak - Budnik T, Karkkainen P, Methuen T, Roine RP , Salaspuro M.(1995) Inhibition of gastric cell proliferation by acetaldehyde. J Pathol 1995 Nov;177(3):317-322.
62. Ma Z, Zhang JR . (2007) RR06 activates transcription of spr1996and cbpA in Streptococcus pneumoniae. J.Bacteriol. 189(6):2497-509.
63. Mauel , J. (1983) Mechanisms of intracellular microbicide. Bull. Eur. Physiopathol. Respir. 19: 115-22.
64. Michael JH . (2002) DNA microarray technology : Devices, Systems, and Applications. Annu,Rev.Biomed.Eng. 4:129-53.
65. Mitchell TJ. (2000) Virulence factors and the pathogenesis of disease caused by Streptococcus pneumoniae . Res Microbiol 151(6):413-419.
66. Morona JK , Morona R, Miller DC , Paton JC. (2003) Mutational analysis of the carboxy- terminal (YGX)4 repeat domain of CpsD, an autophosphorylating tyrosine kinase required for capsule biosynthesis in Streptococcus pneumoniae. J Bacteriol. 185(10):3009-19.
67. Murdoch C, Read RC , Zhang Q, Finn A. (2002) Choline-binding protein A of Streptococcus pneumoniae elicits chemokine production and expression of intercellular adhesion molecule 1 (CD54) by human alveolar epithelial cells. J Infect Dis. 186(9):1253-1260.
68. Nilius M, Malfertheiner P. (1996) Helicobacter pylori enzymes. Aliment Pharmacol Ther. 10 Suppl 1:65-71.
69. Novak R, Charpentier E, Braun J.S., Tuomanen E., (2000) Signal transduction by a death signal peptide: uncovering the mechanism of bacterial killing by penicillin, Mol. Cell 5: 49-57.
70. Obaro SK . (2001) Confronting the pneumococcus: a target shift or bullet change. Vaccine 19(9-10):1211-1217.
71. Oggioni MR , Trappetli C, Kadioglu A, Cassone M, Iannelli F, Ricci S, Andrew PW, Poss G. (2006) Switch from planktonic to sessile life: a major event in pneumococcal pathogenesis. Mol.Microbiol. 61(5):1196-210.
72. Ogunniyi AD , Folland RL , Briles DE , Hollingshead SK , Paton JC. (2000) Immunization of mice with combinations of pneumococcal virulence proteins elicits enhanced protection against challenge with Streptococcus pneumoniae . Infect Immun 68(5):3028-33.
73. Orihuela CJ , Radin JN , Sublett JE , Gao G, Kaushal D, Tuomanen EI .(2004) Microarray analysis of pneumococcal gene expression during invasive disease. Infect Immun. 72(10):5582-96.
74. Overweg K, Pericone CD , Verhoef GG , Weiser JN , Meiring HD , De Jong AP , De Groot R, Hermans PW. (2000) Differential protein expression in phenotypic variants of Streptococcus pneumoniae. Infect Immun. 68(8):4604-10.
75. Pallares R, Linares J, Vadillo M, Cabellos C, Manresa F, Viladrich PF , Martin R, Gudiol F. (1995) Resistance to penicillin and cephalosporin and mortality from severe pneumococcal pneumonia in Barcelona, Spain. N Engl J Med 333(8):474-480.
76. Palliser D, Chowdhury D, Wang QY , Lee SJ , Bronson RT , Knipe DM , Lieberman J. (2006) An siRNA-based microbicide protects mice from lethal herpes simplex virus 2 infection. Nature. 439(7072):89-94.
77. Paton JC , Andrew PW , Boulnois GJ , Mitchell TJ . (1993) Molecular analysis of the pathogenicity of Streptococcus pneumoniae: the role of pneumococcal proteins. Annu Rev Microbiol 47:89-115.
78. Paton JC , Berry AM , Lock RA , Hansman D, Manning PA. (1986) Cloning and expression in Escherichia coli of the Streptococcus pneumoniae gene encoding pneumolysin. Infect Immun 54(1):50-55.
