KR20090034011A - Biomarker for identification of exposure to dibenzo [a, h] anthracene and the method of identification using thereof - Google Patents

Biomarker for identification of exposure to dibenzo [a, h] anthracene and the method of identification using thereof Download PDF

Info

Publication number
KR20090034011A
KR20090034011A KR1020070099135A KR20070099135A KR20090034011A KR 20090034011 A KR20090034011 A KR 20090034011A KR 1020070099135 A KR1020070099135 A KR 1020070099135A KR 20070099135 A KR20070099135 A KR 20070099135A KR 20090034011 A KR20090034011 A KR 20090034011A
Authority
KR
South Korea
Prior art keywords
genebank
registration number
gene registration
gene
protein
Prior art date
Application number
KR1020070099135A
Other languages
Korean (ko)
Other versions
KR100961487B1 (en
Inventor
류재천
김연정
전희경
Original Assignee
한국과학기술연구원
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 한국과학기술연구원 filed Critical 한국과학기술연구원
Priority to KR1020070099135A priority Critical patent/KR100961487B1/en
Publication of KR20090034011A publication Critical patent/KR20090034011A/en
Application granted granted Critical
Publication of KR100961487B1 publication Critical patent/KR100961487B1/en

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6813—Hybridisation assays
    • C12Q1/6834—Enzymatic or biochemical coupling of nucleic acids to a solid phase
    • C12Q1/6837—Enzymatic or biochemical coupling of nucleic acids to a solid phase using probe arrays or probe chips
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/574—Immunoassay; Biospecific binding assay; Materials therefor for cancer
    • G01N33/57407—Specifically defined cancers
    • G01N33/57438—Specifically defined cancers of liver, pancreas or kidney

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Organic Chemistry (AREA)
  • Immunology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Analytical Chemistry (AREA)
  • Wood Science & Technology (AREA)
  • Molecular Biology (AREA)
  • Zoology (AREA)
  • Physics & Mathematics (AREA)
  • Urology & Nephrology (AREA)
  • Biotechnology (AREA)
  • General Health & Medical Sciences (AREA)
  • Microbiology (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • Biomedical Technology (AREA)
  • Genetics & Genomics (AREA)
  • Hematology (AREA)
  • General Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Physics & Mathematics (AREA)
  • Cell Biology (AREA)
  • Oncology (AREA)
  • Hospice & Palliative Care (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Pathology (AREA)
  • Medicinal Chemistry (AREA)
  • Food Science & Technology (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

A biomarker is provided to confirm exposure of dibenzo· a, h·ªanthracene which is polycyclic aromatic hydrocarbon and to decrease or increase gene expression specifically by the dibenzo· a, h·ªanthracene. A method for confirming exposure of dibenzo· a, h·ªanthracene comprises the following steps of: processing an dibenzo· a, h·ªanthracene in a human somatic cell; separating RNA from the human somatic cell; noting the experimental group and a control group with other fluorescent materials respectively while synthesizing the RNA of the control group and the experimental group to cDNA; mixing a DNA microarray chip with the cDNA noted with the other fluorescent materials; analyzing the reacted DNA microarray chip; and confirming an expressed grade of the biomarker from analyzed data.

Description

다이벤조에이에이취안트라센 노출 여부 확인용 바이오마커 및 이를 이용한 확인 방법{Biomarker for identification of exposure to dibenzo［a, h］anthracene and the method of identification using thereof}Biomarker for confirming the exposure of dibenzoAh-anthracene and identification method using the same

본 발명은 다이벤조에이에이취안트라센(dibenzo[a,h]anthracene)에 대한 노출 여부 확인용 바이오마커 및 이를 이용한 확인 방법에 관한 것으로, 더욱 상세하게는 다이벤조에이에이취안트라센에 의해 유전자 발현이 증가 또는 감소하는 바이오마커 및 이를 이용한 다이벤조에이에이취안트라센에 대한 노출 여부를 확인하는 방법에 관한 것이다. The present invention relates to a biomarker for confirming exposure to dibenzo [a, h] anthracene and a method of identifying the same, and more particularly, to increase or decrease gene expression by dibenzoaichanthracene. The present invention relates to a method for identifying a decreasing biomarker and exposure to dibenzoAh-anthracene.

다환 방향족 탄화수소류 중에서 다이벤조에이에이취안트라센은 화재로부터 자연적으로 발생하거나, 트럭, 선반 등에서 연소된 기체로부터 발생하며, 그 외에도 토탄 침전물에서 발견되어진다. 다이벤조에이에이취안트라센은 상업적으로 생산되는 물질은 아니지만 주로 연구목적으로 생산되어진다. Among the polycyclic aromatic hydrocarbons, dibenzoaichanthracene is generated naturally from fire, or from gas burned in trucks, lathes, etc., and is also found in peat deposits. DibenzoAchanthracene is not a commercially produced substance but is mainly produced for research purposes.

다이벤조에이에이취안트라센은 휘발성이 없어서 토양 중 이동성이 아주 미미 하며, 토양중 반감기는 약 400일 정도이다. 물표면에서의 휘발성도 거의 없어서, 주로 저질과 부유물질에 흡착되어지고, 수중에서의 가수분해반응은 일어나지 않으며 수생생물 중 생물농축이 매우 높은 것으로 알려져 있다. 대기 중에서는 입자 상태로만 존재하여 주로 물리적인 방법으로 제거되어질 수 있다. 또한 태양광에 강하게 흡착하여 환경 중에서 직접적인 광분해반응이 일어난다. 국내 식품 중 다환방향족 탄화수소류의 오염도 조사연구에서 전국 9개 도시에서 유통되는 육류, 육류 가공품 및 유지류의 다이벤조에이에이취안트라센의 함량을 조사한 결과 훈연제품, 가금류 식품, 육류에서 0.022~0.046 ㎍/㎏으로 검출되었고(김명철 등, 식품의약품안전청 2001년도 내분비계 장애물질 연구보고서, 2001), 식용유지에서 평균 0.16 ㎍/㎏으로 조사되었다(이종옥 등, 식품의약품안전청 연구보고서 제6권, 790, 2002). DibenzoAchanthracene has no volatility, so mobility in soil is minimal, and half-life in soil is about 400 days. It is known that there is little volatility on the surface of water, so it is mainly adsorbed to low quality and suspended matter, hydrolysis reaction does not occur in water and bioconcentration among aquatic organisms is very high. It exists only in particulate form in the atmosphere and can be removed primarily by physical means. It is also strongly adsorbed by sunlight, causing a direct photolysis reaction in the environment. Contamination of polycyclic aromatic hydrocarbons in Korean foods was examined in the content of dibenzoAh-anthracene in meats, processed meats, and fats and oils distributed in nine cities nationwide. (Kim et al., 2001 Endocrine Obstacle Research Report, Korea Food & Drug Administration, 2001), and average 0.16 ㎍ / kg in edible oil and fat (Lee Jong-ok, et al., Report 6, 790, 2002). .

동물실험에서 다이벤조에이에이취안트라센은 경구를 통하여 흡수되어지고, 피부를 통한 흡수는 매우 느리며, 흡수된 대부분은 분변으로 배출되어지는 것으로 보고되고 있다(ASTDR, 1990). 또한 다이벤조에이에이취안트라센은 사이토크롬(cytochromes) P450에 의해 반응성이 있는 다이올-에폭사이드(diol-epoxide) 유도체와 산화물로 대사되어 DNA와 histones에 공유결합체를 형성할 수 있으며, 궁극적으로 유전독성 및 발암성을 일으키는 것으로 보고되어지고 있다(HSDB).In animal experiments, it has been reported that dibenzoAchanthracene is absorbed orally, absorption through the skin is very slow, and most of the absorption is excreted in feces (ASTDR, 1990). DibenzoAh-anthracene can also be metabolized to reactive diol-epoxide derivatives and oxides by cytochromes P450 to form covalent bonds to DNA and histones, ultimately genotoxic. And carcinogenicity (HSDB).

다환방향족 탄화수소류의 발암성 정도와 유전자 발현 변화에 대한 연구는 일부 보고되고 있지만, 대표적인 다환방향족 탄화수로류로 알려진 벤조에이파이 렌(Benzo[a]pyrene)에 대한 연구에 거의 국한되어 있다. 이처럼 다이벤조에이에이취안트라센의 인간에 대한 발암 가능성에도 불구하고 인체에서의 위해도 평가 데이터가 충분하지 않고, 노출에 대한 검색 방법 역시 GC-MS(Gas Chromatography-Mass Spectrometer) 또는 HPLC(High Performance Liquid Chromatography) 등의 고전적인 방법에 국한되어 있다. GC-MS 또는 HPLC 방법 등을 이용하면 정량은 가능하나 분석을 위한 적정 조건을 설정하여야 하며 고가의 장비 등이 필요하다. 그러므로 보다 빠르고 간편한 스크리닝(screening) 방법, 예를 들면 프라이머(primer)를 이용하는 실시간(real-time) PCR(Real-time reverse transcript polymerase chain reaction)또는 DNA 마이크로어레이 칩 등으로 신속한 위해성 평가를 통해 인체에서의 독성작용을 탐색할 수 있는 분자적 지표를 발굴하고 활용하여 다이벤조에이에이취안트라센의 노출에 대한 적절한 대책 및 관리를 수행하는 것이 중요한 과제라 하겠다.Although some studies on carcinogenicity and gene expression changes of polyaromatic hydrocarbons have been reported, they are almost limited to studies on Benzo [a] pyrene, which is known as a representative polycyclic aromatic hydrocarbon. As such, despite the possibility of carcinogenicity of dibenzoA-Q anthracene in humans, there is insufficient data on risk assessment in humans, and the method of detecting exposure is also shown in Gas Chromatography-Mass Spectrometer (GC-MS) or High Performance Liquid Chromatography It is limited to classical methods such as). Quantification is possible using GC-MS or HPLC methods, but appropriate conditions for analysis are required and expensive equipment is required. Therefore, faster and easier screening methods, such as real-time reverse transcript polymerase chain reaction (PCR) or DNA microarray chips using primers, can be used in humans through rapid risk assessment. It is an important task to identify and utilize molecular indicators that can explore the toxic effects of dibenzoicacanthracene, and to take appropriate measures and control against exposure of dibenzoaquaanthracene.

포유류 6종, 미생물 292종 등 여러 종의 게놈(genome) 염기서열 프로젝트가 완성되어 NCBI(National Center for Biotechnology Information)에 보고되었다. 이렇게 얻어진 막대한 양의 데이터를 기본으로 유전자의 기능을 연구하기 위하여 게놈-와이드 익스프레션(genome-wide expression) 연구가 이루어지고 있다. 한번의 실험으로 수천 개의 유전자의 발현을 분석하기 위하여 DNA 마이크로어레이(microarray) 분석을 수행한다(Schena, M., et al., Proc . Natl . Acad . Sci . USA 93:10614-10619, 1996). Several genome sequencing projects, including six mammals and 292 microbes, have been completed and reported to the National Center for Biotechnology Information (NCBI). Genome-wide expression studies are being conducted to study the function of genes based on the vast amount of data obtained. DNA microarray analysis is performed to analyze the expression of thousands of genes in one experiment (Schena, M., et al. , Proc . Natl . Acad . Sci . USA) . 93: 10614-10619, 1996).

마이크로어레이는 cDNA(complementary DNA)나 20 - 25 염기쌍(base pair) 길이의 올리고뉴클레오티드(oligonucleotide)들의 세트를 유리에 집적화한 것이다. cDNA 마이크로어레이는 학교 내의 연구실 또는 Agilent, Genomic Solutions 등의 회사에서 칩 위에 cDNA 수집물을 기계적으로 고정화 하거나 잉크젯(ink jetting) 방법을 이용하여 생산하고 있다(Sellheyer K. et. al., J. Am . Acad . Dermatol. 51:681-692, 2004). 올리고뉴클레오티드 마이크로어레이는 Affymetrix사에서 사진 식각 공정(photolithography)을 이용하여 칩 위에서 직접 합성하는 방법에 의해 만들어 지고 있으며, Agillent사 등에는 합성된 올리고뉴클레오티드를 고정화하는 방법으로 생산하고 있다(Sellheyer, K. et. al., J. Am . Acad . Dermatol. 51:681-692, 2004).Microarrays integrate a set of oligonucleotides of cDNA (complementary DNA) or 20-25 base pairs in length on glass. cDNA microarrays are produced by labs in schools or companies such as Agilent, Genomic Solutions, etc., by mechanically immobilizing cDNA collections on chips or by using ink jetting (Sellheyer K. et. al., J. Am). . Acad Dermatol 51:.. 681-692 , 2004). Oligonucleotide microarrays are made by Affymetrix by direct synthesis on a chip using photolithography, and Agillent et al. Are produced by immobilizing synthesized oligonucleotides (Sellheyer, K.). et. al., J. Am . Acad . Dermatol . 51: 681-692, 2004).

유전자의 발현을 분석을 위해서는 조직 등 시료에서 RNA를 얻어 DNA 마이크로어레이에 있는 올리고뉴클레오티드와 교잡반응을 수행한다. 얻어진 RNA는 형광이나 동위원소로 표지화하며 cDNA로 전환시킨다. 올리고 마이크로어레이는 주로 두개의 다른 형광(예: Cye3 및 Cye5)으로 대조군과 실험군을 각각 표지화하여 같은 칩 상에서 동시에 교잡 반응을 수행한 후 광학적으로 이미지를 스캔하여 형광의 세기를 얻고 그 결과를 분석한다. 두개의 형광 세기의 비율에 따라 유전자의 발현 여부를 결정한다(Somasundaram, K. et al., Genomics Proteomics I:1-10, 2002).To analyze gene expression, RNA is obtained from samples such as tissues and hybridized with oligonucleotides in DNA microarrays. The resulting RNA is labeled with fluorescence or isotope and converted to cDNA. Oligo microarrays are mainly labeled with two different fluorescences (eg, Cye3 and Cye5) to perform hybridization reactions on the same chip at the same time. . Gene expression is determined by the ratio of the two fluorescence intensities (Somasundaram, K. et al. , Genomics Proteomics I: 1-10, 2002).

