KR20090123113A - Dna marker for discrimination of polygonum multiflorum thunberg, cynanchum wilfordii max. hemsl. and cynacum auriculatum royle ex wight - Google Patents

Abstract

PURPOSE: A primer for determining species of Polygonum multiflorum Thunberg, Cynanchum silfordii Max. and Cyanchum auriculatum is provided to prevent misuse and counterfeit product. CONSTITUTION: A polynucleotide for determining Polygonum multiflorum Thunberg comprises gene sequence of sequence number 23 and 24. A polynucleotide for determining Cynanchum wilfordii Max. Hemsl. and Cynacum auriculatum Royle ex Wight has gene sequence of the sequence numbers 22 and 25. A method for determining species of Polygonum multiflorum Thunberg, Cynanchum silfordii Max. and Cyanchum auriculatum comprises: a step of extracting DNA from a sample; a step of performing PCR with the DNA using the primer; and a step of isolating PCR product through electrophoresis then confirming PCR product.

Description

DNA marker for discrimination of Polygonum multiflorum Thunberg, Cynanchum wilfordii Max. Hemsl. and Cynacum auriculatum Royle ex Wight}

The present invention is the sewage ( Polygonum) multiflorum Thunberg, Cynanchum wilfordii Max. Hemsl.) And Cynacum Auriculatum Royle ex Wight) relates to a genetic marker for the identification of varieties.

Many herbal medicines that are produced and distributed in Korea are often mixed or misused due to their inaccurate origin or similar names. In addition, the countries that use herbal medicines such as Korea, China, and Japan define the origin of medicinal plants differently, and Korea, which relies on imports for more than 80%, is directly exposed to such misuse and misuse. Traditionally, the sensory, physicochemical, and cytological and physiological tests from the morphological point of view are used to distinguish the origins of mixed and misused herbal medicines, but it is difficult to secure a certain quality because herbal medicines are natural products. . This is because the variation in composition between each individual is severe and shows a big difference depending on the breeding method, harvesting time, growth environment, and the site of the medicine. Recently, one of the most controversial medicinal herbs for mixed use and misuse related to origins in the Chinese herbal medicine distribution market is sewage, white squid and bileaf pippie.

Hasuo defines a tuber of Polygonum multiflorum Thunberg, a perennial herb of the Polygonaceae, (Department of Herbology, College of Medicine, National Institute of Oriental Medicine, Seoul, Younglim Publishing Co., 1991, 583-584), Baeksuo Cynanchum of the Asclepiadaceae wilfordii Max. Hemsl.) (Shin Min-kyo, Clinical Herbology, Seoul, Younglim Publishing Co., 1986, 218-221). But in China, Cynacum auriculatum Royle ex Wight and Cynanchum It is recorded that the root of bungei Decne) is used as white squid and the mockery is used as another medicine because it is called oxen (戴新民, 中國 藥材 學, 臺北, 啓 業 書局, 1974, 515-517). At present, the domestic herbal medicine distribution market treats sewage as red sewage (red squid) and white sewage (white shou) and treats them as the same. Especially, in the case of bai shui, it is wrongly known as an improved species of white shou imported from China. A totally different plant, not listed in the herb standard, is produced and distributed in Baeksuo. Sewage, also known as Red Sewage, is reddish brown and is easily distinguished from white white Sewage (White Sioux), which has a starfish shape when intercepted. It is very difficult to distinguish with the naked eye. The distinction between the sewage, baeksuo and bileaf shelter has not been reported yet, and Song Kyung Song et al. Studied the external and internal forms of sewage and baeksuo by using a magnifying glass, a stylus, and an optical microscope. KS et al . , Kor . J. Herbology 19: 55-66, 2004). However, no distinction has been reported between Baeksuo and Lee Yeoppi, which is a bigger problem in production distribution.

The development of differentiation markers of medicinal plants or herbal medicines mainly involves the discrimination of morphological characteristics or the distinction between two species (Park CG et. al . , Korean J. Medicinal Crop Sci . 15: 1-5, 2007), or research to develop genetic markers for identifying specific varieties or products among various varieties (Wang J et. al . , Planta Med . 67: 781-783, 2001). The development of these gene discrimination markers is mainly based on sequence comparison of specific regions such as internal transcribed spacers (ITS) or polymorphic analysis of whole genomic genes such as random amplification of polymorphic DNA (RAPD). characterized amplified region. The RAPD method is the most commonly used method because of the ease and simplicity of analysis at various genome levels, but has a disadvantage of poor reproducibility according to analysis conditions (Bang KH et. al . , Koidz . Korean J. Medicinal Crop Sci . 11: 268-273, 2003). Thus, in order to compensate for the above disadvantages, SCAR primer pairs based on species-specific nucleotide sequences are analyzed by analyzing nucleotide sequences of specific amplification products obtained through RAPD analysis (Paran I & Michelomore RW, Theor . Appl . Genet . 85: 985-993, 1993).

Accordingly, the present inventors discriminated SCAR-derived multi-variate simultaneous genes distinguishable between sewage and white squid, as well as bisulfite liposomes, as well as sessau and white sioux through sequencing of RAPD-specific amplified DNA bands of sesame, baekshou and bileafy pips. The present invention has been completed by developing a marker and confirming that the genetic discrimination marker can be usefully used for preventing the misuse, misuse of sewage errors and the circulation of goods.

The object of the present invention is sewage (Polygonum multiflorum Thunberg), Baeksuo (Cynanchum wilfordii Max. Hemsl.) Or bilobuleCynacum auriculatum It is to provide a polynucleotide for breed discrimination of Royle ex Wight).

Another object of the present invention is to provide a pair of primers selected from the polynucleotide for discriminating the sewage, white sorghum and bilobus pelvis varieties, and capable of amplifying the polynucleotide.

It is another object of the present invention to provide a kit for determining sewage, white squid and bilobus pheiso variety comprising the primer pair.