79. Paton JC , Giammarinaro P.(2001) Genome-based analysis of pneumococcal virulence factors: the quest for novel vaccine antigens and drug targets. Trends Microbiol 9(11):515-518.
80. Polissi A, Pontiggia A, Feger G, Altieri M, Mottl H, Ferrari L, Simon D. (1998) Large-scale identification of virulence genes from Streptococcus pneumoniae. Infect. Immun., 66:5620-5629.
81. Pitrak DL , Tsai HC , Mullane KM , Sutton SH , Stevens P.(1996) Accelerated neutrophil apoptosis in the acquired immunodeficiency syndrome. J Clin Invest. 98(12):2714-2719.
82. Raynaud C, Etienne G, Peyron P, Laneelle MA , Daffe M.(1998) Extracellular enzyme activities potentially involved in the pathogenicity of Mycobacterium tuberculosis. Microbiology. 144(Pt 2):577-587.
83. Reid MF , Fewson CA. (1994) Molecular charaterization of microbial Alcohol dehydrogenase. Crit. Rev. Microbiol. 20(1);13-56
84. Ren , B, Szalai AJ ., Thomas O, Hollingshead SK ., Briles DE .(2003). Both family 1 and family 2 PspA proteins can inhibit complement deposition and confer virulence to a capsular serotype 3 strain of Streptococcus pneumoniae. Infect. Immune. 71, 75-85.
85. Rosenow C, Ryan P, Weiser JN , Johnson S, Fontan P, Ortqvist A, Masure HR . (1997)　 Contribution of novel choline-binding proteins to adherence, colonization and immunogenicity of Streptococcus pneumoniae. Mol Microbiol 25(5):819-829.
86. Rossjohn J, Gilbert RJ , Crane D, Morgan PJ , Mitchell TJ , Rowe AJ , Andrew PW, Paton JC, Tweten RK, Parker MW. (1998) The molecular mechanism of pneumolysin, a virulence factor from Streptococcus pneumoniae. J Mol Biol 284(2):449-461.
87. Rubins JB , Duane PG , Charboneau D, Janoff EN. (1992) Toxicity of pneumolysin to pulmonary endothelial cells in vitro. Infect Immun 60(5):1740-1746.
88. Sandgren A, Albiger B, Orihuela CJ , Tuomanen E, Normark S, Henriques-Normark B. (2005) Virulence in mice of pneumococcal clonal types with known invasive disease potential in humans. J Infect Dis. 192(5):791-800.
89. Sato K, Quartey MK , Liebeler CL , Le CT , Giebink GS. (1996) Roles of autolysin and pneumolysin in middle ear inflammation caused by a type 3 Streptococcus pneumoniae strain in the chinchilla otitis media model. Infect Immun 64(4):1140-1145.
90. Satre MA , Zgombic Knight M, Duester G. (1994) The complete structure of human class IV alcohol dehydrogenase (retinol dehydrogenase) determined from the ADH7 gene. J. Biol. Chem. 269(22):15606-15612.
91. Shinha RK , Khuller GK .(1997) The protective efficacy of a liposomal encapsulated 30 kDa secretory protein of Mycobacterium tuberculosis H37Ra against tuberculosis in mice. Immunol. Cell. Biol. 75: 461-466.
92. Smirnov IM , Bailey K, Flower CH , Garriques NW , Wwsselius LJ . (1999) Effects of TNF-α　 and IL-1 beta on iron metabolism by A549 cells and influence on cytotoxicity. AM J.Physiol. 277(2 pt 1):257-63.
93. Song JH , Ko KS , Lee JY , Back JY , Oh WS , Yoon HS , Jeong JY , Chun JS . (2005) Identification of essential genes in Streptococcus pneumoniae by allelic replacement mutagenesis. Mol.Cells. 19(3):365-374.
94. Standish AJ , Stroeher UV , Paton JC . (2007) The pneumococcal two-component signal transduction system RR/HK06 regulates CbpA & PspA by two distict mechanism. J.Bacteriol.189(15):5591-5600.