최근 DNA 마크로어레이 기술을 이용한 첨단 기법인 독성 유전체학(Toxicogenomics) 연구 등과 접목하여 대량(high throughput)으로 의약품 및 신의약 후보물질은 물론 대표적인 환경오염물질을 비롯해 모든 화학물질에 의한 특정 조직이나 세포주에서 발현되는 유전자들의 발현 패턴의 분석, 양적 분석이 가능해졌다. 이에 따라 특정 세포 내에서 특정 유전자의 발현 빈도를 분석함으로써 약물의 부작용 및 환경오염물질의 유해작용과 관련된 유전자의 발굴이 가능하며, 이를 통하여 환경오염물질의 유해작용과 약물의 작용 및 부작용에 따른 분자적 메커니즘을 이해하게 될 것이며 나아가 독성 및 부작용을 유발하는 물질의 검색 및 확인이 가능하게 될 것이다. In combination with the recent research on toxic genomics (Toxicogenomics), an advanced technique using DNA macroarray technology, high-throughput expression in specific tissues or cell lines by all chemicals including pharmaceuticals and new drug candidates, as well as representative environmental pollutants Analysis and quantitative analysis of expression patterns of genes are now possible. Accordingly, by analyzing the frequency of expression of specific genes in specific cells, it is possible to discover genes related to adverse effects of drugs and harmful effects of environmental pollutants, and through this, molecules according to the harmful effects of environmental pollutants, drugs, and side effects. It will be possible to understand the mechanisms and further search and identify substances that cause toxicity and side effects.

이에 본 발명자들은 인간 유전자 4만 4천개가 집적된 올리고마이크로어레이를 이용하여 다이벤조에이에이취안트라센의 유전자 발현 프로파일을 인간 간암 세포인 HepG2 세포주에서 관찰 및 분석함으로써 다이벤조에이에이취안트라센에 의해 과발현 또는 저발현 되는 유전자를 발굴하고, 실시간(real-time) RT-PCR 방법에 의해 상기 유전자들의 발현 양상을 확인함으로써 다이벤조에이에이취안트라센을 검출할 수 있는 바이오마커 및 이를 이용한 노출 여부를 확인하는 방법을 확립하여 본 발명을 완성하였다.Accordingly, the present inventors observed and analyzed the gene expression profile of dibenzoaichanthracene in a HepG2 cell line, which is a human liver cancer cell, using an oligomicroarray in which 44,000 human genes were accumulated. Establishing a biomarker capable of detecting dibenzoAH-anthracene and an exposure method using the same by discovering the gene to be expressed and confirming the expression pattern of the genes by real-time RT-PCR method The present invention was completed.

본 발명의 목적은 다이벤조에이에이취안트라센의 노출에 의해 과발현 또는 저발현되는 바이오마커 및 상기 바이오마커를 이용한 다이벤조에이에이취안트라센에 대한 노출 여부를 확인하는 방법을 제공하는 것이다.It is an object of the present invention to provide a biomarker that is overexpressed or underexpressed by exposure of dibenzoaquaanthracene and a method for identifying exposure to dibenzoaquaanthracene using the biomarker.

상기 목적을 달성하기 위하여, 본 발명은 다이벤조에이에이취안트라센(dibenzo[a,h]anthracene)의 노출에 의해 발현 변화를 일으키는 것을 특징으로 하는 다이벤조에이에이취안트라센에 대한 노출 여부 확인용 바이오마커를 제공한다.In order to achieve the above object, the present invention provides a biomarker for confirming the exposure to dibenzoaichanthracene, characterized by causing a change in expression by exposure to dibenzo [a, h] anthracene. to provide.

또한, 본 발명은 상기 바이오마커 유전자 서열의 전부 또는 일부를 포함하는 올리고뉴클레오티드 또는 이의 상보가닥 분자가 집적된 다이벤조에이에이취안트라센에 대한 노출 여부 확인용 DNA 마이크로어레이 칩을 제공한다.In addition, the present invention provides a DNA microarray chip for confirming exposure to dibenzoAichanthracene in which an oligonucleotide or a complementary strand molecule thereof including all or part of the biomarker gene sequence is integrated.

또한, 본 발명은 상기 바이오마커를 이용한 다이벤조에이에이취안트라센에 대한 노출 여부를 확인하는 방법을 제공한다.In another aspect, the present invention provides a method for confirming the exposure to dibenzoAh anthracene using the biomarker.

아울러, 본 발명은 다이벤조에이에이취안트라센에 대한 노출 여부 확인용 검색 키트를 제공한다.In addition, the present invention provides a search kit for confirming the exposure to dibenzoAchanthracene.

본 발명의 다이벤조에이에이취안트라센에 대한 노출 여부 확인용 바이오마커 및 이를 이용한 확인방법은 DNA 마이크로어레이 칩을 통하여 선별된 반응 유전자들을 바이오마커로 이용하여 다이벤조에이에이취안트라센의 모니터링 및 위해성을 판정하는데 유용하며, 다이벤조에이에이취안트라센에 의해 야기되는 독성 작용 기작을 규명하는 도구로 이용할 수 있다.The biomarker for confirming the exposure to the dibenzoaquaanthracene of the present invention and a method using the same are used to determine the monitoring and risk of the dibenzoaquaanthracene using a reaction gene selected through a DNA microarray chip as a biomarker. It is useful and can be used as a tool to identify the mechanism of toxic action caused by dibenzoaichanthracene.

이하, 본 발명을 상세히 설명한다.Hereinafter, the present invention will be described in detail.

본 발명은 다이벤조에이에이취안트라센의 노출에 의해 발현 변화를 일으키는 것을 특징으로 하는 다이벤조에이에이취안트라센에 대한 노출 여부 확인용 바이오마커를 제공한다.The present invention provides a biomarker for confirming the exposure to dibenzoaichanthracene, characterized by causing a change in expression by exposure to dibenzoaquaanthracene.

상기 바이오마커는 2배 이상 발현이 증가 또는 감소한 유전자로써, 세포 주기(cell cycle), 핵산 결합(nucleic acid binding), 금속원소 결합(metal binding), 산화 환원 효소 활성(Oxidoreductase activity), I-kappaB 키나아제(kinase)/NF-kappaB 캐스케이드(cascade), 암(Cancer), 외부 자극에 대한 반응(Response to external stimulus), 세포골격 단백질 결합(Cytoskeletal protein binding), 칼슘 이온 결합(Calcium ion binding), 소낭-매개 수송(Vesicle-mediated transport), 징크-핑거(Zinc-finger), 뉴클레오티드 결합(Nucleotide binding), 유기산 대사(Organic acid metabolism), 보체 및 응고 캐스케이 드(Complement and coagulation cascades), 알코올 대사(Alcohol metabolism), MAPKKK 캐스케이드(cascade), GTPase 조절 활성(regulator activity), 아팝토시스(apoptosis), 단백질 전달(protein transport), 형태 형성(morphogenesis), 면역반응(immune response), 세포 증식(cell proliferation), 지방산 대사(lipid metabolism), 화학물질 자극 반응(response to chemical stimulus) 또는 DNA 손상 반응(response to DNA damage stimulus) 등의 관련 유전자로 구성되어 있다.The biomarker is a gene whose expression is increased or decreased more than two times, and includes a cell cycle, a nucleic acid binding, a metal binding, an oxidoreductase activity, and an I-kappaB. Kinase / NF-kappaB cascade, Cancer, Response to external stimulus, Cytoskeletal protein binding, Calcium ion binding, vesicle Vesicle-mediated transport, zinc-finger, nucleotide binding, organic acid metabolism, complement and coagulation cascades, alcohol metabolism ( Alcohol metabolism, MAPKKK cascade, GTPase regulator activity, apoptosis, protein transport, morphogenesis, immune response, cell prolif It is composed of related genes such as eration, lipid metabolism, response to chemical stimulus, or response to DNA damage stimulus.

본 발명은 하기와 같이 구성된 군에서 선택되어지는 것을 특징으로 하는 바이오마커를 제공한다: The present invention provides a biomarker which is selected from the group consisting of:

유전자 등록번호(Genebank) AB209605(SKIV2L, Superkiller viralicidic activity 2-like(S. cerevisiae)), 유전자 등록번호(Genebank) AI200373(HIST1H2AL, Histone 1, H2al), 유전자 등록번호(Genebank) AK001594(AKAP8L, A kinase(PRKA) anchor protein 8-like), 유전자 등록번호(Genebank) AK057577(IRF3, Interferon regulatory factor 3), 유전자 등록번호(Genebank) AL832659(FLJ22833, Hypothetical protein FLJ22833), 유전자 등록번호(Genebank) BC034487(HIST1H2AK, Histone 1, H2ak), 유전자 등록번호(Genebank) BC034569(ZNF337, Zinc finger protein 337), 유전자 등록번호(Genebank) BC038432(RARA, Retinoic acid receptor, alpha), 유전자 등록번호(Genebank) BC067782(HIST1H2AG, Histone 1, H2ag), 유전자 등록번호(Genebank) BC069193(HIST2H2BE, Histone 2, H2be), 유전자 등록번호(Genebank) BC071638(HIST2H2BE, Histone 2, H2be), 유전자 등록번호(Genebank) BC082232(HIST1H2BG, Histone 1, H2bg), 유전자 등록번호(Genebank) BC101655(HIST1H2BI, Histone 1, H2bi), 유전자 등록번호(Genebank) BE741093(HIST1H2AE ,Histone 1, H2ae), 유전자 등록번호(Genebank) BE973853(HIST1H4J, Histone 1, H4j), 유전자 등록번호(Genebank) BM752802(HIST1H2BM, Histone 1, H2bm), 유전자 등록번호(Genebank) BM919305(POLR2L, Polymerase(RNA) II(DNA directed) polypeptide L, 7.6kDa), 유전자 등록번호(Genebank) BU603483(HIST1H1E, Histone 1, H1e), 유전자 등록번호(Genebank) BX436525(HIST1H2BH, Histone 1, H2bh), 유전자 등록번호(Genebank) BX647290(HIST1H2BO, Histone 1, H2bo), 유전자 등록번호(Genebank) CB529694(HIST2H2BE, Histone 2, H2be), 유전자 등록번호(Genebank) CD710576(HIST2H2AC, Histone 2, H2ac), 유전자 등록번호(Genebank) CK000930(HIST1H2AI, Histone 1, H2ai), 유전자 등록번호(Genebank) CR608156(HIST1H2AC, Histone 1, H2ac), 유전자 등록번호(Genebank) NM_002515(NOVA1, Neuro-oncological ventral antigen 1), 유전자 등록번호(Genebank) NM_003516(HIST2H2AA, Histone 2, H2aa), 유전자 등록번호(Genebank) NM_003519(HIST1H2BL, Histone 1, H2bl), 유전자 등록번호(Genebank) NM_003670(BHLHB2, Basic helix-loop-helix domain containing, class B, 2), 유전자 등록번호(Genebank) NM_004660(DDX3Y, DEAD(Asp-Glu-Ala-Asp) box polypeptide 3, Y-linked), 유전자 등록번호(Genebank) NM_005319(HIST1H1C, Histone 1, H1c), 유전자 등록번호(Genebank) NM_005320(HIST1H1D, Histone 1, H1d), 유전자 등록번호(Genebank) NM_005524(HES1, Hairy and enhancer of split 1,(Drosophila)), 유전자 등록번호(Genebank) NM_006442(DRAP1, DR1-associated protein 1(negative cofactor 2 alpha)), 유전자 등록번호(Genebank) NM_021035(KIAA1404, KIAA1404 protein), 유전자 등록번호(Genebank) U86136(TEP1, Telomerase-associated protein 1), 유전자 등록번호(Genebank) AB209586(MAPK13, Mitogen-activated protein kinase 13), 유전자 등록번호(Genebank) AK074652(SERTAD1, SERTA domain containing 1), 유전자 등록번호(Genebank) AK122829(GAS2L1, Growth arrest-specific 2 like 1), 유전자 등록번호(Genebank) AK129595(GADD45B, Growth arrest and DNA-damage-inducible, beta), 유전자 등록번호(Genebank) BC018266(CDC42, Cell division cycle 42(GTP binding protein, 25kDa)), 유전자 등록번호(Genebank) BC041022(SCAND1, SCAN domain containing 1), 유전자 등록번호(Genebank) BM904612(S100A6, S100 calcium binding protein A6(calcyclin)), 유전자 등록번호(Genebank) BM913048(TIMP1, TIMP metallopeptidase inhibitor 1), 유전자 등록번호(Genebank) CR612719(GADD45A, Growth arrest and DNA-damage-inducible, alpha), 유전자 등록번호(Genebank) NM_001007271(DUSP13, Dual specificity phosphatase 13), 유전자 등록번호(Genebank) NM_001015053(HDAC5, Histone deacetylase 5), 유전자 등록번호(Genebank) NM_001953(ECGF1, Endothelial cell growth factor 1(platelet-derived)), 유전자 등록번호(Genebank) NM_003255(TIMP2, TIMP metallopeptidase inhibitor 2), 유전자 등록 번호(Genebank) NM_005072(SLC12A4, Solute carrier family 12(potassium/chloride transporters), member 4), 유전자 등록번호(Genebank) NM_005343(HRAS, V-Ha-ras Harvey rat sarcoma viral oncogene homolog), 유전자 등록번호(Genebank) NM_005736(ACTR1A, ARP1 actin-related protein 1 homolog A, centractin alpha(yeast)), 유전자 등록번호(Genebank) NM_007065(CDC37, CDC37 cell division cycle 37 homolog(S. cerevisiae)), 유전자 등록번호(Genebank) NM_078467(CDKN1A, Cyclin-dependent kinase inhibitor 1A(p21, Cip1)), 유전자 등록번호(Genebank) U68019(SMAD3, SMAD, mothers against DPP homolog 3(Drosophila)), 유전자 등록번호(Genebank) X02812(TGFB1, Transforming growth factor, beta 1(Camurati-Engelmann disease)), 유전자 등록번호(Genebank) AB033060(PDCD6, Aryl-hydrocarbon receptor repressor), 유전자 등록번호(Genebank) AB209361(FAS, Fas(TNF receptor superfamily, member 6)), 유전자 등록번호(Genebank) AF332558(BBC3, BCL2 binding component 3), 유전자 등록번호(Genebank) AY028896(CARD10, Caspase recruitment domain family, member 10), 유전자 등록번호(Genebank) BC063507(HSPA1B, Heat shock 70kDa protein 1B), 유전자 등록번호(Genebank) BM557864(HSPB1, Heat shock 27kDa protein 1), 유전자 등록번호(Genebank) NM_001003940(BMF ,Bcl2 modifying factor), 유전자 등록번호(Genebank) NM_001165(BIRC3, Baculoviral IAP repeat-containing 3), 유전자 등록번호(Genebank) NM_001197(BIK, BCL2-interacting killer(apoptosis-inducing)), 유전자 등록번호(Genebank) NM_002305(LGALS1, Lectin, galactoside- binding, soluble, 1(galectin 1)), 유전자 등록번호(Genebank) NM_003311(PHLDA2, Pleckstrin homology-like domain, family A, member 2), 유전자 등록번호(Genebank) NM_003639(IKBKG, Inhibitor of kappa light polypeptide gene enhancer in B-cells, kinase gamma), 유전자 등록번호(Genebank) NM_003820(TNFRSF14, Tumor necrosis factor receptor superfamily, member 14(herpesvirus entry mediator)), 유전자 등록번호(Genebank) NM_003897(IER3, Immediate early response 3), 유전자 등록번호(Genebank) NM_004401(DFFA, DNA fragmentation factor, 45kDa, alpha polypeptide), 유전자 등록번호(Genebank) NM_016639(TNFRSF12A, Tumor necrosis factor receptor superfamily, member 12A), 유전자 등록번호(Genebank) BC048334(MT1G, Metallothionein 1G), 유전자 등록번호(Genebank) BC053882(MT1X, Metallothionein 1X), 유전자 등록번호(Genebank) BI488702(MT1K, Metallothionein 1M), 유전자 등록번호(Genebank) NM_005947(MT1B, Metallothionein 1B(functional)), 유전자 등록번호(Genebank) AK055088(CYP2J2, Cytochrome P450, family 2, subfamily J, polypeptide 2), 유전자 등록번호(Genebank) AK094474(RHOC, Ras homolog gene family, member C), 유전자 등록번호(Genebank) BC015041(VAT1, Family with sequence similarity 82, member C), 유전자 등록번호(Genebank) NM_000499(CYP1A1, Cytochrome P450, family 1, subfamily A, polypeptide 1), 유전자 등록번호(Genebank) NM_004881(TP53I3, Tumor protein p53 inducible protein 3), 유전자 등록번호(Genebank) NM_201397(GPX1, Glutathione peroxidase 1), 유전자 등록번호(Genebank) XM_498018(LOC391827, Similar to Keratin, type I cytoskeletal 18(Cytokeratin 18)(K18)(CK 18)), 유전자 등록번호(Genebank) AF524864(AKR1B10, Aldo-keto reductase family 1, member B10(aldose reductase)), 유전자 등록번호(Genebank) AL833205(ETFB, Electron-transfer-flavoprotein, beta polypeptide), 유전자 등록번호(Genebank) BC034763(FDXR, Ferredoxin reductase), 유전자 등록번호(Genebank) CR610878(AKR1B1, Aldo-keto reductase family 1, member B1(aldose reductase)), 유전자 등록번호(Genebank) NM_003330(TXNRD1, Thioredoxin reductase 1), 유전자 등록번호(Genebank) NM_004199(P4HA2, Procollagen-proline, 2-oxoglutarate 4-dioxygenase(proline 4-hydroxylase), alpha polypeptide II), 유전자 등록번호(Genebank) NM_004753(DHRS3, Dehydrogenase/reductase(SDR family) member 3), 유전자 등록번호(Genebank) NM_031226(CYP19A1, Cytochrome P450, family 19, subfamily A, polypeptide 1), 유전자 등록번호(Genebank) NM_032468(ASPH, Aspartate beta-hydroxylase), 유전자 등록번호(Genebank) AB209112(SLC2A8, Solute carrier family 2,(facilitated glucose transporter) member 8), 유전자 등록번호(Genebank) BC011409(UGT1A6, UDP glucuronosyltransferase 1 family, polypeptide A9), 유전자 등록번호(Genebank) H18681(C20orf139, Sulfiredoxin 1 homolog(S. cerevisiae)), 유전자 등록번호(Genebank) NM_002658(PLAU, Plasminogen activator, urokinase), 유전자 등록번호(Genebank) NM_005064(CCL23, Chemokine(C-C motif) ligand 23), 유전자 등록번 호(Genebank) NM_032965(CCL14, Chemokine(C-C motif) ligand 15), 유전자 등록번호(Genebank) Y11307(CYR61, Cysteine-rich, angiogenic inducer, 61), 유전자 등록번호(Genebank) AB209808(AP1M1, Adaptor-related protein complex 1, mu 1 subunit), 유전자 등록번호(Genebank) AK074154(SYTL1, Synaptotagmin-like 1), 유전자 등록번호(Genebank) AK098475(GRPEL1, GrpE-like 1, mitochondrial(E. coli)), 유전자 등록번호(Genebank) AK123405(GDI1, GDP dissociation inhibitor 1), 유전자 등록번호(Genebank) BC000786(ARFGAP1, ADP-ribosylation factor GTPase activating protein 1), 유전자 등록번호(Genebank) BC042390(VTI1B, Vesicle transport through interaction with t-SNAREs homolog 1B(yeast)), 유전자 등록번호(Genebank) BG036385(RAMP1, Receptor(calcitonin) activity modifying protein 1), 유전자 등록번호(Genebank) BX648781(GABARAPL1, GABA(A) receptor-associated protein like 1), 유전자 등록번호(Genebank) NM_001013839(EXOC7, Exocyst complex component 7), 유전자 등록번호(Genebank) NM_002926(RGS12, Regulator of G-protein signalling 12), 유전자 등록번호(Genebank) NM_007097(CLTB, Clathrin, light polypeptide(Lcb)), 유전자 등록번호(Genebank) NM_013336(SEC61A1, Sec61 alpha 1 subunit(S. cerevisiae)), 유전자 등록번호(Genebank) NM_024101(MLPH, Melanophilin), 유전자 등록번호(Genebank) NM_032872(SYTL1, Synaptotagmin-like 1), 유전자 등록번호(Genebank) NM_000596(IGFBP1, Insulin-like growth factor binding protein 1), 유전자 등록번호(Genebank) NM_001553(IGFBP7, Insulin-like growth factor binding protein 7), 유전자 등록번호(Genebank) NM_001712(CEACAM1, Carcinoembryonic antigen-related cell adhesion molecule 1(biliary glycoprotein)), 유전자 등록번호(Genebank) NM_012396(PHLDA3, Pleckstrin homology-like domain, family A, member 3), 유전자 등록번호(Genebank) Y12692(WNT11, Wingless-type MMTV integration site family, member 11), 유전자 등록번호(Genebank) BC014470(AZGP1, Alpha-2-glycoprotein 1, zinc), 유전자 등록번호(Genebank) BQ683841(S100A11, S100 calcium binding protein A11(calgizzarin)), 유전자 등록번호(Genebank) NM_002337(LRPAP1, Low density lipoprotein receptor-related protein associated protein 1), 유전자 등록번호(Genebank) AF059617(PLK2, Polo-like kinase 2(Drosophila)), 유전자 등록번호(Genebank) AK128553(ZZANK1, Mindbomb homolog 2(Drosophila)), 유전자 등록번호(Genebank) BX649164(PAI; PAI1; PAI-1; PLANH1, serpin peptidase inhibitor, clade E(nexin, plasminogen activator inhibitor type 1), member 1), 유전자 등록번호(Genebank) NM_000602(SERPINE1, Serpin peptidase inhibitor, clade E(nexin, plasminogen activator inhibitor type 1), member 1), 유전자 등록번호(Genebank) BI767815(GP9, Glycoprotein IX(platelet)), 유전자 등록번호(Genebank) BM918324(LY96, Lymphocyte antigen 96), 유전자 등록번호(Genebank) NM_006404(PROCR, Protein C receptor, endothelial(EPCR)), 유전자 등록번호(Genebank) AF031469(MR1, Major histocompatibility complex, class I-related), 유전자 등록번호(Genebank) BF569086(NK4, Interleukin 32), 유전자 등 록번호(Genebank) BG564326(SAA4, Serum amyloid A4, constitutive), 유전자 등록번호(Genebank) NM_001633(AMBP, Alpha-1-microglobulin/bikunin precursor), 유전자 등록번호(Genebank) NM_005532(IFI27, Interferon, alpha-inducible protein 27), 유전자 등록번호(Genebank) NM_017670(OTUB1, OTU domain, ubiquitin aldehyde binding 1), 유전자 등록번호(Genebank) AK130130(CAPG, Capping protein(actin filament), gelsolin-like), 유전자 등록번호(Genebank) BX648190(WDR1, WD repeat domain 1), 유전자 등록번호(Genebank) CF552540(TNNI2, Troponin I type 2(skeletal, fast)), 유전자 등록번호(Genebank) NM_001006946(SDC1, Syndecan 1), 유전자 등록번호(Genebank) NM_007284(PTK9L, PTK9L protein tyrosine kinase 9-like(A6-related protein)), 유전자 등록번호(Genebank) NM_015990(KLHL5, Kelch-like 5(Drosophila)), 유전자 등록번호(Genebank) BM467105(CIB1, Calcium and integrin binding 1(calmyrin)), 유전자 등록번호(Genebank) CF553054(TNNC1, Troponin C type 1(slow)), 유전자 등록번호(Genebank) NM_006384(CIB1, Calcium and integrin binding 1(calmyrin)), 유전자 등록번호(Genebank) NM_080388(S100A16, S100 calcium binding protein A16), 유전자 등록번호(Genebank) NM_005817(M6PRBP1, Mannose-6-phosphate receptor binding protein 1), 유전자 등록번호(Genebank) NM_006555(YKT6, SNARE protein Ykt6), 유전자 등록번호(Genebank) AK093461(ISYNA1, Myo-inositol 1-phosphate synthase A1), 유전자 등록번호(Genebank) AK097009(PLTP,phospholipid transfer protein), 유전자 등록번호(Genebank) BC030207(NR0B2, Nuclear receptor subfamily 0, group B, member 2), 유전자 등록번호(Genebank) BC035124(UNQ2541, MSFL2541), 유전자 등록번호(Genebank) NM_145323(OSBPL3, Oxysterol binding protein-like 3), 유전자 등록번호(Genebank) BC050455(DDB2, LIM homeobox 3), 유전자 등록번호(Genebank) BC068535(TP53AP1, TP53 activated protein 1), 유전자 등록번호(Genebank) NM_016440(VRK3, Vaccinia related kinase 3), 유전자 등록번호(Genebank) NM_001124(ADM, Adrenomedullin), 유전자 등록번호(Genebank) NM_170707(LMNA, Lamin A/C), 유전자 등록번호(Genebank) NM_004633(IL1R2, Interleukin 1 receptor, type II), 유전자 등록번호(Genebank) NM_004864(GDF15, Growth differentiation factor 15), 유전자 등록번호(Genebank) NM_017572(MKNK2, MAP kinase interacting serine/threonine kinase 