Another object of the present invention is to provide a method for discriminating sewage, white squid and bilobus phepiform using the primer pairs.

In order to achieve the above object, the present invention is sewage ( Polygonum multiflorum Thunberg, Cynanchum wilfordii Max. Hemsl.) And Cynacum auriculatum Royle ex Wight.

In addition, the present invention is a sewage, Baeksuo and bilobules varieties capable of amplifying the polynucleotide consisting of 15 to 50 consecutive nucleotides, selected from the polynucleotides for determining the sewage, Baeksuo and bilopeus cultivars Provides a pair of discriminating primers.

In addition, the present invention provides a kit for determining the sewage, baeksuo and bilobus pippe varieties comprising the primer pair for determining the sewage, baeksuo and bilobite pips.

In addition, the present invention provides a method for determining sewage, white squid and bileaf pippe varieties by using the primers for determining the sewage, white squid and bilobite pips.

Hereinafter, the term used by this invention is demonstrated.

'Multiplex PCR' is a method of amplifying a plurality of target genes in the same reaction solution by using a plurality of primer pairs simultaneously. In this case, the interaction of multiple primers should be calculated to create a primer combination in which the primers do not form a dimer. In addition, multiple PCR product sizes should be sufficiently distinguishable in agarose gels.

Hereinafter, the present invention will be described in detail.

The present invention is a sewage ( Polygonum multiflorum Thunberg), Baeksuo ( Cynanchum wilfordii Max. Hemsl.) Or bileafy pips ( Cynacum Auriculatum Royle ex Wight) provides a polynucleotide for discriminating a variety.

Specifically, the present invention provides polynucleotides for sewage variety discrimination described in SEQ ID NOs: 23 and 24.

In addition, the present invention provides a polynucleotide for discriminating Baeksuo and bilobules of cultivars described in SEQ ID NOs: 22 and 25.

In addition, the present invention provides a polynucleotide for discriminating the bilobal papilloma variety described in SEQ ID NO: 21.

In the embodiment of the present invention using the RAPD primers of SEQ ID NO: 1 to 20 using the nucleotide sequence of the species-specific gene (see Fig. 1) of SEQ ID NO: 21 to 25 specifically present in sewage, Baeksuo and bilobule After obtaining through the analysis method, SCAR primer pairs of SEQ ID NOS: 26 to 37 of the present invention were prepared in the nucleotide sequence except for the region of the RAPD primer sequence. The SCAR primer pairs are designed to amplify species-specific genes. In fact, PCR of plant DNA of sewage, white squid and bilobule pelvis using the SCAR primer pairs yields a single amplification product of expected size. It was confirmed that (see FIGS. 2 to 6). Specifically, in the case of S and AS SCAR primer pairs (see FIG. 2A) prepared from about 450 bp bilobal piposomal specific amplification products (HA13-2; FIG. It was confirmed that to generate an amplification product of about 300 bp size (see Fig. 2b), but S S produced from a bilobular liposomal specific amplification product (HA13-3; see Fig. 1a) of about 220 bp by OPA13 RAPD primer In the case of and reference to the AS SCAR primer pair (FIG. 3a), amplification products of 196 bp in size were found in Baeksuo and bilobal pelvis, except for sewage (see FIG. 3b). In addition, in the case of S and AS 1 or AS 2 SCAR primer pairs (see FIG. 6A) prepared from the bileafi pelvis specific amplification product (HC20-1; see FIG. 1D) of about 750 bp by OPC20 RAPD primer, Amplification products of 110 bp and 407 bp were found in common in Baeksuo and bilobal pelvis, except for FIGS. 6B and 6C. The above results indicate that Baeksuo and Lee Yeoppiso are plants belonging to the same genus, and because of their high similarity between genome gene sequences, their specificity is determined by the position of the designated primer pair. SCAR markers developed using HA13-3 and HC20-1, which are commonly amplified in Baeksuo and bileafy pips, are difficult to use as SCAR markers for the identification of Baeksuo or bilobite pips. It is thought to be a useful marker to distinguish it from sewage. In addition, when PCR was performed using the SCAR markers of HA13-3 and HC20-1 together with the HA13-2 marker which is specifically amplified bilobite pellucida, PCR could not only distinguish species from sewage, but also mixed with deceased leucine pelvis In this case, it can be identified.

In addition, the S and AS 1 or AS 2 SCAR primer pairs prepared from about 700 bp sized sewage-specific amplification product (HC14-2; see FIG. 1D) by OPC14 RAPD primer and about 400 bp size by OPC18 RAPD primer For the S and AS SCAR primer pairs produced from the sewage specific amplification product of HC18-1 (see FIG. 1C), 240 bp (see FIG. 4B), 460 bp (see FIG. 4C) and 340 bp (see FIG. 5B), respectively. By confirming the amplification of the DNA fragments specifically in the sewage accurately, it was confirmed that the three pairs of primer pairs could be utilized as primers suitable for the development of sewage screening SCAR markers.

As such, a pair of primers for discriminating a variety of the sequence selected from the sequences described in SEQ ID NOs: 21 to 25 of the present invention may be used in combination of two or more kinds depending on the variety to be discriminated. Can be.

Specifically, the species identification using species-specific SCAR primer pairs may not be effective at the time of incorporation of Baeksuo and bilopeus pelvis that are difficult to distinguish with the naked eye because they have the same shape and color. And multiplex PCR as a result of combining primer pairs as described below to determine whether a product is mixed, and confirms that the correct DNA fragment of the expected size is amplified, as well as discriminating three types of sewage errors simultaneously. It was confirmed that the incorporation of the bile lipophilic, which is a false product, was also a marker for discriminating multiple genes at the same time (see FIG. 7).