95. Talbot UM , Paton AW , Paton JC. (1996) Uptake of Streptococcus pneumoniae by respiratory epithelial cells. Infect Immun. 64(9):3772-3777.
96. Throup JP , Koretke KK , Bryant AP , Ingraham KA , Chalker AF , Ge Y, Marra A, Wallis NG, Brown JR, Holmes DJ, Rosenberg M, Burnham MK. (2000) A genomic analysis of two-component signal transduction in Streptococcus pneumoniae. Mol Microbiol 35:566-576.
97. Tuomanen E. (1993) Breaching the blood-brain barrier. Sci Am. 268(2):80-84.
98. Tuomanen E. (1999) Molecular and cellular biology of pneumococcal infection. Curr Opin Microbiol 2(1):35-39.
99. Tuomanen , E.I., Austrian , R., Masure , H.R.(1995) Pathogenesis of pneumococcal infection. N. Engl. J. Med. 332, 1280-4.
*100. Weiser , J. N., Z. Markiewicz , E. I. Tuomanen , and J. H. Wani . 1996. Relationship between phase variation in colony morphology, intrastrain variation in cell wall physiology, and nasopharyngeal colonization by Streptococcus pneumoniae. Infect. Immun. 64:2240-2245.
101. Winter AJ , Comis SD , Osborne MP , Tarlow MJ , Stephen J, Andrew PW , Hill J, Mitchell TJ.(1997) A role for pneumolysin but not neuraminidase in the hearing loss and cochlear damage induced by experimental pneumococcal meningitis in guinea pigs. Infect Immun 65(11): 4411-4418.
102. Wizemann TM , Heinrichs JH , Adamou JE , Erwin AL , Kunsch C, Choi GH , Barash SC, Rosen CA, Masure HR, Tuomanen E, Gayle A, Brewah YA, Walsh W, Barren P, Lathigra R, Hanson M, Langermann S, Johnson S, Koenig S. (2001) Use of a whole genome approach to identify vaccine molecules affording protection against Streptococcus pneumoniaeinfection. Infect Immun 69:1593-1598.
103. World Health Organization . (2001) Report of a meeting on priorities for pneumococcal and Haemophilus influenzae type B vaccine development and introduction. WHO/V&B/01.14.
104. Wu HY , Virolainen A, Mathews B, King J, Russell MW ., Briles DE .(1997) Establishment of a Streptococcus pneumoniaenasopharyngeal colonization model in adult mice. Microb. Pathog. 23, 127-37.
105. Yanagihara K, Tashiro M, Fukuda Y, Ohno H, Higashiyama Y, Miyazaki Y, Hirakata Y, Tomono K, Mizuta Y, Tsukamoto K, Kohno S. (2006) Effects of short interfering RNA against methicillin-resistant Staphylococcus aureus coagulase in vitro and in vivo. J Antimicrob Chemother. 57(1):122-6.
106. Yasunami M, Chen CS , Yoshida A. (1991) A human alcohol dehydrogenase gene (ADH6) encoding an additional class of isozyme. Proc. Natl. Acad. Sci. USA. 88(17):7610-7614.
107. Zhang JR , Mostov KE , Lamm ME , Nanno M, Shimida S, Ohwaki M, Tuomanen E. (2000)The polymeric immunoglobulin receptor translocates pneumococci across human nasopharyngeal epithelial cells. Cell. 102, 827-37.
108. Aricha B, Fishov I, Cohen Z, Sikron N, Pesakhov S, Khozin - Goldberg I, Dagan R, Porat N. 2004. Differences in membrane fluidity and fatty acid composition between phenotypic variants of Streptococcus pneumoniae. J Bacteriol. 186(14):4638-44.
도 1은 본 발명에 따른 삽입 결실 돌연변이의 개략도이다.
도 2는D39와 그것의 돌연변이체의 생장을 나타내는 도면이다.
도 3돌연변이체의 페니실린에 의해 유도된 자가분해의 그래프이다.
도 4는 돌연변이체의 세포탁심(Cefotaxime)에 의해 유도된 자가분해의 그래프이다.
도 5은 돌연변이체의 DOC에 의해 유도된 자가분해의 그래프이다.
도 6은 DOC처리 후, 돌연변이체의 생존율을 나타낸 그래프이다.