2), 유전자 등록번호(Genebank) AA669162(AMPD3, Transcribed locus), 유전자 등록번호(Genebank) AB033073(SULF2, Sulfatase 2), 유전자 등록번호(Genebank) AB208949(LRDD, Leucine-rich repeats and death domain containing), 유전자 등록번호(Genebank) AK022712(FLJ12650, Family with sequence similarity 77, member C), 유전자 등록번호(Genebank) AK095363(AQP3, Aquaporin 3), 유전자 등록번호(Genebank) AY368150(CHR2SYT, Family with sequence similarity 62(C2 domain containing) member B), 유전자 등록번호(Genebank) BU587578(RGS10, Regulator of G-protein signalling 10), 유전자 등록번호(Genebank) BU945318(MT2A, Hypothetical gene supported by X97260; BC070289), 유전자 등록번호(Genebank) NM_001013632(LOC343521, Similar to hypothetical protein 4833401D15), 유전자 등록번호(Genebank) NM_006426(DPYSL4, Dihydropyrimidinase-like 4), 유전자 등록번호(Genebank) NM_133493(CD109, CD109 antigen(Gov platelet alloantigens)), 유전자 등록번호(Genebank) NM_145256(LRRC25, Leucine rich repeat containing 25), 유전자 등록번호(Genebank) AB033337(MPHOSPH1,M-phase phosphoprotein 1), 유전자 등록번호(Genebank) AB208875(Septin 10,Septin 10 ), 유전자 등록번호(Genebank) AF053305(BUB1,BUB1 budding uninhibited by benzimidazoles 1 homolog(yeast)), 유전자 등록번호(Genebank) AF053306(BUB1B,BUB1 budding uninhibited by benzimidazoles 1 homolog beta(yeast)), 유전자 등록번호(Genebank) AF345347(SPAG5,Sperm associated antigen 5), 유전자 등록번호(Genebank) AK222819(NUSAP1,Nucleolar and spindle associated protein 1), 유전자 등록번호(Genebank) AY367065(ASPM,Asp(abnormal spindle)-like, microcephaly associated(Drosophila)), 유전자 등록번호(Genebank) BC004352(KIF22,Kinesin family member 22), 유전자 등록번호(Genebank) BC010607(IGF1R,Insulin-like growth factor 1 receptor), 유전자 등록번호(Genebank) BC011000(CDCA5,Cell division cycle associated 5), 유전자 등록번호(Genebank) BC013326(GAS2,Growth arrest-specific 2), 유전자 등록번호(Genebank) BC032677(UBE2C,Ubiquitin-conjugating enzyme E2C), 유전자 등록번호(Genebank) BC040991(TFDP2,Transcription factor Dp-2(E2F dimerization partner 2)), 유전자 등록번호(Genebank) BC050384(SUPT3H,Suppressor of Ty 3 homolog(S. cerevisiae)), 유전자 등록번호(Genebank) BC068483(RINT-1,Rad50-interacting protein 1), 유전자 등록번호(Genebank) BQ278454(CKS1B,CDC28 protein kinase regulatory subunit 1B), 유전자 등록번호(Genebank) BX647885(STMN1,Stathmin 1/oncoprotein 18), 유전자 등록번호(Genebank) CR604810(CCNA2,Cyclin A2), 유전자 등록번호(Genebank) CR933728(CDC2,Cell division cycle 2, G1 to S and G2 to M), 유전자 등록번호(Genebank) D42045(DCLRE1A,DNA cross-link repair 1A(PSO2 homolog, S. cerevisiae)), 유전자 등록번호(Genebank) NM_00089(HK2,Hexokinase 2), 유전자 등록번호(Genebank) NM_001005414(ZWINT,ZW10 interactor antisense), 유전자 등록번호(Genebank) NM_001018159(APPBP1,Amyloid beta precursor protein binding protein 1), 유전자 등록번호(Genebank) NM_001239(CCNH,Cyclin H), 유전자 등록번호(Genebank) NM_001790(CDC25C,Cell division cycle 25C), 유전자 등록번호(Genebank) NM_001827(CKS2,CDC28 protein kinase regulatory subunit 2), 유전자 등록번호(Genebank) NM_002431(MNAT1,Menage a trois 1(CAK assembly factor)), 유전자 등록번호(Genebank) NM_002467(MYC,V-myc myelocytomatosis viral oncogene homolog(avian)), 유전자 등록번호(Genebank) NM_002709(PPP1CB,Protein phosphatase 1, catalytic subunit, beta isoform), 유전자 등록번호(Genebank) NM_002737(PRKCA,Protein kinase C, alpha), 유전자 등록번호(Genebank) NM_002894(RBBP8,Retinoblastoma binding protein 8), 유전자 등록번호(Genebank) NM_003318(TTK,TTK protein kinase), 유전자 등록번호(Genebank) NM_003478(CUL5,Cullin 5), 유전자 등록번호(Genebank) NM_003981(PRC1,Protein regulator of cytokinesis 1), 유전자 등록번호(Genebank) NM_004064(CDKN1B,Cyclin-dependent kinase inhibitor 1B(p27, Kip1)), 유전자 등록번호(Genebank) NM_004354(CCNG2,Cyclin G2), 유전자 등록번호(Genebank) NM_004365(CETN3,Centrin, EF-hand protein, 3(CDC31 homolog, yeast)), 유전자 등록번호(Genebank) NM_004523(KIF11,Kinesin family member 11), 유전자 등록번호(Genebank) NM_004701(CCNB2,Cyclin B2), 유전자 등록번호(Genebank) NM_005504(BCAT1,Branched chain aminotransferase 1, cytosolic), 유전자 등록번호(Genebank) NM_005915(MCM6,MCM6 minichromosome maintenance deficient 6(MIS5 homolog, S. pombe)(S. cerevisiae)), 유전자 등록번호(Genebank) NM_006101(KNTC2,Kinetochore associated 2), 유전자 등록번호(Genebank) NM_006265(RAD21,RAD21 homolog(S. pombe)), 유전자 등록번호(Genebank) NM_014750(DLG7,Discs, large homolog 7(Drosophila)), 유전자 등록번호(Genebank) NM_014751(MTSS1,Metastasis suppressor 1), 유전자 등록번호(Genebank) NM_016343(CENPF,Centromere protein F, 350/400ka(mitosin)), 유전자 등록번호(Genebank) NM_018492(PBK,PDZ binding kinase), 유전자 등록번호(Genebank) NM_018685(ANLN,Anillin, actin binding protein(scraps homolog, Drosophila)), 유전자 등록번호(Genebank) NM_019001(XRN1,5'-3' exoribonuclease 1), 유전자 등록번호(Genebank) NM_019063(EML4,Echinoderm microtubule associated protein like 4), 유전자 등록번호(Genebank) NM_020242(KNSL7,Kinesin family member 15), 유전자 등록번호(Genebank) U65410(MAD2L1,MAD2 mitotic arrest deficient-like 1(yeast)), 유전자 등록번호(Genebank) AB096175(SP5,Sp5 transcription factor), 유전자 등록번호(Genebank) AB209086(ZNF493,Zinc finger protein 493), 유전자 등록번호(Genebank) AB209334(SP3,Sp3 transcription factor), 유전자 등록번호(Genebank) AB209892(ZFX,Zinc finger protein, X-linked), 유전자 등록번호(Genebank) AF279145(ANTXR1,Anthrax toxin receptor 1), 유전자 등록번호(Genebank) AK095600(FLJ38281,Zinc finger protein 564), 유전자 등록번호(Genebank) AK123010(RRM2,Ribonucleotide reductase M2 polypeptide), 유전자 등록번호(Genebank) AK126180(DTYMK,Deoxythymidylate kinase(thymidylate kinase)), 유전자 등록번호(Genebank) AK130071(HSPC063,BTB(POZ) domain containing 15), 유전자 등록번호(Genebank) AK131420(ZNF66,Zinc finger protein 66), 유전자 등록번호(Genebank) AK131472(Homo sapiens cDNA FLJ16640 fis, clone TESTI4028938, moderately similar to Zinc finger protein 85. [AK131472],CDNA FLJ16640 fis, clone TESTI4028938, moderately similar to Zinc finger protein 85), 유전자 등록번호(Genebank) AK131527(ZNF15L1,Zinc finger protein 708(KOX8)), 유전자 등록번호(Genebank) AK160373(DKFZp547K1113,Zinc finger protein 710), 유전자 등록번호(Genebank) AL832422(ZNF430,Zinc finger protein 430), 유전자 등록번호(Genebank) AY269786(ZNF429,Zinc finger protein 429), 유전자 등록번호(Genebank) BC035579(ZNF100,Zinc finger protein 100), 유전자 등록번호(Genebank) BC036394(ZNF85,Zinc finger protein 85(HPF4, HTF1)), 유전자 등록번호(Genebank) BM466459(DGKI,Diacylglycerol kinase, iota), 유전자 등록번호(Genebank) BX537574(FREM1,FRAS1 related extracellular matrix 1), 유전자 등 록번호(Genebank) BX537987(TRIM59,Tripartite motif-containing 59), 유전자 등록번호(Genebank) BX648469(ATF2,Activating transcription factor 2), 유전자 등록번호(Genebank) CR608275(CBLL1,Cas-Br-M(murine) ecotropic retroviral transforming sequence-like 1), 유전자 등록번호(Genebank) CR749233(ZNF626,Zinc finger protein 626), 유전자 등록번호(Genebank) CR749832(IMPDH1,IMP(inosine monophosphate) dehydrogenase 1), 유전자 등록번호(Genebank) CR936615(MATR3,Matrin 3), 유전자 등록번호(Genebank) NM_000946(PRIM1,Primase, polypeptide 1, 49kDa), 유전자 등록번호(Genebank) NM_001123(ADK,Adenosine kinase), 유전자 등록번호(Genebank) NM_002317(LOX,Lysyl oxidase), 유전자 등록번호(Genebank) NM_002655(PLAG1,Pleiomorphic adenoma gene 1), 유전자 등록번호(Genebank) NM_003423(ZNF43,Zinc finger protein 43(HTF6)), 유전자 등록번호(Genebank) NM_005180(PCGF4,Polycomb group ring finger 4), 유전자 등록번호(Genebank) NM_014615(KIAA0182,KIAA0182 protein), 유전자 등록번호(Genebank) NM_014919(WHSC1,Wolf-Hirschhorn syndrome candidate 1), 유전자 등록번호(Genebank) NM_015040(PIP5K3,Phosphatidylinositol-3-phosphate/phosphatidylinositol 5-kinase, type III), 유전자 등록번호(Genebank) NM_015387(PREI3,Preimplantation protein 3), 유전자 등록번호(Genebank) NM_015905(TIF1,Tripartite motif-containing 24), 유전자 등록번호(Genebank) NM_016513(ICK,Intestinal cell(MAK-like) kinase), 유전자 등록번호(Genebank) NM_016626(RKHD2,Ring finger and KH domain containing 2), 유전자 등록번 호(Genebank) NM_018660(ZNF395,Zinc finger protein 395), 유전자 등록번호(Genebank) NM_021129(PP,Pyrophosphatase(inorganic) 1), 유전자 등록번호(Genebank) NM_025074(FRAS1,Fraser syndrome 1), 유전자 등록번호(Genebank) NM_173694(ATP11C,ATPase, Class VI, type 11C), 유전자 등록번호(Genebank) NM_176869(PPA2,Pyrophosphatase(inorganic) 2), 유전자 등록번호(Genebank) NM_182851(CCNB1IP1,Cyclin B1 interacting protein 1), 유전자 등록번호(Genebank) NM_199040(NUDT4,Nudix(nucleoside diphosphate linked moiety X)-type motif 4 pseudogene 2), 유전자 등록번호(Genebank) AK122869(LOC148213,Zinc finger protein 681), 유전자 등록번호(Genebank) BC042500(MGC42493,Hypothetical protein MGC15634), 유전자 등록번호(Genebank) BC043147(ZNF539,Zinc finger protein 254), 유전자 등록번호(Genebank) BC044060(ZNF650,Zinc finger protein 650), 유전자 등록번호(Genebank) BC050340(ZNF230,Zinc finger protein 230), 유전자 등록번호(Genebank) CR749800(ZNFN1A5,Zinc finger protein, subfamily 1A, 5), 유전자 등록번호(Genebank) CR936695(ZNF468,Zinc finger protein ZNF468), 유전자 등록번호(Genebank) NM_001009881(ZCCHC11,Zinc finger, CCHC domain containing 11), 유전자 등록번호(Genebank) NM_003441(ZNF141,Zinc finger protein 141(clone pHZ-44)), 유전자 등록번호(Genebank) NM_006526(ZNF217,Zinc finger protein 217), 유전자 등록번호(Genebank) NM_007146(ZNF161,Zinc finger protein 161), 유전자 등록번호(Genebank) NM_015336(ZDHHC17,Zinc finger, DHHC-type containing 17), 유전자 등록번호(Genebank) NM_016220(ZNF588,Zinc finger protein 588), 유전자 등록번호(Genebank) NM_017742(ZCCHC2,Zinc finger, CCHC domain containing 2), 유전자 등록번호(Genebank) NM_021994(ZNF277,Zinc finger protein 277), 유전자 등록번호(Genebank) NM_024733(FLJ14345,Zinc finger protein 665), 유전자 등록번호(Genebank) NM_032367(ZBED3,Zinc finger, BED-type containing 3), 유전자 등록번호(Genebank) NM_033114(MADP-1,MADP-1 protein), 유전자 등록번호(Genebank) NM_133473(ZNF431,Zinc finger protein 431), 유전자 등록번호(Genebank) NM_152626(ZNF92,Zinc finger protein 92(HTF12)), 유전자 등록번호(Genebank) NM_178558(FLJ90430,Zinc finger protein 680), 유전자 등록번호(Genebank) NM_198893(ZNF160,Zinc finger protein 160), 유전자 등록번호(Genebank) XM_047550(ZNF492,Zinc finger protein 492), 유전자 등록번호(Genebank) XM_290865(LOC163233,Similar to Zinc finger protein 93(Zinc finger protein HTF34)), 유전자 등록번호(Genebank) XM_371174(ZNF283,Zinc finger protein 283), 유전자 등록번호(Genebank) AB023141(ZNF652,Zinc finger protein 652), 유전자 등록번호(Genebank) AB209245(HMGN1,High-mobility group nucleosome binding domain 1), 유전자 등록번호(Genebank) AB209389(GTF2IRD1,GTF2I repeat domain containing 1), 유전자 등록번호(Genebank) AB209562(HNRPK,Heterogeneous nuclear ribonucleoprotein K), 유전자 등록번호(Genebank) AB209753(RBM7,RNA binding motif protein 7), 유전자 등록번호(Genebank) AF136171(EAP; HBP15; HBP15/L22,ribosomal protein L22), 유전자 등록번호(Genebank) AK001230(POT1,POT1 protection of telomeres 1 homolog(S. pombe)), 유전자 등록번호(Genebank) AK022942(LOC58486,Transposon-derived Buster1 transposase-like protein gene), 유전자 등록번호(Genebank) AK025758(NFATC2,Nuclear factor of activated T-cells, cytoplasmic, calcineurin-dependent 2), 유전자 등록번호(Genebank) AK056803(H2AFZ,H2A histone family, member Z), 유전자 등록번호(Genebank) AK074119(ZZZ3,Zinc finger, ZZ-type containing 3), 유전자 등록번호(Genebank) AK091927(SFRS3,Splicing factor, arginine/serine-rich 3), 유전자 등록번호(Genebank) AK095937(GC20,Translation factor sui1 homolog), 유전자 등록번호(Genebank) AK124178(EIF3S6,Eukaryotic translation initiation factor 3, subunit 6 48kDa), 유전자 등록번호(Genebank) AL110212(H2AFV,H2A histone family, member V), 유전자 등록번호(Genebank) BC010266(HNRNPA1; MGC102835,Heterogeneous nuclear ribonucleoprotein A1), 유전자 등록번호(Genebank) BM464978(HMGN2,High-mobility group nucleosomal binding domain 2), 유전자 등록번호(Genebank) BM800367(RPL21,Ribosomal protein L21), 유전자 등록번호(Genebank) BU677381(RPL21,Ribosomal protein L21), 유전자 등록번호(Genebank) BX647205(HNRPH1,Heterogeneous nuclear ribonucleoprotein H1(H)), 유전자 등록번호(Genebank) BX647217(HNRPA3,Heterogeneous nuclear ribonucleoprotein A3), 유전자 등록번호(Genebank) CR625990(PC4,SUB1 homolog(S. cerevisiae)), 유전자 등록번호(Genebank) CR627133(LOC342892,Hypothetical protein LOC342892), 유전자 등록번호(Genebank) NM_000947(PRIM2A,Primase, polypeptide 2A, 58kDa), 유전자 등록번호(Genebank) NM_000983(RPL22,Ribosomal protein L22), 유전자 등록번호(Genebank) NM_001015886(HMGA2,High mobility group AT-hook 2), 유전자 등록번호(Genebank) NM_001017430(RBM3,RNA binding motif(RNP1, RRM) protein 3), 유전자 등록번호(Genebank) NM_001018067(PAI-RBP1,SERPINE1 mRNA binding protein 1), 유전자 등록번호(Genebank) NM_001412(EIF1AX,Eukaryotic translation initiation factor 1A, X-linked), 유전자 등록번호(Genebank) NM_001809(CENPA,Centromere protein A, 17kDa), 유전자 등록번호(Genebank) NM_002139(RBMX,RNA binding motif protein, X-linked), 유전자 등록번호(Genebank) NM_002568(PABPC1,Poly(A) binding