Primer set combinations:

1) A pair of primers for sewage-specific amplification of HC18-1 S and AS SCAR primers (340 bp), a pair of primers for amplification of bilobular liposomal specific amplifications of HC13-2 S and AS SCAR primers (300 bp) HC13-3 S and AS SCAR primer pair (196 bp) capable of distinguishing woopi;

2) A pair of primers for sewage-specific amplification of HC18-1 S and AS SCAR primers (340 bp), a pair of primers for amplification of bilobular liposomal specific amplifications of HC13-2 S and AS SCAR primers (300 bp) A pair of primers (407 bp) for Baeksuo and bilobal papilloma-specific amplification of HC20-1 S and AS 2 SCAR primers, which can distinguish woopi.

In addition, the present invention is a sewage, Baeksuo and bilobules varieties capable of amplifying the polynucleotide consisting of 15 to 50 consecutive nucleotides, selected from the polynucleotides for determining the sewage, Baeksuo and bilopeus cultivars Provide a primer pair for discrimination.

Specifically, there is provided a pair of primers for discriminating one or more sewage, white squid and bilobal pippe varieties selected from the group consisting of:

1) a pair of primers for determining the bilobular pippeta varieties capable of amplifying the polynucleotide consisting of 15 to 50 consecutive nucleotides selected from the sequences set forth in SEQ ID NO: 21;

2) a pair of primers for discriminating bileafi phipi and baeksuo varieties capable of amplifying the polynucleotide consisting of 15 to 50 consecutive nucleotides selected from the sequences set forth in SEQ ID NO: 22;

3) a pair of primers for sewage variety determination capable of amplifying said polynucleotide consisting of 15 to 50 contiguous nucleotides selected from the sequences set forth in SEQ ID NO: 23;

4) a pair of primers for sewage variety determination capable of amplifying the polynucleotide consisting of 15 to 50 consecutive nucleotides selected from the sequences set forth in SEQ ID NO: 24; And,

5) A pair of primers for discriminating bilobular phepipo and baeksuo varieties capable of amplifying the polynucleotide consisting of 15 to 50 consecutive nucleotides selected from the sequences set forth in SEQ ID NO: 25.

The primer pair of 1) is described in SEQ ID NO: 26 and SEQ ID NO: 27, the primer pair of 2) is described in SEQ ID NO: 28 and SEQ ID NO: 29 or SEQ ID NO: 30, the primer of 3) The pair is described by SEQ ID NO: 31 and SEQ ID NO: 32, wherein the primer pair of 4) is described by SEQ ID NO: 33 and SEQ ID NO: 34, and the primer pair of 5) is SEQ ID NO: 35 and SEQ ID NO: 36 or SEQ ID NO: 37 is described.

If the length of the primer pairs is too short, it is not specific to the desired sequence, and if it is too long, they may be mismatched, so it is preferable to have a size of 16 to 35 bp, more preferably 16 to 25 bp. However, it is not particularly limited thereto.

In the embodiment of the present invention using the RAPD primers of SEQ ID NO: 1 to 20 using the nucleotide sequence of the species-specific gene (see Fig. 1) of SEQ ID NO: 21 to 25 specifically present in sewage, Baeksuo and bilobule After obtaining through the analysis method, SCAR primer pairs of SEQ ID NOS: 26 to 37 of the present invention were prepared in the nucleotide sequence except for the region of the RAPD primer sequence. The SCAR primer pairs are designed to amplify species-specific genes. In fact, PCR of plant DNA of sewage, white squid and bilobule pelvis using the SCAR primer pairs produces a single amplification product of expected size. It was confirmed that (see FIGS. 2 to 6).

In addition, a pair of primers for discriminating a variety of the above sequence selected from the sequences described in SEQ ID NOs: 21 to 25 of the present invention may be used in combination of two or more kinds depending on the variety to be discriminated. (See FIG. 7).

In addition, the present invention provides a kit for determining sewage, baeksuo or bileaf pippe varieties comprising the primer pair for determining the sewage, baeksuo or bilobite pips.

Specifically, the present invention provides a kit for sewage variety determination comprising a primer pair capable of amplifying the polynucleotide consisting of 15 to 50 consecutive nucleotides selected from the sequences set forth in SEQ ID NOs: 23 and 24.

In addition, the present invention is a kit for discriminating Baeksuo and bilobus pips, comprising a primer pair capable of amplifying the polynucleotide consisting of 15 to 50 consecutive nucleotides selected from the sequences shown in SEQ ID NOs: 22 and 25. To provide.

In another aspect, the present invention provides a kit for determining the bilobular pippeta variety comprising a primer pair capable of amplifying the polynucleotide consisting of 15 to 50 consecutive nucleotides selected from the sequence set forth in SEQ ID NO: 21.

In addition, the present invention provides a kit for sewage, white squid and bilobus pippei varieties comprising both a primer pair for sewage varieties determination, a pair of primers for determining the species of baeksuo and bilobus pips, and a pair of primers for discriminating the species of foliar pips. do.

In a preferred embodiment of the present invention, the primer pairs were specifically amplified for DNA of sewage, white squid or bilobus pelvis, respectively (see FIGS. 2 to 6), and each or two or more were mixed according to the variety to be discriminated. It may be included. In the embodiment of the present invention, even when the primer pairs are used in combination, it is possible to discriminate three types of sewage errors simultaneously by confirming that the correct DNA fragment of the expected size is amplified, and also to discriminate the incorporation of the false bilobite piposo. It was confirmed that it is a marker for discriminating multiple genes simultaneously.

In addition, the kit may additionally include reagents for DNA extraction, amplification and product detection, and instructions therefor. For example, the kit may contain a reagent for DNA extraction, a deoxynucleotide, a thermostable polymerase suitable for a DNA amplification reaction, and a reagent for labeling and detecting nucleic acids.