도7은 돌연변이체의 적혈구 용혈능을 측정한 결과를 나타낸 그래프이다.
도 8는　A549세포에 대한 돌연변이체의 세포독성을 MTT 어세이로 측정한 결과를 나타낸 그래프이다.
도 9은 복강 내 감염 후, 돌연변이체의 약독화 측정 결과를 나타낸 도면이다.
도 10은 인후 감염 후, 돌연변이체의 약독화 측정 결과를 나타낸 도면이다.
도 11는 전신 시험감염 후, 생쥐의 생존시간을 측정한 그래프이다.
도 12은 인후 시험감염 후, 생쥐의 생존시간을 측정한 그래프이다.
<110> SUNGKYUNKWAN UNIVERSITY Foundation for Corporate Collaboration <120> Attenuated vaccine and diagnostic method thereof for treating Streptococcus pneumonia using mutants including mutated spr1709 gene <160> 7 <170> KopatentIn 1.71 <210> 1 <211> 1565 <212> DNA <213> Streptococcus pneumoniae <400> 1 ttgcgccagt tgactacgac gaagtggact cagcttttgg tgattgggag gatgttaagc 60 gtttaggtga gagatattat cttatgtttg attttatgat taatcatatt tctcgtcaat 120 ccaagtatta taaggactat caagaaaaac atgaagccag tgaatttaaa gctctctttt 180 taaactggga taagttttgg ccagaaaacc gtccgacaca gtctgatgta gatttaattt 240 acaagcgtaa ggatcgtgca ccaaagcaag agattgtgtt tgaagatggt tcagtggaac 300 atttgtggaa tacctttggt gaggagcaga ttgatcttga tgtgaccaaa gaagtaacta 360 tggaatttat ccgtaagacc attcagcact tggctagtcg gcagcgactc aagaattatt 420 tcctcccgtt aaataataga taactattaa aaatagacaa tacttgctca taagtaacgg 480 tacttaaatt gtttactttg gcgtgtttca ttgcttgatg aaactgattt ttagtaaaca 540 gttgacgata ttctcgattg acccattttg aaacaaagta cgtatatagc ttccaatatt 600 tacctggaac atctgtggta tggcgggtaa gttttattaa gacactgttt acttgtggtt 660 taggatgaaa gcattccgct ggcagcttaa gcaattgctg aatcgagact tgagtgtgca 720 agagcaaccc tagtgttcgg tgaatatcca aggtacgctt gtagaatcct tcttcaacaa 780 tcagatagat gtcagacgca tggctttcaa aaaccacttt tttaataatt tgtgtgctta 840 aatggtaagg aatactccca acaattttat acctctgttt gttagggaat tgaaactgta 900 gaatatcttg gtgaattaaa gtgacacgag tattcagttt taatttttct gacgataagt 960 tgaatagatg actgtctaat tcaatagacg ttacctgttt acttatttta gccagtttcg 1020 tcgttaaatg ccctttacct gttccaattt cgtaaacggt atcggtttct tttaaattca 1080 attgttttat tatttggttg agtacttttt cactcgttaa aaagttttga gaatatttta 1140 tatttttgtt catgtaatca ctccttctta attacaaatt tttagcgtct aatttaactt 1200 caattcctat tatacaaaat tttaagatac aaatcaaaca aattttgggc ccagctacta 1260 ttcagcgctt ggagatgatg atgtcaagta ttttctcgct cgtctaattc aagcttttgc 1320 cccaggtatt cctcaggttt actatgtggg tctattagca ggcaagaatg acttgaaatt 1380 attagaagaa actaaagaag gtcgaaatat taatcgtcat tactatagca acgaggaaat 1440 agcaaaagaa gtgcaacgac ctgttgtgaa ggcccttctc aatctatttt ctttccgtaa 1500 ccgttcagaa gcctttgatc tagaggggac tactgagata gagacaccaa cagctcacag 1560 cattg 1565 <210> 2 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> The forward primer erm cassette <400> 2 agtcggcagc gactcataga at 22 <210> 3 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> The reverse primer for erm cassette <400> 3 ccgggcccaa aatttgtttg at 22 <210> 4 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> The forward primer for left arm <400> 4 ttgcgccagt tgactacga 19 <210> 5 <211> 44 <212> DNA <213> Artificial Sequence <220> <223> The reverse primer for left arm <400> 5 attctatgag tcgctgccga ctgccaagtg ctgaatggtc ttac 44 <210> 6 <211> 42 <212> DNA <213> Artificial Sequence <220> <223> The forward primer for right arm <400> 6 atcaaacaaa ttttggcccc ggcctactat tcagcgcttg ga 42 <210> 7 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> The reverse primer for right arm <400> 7 caatgctgtg agctgttggt gtc 23