protein, cytoplasmic 1), 유전자 등록번호(Genebank) NM_003972(BTAF1,BTAF1 RNA polymerase II, B-TFIID transcription factor-associated, 170kDa(Mot1 homolog, S. cerevisiae)), 유전자 등록번호(Genebank) NM_004454(ETV5,Ets variant gene 5(ets-related molecule)), 유전자 등록번호(Genebank) NM_005463(HNRPDL,Heterogeneous nuclear ribonucleoprotein D-like), 유전자 등록번호(Genebank) NM_006047(CPNE1,RNA binding motif protein 12), 유전자 등록번호(Genebank) NM_006345(SLC30A9,Solute carrier family 30(zinc transporter), member 9), 유전자 등록번호(Genebank) NM_006451(PAIP1,Poly(A) binding protein interacting protein 1), 유전자 등록번호(Genebank) NM_006546(IMP-1,IGF-II mRNA-binding protein 1), 유전자 등록번호(Genebank) NM_006716(ASK,DBF4 homolog(S. cerevisiae)), 유전자 등록번호(Genebank) NM_006775(QKI,Quaking homolog, KH domain RNA binding(mouse)), 유 전자 등록번호(Genebank) NM_007080(LSM6,LSM6 homolog, U6 small nuclear RNA associated(S. cerevisiae)), 유전자 등록번호(Genebank) NM_007208(MRPL3,Mitochondrial ribosomal protein L3), 유전자 등록번호(Genebank) NM_012207(HNRPH3,Heterogeneous nuclear ribonucleoprotein H3(2H9)), 유전자 등록번호(Genebank) NM_014321(ORC6L,Origin recognition complex, subunit 6 homolog-like(yeast)), 유전자 등록번호(Genebank) NM_014393(STAU2,Staufen, RNA binding protein, homolog 2(Drosophila)), 유전자 등록번호(Genebank) NM_014892(RBM16,RNA binding motif protein 16), 유전자 등록번호(Genebank) NM_015361(R3HDM,R3H domain containing 1), 유전자 등록번호(Genebank) NM_015975(TAF9L,TAF9-like RNA polymerase II, TATA box binding protein(TBP)-associated factor, 31kDa), 유전자 등록번호(Genebank) NM_016200(LSM8,LSM8 homolog, U6 small nuclear RNA associated(S. cerevisiae)), 유전자 등록번호(Genebank) NM_017437(CPSF2,Cleavage and polyadenylation specific factor 2, 100kDa), 유전자 등록번호(Genebank) NM_018048(FLJ10292,Mago-nashi homolog), 유전자 등록번호(Genebank) NM_018237(CCAR1,Cell division cycle and apoptosis regulator 1), 유전자 등록번호(Genebank) NM_031157(HNRPA1,Heterogeneous nuclear ribonucleoprotein A1), 유전자 등록번호(Genebank) NM_032390(MKI67IP,MKI67(FHA domain) interacting nucleolar phosphoprotein), 유전자 등록번호(Genebank) NM_033222(PSIP1,PC4 and SFRS1 interacting protein 1), 유전자 등록번호(Genebank) NM_054016(FUSIP1,FUS interacting protein(serine/arginine-rich) 1), 유전자 등록번호(Genebank) NM_145018(FLJ25416,Hypothetical protein FLJ25416), 유전자 등록번호(Genebank) NM_153333(TCEAL8,Transcription elongation factor A(SII)-like 8), 유전자 등록번호(Genebank) NM_203463(LASS6,LAG1 longevity assurance homolog 6(S. cerevisiae)), 유전자 등록번호(Genebank) NM_206866(BACH1,BTB and CNC homology 1, basic leucine zipper transcription factor 1), 유전자 등록번호(Genebank) U38847(TARBP1,TAR(HIV) RNA binding protein 1), 유전자 등록번호(Genebank) XM_371470(LOC388907,Similar to ribosomal protein L5; 60S ribosomal protein L5), 유전자 등록번호(Genebank) XM_372050(LOC389674,Heterogeneous nuclear ribonucleoprotein A1 pseudogene 4), 유전자 등록번호(Genebank) XM_372396(LOC390158,Olfactory receptor, family 8, subfamily K, member 1), 유전자 등록번호(Genebank) XM_496355(LOC440577,Similar to nucleophosmin 1; nucleolar phosphoprotein B23; numatrin; nucleophosmin/nucleoplasmin family, member 1), 유전자 등록번호(Genebank) XM_498328(LOC392345,Similar to PRED65), 유전자 등록번호(Genebank) XM_499298(FLJ46189,similar to Zinc finger protein 479(Zinc finger protein Kr19)(HKr19)), 유전자 등록번호(Genebank) XM_499343(PEG10,Paternally expressed 10), 유전자 등록번호(Genebank) AB013380(ABCB10,ATP-binding cassette, sub-family B(MDR/TAP), member 10), 유전자 등록번호(Genebank) AB018342(MYO10,Myosin X), 유전자 등록번호(Genebank) AK025258(UMP-CMPK,Cytidylate kinase), 유전자 등록번호(Genebank) AK098205(AK3L1,Adenylate kinase 3), 유전자 등록번호(Genebank) AK122685(GLUD1,Glutamate dehydrogenase 1), 유전자 등록번호(Genebank) AK122695(RRM1,Ribonucleotide reductase M1 polypeptide), 유전자 등록번호(Genebank) AK126343(STK39,Serine threonine kinase 39(STE20/SPS1 homolog, yeast)), 유전자 등록번호(Genebank) BC051861(SPATA5L1,Spermatogenesis associated 5-like 1), 유전자 등록번호(Genebank) BC064610(SEPHS1,Selenophosphate synthetase 1), 유전자 등록번호(Genebank) BX640965(SLC22A3,Solute carrier family 22(extraneuronal monoamine transporter), member 3), 유전자 등록번호(Genebank) D86550(DYRK1A,Dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 1A), 유전자 등록번호(Genebank) NM_006343(MERTK,C-mer proto-oncogene tyrosine kinase), 유전자 등록번호(Genebank) NM_012073(CCT5,Chaperonin containing TCP1, subunit 5(epsilon)), 유전자 등록번호(Genebank) NM_020326(ABCD4,ATP-binding cassette, sub-family D(ALD), member 4), 유전자 등록번호(Genebank) NM_030752(TCP1,T-complex 1), 유전자 등록번호(Genebank) NM_030919(C20orf129,Chromosome 20 open reading frame 129), 유전자 등록번호(Genebank) NM_182964(NAV2,Neuron navigator 2), 유전자 등록번호(Genebank) AF020038(IDH1,Isocitrate dehydrogenase 1(NADP+), soluble), 유전자 등록번호(Genebank) AK093311(ACAA2,Acetyl-Coenzyme A acyltransferase 2(mitochondrial 3-oxoacyl-Coenzyme A thiolase)), 유전자 등록번호(Genebank) BC008366(DDC,Dopa decarboxylase(aromatic L-amino acid decarboxylase)), 유전자 등록번호(Genebank) BC012616(BHMT,Betaine-homocysteine methyltransferase), 유전자 등록번호(Genebank) BC015062(MTHFD2,Methylenetetrahydrofolate dehydrogenase(NADP+ dependent) 2, methenyltetrahydrofolate cyclohydrolase), 유전자 등록번호(Genebank) BC033320(TAF9,TAF9 RNA polymerase II, TATA box binding protein(TBP)-associated factor, 32kDa), 유전자 등록번호(Genebank) BC033517(ACOX2,Acyl-Coenzyme A oxidase 2, branched chain), 유전자 등록번호(Genebank) BC034481(BCKDHB,Branched chain keto acid dehydrogenase E1, beta polypeptide(maple syrup urine disease)), 유전자 등록번호(Genebank) BC035654(NR1H4,Nuclear receptor subfamily 1, group H, member 4), 유전자 등록번호(Genebank) BC042453(MCCC1,Methylcrotonoyl-Coenzyme A carboxylase 1(alpha)), 유전자 등록번호(Genebank) BC045541(LOC200895,Dihydrofolate reductase-like 1), 유전자 등록번호(Genebank) CR609484(KYNU,Kynureninase(L-kynurenine hydrolase)), 유전자 등록번호(Genebank) CR749593(GLS,Glutaminase), 유전자 등록번호(Genebank) NM_000016(ACADM,Acyl-Coenzyme A dehydrogenase, C-4 to C-12 straight chain), 유전자 등록번호(Genebank) NM_000277(PAH,Phenylalanine hydroxylase), 유전자 등록번호(Genebank) NM_001801(CDO1,Cysteine dioxygenase, type I), 유전자 등록번호(Genebank) NM_002860(ALDH18A1,Aldehyde dehydrogenase 18 family, member A1), 유전자 등록번호(Genebank) NM_004169(SHMT1,Serine hydroxymethyltransferase 1(soluble)), 유전자 등록번호(Genebank) NM_004457(ACSL3,Acyl-CoA synthetase long-chain family member 3), 유전자 등록번호(Genebank) NM_005589(ALDH6A1,Aldehyde dehydrogenase 6 family, member A1), 유전자 등록번호(Genebank) NM_013261(PPARGC1A,Peroxisome proliferative activated receptor, gamma, coactivator 1, alpha), 유전자 등록번호(Genebank) NM_018122(FLJ10514,Aspartyl-tRNA synthetase 2(mitochondrial)), 유전자 등록번호(Genebank) NM_080820(HARS2,Histidyl-tRNA synthetase 2), 유전자 등록번호(Genebank) U73338(MTR,5-methyltetrahydrofolate-homocysteine methyltransferase), 유전자 등록번호(Genebank) AK001676(NUP133,Nucleoporin 133kDa), 유전자 등록번호(Genebank) AK002165(DKFZP564O123,Chromatin modifying protein 2B), 유전자 등록번호(Genebank) AK023143(C10orf119,Chromosome 10 open reading frame 119), 유전자 등록번호(Genebank) AK094603(Homo sapiens cDNA FLJ37284 fis, clone BRAMY2013590. [AK094603],unnamed protein product; Homo sapiens cDNA FLJ37284 fis, clone BRAMY2013590.), 유전자 등록번호(Genebank) AK124768(TNPO1,Transportin 1), 유전자 등록번호(Genebank) BC000100(SNX5,Sorting nexin 5), 유전자 등록번호(Genebank) BC039468(NUP50,Nucleoporin 50kDa), 유전자 등록번호(Genebank) BC064351(SRP9,Signal recognition particle 9kDa), 유전자 등록번호(Genebank) BX091259(UNQ9438,TIMM9), 유전자 등록번호(Genebank) BX641063(DEK,DEK oncogene(DNA binding)), 유전자 등록번호(Genebank) BX648363(SNX10,Sorting nexin 10), 유전자 등록번호(Genebank) CR618609(NOP5/NOP58,Nucleolar protein NOP5/NOP58), 유전자 등록번호(Genebank) NM_002156(HSPD1,Heat shock 60kDa protein 1(chaperonin)), 유전자 등록번호(Genebank) NM_006380(APPBP2,Amyloid beta precursor protein(cytoplasmic tail) binding protein 2), 유전자 등록번호(Genebank) NM_007214(SEC63,SEC63-like(S. cerevisiae)), 유전자 등록번호(Genebank) NM_012460(TIMM9,Translocase of inner mitochondrial membrane 9 homolog(yeast)), 유전자 등록번호(Genebank) NM_014765(TOMM20,Translocase of outer mitochondrial membrane 20 homolog(yeast)), 유전자 등록번호(Genebank) NM_020401(NUP107,Nucleoporin 107kDa), 유전자 등록번호(Genebank) NM_021807(SEC8L1,Exocyst complex component 4), 유전자 등록번호(Genebank) NM_031296(RAB33B,RAB33B, member RAS oncogene family), 유전자 등록번호(Genebank) NM_145261(TIM14,DnaJ(Hsp40) homolog, subfamily C, member 19), 유전자 등록번호(Genebank) NM_173827(FLJ38991,Mitochondrial COX18), 유전자 등록번호(Genebank) AL162068(NAP1L1,Nucleosome assembly protein 1-like 1), 유전자 등록번호(Genebank) AL834186(CDCA7,Cell division cycle associated 7), 유전자 등록번호(Genebank) BC065520(TCFL5,Transcription factor-like 5(basic helix-loop-helix)), 유전자 등록번호(Genebank) CR620626(FGG,Fibrinogen gamma chain), 유전자 등록번호(Genebank) M58569(Homo sapiens fibrinogen, A alpha polypeptide(FGA), transcript variant alpha-E, mRNA [NM_000508]), 유전자 등록번호(Genebank) NM_002291(LAMB1,Laminin, beta 1), 유전자 등록번호(Genebank) NM_005141(FGB,Fibrinogen beta chain), 유전자 등록번호(Genebank) NM_005746(PBEF1,Pre-B-cell colony enhancing factor 1), 유전자 등록번호(Genebank) AK002156(WDR33,WD repeat domain 33), 유전자 등록번호(Genebank) AK074377(UHRF1,Chromosome 19 open reading frame 31), 유전자 등록번호(Genebank) AK122825(HMGB1,High-mobility group box 1), 유전자 등록번호(Genebank) BC032617(POLI,Polymerase(DNA directed) iota), 유전자 등록번호(Genebank) CR600021(HMGB2,High-mobility group box 2), 유전자 등록번호(Genebank) NM_001067(TOP2A,Topoisomerase(DNA) II alpha 170kDa), 유전자 등록번호(Genebank) NM_002916(RFC4,Replication factor C(activator 1) 4, 37kDa), 유전자 등록번호(Genebank) NM_003368(USP1,Ubiquitin specific peptidase 1), 유전자 등록번호(Genebank) NM_006904(PRKDC,Protein kinase, DNA-activated, catalytic polypeptide), 유전자 등록번호(Genebank) NM_138271(ATRX,Alpha thalassemia/mental retardation syndrome X-linked(RAD54 homolog, S. cerevisiae)), 유전자 등록번호(Genebank) AF285167(ABCA1,ATP-binding cassette, sub-family A(ABC1), member 1), 유전자 등록번호(Genebank) AK124635(PCSK9,Proprotein convertase subtilisin/kexin type 9), 유전자 등록번호(Genebank) NM_000236(LIPC,Lipase, hepatic), 유전자 등록번호(Genebank) AF062341(CTNND1,Catenin(cadherin-associated protein), delta 1), 유전자 등록번호(Genebank) AF480883(PPAP2B,Phosphatidic acid phosphatase type 2B), 유전자 등록번호(Genebank) BC035638(LSS,Lanosterol synthase(2,3-oxidosqualene- lanosterol cyclase)), 유전자 등록번호(Genebank) BX648473(PIGK,Phosphatidylinositol glycan, class K), 유전자 등록번호(Genebank) NM_001444(FABP5,Fatty acid binding protein 5(psoriasis-associated)), 유전자 등록번호(Genebank) NM_003129(SQLE,Squalene epoxidase), 유전자 등록번호(Genebank) NM_003580(NSMAF,Neutral sphingomyelinase(N-SMase) activation associated factor), 유전자 등록번호(Genebank) NM_018361(AGPAT5,1-acylglycerol-3-phosphate O-acyltransferase 5(lysophosphatidic acid acyltransferase, epsilon)), 유전자 등록번호(Genebank) NM_020918(GPAM,Glycerol-3-phosphate acyltransferase, mitochondrial), 유전자 등록번호(Genebank) AB209031(C5,Complement component 5), 유전자 등록번호(Genebank) AF130100(SERPINC1,Serpin peptidase inhibitor, clade C(antithrombin), member 1), 유전자 등록번호(Genebank) AK122686(IF,I factor(complement)), 유전자 등록번호(Genebank) BC022312(C4BPA,Complement component 4 binding protein, alpha), 유전자 등록번호(Genebank) M75106(CPB2,Carboxypeptidase B2(plasma, carboxypeptidase U)), 유전자 등록번호(Genebank) NM_000893(KNG1,Kininogen 1), 유전자 등록번호(Genebank) AK055619(GNAQ,Guanine nucleotide binding protein(G protein), q polypeptide), 유전자 등록번호(Genebank) AL832747(GNAQ,Guanine nucleotide binding protein(G protein), q polypeptide), 유전자 등록번호(Genebank) CR596712(IL17D,Interleukin 17D), 유전자 등록번호(Genebank) AK000972(C9orf40,Chromosome 9 open reading frame 40), 유전자 등록번호(Genebank) AK023675(UTRN,Utrophin(homologous to dystrophin)), 유전자 등록번호(Genebank) AK026095(SNTB1,Syntrophin, beta 1(dystrophin-associated protein A1, 59kDa, basic component 1)), 유전자 등록번호(Genebank) AL117472(SORBS1,Sorbin and SH3 domain containing 1), 유전자 등록번호(Genebank) NM_018728(MYO5C,Myosin VC), 유전자 등록번호(Genebank) XM_371116(MYO5B,Myosin VB), 유전자 등록번호(Genebank) BC026320(OGDHL,Oxoglutarate dehydrogenase-like), 유전자 등록번호(Genebank) BC033391(PP1665,Glycerophosphodiester phosphodiesterase domain containing 5), 유전자 등록번호(Genebank) BC042421(GK,Glycerol kinase), 유전자 등록번호(Genebank) M15943(ADH4,Alcohol dehydrogenase 4(class II), pi polypeptide), 유전자 등록번호(Genebank) NM_000671(ADH5,Alcohol