In addition, the present invention comprises the steps of 1) extracting the DNA of the assay sample;

2) performing a polymerase chain reaction (PCR) from the DNA of step 1) using the primer of the present invention; And,

3) provides a method for discriminating sewage, white squid and bilobule pips, comprising the step of identifying the PCR product by separating the PCR product of step 2) by electrophoresis.

The sample may be food that is expected to contain sewage, baekshou and bileafy pips or the sewage, baekshou and bileafy pips.

In addition, the primers include primers capable of specifically amplifying the sequence selected from the sequences set forth in SEQ ID NOs: 21 to 25. In a preferred embodiment of the present invention, the primers amplify species-specific DNA of sewage, baeksuo and bilobule pelvis, respectively (see FIGS. 2 to 6).

In addition, varieties for discriminating primers capable of specifically amplifying the sequence selected from the sequences set forth in SEQ ID NOs: 21 to 25 of the present invention may be used either individually or in combination of two or more according to the variety to be discriminated. . In the embodiment of the present invention, even when the primers are used in combination, it is possible to discriminate three types of sewage errors simultaneously by confirming that the correct DNA fragment of the expected size is amplified, as well as to discriminate the incorporation of the false bilobite piposo. It was confirmed that it is a marker for discriminating multiple varieties simultaneously (see FIG. 7).

Qualitative analysis of step 3) can be performed by detecting the PCR product of the electrophoresis result. In other words, when PCR is performed using a primer that can amplify the SCAR markers of HA13-3 and HC20-1 and a primer that can amplify the HA13-2 marker that is specifically amplified bilobus pelvis, the species is distinguished from sewage. In addition, it can be judged that even if the double-leafed pippe is mixed in Baeksuo.

The breed discrimination method using the primers for sewage, baeksuo and bileaf pippe varieties of the present invention can be utilized to prevent the misuse and misuse of sewage errors and circulation of goods.

Hereinafter, the present invention will be described in detail by way of examples.

However, the following examples are merely to illustrate the present invention, the contents of the present invention is not limited to the following examples.

< Example  1> plants DNA  extraction

<1-1> Test Materials

Two sewage lines, Baeksuo and two-leafed shelter, which were collected from domestic cultivation and inhabitants, were used. Specifically, Hasuo planted two strains grown at the Jeollabuk-do Agricultural Research Institute Herbal Research Institute and 1 planted at Jeollabuk-do Agricultural Research Institute Herbal Research Institute and one plant at Shin-Ari, Geumseo-myeon, Sancheong-gun, Gyeongsangnam-do, and Bovalley, Gagok-myeon, Yeongju-si, Gyeongbuk. Collected or distributed, Lee Yeop Woo-Pi received three strains grown in the Chungcheongbuk-do Agricultural Research and Development Institute and stored the roots, stems, and leaves of biological samples at -70 ℃.

<1-2> plants DNA  extraction

The biological sample stored at −70 ° C. was quenched with liquid nitrogen and ground to a powder state using a mortar, and then DNA was extracted using a Plant genomic DNA Prep kit (Solgent, Korea). Specifically, 50 mg of the powdered biological sample was collected in a 1.5 ml tube, 500 µl of cell lysate was added and mixed well. Then, 8 µl of protease-K (20 mg / ml) was added and vortexed lightly at 65 ° C. Cell disruption was incubated for 30 minutes. The crushed samples were cooled on ice for 5 minutes, and then 200 μl of Protein Precipitation Solution was added thereto, mixed well, and centrifuged at 13,000 rpm for 10 minutes. After centrifugation, 600 μl of the supernatant was taken and separated according to the manufacturer's user instructions to store the final 50 μl (45 ng / μl) of purified total DNA at −20 ° C.

< Example  2> RAPD  analysis

<2-1> PCR  Perform

PCR amplification was performed for RAPD analysis using RAPD kits A and C (Table 1) among 10-mer RAPD Kits of Operon. 20 ng of total DNA, 40 pmole of RAPD primer of Table 1 and 2 units of DNA polymerase were added in 30 μl of 1 × reaction solution [75 mM Tris-HCL (pH 8.8), 20 mM (NH ₄ ) ₂ SO ₄ , 0.1% (v / v) Tween 20, 20 μM dNTP, 200 μM MgCl ₂ ], respectively, were amplified using a DNA Engine Dyad Thermal Cycler (MJ Research, USA). Reaction conditions were performed under the conditions of initial denaturation at 95 ° C. for 5 minutes, 30 seconds denaturation at 95 ° C., 30 seconds annealing at 46 ° C., 45 seconds elongation at 72 ° C., and final extension at 72 ° C. for 5 minutes. It was. RAPD specific PCR amplification products were observed by electrophoresis with 100 bp DNA ladder (Invitrogen, USA) on 1.5% agarose gel and stained with EtBr.

As a result, PCR amplification products appeared in a variety of mainly 0.2 kb ~ 3.0 kb size, of which specific amplification products were distributed in the range of about 0.2 kb ~ 1.5 kb. Five species-specific amplification products for sewage and bilobite pips were obtained from a total of four primers (OPA13, OPC14, OPC18 and OPC20) (FIG. 1).

Specifically, about 450 bp and 220 bp sized bilobal liposomal specific amplification products were obtained from OPA13 primers (FIG. 1A), which were named HA13-2 and HA13-3, respectively; A sewage specific amplification product of about 700 bp in size was obtained from the OPC14 primer (FIG. 1B), which was named HC14-2; About 400 bp of sewage specific amplification product was obtained from the OPC18 primer (FIG. 1C), which was named HC18-1; About 750 bp bilobal liposomal specific amplification product was obtained from the OPC20 primer (FIG. 1B), which was named HC20-1.