Claims (17)

  1. spr1709유전자의 기능이 손상된 폐렴구균 돌연변이체.
  2. 제1항에 있어서, 결실되는 부위는 폐렴구균 전체 유전자의 1681098번부터 1682261번까지임을 특징으로 하는 폐렴구균 돌연변이체
  3. 서열번호 1로 표시되는 spr1709유전자의 기능을 손상시키는 폐렴구균 돌연변이 유발용 DNA.
  4. 제3항의 돌연변이 유발용 DNA를 제조하기 위한 서열번호 2 내지 7로 표시되는 프라이머 세트.
  5. 제 3항의 DNA가 도입되어 형질전환된 폐렴구균 돌연변이체 .
  6. 제1항, 제2항 및 제 5항 중 어느 한 항에 있어서, 폐렴구균은 D39임을 특징으로 하는 돌연변이체.
  7. 제 1항, 제2항, 및 제 5항 중 어느 하나의 항의 돌연변이체를 유효성분으로 하고, 약제학적으로 허용되는 담체를 포함하는 폐렴 구균 치료용 백신 조성물.
  8. 제 7항에 있어서, 복강을 통하여 백신화시키는 것을 특징으로 하는 백신 조성물.
  9. 제 7항에 있어서, 인후 점막를 통해 점막에 투여하는 것을 특징으로 하는 백신 조성물.
  10. 제9항에 있어서, 에어로졸 또는 점적 전달 시스템의 형태로투여하는 것을 특징으로 하는 백신 조성물.
  11. 제7항에 있어서, 사람 또는 동물을 폐렴구균 감염증에 대해 면역화시키기 위한 것임을 특징으로 하는 백신 조성물.
  12. 제11항에 있어서, 폐렴구균 감염증이 세균성 폐렴, 중이염, 균혈증 또는 수막염임을 특징으로 하는 백신 조성물.
  13. spr1709 유전자의 단편, 이들로부터 유래되는 펩타이드 및 펩타이드에 대한 항체로 구성되는 군에서 선택되는 어느 하나를 포함하는, 폐렴구균 진단용 키트.
  14. 폐렴구균 감염시 발현량이 증가하는 것이 특징인, 폐렴구균 감염 진단용 바 이오 마커 spr1709 유전자.
  15. 사람 또는 동물로부터 채취한 세포에 대하여 spr1709 유전자 의 발현 여부를 확인하여 폐렴구균 감염 여부를 진단하는 방법.
  16. 제15항에 있어서, 웨스턴 블롯, RT-PCR 및 실시간 PCT(real PCR)방법으로 단백질 또는 유전자의 발현 여부를 진단하는 방법.
  17. 폐렴 구균에 대한 백신으로 사용하기 위한 제 14항의 유전자로 코딩되어 있는 펩타이드.
KR1020080093229A 2008-09-23 2008-09-23 ｓｐｒ1709 유전자가 손상된 변이주를 이용한 폐렴구균을 치료하기 위한 약독화 백신 및 이의 진단방법 KR20100034206A (ko)