dehydrogenase 5(class III), chi polypeptide), 유전자 등록번호(Genebank) NM_002610(PDK1,Pyruvate dehydrogenase kinase, isozyme 1), 유전자 등록번호(Genebank) AK026927(MGC5297,Hypothetical protein MGC5297), 유전자 등록번호(Genebank) AK127326(PHF17,PHD finger protein 17), 유전자 등록번호(Genebank) BC039110(SMNDC1,Survival motor neuron domain containing 1), 유전자 등록번호(Genebank) BC041849(ROCK1,Rho-associated, coiled-coil containing protein kinase 1), 유전자 등록번호(Genebank) BX537500(PDCD4,Programmed cell death 4(neoplastic transformation inhibitor)), 유전자 등록번호(Genebank) CR596268(ITGB3BP,Integrin beta 3 binding protein(beta3-endonexin)), 유전자 등록번호(Genebank) NM_004938(DAPK1,Death-associated protein kinase 1), 유전자 등록번호(Genebank) NM_012238(SIRT1,Sirtuin(silent mating type information regulation 2 homolog) 1(S. cerevisiae)), 유전자 등록번호(Genebank) NM_130837(OPA1,Optic atrophy 1(autosomal dominant)), 유전자 등록번호(Genebank) NM_148957(TNFRSF19,Tumor necrosis factor receptor superfamily, member 19), 유전자 등록번호(Genebank) AB208919(FGFR1,Fibroblast growth factor receptor 1(fms-related tyrosine kinase 2, Pfeiffer syndrome)), 유전자 등록번호(Genebank) AB209601(TIZ,Zinc finger protein 675), 유전자 등록번호(Genebank) AK125150(MAPK8,Mitogen-activated protein kinase 8), 유전자 등록번호(Genebank) BC027881(AFP,Alpha-fetoprotein), 유전자 등록번호(Genebank) NM_020995(HPR,Haptoglobin-related protein), 유전자 등록번호(Genebank) AF167706(CRIM1,Cysteine rich transmembrane BMP regulator 1(chordin-like)), 유전자 등록번호(Genebank) BC045655(MAC30,Hypothetical protein MAC30), 유전자 등록번호(Genebank) BX537509(NET1,Neuroepithelial cell transforming gene 1), 유전자 등록번호(Genebank) BX640958(YEATS4,YEATS domain containing 4), 유전자 등록번호(Genebank) BX647757(Homo sapiens sex comb on midleg-like 1(Drosophila)(SCML1), mRNA [NM_006746],sex comb on midleg-like 1(Drosophila)), 유전자 등록번호(Genebank) NM_006548(IMP-2,IGF-II mRNA-binding protein 2), 유전자 등록번호(Genebank) AY376439(ECT2,Epithelial cell transforming sequence 2 oncogene), 유전자 등록번호(Genebank) AY596970(GARNL1,GTPase activating Rap/RanGAP domain-like 1), 유전자 등록번호(Genebank) BC050630(RAB3-GAP150,RAB3 GTPase activating protein subunit 2(non-catalytic)), 유전자 등록번호(Genebank) NM_001001132(ITSN1,Intersectin 1(SH3 domain protein)), 유전자 등록번호(Genebank) NM_016340(KIAA1961,KIAA1961 gene), 유전자 등록번호(Genebank) NM_145290(GPR125,G protein-coupled receptor 125), 유전자 등록번호(Genebank) NM_003574(VAPA,VAMP(vesicle-associated membrane protein)-associated protein A, 33kDa), 유전자 등록번호(Genebank) M28016(cytochrome b,Human mitochondrial cytochrome b gene, partial cds.), 유전자 등록번호(Genebank) NM_013277(RACGAP1,Rac GTPase activating protein 1), 유전자 등록번호(Genebank) AB096248(SNF1LK2,SNF1-like kinase 2), 유전자 등록번호(Genebank) NM_001698(AUH,AU RNA binding protein/enoyl-Coenzyme A hydratase), 유전자 등록번호(Genebank) AB091343(C10orf3,Centrosomal protein 55kDa).Genebank (Genebank) AB209605 (SKIV2L, Superkiller viralicidic activity 2-like (S.  cerevisiae)), Genebank AI200373 (HIST1H2AL, Histone 1, H2al), Genebank AK001594 (AKAP8L, A kinase (PRKA) anchor protein 8-like), Genebank AK057577 ( IRF3, Interferon regulatory factor 3), Genebank AL832659 (FLJ22833, Hypothetical protein FLJ22833), Genebank BC034487 (HIST1H2AK, Histone 1, H2ak), Genebank BC034569 (ZNF337, Zinc finger protein 337), Genebank BC038432 (RARA, Retinoic acid receptor, alpha), Genebank (Genebank) BC067782 (HIST1H2AG, Histone 1, H2ag), Genebank BC069193 (HIST2H2BE, Histone 2 , H2be), Gene Registration Number (Genebank) BC071638 (HIST2H2BE, Histone 2, H2be), Gene Registration Number (Genebank) BC082232 (HIST1H2BG, Histone 1, H2bg), Gene Registration Number (Genebank) BC101655 (HIST1H2BI, Histone 1, H2bi ), Genebank BE741093 (HIST1H2AE, Histone 1, H2ae), Heredity Registration Number (Genebank) BE973853 (HIST1H4J, Histone 1, H4j), Gene Registration Number (Genebank) BM752802 (HIST1H2BM, Histone 1, H2bm), Gene Registration Number (Genebank) BM919305 (POLR2L, Polymerase (RNA) II (DNA directed) polypeptide L, 7. 6kDa), Gene Registration Number (Genebank) BU603483 (HIST1H1E, Histone 1, H1e), Gene Registration Number (Genebank) BX436525 (HIST1H2BH, Histone 1, H2bh), Gene Registration Number (Genebank) BX647290 (HIST1H2BO, Histone 1, H2bo) , Gene Registration Number (Genebank) CB529694 (HIST2H2BE, Histone 2, H2be), Gene Registration Number (Genebank) CD710576 (HIST2H2AC, Histone 2, H2ac), Gene Registration Number (Genebank) CK000930 (HIST1H2AI, Histone 1, H2ai), Gene Genebank CR608156 (HIST1H2AC, Histone 1, H2ac), Gene Registration Number (Genebank) NM_002515 (NOVA1, Neuro-oncological ventral antigen 1), Genebank NM_003516 (HIST2H2AA, Histone 2, H2aa), Gene Genebank NM_003519 (HIST1H2BL, Histone 1, H2bl), Genebank NG_003670 (BHLHB2, Basic helix-loop-helix domain containing, class B, 2), Genebank NM_004660 (DDX3Y, DEAD (Asp-Glu-Ala-Asp) box polypeptide 3, Y-linked), Gene Accession Number (Genebank) NM_005319 (HIST1H1C, Histo ne 1, H1c), Gene Registration Number (Genebank) NM_005320 (HIST1H1D, Histone 1, H1d), Gene Registration Number (Genebank) NM_005524 (HES1, Hairy and Enhancer of Split 1, (Drosophila)), Gene Registration Number (Genebank) NM_006442 (DRAP1, DR1-associated protein 1 (negative cofactor 2 alpha)), gene registration number (Genebank) NM_021035 (KIAA1404, KIAA1404 protein), gene registration number (Genebank) U86136 (TEP1, Telomerase-associated protein 1), gene registration Genebank AB209586 (MAPK13, Mitogen-activated protein kinase 13), Gene Registration Number (Genebank) AK074652 (SERTAD1, SERTA domain containing 1), Genebank AK122829 (GAS2L1, Growth arrest-specific 2 like 1) , Genebank AK129595 (GADD45B, Growth arrest and DNA-damage-inducible, beta), Genebank (Genebank) BC018266 (CDC42, Cell division cycle 42 (GTP binding protein, 25kDa)), Gene Registration Number ( Genebank) BC041022 (SCAND1, SCAN domain containing 1), Genebank BM9046 12 (S100A6, S100 calcium binding protein A6 (calcyclin)), Genebank BM913048 (TIMP1, TIMP metallopeptidase inhibitor 1), Genebank CR612719 (GADD45A, Growth arrest and DNA-damage-inducible, alpha ), Gene Registration Number (Genebank) NM_001007271 (DUSP13, Dual specificity phosphatase 13), Gene Registration Number (Genebank) NM_001015053 (HDAC5, Histone deacetylase 5), Gene Registration Number (Genebank) NM_001953 (ECGF1, Endothelial cell growth factor 1 (platelet) -derived), Genebank NM_003255 (TIMP2, TIMP metallopeptidase inhibitor 2), Genebank NM_005072 (SLC12A4, Solute Carrier Family 12 (potassium / chloride transporters), member 4), Gene Registry Number ( Genebank) NM_005343 (HRAS, V-Ha-ras Harvey rat sarcoma viral oncogene homolog), Gene Registration Number (Genebank) NM_005736 (ACTR1A, ARP1 actin-related protein 1 homolog A, centractin alpha (yeast), Gene Registration Number (Genebank) ) NM_007065 (CDC37, CDC37 cell div ision cycle 37 homolog (S.  cerevisiae)), Genebank NM_078467 (CDKN1A, Cyclin-dependent kinase inhibitor 1A (p21, Cip1)), Genebank U68019 (SMAD3, SMAD, mothers against DPP homolog 3 (Drosophila)), Gene Genebank X02812 (TGFB1, Transforming growth factor, beta 1 (Camurati-Engelmann disease), Genebank AB033060 (PDCD6, Aryl-hydrocarbon receptor repressor), Genebank AB209361 (FAS, Fas (TNF receptor superfamily, member 6)), Genebank AF332558 (BBC3, BCL2 binding component 3), Genebank AY028896 (CARD10, Caspase recruitment domain family, member 10), Gene entry number ( Genebank) BC063507 (HSPA1B, Heat shock 70kDa protein 1B), Gene Registration Number (Genebank) BM557864 (HSPB1, Heat Shock 27kDa protein 1), Gene Registration Number (Genebank) NM_001003940 (BMF, Bcl2 modifying factor), Gene Registration Number (Genebank) NM_001165 (BIRC3, Baculoviral IAP repeat-containing 3), heredity Genebank NM_001197 (BIK, BCL2-interacting killer (apoptosis-inducing)), Genebank (Genebank) NM_002305 (LGALS1, Lectin, galactoside-binding, soluble, 1 (galectin 1)), Gene Registration Number ( Genebank) NM_003311 (PHLDA2, Pleckstrin homology-like domain, family A, member 2), Genebank NM_003639 (IKBKG, Inhibitor of kappa light polypeptide gene enhancer in B-cells, kinase gamma), Gene accession number (Genebank ) NM_003820 (TNFRSF14, Tumor necrosis factor receptor superfamily, member 14 (herpesvirus entry mediator), Genebank NM_003897 (IER3, Immediate early response 3), Genebank NM_004401 (DFFA, DNA fragmentation factor, 45 kDa, alpha polypeptide), Genebank NM_016639 (TNFRSF12A, Tumor necrosis factor receptor superfamily, member 12A), Genebank BC048334 (MT1G, Metallothionein 1G), Genebank BC053882 (MT1X, Metallothionein 1X), heredity Genebank BI488702 (MT1K, Metallothionein 1M), Gene Registration Number (Genebank) NM_005947 (MT1B, Metallothionein 1B (functional)), Gene Registration Number (Genebank) AK055088 (CYP2J2, Cytochrome P450, family 2, subfamily J, polypeptide 2), Genebank AK094474 (RHOC, Ras homolog gene family, member C), Genebank BC015041 (VAT1, Family with sequence similarity 82, member C), Genebank NM_000499 ( CYP1A1, Cytochrome P450, family 1, subfamily A, polypeptide 1), gene registration number (Genebank) NM_004881 (TP53I3, Tumor protein p53 inducible protein 3), gene registration number (Genebank) NM_201397 (GPX1, Glutathione peroxidase 1), gene registration Genebank XM_498018 (LOC391827, Similar to Keratin, type I cytoskeletal 18 (Cytokeratin 18) (K18) (CK 18)), Gene accession number (Genebank) AF524864 (AKR1B10, Aldo-keto reductase family 1, member B10 (aldose) reductase), Genebank AL833205 (ETFB, Electron- transfer-flavoprotein, beta polypeptide), genebank (Genebank) BC034763 (FDXR, Ferredoxin reductase), genebank (Genebank) CR610878 (AKR1B1, Aldo-keto reductase family 1, member B1 (aldose reductase), gene registration number (Genebank) NM_003330 (TXNRD1, Thioredoxin reductase 1), gene registration number (Genebank) NM_004199 (P4HA2, Procollagen-proline, 2-oxoglutarate 4-dioxygenase (proline 4-hydroxylase), alpha polypeptide II), gene registration number (Genebank) NM_004753 (DHRS3, Dehydrogenase / reductase (SDR family) member 3), gene registration number (Genebank) NM_031226 (CYP19A1, Cytochrome P450, family 19, subfamily A, polypeptide 1), gene registration number (Genebank) NM_032468 (ASPH, Aspartate beta -hydroxylase), Genebank AB209112 (SLC2A8, Solute carrier family 2, (facilitated glucose transporter) member 8), Genebank (Genebank) BC011409 (UGT1A6, UDP glucuronosyltransferase 1 family, polypeptide A9) (Genebank) H18681 (C20or f139, Sulfiredoxin 1 homolog (S.  cerevisiae)), Genebank NM_002658 (PLAU, Plasminogen activator, urokinase), Genebank NM_005064 (CCL23, Chemokine (CC motif) ligand 23), Genebank NM_032965 (CCL14, Chemokine (CC motif) ligand 15), Genebank Y11307 (CYR61, Cysteine-rich, angiogenic inducer, 61), Genebank AB209808 (AP1M1, Adaptor-related protein complex 1, mu 1 subunit) , Genebank AK074154 (SYTL1, Synaptotagmin-like 1), Genebank AK098475 (GRPEL1, GrpE-like 1, mitochondrial (E.  coli)), Genebank AK123405 (GDI1, GDP dissociation inhibitor 1), Genebank (Genebank) BC000786 (ARFGAP1, ADP-ribosylation factor GTPase activating protein 1), Genebank BC042390 (VTI1B, Vesicle transport through interaction with t-SNAREs homolog 1B (yeast), Genebank BG036385 (RAMP1, Receptor (calcitonin) activity modifying protein 1), Genebank BX648781 (GABARAPL1, GABA (A) receptor -associated protein like 1), gene registration number (Genebank) NM_001013839 (EXOC7, Exocyst complex component 7), gene registration number (Genebank) NM_002926 (RGS12, Regulator of G-protein signaling 12), gene registration number (Genebank) NM_007097 ( CLTB, Clathrin, light polypeptide (Lcb)), gene accession number (Genebank) NM_013336 (SEC61A1, Sec61 alpha 1 subunit (S.  cerevisiae)), gene accession number (Genebank) NM_024101 (MLPH, Melanophilin), gene accession number (Genebank) NM_032872 (SYTL1, Synaptotagmin-like 1), gene accession number (Genebank) NM_000596 (IGFBP1, Insulin-like growth factor binding protein 1), gene registration number (Genebank) NM_001553 (IGFBP7, Insulin-like growth factor