Sequences of Operon RAPD Primers A and C primer Sequence (5'-3 ') SEQ ID NO: GC content (%) primer Sequence (5'-3 ') SEQ ID NO: GC content (%) OPA-11 CAATCGCCGT One 60% OPC-11 AAAGCTGCGG 11 60% OPA-12 TCGGCGATAG 2 60% OPC-12 TGTCATCCCC 12 60% OPA-13 CAGCACCCAC 3 70% OPC-13 AAGCCTCGTC 13 60% OPA-14 TCTGTGCTGG 4 60% OPC-14 TGCGTGCTTG 14 60% OPA-15 TTCCGAACCC 5 60% OPC-15 GACGGATCAG 15 60% OPA-16 AGCCAGCGAA 6 60% OPC-16 CACACTCCAG 16 60% OPA-17 GACCGCTTGT 7 60% OPC-17 TTCCCCCCAG 17 70% OPA-18 AGGTGACCGT 8 60% OPC-18 TGAGTGGGTG 18 60% OPA-19 CAAACGTCGG 9 60% OPC-19 GTTGCCAGCC 19 70% OPA-20 GTTGCGATCC 10 60% OPC-20 ACTTCGCCAC 20 60%

<2-2> RAPD  Specific amplification products of  Sequencing

The base sequences of five species-specific amplification products obtained in Example 2-1 were analyzed and used to prepare primers for the development of species-specific RAPD-derived SCAR markers.

Specifically, the identified species-specific RAPD amplification products were recovered and purified from agarose gel using PCR & Gel Purification Kit (SolGent, Korea), and then inserted into pGEM-T Easy Vector Systems (Promega, USA). The inserted amplification products were transduced into XL1-Blue MRF 'transforming cells (Stratagene, USA), and then added to LB agar medium containing ampicillin (Sigma, USA) and X-gal / IPTG (Sigma, USA). Smear and incubate. After white colony was selected and cultured at 37 ° C. in an ampicillin-added LB liquid medium, the cells were recovered to separate plasmid DNA using a Plasmid mini preparation kit (SolGent, Korea). Sequences were analyzed in ABI3730 automatic DNA sequencer (Applied Biosystems, USA) using T7 and SP6 primer pairs.

As a result, nucleotide sequences of five amplification products of SEQ ID NOs: 21 to 25 for HA13-2, HA13-3, HC14-2, HC18-1, and HC20-1 were obtained (SEQ ID NO: 21: bilobular liposomal specificity). Red HA13-2, 439 bp; SEQ ID NO: 22 bilobus duct specific HA13-3, 216 bp; SEQ ID NO: 23 sewage specific HC14-2, 687 bp; SEQ ID NO: 24 sewage specific HC18-1 425 bp And SEQ ID NO: 25 bileaflet specific HC20-1, 750 bp).

< Example  3> SCAR Marker  Exploration and Multiclass Identification of Genes Marker  Development

Based on the sequencing results of the species specific RAPD amplification products of Example 2, PCR was performed by constructing 20 mer SCAR primer pairs at the portion except for the RAPD 10-mer primer sequence region, and the specificity of the amplification products was confirmed.

Specifically, as shown in Table 2, SCAR primer pairs were produced by commissioning to Bioneer (Korea).

SCAR primer Amplification primer Sequence (5'-3 ') SEQ ID NO: HA13-2 S TGAGTCGTGAGTTAGAGCTC 26 AS TAACTCTAAGCACAAATAAC 27 HA13-3 S AATCAACAATTACTTGGTGT 28 AS GAAAAAGGATTGTGTAGGGA 29 HC14-2 S TGAGTCGTGAGTTAGAGCTC 30 AS 1 ACATACCCTGATATGTATGA 31 AS 2 GATTAGCTCGAATGACACAT 32 HC18-1 S GCAAGTGGCAATGGGATTGC 33 AS TCCTCTTATCTCAGGCATCC 34 HC20-1 S GTGTAATCCTAATATCTCTA 35 AS 1 AGGCTGCCTAACCTCAGTAT 36 AS 2 CTCCTAGCGTTGAACTTGTT 37

PCR amplification conditions using the SCAR primer pair are as follows: 20 ng of total DNA, 20 pmole of S (sense) primer, AS (anti sense) primer, and 2 units of DNA polymerase 30 μl of 1 × reaction solution. Each was added to and amplified using a DNA Engine Dyad Thermal Cycler. The reaction conditions were initially denatured at 95 ° C. for 5 minutes, followed by 1 minute denaturation at 95 ° C., 30 seconds annealing at 51 ° C., 2 minutes elongation at 72 ° C., and finally elongated at 72 ° C. for 5 minutes. The SCAR amplification products were observed by electrophoresis with 100 bp DNA ladder on 1.5% agarose gel and stained with EtBr.

As a result, the S and AS SCAR primers (FIG. 2A) prepared from about 450 bp bilobal pipio specific amplification products (HA13-2; FIG. It was confirmed that the amplification product of the bp size (Fig. 2b), but the S and AS SCAR primers (HA13-3; FIG. In the case of FIG. 3a), amplification products having a size of 196 bp were commonly found in Baeksuo and Bileafi pelvis, except for sewage (FIG. 3b). In addition, S and AS 1 or AS 2 SCAR primers (FIG. 6a) prepared from about 750 bp bilobal pipio specific amplification products (HC20-1; FIG. 1D) by OPC20 RAPD primers were also extracted from sewage. Amplification products of 110 bp and 407 bp in size were found in both common and bilobal pelvis (FIGS. 6B and 6C).

In addition, S and AS 1 or AS 2 SCAR primers prepared from about 700 bp of sewage specific amplification product (HC14-2; FIG. 1D) by OPC14 RAPD primer and about 400 bp of sewage by OPC18 RAPD primer S and AS SCAR primers prepared from the specific amplification product (HC18-1; FIG. 1C) were precisely sewage specific at 240 bp (FIG. 4B), 460 bp (FIG. 4C), and 340 bp (FIG. 5B) sizes, respectively. DNA fragments were amplified.