Priority Applications (1)

Application Number Priority Date Filing Date Title
KR1020080093229A KR20100034206A (ko) 2008-09-23 2008-09-23 ｓｐｒ1709 유전자가 손상된 변이주를 이용한 폐렴구균을 치료하기 위한 약독화 백신 및 이의 진단방법

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
KR1020080093229A KR20100034206A (ko) 2008-09-23 2008-09-23 ｓｐｒ1709 유전자가 손상된 변이주를 이용한 폐렴구균을 치료하기 위한 약독화 백신 및 이의 진단방법

Publications (1)

Publication Number Publication Date
KR20100034206A true KR20100034206A (ko) 2010-04-01

Family

ID=42212391

Family Applications (1)

Application Number Title Priority Date Filing Date
KR1020080093229A KR20100034206A (ko) 2008-09-23 2008-09-23 ｓｐｒ1709 유전자가 손상된 변이주를 이용한 폐렴구균을 치료하기 위한 약독화 백신 및 이의 진단방법

Country Status (1)

Country Link
KR (1) KR20100034206A (ko)

Similar Documents

Publication Publication Date Title
Lynch et al. Escalation of antimicrobial resistance among Streptococcus pneumoniae: implications for therapy
Blasi et al. Understanding the burden of pneumococcal disease in adults
Proctor Is there a future for a Staphylococcus aureus vaccine?
Feldman et al. Epidemiology, virulence factors and management of the pneumococcus
US20210170011A1 (en) Streptococcal vaccine
EP2665490B1 (en) Vaccines and compositions against streptococcus pneumoniae
ES2562979T3 (es) Tratamiento de infecciones estreptocócicas
Keller et al. Surface proteins and pneumolysin of encapsulated and nonencapsulated Streptococcus pneumoniae mediate virulence in a chinchilla model of otitis media
US20210361757A1 (en) Streptococcal vaccine formulations and uses thereof
Wu et al. Mucosal and systemic immunization with a novel attenuated pneumococcal vaccine candidate confer serotype independent protection against Streptococcus pneumoniae in mice
Austrian Pneumococcal infections
KR101252911B1 (ko) ｐｅｐ27 유전자 돌연변이를 포함하는 약독화된 폐렴구균 균주 및 이의 용도
KR102040665B1 (ko) 약독화된 폐렴구균 균주를 포함하는 약제학적 조성물 및 이의 용도
KR20100034201A (ko) ｓｐｒ0526, ｓｐｒ0527, 및 ｓｐｒ0528 유전자가 손상된 변이주를 이용한 폐렴구균을 치료하기 위한 약독화 백신 및이의 진단 방법
US20210361758A1 (en) Streptococcal vaccines and methods for use
KR20100034206A (ko) ｓｐｒ1709 유전자가 손상된 변이주를 이용한 폐렴구균을 치료하기 위한 약독화 백신 및 이의 진단방법
RU2701733C1 (ru) Живая вакцина на основе штамма пробиотиков ENTEROCOCCUS FAECIUM L3 для профилактики инфекции, вызванной STREPTOCOCCUS PNEUMONIE
Verhaegen et al. Antibiotic susceptibility and serotype distribution of 240 Streptococcus pneumoniae causing meningitis in Belgium 1997-2000
Cron et al. Two DHH subfamily 1 proteins contribute to pneumococcal virulence and confer protection against pneumococcal disease
Weiss-Salz et al. Asymptomatic carriage of respiratory pathogens:“The wolf shall dwell with the lamb… and a little child shall lead them”(Isaiah 11: 6)
Tarragó et al. Effects of amoxicillin subinhibitory concentrations on the cross-protection developed by pneumococcal antibodies in mouse sepsis caused by an amoxicillin-resistant serotype 6B Streptococcus pneumoniae strain
Iovino et al. Experimental Model for Studies of Pneumococcal Colonization in Older Adults
Balakrishnan Streptococcus pneumoniae
Zhi Investigation in to the functional role of Rgg Quorum Sensing Systems in Streptococcus pneumoniae
KR20190110254A (ko) 형질전환 불능 폐렴구균 변이주 및 이를 포함하는 약제학적 조성물

Legal Events

Date Code Title Description
A201 Request for examination
E902 Notification of reason for refusal
E601 Decision to refuse application