binding protein 7), gene registration number (Genebank) NM_001712 (CEACAM1, Carcinoembryonic antigen-related cell adhesion molecule 1 (biliary glycoprotein)), gene registration number (Genebank) NM_012396 (PHLDA3, Pleckstrin homology-like domain, family A, member 3), Genebank Number Y12692 (WNT11, Wingless-type MMTV integration site family, member 11), Genebank Number BC014470 ( AZGP1, Alpha-2-glycoprotein 1, zinc), Genebank BG683841 (S100A11, S100 calcium binding protein A11 (calgizzarin)), Genebank NM_002337 (LRPAP1, Low density lipoprotein receptor-related protein associated protein 1), heredity Registration Number (Genebank) AF059617 (PLK2, Polo-like kinase 2 (Drosophila)), gene registration number (Genebank) AK128553 (ZZANK1, Mindbomb homolog 2 (Drosophila)), gene registration number (Genebank) BX649164 (PAI; PAI1; PAI-1; PLANH1, serpin peptidase inhibitor, clade E (nexin, plasminogen activator inhibitor type 1), member 1), gene accession number (Genebank) NM_000602 (SERPINE1, Serpin peptidase inhibitor, clade E (nexin, plasminogen activator inhibitor type 1), member 1 Genebank BI767815 (GP9, Glycoprotein IX (platelet)), Genebank (Genebank) BM918324 (LY96, Lymphocyte Antigen 96), Genebank NM_006404 (PROCR, Protein C receptor, endothelial ( EPCR)), Genebank AF031469 (MR1, Major histocompatibility complex, class I-related), Genebank BF569086 (NK4, Interleukin 32), Genebank BG564326 (SAA4, Serum amyloid A4, constitutive), gene registration number (Genebank) NM_001633 (AMBP, Alpha-1-microglobulin / bikunin precursor), gene registration number (Genebank) NM_005532 (IFI27, Interferon, alpha-inducible protein 27), gene registration number (Genebank) NM_017670 (OTUB1, OTU domain, ubiquitin aldehyde bind ing 1), Gene Registration Number (Genebank) AK130130 (CAPG, Capping protein (actin filament), gelsolin-like), Gene Registration Number (Genebank) BX648190 (WDR1, WD repeat domain 1), Gene Registration Number (Genebank) CF552540 ( TNNI2, Troponin I type 2 (skeletal, fast)), Gene Registration Number (Genebank) NM_001006946 (SDC1, Syndecan 1), Gene Registration Number (Genebank) NM_007284 (PTK9L, PTK9L protein tyrosine kinase 9-like (A6-related protein) ), Gene Registration Number (Genebank) NM_015990 (KLHL5, Kelch-like 5 (Drosophila)), Gene Registration Number (Genebank) BM467105 (CIB1, Calcium and integrin binding 1 (calmyrin)), Gene Registration Number (Genebank) CF553054 (TNNC1) , Troponin C type 1 (slow)), Gene Registration Number (Genebank) NM_006384 (CIB1, Calcium and integrin binding 1 (calmyrin)), Gene Registration Number (Genebank) NM_080388 (S100A16, S100 calcium binding protein A16), Gene Registration Number (Genebank) NM_005817 (M6PRBP1, Mannose-6-phosphate receptor binding protein 1), gene accession number (Genebank) NM_006555 (Y KT6, SNARE protein Ykt6), gene registration number (Genebank) AK093461 (ISYNA1, Myo-inositol 1-phosphate synthase A1), gene registration number (Genebank) AK097009 (PLTP, phospholipid transfer protein), gene registration number (Genebank) BC030207 ( NR0B2, Nuclear receptor subfamily 0, group B, member 2), Genebank BC035124 (UNQ2541, MSFL2541), Genebank NM_145323 (OSBPL3, Oxysterol binding protein-like 3), Genebank (Genebank) ) BC050455 (DDB2, LIM homeobox 3), Genebank BC068535 (TP53AP1, TP53 activated protein 1), Genebank NM_016440 (VRK3, Vaccinia related kinase 3), Genebank NM_001124 ( ADM, Adrenomedullin), Gene Registration Number (Genebank) NM_170707 (LMNA, Lamin A / C), Gene Registration Number (Genebank) NM_004633 (IL1R2, Interleukin 1 receptor, type II), Gene Registration Number (Genebank) NM_004864 (GDF15, Growth differentiation factor 15), Genebank NM_017572 ( MKNK2, MAP kinase interacting serine / threonine kinase 2), gene accession number (Genebank) AA669162 (AMPD3, Transcribed locus), gene accession number (Genebank) AB033073 (SULF2, Sulfatase 2), gene accession number (Genebank) AB208949 (LRDD, Leucine-rich repeats and death domain containing), Genebank AK022712 (FLJ12650, Family with sequence similarity 77, member C), Genebank AK095363 (AQP3, Aquaporin 3), Gene Registration Number (Genebank) AY368150 (CHR2SYT, Family with sequence similarity 62 (C2 domain containing) member B), Genebank BU587578 (RGS10, Regulator of G-protein signaling 10), Genebank BU945318 (MT2A, Hypothetical gene supported by X97260; BC070289), Gene Registration Number (Genebank) NM_001013632 (LOC343521, Similar to hypothetical protein 4833401D15), Gene Registration Number (Genebank) NM_006426 (DPYSL4, Dihydropyrimidinase-like 4), Gene Registration Number (Genebank) NM_133493 (CD109, CD109 antigen (Gov) platelet alloantigens)), Genebank NM_145256 (LRRC25, Leucine rich repeat containing 25), Genebank AB033337 (MPHOSPH1, M-phase phosphoprotein 1), Genebank AB208875 (Septin 10, Septin 10), Genebank AF053305 (BUB1, BUB1 budding uninhibited by benzimidazoles 1 homolog (yeast), Genebank AF053306 (BUB1B, BUB1 budding uninhibited by benzimidazoles 1 homolog beta (yeast), gene Genebank AF345347 (SPAG5, Spm associated antigen 5), Genebank AK222819 (NUSAP1, Nucleolar and spindle associated protein 1), Genebank AY367065 (ASPM, Asp (abnormal spindle) -like , microcephaly associated (Drosophila)), Genebank BC004352 (KIF22, Kinesin family member 22), Genebank BC010607 (IGF1R, Insulin-like growth factor 1 receptor), Genebank BC011000 (CDCA5 Cell division cycle associated 5), Genebank BC013326 (GAS2, Growth arrest-specific 2), Genebank BC032677 (UBE2C, Ubiquitin-conjugating enzyme E2C), Genebank BC040991 (Genebank) TFDP2, Transcription factor Dp-2 (E2F dimerization partner 2), Genebank BC050384 (SUPT3H, Suppressor of Ty 3 homolog (S.  cerevisiae)), Gene Banking Number BC068483 (RINT-1, Rad50-interacting protein 1), Gene Banking Number (Genebank) BQ278454 (CKS1B, CDC28 protein kinase regulatory subunit 1B), Gene Banking Number (Genebank) BX647885 (STMN1 , Stathmin 1 / oncoprotein 18), Genebank CR604810 (CCNA2, Cyclin A2), Genebank CR933728 (CDC2, Cell division cycle 2, G1 to S and G2 to M), Gene registry number ( Genebank) D42045 (DCLRE1A, DNA cross-link repair 1A (PSO2 homolog, S.  cerevisiae)), Gene Registration Number (Genebank) NM_00089 (HK2, Hexokinase 2), Gene Registration Number (Genebank) NM_001005414 (ZWINT, ZW10 interactor antisense), Gene Registration Number (Genebank) NM_001018159 (APPBP1, Amyloid beta precursor protein binding protein 1 ), Genebank NM_001239 (CCNH, Cyclin H), Genebank NM_001790 (CDC25C, Cell division cycle 25C), Genebank NM_001827 (CKS2, CDC28 protein kinase regulatory subunit 2), Genebank NM_002431 (MNAT1, Menage a trois 1 (CAK assembly factor)), Genebank NM_002467 (MYC, V-myc myelocytomatosis viral oncogene homolog (avian)), Genebank NM_002709 (PPP1CB, Protein phosphatase 1, catalytic subunit, beta isoform), Gene Registration Number (Genebank) NM_002737 (PRKCA, Protein kinase C, alpha), Gene Registration Number (Genebank) NM_002894 (RBBP8, Retinoblastoma binding protein 8), Gene Registration Number (Genebank) NM_003318 (TTK, TTK protei kinase, Genebank NM_003478 (CUL5, Cullin 5), Genebank NM_003981 (PRC1, Protein regulator of cytokinesis 1), Genebank NM_004064 (CDKN1B, Cyclin-dependent kinase inhibitor 1B (p27, Kip1)), Gene Registration Number (Genebank) NM_004354 (CCNG2, Cyclin G2), Gene Registration Number (Genebank) NM_004365 (CETN3, Centrin, EF-hand protein, 3 (CDC31 homolog, yeast)), Gene Registration Number (Genebank) NM_004523 (KIF11, Kinesin family member 11), gene registration number (Genebank) NM_004701 (CCNB2, Cyclin B2), gene registration number (Genebank) NM_005504 (BCAT1, Branched chain aminotransferase 1, cytosolic), gene registration number ( Genebank) NM_005915 (MCM6, MCM6 minichromosome maintenance deficient 6 (MIS5 homolog, S.  pombe) (S.  cerevisiae)), Genebank NM_006101 (KNTC2, Kinetochore associated 2), Genebank NM_006265 (RAD21, RAD21 homolog (S.  pombe), Gene Registration Number (Genebank) NM_014750 (DLG7, Discs, large homolog 7 (Drosophila)), Gene Registration Number (Genebank) NM_014751 (MTSS1, Metastasis suppressor 1), Gene Registration Number (Genebank) NM_016343 (CENPF, Centromere protein F, 350 / 400ka (mitosin)), gene accession number (Genebank) NM_018492 (PBK, PDZ binding kinase), gene accession number (Genebank) NM_018685 (ANLN, Anillin, actin binding protein (scraps homolog, Drosophila)), gene Genebank NM_019001 (XRN1,5'-3 'exoribonuclease 1), Gene Registration Number (Genebank) NM_019063 (EML4, Echinoderm microtubule associated protein like 4), Genebank Number NM_020242 (KNSL7, Kinesin family member 15 ), Genebank number U65410 (MAD2L1, MAD2 mitotic arrest deficient-like 1 (yeast)), Genebank number (Genebank) AB096175 (SP5, Sp5 transcription factor), Genebank number AB209086 (ZNF493, Zinc) finger protein 493), Genebank AB209334 (SP3, Sp3 transcription factor) Genebank AB209892 (ZFX, Zinc finger protein, X-linked), Genebank AF279145 (ANTXR1, Anthrax toxin receptor 1), Genebank AK095600 (FLJ38281, Zinc finger protein 564) ), Gene registration number (Genebank) AK123010 (RRM2, Ribonucleotide reductase M2 polypeptide), gene registration number (Genebank) AK126180 (DTYMK, Deoxythymidylate kinase (thymidylate kinase)), gene registration number (Genebank) AK130071 (HSPC063, BTB (POZ) domain containing 15), Genebank AK131420 (ZNF66, Zinc finger protein 66), Genebank AK131472 (Homo sapiens cDNA FLJ16640 fis, clone TESTI4028938, moderately similar to Zinc finger protein 85.  [AK131472], CDNA FLJ16640 fis, clone TESTI4028938, moderately similar to Zinc finger protein 85), gene accession number (Genebank) AK131527 (ZNF15L1, Zinc finger protein 708 (KOX8)), gene accession number (Genebank) AK160373 (DKFZp547K1113, Zinc finger protein 710, Genebank AL832422 (ZNF430, Zinc finger protein 430), Genebank AY269786 (ZNF429, Zinc finger protein 429), Genebank BC035579 (ZNF100, Zinc finger protein) 100), Gene Registration Number (Genebank) BC036394 (ZNF85, Zinc finger protein 85 (HPF4, HTF1)), Gene Registration Number (Genebank) BM466459 (DGKI, Diacylglycerol kinase, iota), Gene Registration Number (Genebank) BX537574 (FREM1, FRAS1 related extracellular matrix 1), Genebank BX537987 (TRIM59, Tripartite motif-containing 59), Genebank BX648469 (ATF2, activating transcription factor 2), Genebank CR608275 (CBLL1 , Cas-Br-M (murine) ecotropic retroviral transforming sequence-like 1), gene accession number (Genebank) CR749233 (ZNF626, Zinc finger protein 626), gene accession number (Genebank) CR749832 (IMPDH1, IMP (inosine monophosphate) dehydrogenase 1), gene accession number (Genebank) CR936615 (MATR3) , Matrin 3), Gene Registration Number (Genebank) NM_000946 (PRIM1, Primase, polypeptide 1, 49 kDa), Gene Registration Number (Genebank) NM_001123 (ADK, Adenosine kinase), Gene Registration Number (Genebank) NM_002317 (LOX, Lysyl oxidase) , Gene Registration Number (Genebank) NM_002655 (PLAG1, Pleiomorphic adenoma gene 1), Gene Registration Number (Genebank) NM_003423 (ZNF43, Zinc finger protein 43 (HTF6)), Gene Registration Number (Genebank) NM_005180 (PCGF4, Polycomb group ring finger 4), Gene Registration Number (Genebank) NM_014615 (KIAA0182, KIAA0182 protein), Gene Registration Number (Genebank) NM_014919 (WHSC1, Wolff-Hirschhorn syndrome candidate 1), Gene Registration Number (Genebank) NM_015040 (PIP5K3, Phosphhatidylinositol-3-phosphate / phosphatidylinositol 5-kinase, type III), gene registration number Genebank NM_015387 (PREI3, Preimplantation protein 3), Genebank NM_015905 (TIF1, Tripartite motif-containing 24), Genebank NM_016513 (ICK, Intestinal cell (MAK-like) kinase), Gene Genebank NM_016626 (RKHD2, Ring finger and KH domain containing 2), Genebank NM_018660 (ZNF395, Zinc finger protein 395), Genebank NM_021129 (PP, Pyrophosphatase (inorganic) 1 ), Gene Registration Number (Genebank) NM_025074 (FRAS1, Fraser syndrome 1), Gene Registration Number (Genebank) NM_173694 (ATP11C, ATPase, Class VI, type 11C), Gene