 < Example  4> Differential Genes Differentiation Using Species Specific Sequences Marker  Development

<4-1> Marker  Development

Differentiation of species-specific SCAR primer pairs may not be effective when incorporating Baeksuo and bilopeus pelvis that are difficult to distinguish with the naked eye because they are identical in shape and color. Differentiation markers have been developed to distinguish them.

Specifically, a set of primers for sewage specific amplification of HC18-1 S and AS 1 or AS 2 SCAR primers and HC18-1 S and AS SCAR primers, which can distinguish sewage from Baeksuo and bilobal pelvis of Table 2 (240 bp , 460 bp and 340 bp); A set of primers for the amplification of the white and S. aureus specific for the HC13-3 S and AS SCAR primers and the HC20-1 S and AS 1 or AS 2 SCAR primers, which can distinguish Baeksuo and the bilobite pelvis from sewage (196 bp, 110 bp and 407 bp); And a primer set (300 bp) for amplifying bispecific liposomes specific to HC13-2S and AS SCAR primers capable of distinguishing Baeksuo and bileafy pips.

<4-2> multiplex PCR  One

Primer set for sewage-specific amplification of HC18-1 S and AS SCAR primers in Table 2 (340 bp), primer set for amplification of bilobular liposomal specific amplification of HC13-2 S and AS SCAR primers (300 bp) and sewage Multiplex PCR was performed using HC13-3S and AS SCAR primer set (196 bp) capable of distinguishing bilobular liposomes.

Multiplex PCR conditions were amplified using DNA Engine Dyad Thermal Cycler by adding 20 ng of total DNA, 20 pmole of S primer, 3 pairs of AS primer, and 2 units of DNA polymerase to 30 μl of 1 × reaction solution. It was. The reaction conditions were initially denatured at 95 ° C. for 5 minutes, followed by 1 minute denaturation at 95 ° C., 30 seconds annealing at 51 ° C., 2 minutes elongation at 72 ° C., and finally elongated at 72 ° C. for 5 minutes. The SCAR amplification products were observed by electrophoresis with 100 bp DNA ladder on 1.5% agarose gel and stained with EtBr.

As a result, as shown in Fig. 7a, by confirming that the correct DNA fragment of the expected size is amplified, it is possible to discriminate not only three kinds of sewage errors at the same time, but also to discriminate the incorporation of the false bilobite pelvis. It was confirmed that it was a marker.

<4-3> multiplex PCR  2

Primer set for sewage-specific amplification of HC18-1 S and AS SCAR primers (340 bp), primer set for amplification of bilobite liposomal specific amplification of HC13-2 S and AS SCAR primers (300 bp) Multiplex PCR was performed in the same manner as in Example 4-2, using the primer set (407 bp) for amplification of the Baeksuo and bilobal phepi specific of HC20-1S and AS 2 SCAR primers.

As a result, as shown in Fig. 7b, by confirming that the correct DNA fragment of the expected size is amplified, it is possible not only to discriminate three kinds of sewage errors at the same time, but also to discriminate the incorporation of the false bilobite pelvis. It was confirmed that it was a marker. The marker was confirmed to be more stable overall DNA amplification specificity or amplification than the marker of Figure 7a.

1 is a diagram showing the results of PCR in sewage, white squid and bilobule pelvis using RAPD primers:

a: OPA13;

b: OPC14;

c: OPC18; And,

d: OPC20.

2 is a diagram showing the results of PCR in sewage, white squid and bilobule pelvis using the nucleotide sequence of the HA13-2 amplification product and the SCAR primer pair prepared based on the nucleotide sequence:

a: nucleotide sequence; And,

b: PCR result.

3 is a diagram showing the results of PCR in sewage, white squid and bilobule pelvis using the nucleotide sequence of the HA13-3 amplification product and the SCAR primer pair prepared based on the nucleotide sequence:

a: nucleotide sequence; And,

b: PCR result.

4 is a diagram showing the results of PCR in sewage, white squid and bilobule pelvis using the nucleotide sequence of the HC14-2 amplification product and the SCAR primer pair prepared based on the nucleotide sequence:

a: nucleotide sequence;

b: PCR result (240 bp); And,

c: PCR result (460 bp).

5 is a diagram showing the results of PCR in sewage, white squid and bilobule pelvis using the nucleotide sequence of the HC18-1 amplification product and the SCAR primer pair prepared based on the nucleotide sequence:

a: nucleotide sequence; And,

b: PCR result.

6 is a diagram showing the results of PCR in sewage, white squid and bilobule pelvis using the nucleotide sequence of HC20-1 amplification product and the SCAR primer pair prepared based on the nucleotide sequence:

a: nucleotide sequence;

b: PCR result (110 bp); And,

c: PCR result (407 bp).

7 is a diagram showing the results of performing multiplex PCR using three pairs of SCAR primer pairs:

a: HC18-1 S / AS, HA13-2 S / AS and HA13-3 S / AS; And,

b: HC20-1 S / AS, HC18-1 S / AS and HA13-2 S / AS.

<110> Korea Institute of Oriental Medicine <120> Gene marker for classification of Polygonum multiflorum Thunberg,          Cynanchum wilfordi Max. Hemsl. and Cyynacum auriculatum Royle ex          Wight <130> 8P-03-62 <160> 37 <170> KopatentIn 1.71 <210> 1 <211> 10 <212> DNA <213> Artificial Sequence <220> <223> OPA-11 <400> 1 caatcgccgt 10 <210> 2 <211> 10 <212> DNA <213> Artificial Sequence <220> <223> OPA-12 <400> 2 tcggcgatag 10 <210> 3 <211> 10 <212> DNA <213> Artificial Sequence <220> <223> OPA-13 <400> 3 cagcacccac 10 <210> 4 <211> 10 <212> DNA <213> Artificial Sequence <220> <223> OPA-14 <400> 4 tctgtgctgg 10 <210> 5 <211> 10 <212> DNA <213> Artificial Sequence <220> <223> OPA-15 <400> 5 ttccgaaccc 10 <210> 6 <211> 10 <212> DNA <213> Artificial Sequence <220> <223> OPA-16 <400> 6 agccagcgaa 10 <210> 7 <211> 10 <212> DNA <213> Artificial Sequence <220> <223> OPA-17 <400> 7 gaccgcttgt 10 <210> 8 <211> 10 <212> DNA <213> Artificial Sequence <220> <223> OPA-18 <400> 8 aggtgaccgt 10 <210> 9 <211> 10 <212> DNA <213> Artificial Sequence <220> <223> OPA-19 <400> 9 caaacgtcgg 10 <210> 10 <211> 10 <212> DNA <213> Artificial Sequence <220> <223> OPA-20 <400> 10 gttgcgatcc 10 <210> 11 <211> 10 <212> DNA <213> Artificial Sequence <220> <223> OPC-11 <400> 11 aaagctgcgg 10 <210> 12 <211> 10 <212> DNA <213> Artificial Sequence <220> <223> OPC-12 <400> 12 tgtcatcccc 10 <210> 13 <211> 10 <212> DNA <213> Artificial Sequence <220> <223> OPC-13 <400> 13 aagcctcgtc 10 <210> 14 <211> 10 <212> DNA <213> Artificial Sequence <220> <223> OPC-14 <400> 14 tgcgtgcttg 10 <210> 15 <211> 10 <212> DNA <213> Artificial Sequence <220> <223> OPC-15 <400> 15 gacggatcag 10 <210> 16 <211> 10 <212> DNA <213> Artificial Sequence <220> <223> OPC-16 <400> 16 cacactccag 10 <210> 17 <211> 10 <212> DNA <213> Artificial Sequence <220> <223> OPC-17 <400> 17 ttccccccag 10 <210> 18 <211> 10 <212> DNA <213> Artificial Sequence <220> <223> OPC-18 <400> 18 tgagtgggtg 10 <210> 19 <211> 10 <212> DNA <213> Artificial Sequence <220> <223> OPC-19 <400> 19 gttgccagcc 10 <210> 20 <211> 10 <212> DNA <213> Artificial Sequence <220> <223> OPC-20 <400> 20 acttcgccac 10 <210> 21 <211> 439 <212> DNA <213> Artificial Sequence <220> <223> HA13-2 <400> 21 cagcacccac ggtcaacgac atgatattgt tctcactgta ccaaaagtga taccccgagt 60 tgactatgag tacctagaca cattcccttc ccttaccttc tcctagagct gtaaacaaac 120 caagttgttt gcaaacaaag ctcgttcgag ctcgctcttt attaaacaaa acaaactcaa 180 ataatttttt aagctcaatt aattttcaag tctattcaaa cagtgttcga aaattaagca 240 aaccaagttc aaaactccga tattttgtta gactcgactc gactcgttta taactctaag 300 cacaaataac ccttaaaaac aagatataaa ttctagttat caagggacta atgacaaaaa 360 tttattgaag ggcatgtagt gagactttta aaaaattgaa agatagccta tgaacaaaat 420 tcacttgagg tgggtgcgg 439 <210> 22 <211> 216 <212> DNA <213> Artificial Sequence <220> <223> HA13-3 <400> 22 cagcacccac aatcaacaat tacttggtgt tatcttcact acaccaaatt gaatatttcg 60 agttgactat gagtacctag atctattttt ataaatcatt actcattcac ttattttttt 120 tatatgattt gctatatcac attattcgag atgaatggaa aataatgtat atatatatat 180 atgaaagaaa aaggattgtg tagggagtgg gtgctg 216 <210> 23 <211> 687 <212> DNA <213> Artificial Sequence <220> <223> HC14-2 <400> 23 tgcgtgcttg taaagggcac aggaaaagga attatcctcg tgagtcgtga gttagagctc 60 aaaccctaaa ttccacaagt ttgatacatg tagagcatgc gactttagtg ggtcaaatca 120 aatgaaagtg aatgggaaat acaaacaccg atataaatgt tgagtacgct caacatccat 180 gtatctaaac catctaaaat gaaatattta ataccaaagc ttgctaaaaa accaaatagg 240 atcaactaac taagtgcaac acataccctg atatgtatga cctaaaaaag cttgaaaaac 300 aaataaccac taaatatgag aatttacatg atacctcaga aacaaaacta atgttgctga 360 agcagattcg gctttttttc aacagcctcg aactggagaa tgaagttttc ctgaaaaatg 420 aagagtacat atagcatatt cagggcattg atgggaagag gggaaattta agtataaaag 480 gattagctcg aatgacacat cattaccttg atgacagttt cccatatgat gggatcgaaa 540 cagataaaag atcctcgttc ataggtcggg tgtgtagcga ggacatccat gttgcctacc 600 cttgtcaacc acatccttaa atctctgtga tacatccagc cccttctgat actgcgaaga 660 gtgttcagac ctcttagcaa gcacgca 687 <210> 24 <211> 425 <212> DNA <213> Artificial Sequence <220> <223> HC18-1 <400> 24 tgagtgggtg gcaagtggca atgggattgc caatcaaatt gacaacgagc atcgaatcca 60 tctccaaata aacaattcga agacctttat tccaagctaa tttcagcccc tccaaaatac 120 cccatagctc agctttgagg attgaacact agctaatatt gtgaacaaac ccacccatcc 180 aacgcccatc cgaatcatga acgacaccaa cagtcatagc acgcccttga acattgacgg 240 cgccgtcaat attgattttg atccaattat gagggggcct catccaagta atacagcact 300 cctctttcct aggcttcaca ttagagcagc tcctcttatc tcaggcatcc ttgtactccg 360 cagtacgatc agttgctcat cttgccccat caacaacccg agatgaattg tcgaaccccc 420 actca 425 <210> 25 <211> 760 <212> DNA <213> Artificial Sequence <220> <223> HC20-1 <400> 25 acttcgccac gtgtaatcct aatatctcta agattagtat caaattctga atttaatagt 60 taaccctaag atgtataata agttcaaact caaggttatt aggctgccta acctcagtat 120 ggtcgccaca agttattact gcctaacctc agtgacccaa gcctcttgtt ggccaaattc 180 catcgtttta accaattttt caaatttgta agtatttttt gctttcattt tagtaatttt 240 tgttgttttt tagattagtt tcttgcatct ccttgtgttt ttctttgaac tttgtttatg 300 actaggtcat ctactagtaa gttagttgat tttgatcctg aaattgatag aacttttcat 360 aagcaactta gggaaaagaa gaatgaacaa gaaaaatctc ctagcgttga acttgttagt 420 gaattgttta aagatttgaa acttgataat tatgaaaaag ttgttgatta tgaaatcatg 480 gctggaaata ataatgataa taggacactt aaggaattag caactcctga tatgagttga 540 cagcatgctt gcatagagta tccagaagtg caggctaatt ttgaacttaa atctggtcta 600 atataattgt tgcctagatt tcatggtctt gcaggtgaag atcctcataa gcatcttaag 660 gaatttcata ttgtttgctc tacaatgcag cctagggaga ttacagagga acagattaaa 720 ctgagggcat ttcctttctc tttggatgga gtggcgaagt 760 <210> 26 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> HA13-2 S <400> 26 tgagtcgtga gttagagctc 20 <210> 27 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> HA13-2 AS <400> 27 taactctaag cacaaataac 20 <210> 28 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> HA13-3 S <400> 28 aatcaacaat tacttggtgt 20 <210> 29 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> HA13-3 AS <400> 29 gaaaaaggat tgtgtaggga 20 <210> 30 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> HC14-2 S <400> 30 tgagtcgtga gttagagctc 20 <210> 31 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> HC14-2 AS1 <400> 31 acataccctg atatgtatga 20 <210> 32 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> HC14-2 AS2 <400> 32 gattagctcg aatgacacat 20 <210> 33 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> HC18-1 S <400> 33 gcaagtggca atgggattgc 20 <210> 34 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> HC18-1 AS <400> 34 tcctcttatc tcaggcatcc 20 <210> 35 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> HC20-1 S <400> 35 gtgtaatcct aatatctcta 20 <210> 36 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> HC20-1 AS1 <400> 36 aggctgccta acctcagtat 20 <210> 37 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> HC20-1 AS2 <400> 37 ctcctagcgt tgaacttgtt 20  

Claims (18)

Polygonum as set forth in SEQ ID NOs: 23 and 24 multiflorum Thunberg) Polynucleotide for discriminating varieties. Cynanchum as set forth in SEQ ID NOs: 22 and 25 wilfordii Max. Hemsl.) And Cynacum auriculatum Royle ex Wight) variety polynucleotide for discrimination. Cynacum as described in SEQ ID NO: 21 auriculatum Royle ex Wight) variety polynucleotide for discrimination. A primer pair for sewage variety determination capable of amplifying said polynucleotide consisting of 15 to 50 consecutive nucleotides, selected from the sequences set forth in SEQ ID NO: 23 and SEQ ID NO: 24. The primer pair of claim 4, wherein the primer pair capable of amplifying the sequence set forth in SEQ ID NO: 23 consists of two polynucleotides set forth in SEQ ID NO: 31 and SEQ ID NO: 32, respectively. The primer pair of claim 4, wherein the primer pair capable of amplifying the sequence set forth in SEQ ID NO: 24 consists of two polynucleotides set forth in SEQ ID NO: 33 and SEQ ID NO: 34, respectively. A pair of primers for determining the species of Baeksuo and Bilopipius, which can amplify the polynucleotide consisting of 15 to 50 contiguous nucleotides selected from the sequences set forth in SEQ ID NO: 22 and SEQ ID NO: 25. 8. The primer pair of claim 7, wherein the primer pair capable of amplifying the sequence set forth in SEQ ID NO: 22 consists of two polynucleotides set forth in SEQ ID NO: 28 and SEQ ID NO: 29 or SEQ ID NO: 30, respectively. 8. The primer pair of claim 7, wherein the primer pair capable of amplifying the sequence set forth in SEQ ID NO: 25 consists of two polynucleotides set forth in SEQ ID NO: 35 and SEQ ID NO: 36 or SEQ ID NO: 37, respectively. A pair of primers for discriminating bilobus piposomal varieties capable of amplifying the polynucleotide consisting of 15 to 50 contiguous nucleotides, selected from the sequences set forth in SEQ ID NO: 21. The primer pair of claim 10, wherein the primer pair capable of amplifying the sequence set forth in SEQ ID NO: 21 consists of two polynucleotides set forth in SEQ ID NO: 26 and SEQ ID NO: 27, respectively. Sewage variety determination kit comprising a primer pair of claim 4. A kit for determining the breed of Baeksuo and bilobules containing the primer pair of claim 7. A kit for discriminating bilobite pips comprising the primer pair of claim 10. Claim 4, 7 and claim 10, including the primer pairs of sewage, white squid and bilobus pippei discrimination kit. 1) extracting the DNA of the assay sample; 2) performing a polymerase chain reaction (PCR) from the DNA of step 1) using the primers of claim 4, 7 and 10; And, 3) A method for discriminating sewage, white squid and bilobule pips, comprising the step of identifying the PCR product by separating the PCR product of step 2) by electrophoresis. 17. The method of claim 16, wherein the sample of step 1) is sewage, baekshou and bileafy pippe itself or a food that is expected to contain the sewage, baekshou and bileafy pippe. 17. The method of claim 16, wherein the primers of step 2) may each contain two or more primers according to the variety to be determined.

Images