Registration Number (Genebank) NM_176869 (PPA2, Pyrophosphatase (inorganic) 2), Gene Registration Number (Genebank) NM_182851 (CCNB1IP1, Cyclin B1 interacting protein 1), Gene Registration Number (Genebank) NM_199040 (NUDT4, Nudix (nucleoside diphosphate linked moiety X) -type motif 4 pseudogene 2), Gene Registration Number ( Genebank) AK122869 (LOC148213, Zinc finger protein 681), gene registration number Genebank BC042500 (MGC42493, Hypothetical protein MGC15634), Genebank BC043147 (ZNF539, Zinc finger protein 254), Genebank BC044060 (ZNF650, Zinc finger protein 650), Genebank (Genebank) BC050340 (ZNF230, Zinc finger protein 230), Genebank (Genebank) CR749800 (ZNFN1A5, Zinc finger protein, subfamily 1A, 5), Genebank (Genebank) CR936695 (ZNF468, Zinc finger protein ZNF468), Gene Registration Number ( Genebank) NM_001009881 (ZCCHC11, Zinc finger, CCHC domain containing 11), Gene Registration Number (Genebank) NM_003441 (ZNF141, Zinc Finger Protein 141 (clone pHZ-44)), Gene Registration Number (Genebank) NM_006526 (ZNF217, Zinc finger protein 217), Genebank NM_007146 (ZNF161, Zinc finger protein 161), Genebank NM_015336 (ZDHHC17, Zinc finger, DHHC-type containing 17), Genebank NM_016220 (ZNF588, Zinc finger protein 588), gene accession number (Genebank) NM_017742 ( ZCCHC2, Zinc finger, CCHC domain containing 2), Genebank NM_021994 (ZNF277, Zinc finger protein 277), Genebank NM_024733 (FLJ14345, Zinc finger protein 665), Genebank NM_032367 (ZBED3, Zinc finger, BED-type containing 3), Genebank NM_033114 (MADP-1, MADP-1 protein), Genebank NM_133473 (ZNF431, Zinc finger protein 431), Gene Registry Number (Genebank) NM_152626 (ZNF92, Zinc finger protein 92 (HTF12)), Gene Registration Number (Genebank) NM_178558 (FLJ90430, Zinc finger protein 680), Gene Registration Number (Genebank) NM_198893 (ZNF160, Zinc finger protein 160), Gene Registration Number (Genebank) XM_047550 (ZNF492, Zinc finger protein 492), Gene Registration Number (Genebank) XM_290865 (LOC163233, Similar to Zinc finger protein 93 (Zinc finger protein HTF34)), Gene Registration Number (Genebank) XM_371174 (ZNF283, Zinc finger protein 283), Genebank AB023141 (ZNF652, Zinc finger protei 652), Genebank AB209245 (HMGN1, High-mobility group nucleosome binding domain 1), Genebank AB209389 (GTF2IRD1, GTF2I repeat domain containing 1), Genebank AB209562 (HNRPK , Heterogeneous nuclear ribonucleoprotein K, Genebank AB209753 (RBM7, RNA binding motif protein 7), Genebank AF136171 (EAP; HBP15; HBP15 / L22, ribosomal protein L22), Genebank AK001230 (POT1, POT1 protection of telomeres 1 homolog (S.   pombe), Genebank AK022942 (LOC58486, Transposon-derived Buster1 transposase-like protein gene), Genebank AK025758 (NFATC2, Nuclear factor of activated T-cells, cytoplasmic, calcineurin-dependent 2) , Genebank AK056803 (H2AFZ, H2A histone family, member Z), Genebank AK074119 (ZZZ3, Zinc finger, ZZ-type containing 3), Genebank AK091927 (SFRS3, Splicing factor, arginine / serine-rich 3), Genebank AK095937 (GC20, Translation factor sui1 homolog), Genebank AK124178 (EIF3S6, Eukaryotic translation initiation factor 3, subunit 6 48kDa), Gene accession number (Genebank) AL110212 (H2AFV, H2A histone family, member V), Genebank BC010266 (HNRNPA1; MGC102835, Heterogeneous nuclear ribonucleoprotein A1), Genebank BM464978 (HMGN2, High-mobility group nucleosomal binding domain 2), Gene Registration Number (Geneb ank) BM800367 (RPL21, Ribosomal protein L21), Gene Registration Number (Genebank) BU677381 (RPL21, Ribosomal protein L21), Gene Registration Number (Genebank) BX647205 (HNRPH1, Heterogeneous nuclear ribonucleoprotein H1 (H)), Gene Registration Number (Genebank) ) BX647217 (HNRPA3, Heterogeneous nuclear ribonucleoprotein A3), Gene Accession Number (Genebank) CR625990 (PC4, SUB1 homolog (S.  cerevisiae)), Gene Registration Number (Genebank) CR627133 (LOC342892, Hypothetical protein LOC342892), Gene Registration Number (Genebank) NM_000947 (PRIM2A, Primase, polypeptide 2A, 58 kDa), Gene Registration Number (Genebank) NM_000983 (RPL22, Ribosomal protein L22) ), Gene registration number (Genebank) NM_001015886 (HMGA2, High mobility group AT-hook 2), gene registration number (Genebank) NM_001017430 (RBM3, RNA binding motif (RNP1, RRM) protein 3), gene registration number (Genebank) NM_001018067 (PAI-RBP1, SERPINE1 mRNA binding protein 1), Genebank NM_001412 (EIF1AX, Eukaryotic translation initiation factor 1A, X-linked), Genebank NM_001809 (CENPA, Centromere protein A, 17kDa), Genebank (Genebank) NM_002139 (RBMX, RNA binding motif protein, X-linked), Genebank (Genebank) NM_002568 (PABPC1, Poly (A) binding protein, cytoplasmic 1), Genebank (Menebank) NM_003972 (BTAF1 , BTAF1 RNA polymerase II, B-TFIID transcription factor-associated, 17 0 kDa (Mot1 homolog, S.  cerevisiae)), Genebank NM_004454 (ETV5, Ets variant gene 5 (ets-related molecule)), Genebank NM_005463 (HNRPDL, Heterogeneous nuclear ribonucleoprotein D-like), Genebank (Genebank) NM_006047 (CPNE1, RNA binding motif protein 12), gene registration number (Genebank) NM_006345 (SLC30A9, Solute carrier family 30 (zinc transporter), member 9), gene registration number (Genebank) NM_006451 (PAIP1, Poly (A) binding protein interacting protein 1), Genebank NM_006546 (IMP-1, IGF-II mRNA-binding protein 1), Genebank NM_006716 (ASK, DBF4 homolog (S.  cerevisiae)), Genebank NM_006775 (QKI, Quaking homolog, KH domain RNA binding (mouse)), Genebank NM_007080 (LSM6, LSM6 homolog, U6 small nuclear RNA associated (S.  cerevisiae)), gene registration number (Genebank) NM_007208 (MRPL3, Mitochondrial ribosomal protein L3), gene registration number (Genebank) NM_012207 (HNRPH3, heterogeneous nuclear ribonucleoprotein H3 (2H9)), gene registration number (Genebank) NM_014321 (ORC6L, Origin recognition complex, subunit 6 homolog-like (yeast), Genebank NM_014393 (STAU2, Staufen, RNA binding protein, homolog 2 (Drosophila)), Genebank NM_014892 (RBM16, RNA binding motif protein 16), Genebank NM_015361 (R3HDM, R3H domain containing 1), Genebank NM_015975 (TAF9L, TAF9-like RNA polymerase II, TATA box binding protein (TBP) -associated factor, 31kDa), Genebank (Genebank) NM_016200 (LSM8, LSM8 homolog, U6 small nuclear RNA associated (S.  cerevisiae)), Genebank NM_017437 (CPSF2, Cleavage and polyadenylation specific factor 2, 100kDa), Genebank NM_018048 (FLJ10292, Mago-nashi homolog), Genebank NM_018237 (CCAR1, Cell division cycle and apoptosis regulator 1), gene registration number (Genebank) NM_031157 (HNRPA1, Heterogeneous nuclear ribonucleoprotein A1), gene registration number (Genebank) NM_032390 (MKI67IP, MKI67 (FHA domain) interacting nucleolar phosphoprotein), gene registration number (Genebank) NM_033222 (PSIP1, PC4 and SFRS1 interacting protein 1), Genebank NM_054016 (FUSIP1, FUS interacting protein (serine / arginine-rich) 1), Genebank NM_145018 (FLJ25416, Hypothetical protein FLJ25416) , Genebank NM_153333 (TCEAL8, Transcription elongation factor A (SII) -like 8), Genebank NM_203463 (LASS6, LAG1 longevity assurance homolog 6 (S.  cerevisiae)), Genebank NM_206866 (BACH1, BTB and CNC homology 1, basic leucine zipper transcription factor 1), Genebank U38847 (TARBP1, TAR (HIV) RNA binding protein 1), Gene registration Number (Genebank) XM_371470 (LOC388907, Simallar to ribosomal protein L5; 60S ribosomal protein L5), Gene accession number (Genebank) XM_372050 (LOC389674, Heterogeneous nuclear ribonucleoprotein A1 pseudogene 4), Gene accession number (Genebank) XM_372396 (LOC390158, Ol) , family 8, subfamily K, member 1), Genebank XM_496355 (LOC440577, Similar to nucleophosmin 1; nucleolar phosphoprotein B23; numatrin; nucleophosmin / nucleoplasmin family, member 1), Genebank XM_498328 (LOC392345 , Similar to PRED65), Genebank XM_499298 (FLJ46189, similar to Zinc finger protein 479 (Zinc finger protein Kr19) (HKr19)), Genebank XM_499343 (PEG10, Paternally expressed 10), Gene Registration Genebank AB013380 (ABCB10, ATP-binding cassette, sub-family B (MDR / TAP), member 10), Gene Registration Number (Genebank) AB018342 (MYO10, Myosin X), Gene Registration Number (Genebank) AK025258 (UMP -CMPK, Cyidylate kinase, Genebank AK098205 (AK3L1, Adenylate kinase 3), Gene Accession Number (Genebank) AK122685 (GLUD1, Glutamate dehydrogenase 1), Gene Accession Number (Genebank) AK122695 (RRM1, Ribonucleotide reductase M1 polypeptide), Genebank AK126343 (STK39, Serine threonine kinase 39 (STE20 / SPS1 homolog, yeast)), Genebank (Genebank) BC051861 (SPATA5L1, Spermatogenesis associated 5-like 1), Gene accession number (Genebank) ) BC064610 (SEPHS1, Selenophosphate synthetase 1), Gene Registration Number (Genebank) BX640965 (SLC22A3, Solute carrier family 22 (extraneuronal monoamine transporter), member 3), Gene Registration Number (Genebank) D86550 (DYRK1A, Dual-specificity tyrosine- ( Y) -phosphorylation regulated kinase 1A), Genebank NM _006343 (MERTK, C-mer proto-oncogene tyrosine kinase), gene registration number (Genebank) NM_012073 (CCT5, Chaperonin containing TCP1, subunit 5 (epsilon)), gene registration number (Genebank) NM_020326 (ABCD4, ATP-binding cassette, sub-family D (ALD), member 4), Genebank NM_030752 (TCP1, T-complex 1), Genebank NM_030919 (C20orf129, Chromosome 20 open reading frame 129), Gene Registry Number ( Genebank) NM_182964 (NAV2, Neuron navigator 2), Gene Registration Number (Genebank) AF020038 (IDH1, Isocitrate dehydrogenase 1 (NADP +), Soluble), Gene Registration Number (Genebank) AK093311 (ACAA2, Acetyl-Coenzyme A acyltransferal 2 3mitochon -oxoacyl-Coenzyme A thiolase)), Gene Registration Number (Genebank) BC008366 (DDC, Dopa decarboxylase (aromatic L-amino acid decarboxylase)), Gene Registration Number (Genebank) BC012616 (BHMT, Betaine-homocysteine methyltransferase), Gene Registration Number Genebank BC015062 (MTHFD2, Methylenetetrahydrofolate dehydrogenase (NADP + dependent) 2, m ethenyltetrahydrofolate cyclohydrolase), Genebank BC033320 (TAF9, TAF9 RNA polymerase II, TATA box binding protein (TBP) -associated factor, 32kDa), Genebank BC033517 (ACOX2, Acyl-Coenzyme A oxidase 2, branched chain, Genebank BC034481 (BCKDHB, Branched chain keto acid dehydrogenase E1, beta polypeptide (maple syrup urine disease)), Gene accession (Genebank) BC035654 (NR1H4, Nuclear receptor subfamily 1, group H, member 4) Gene Registration Number (Genebank) BC042453 (MCCC1, Methylcrotonoyl-Coenzyme A carboxylase 1 (alpha)), Gene Registration Number (Genebank) BC045541 (LOC200895, Dihydrofolate reductase-like 1), Gene Registration Number (Genebank) CR609484 (KYNU Kynureninase (L-kynurenine hydrolase), Genebank (Genebank) CR749593 (GLS, Glutaminase), Genebank (Genebank) NM_000016 (ACADM, Acyl-Coenzyme A dehydrogenase, C-4 to C-12 straight chain), Genebank Number (Genebank) NM_000277 (PAH, Phenylalanine hydr oxylase), Gene Registration Number (Genebank) NM_001801 (CDO1, Cysteine dioxygenase, type I), Gene Registration Number (Genebank) NM_002860 (ALDH18A1, Aldehyde dehydrogenase 18 family, member A1), Gene Registration Number (Genebank) NM_004169 (SHMT1, Serine hydroxymethyltransferase 1 (soluble)), gene registration number (Genebank) NM_004457 (ACSL3, Acyl-CoA synthetase long-chain family member 3), gene registration number (Genebank) NM_005589 (ALDH6A1, Aldehyde dehydrogenase 6 family, member A1), gene registration Number (Genebank) NM_013261 (PPARGC1A, Peroxisome proliferative activated receptor, gamma, coactivator 1, alpha), Gene Registration Number (Genebank) NM_018122 (FLJ10514, Aspartyl-tRNA synthetase 2 (mitochondrial)), Gene Registration Number (Genebank) NM_080820 (HARS2 , Histidyl-tRNA synthetase 2), Gene Registration Number (Genebank) U73338 (MTR, 5-methyltetrahydrofolate-homocysteine methyltransferase), Gene Registration Number (Genebank) AK001676 (NUP133, Nucleoporin 133kDa), Gene Registration Number (Genebank) AK002165 (DKFZP564O 123, Chromatin modifying protein 2B, Genebank AK023143 (C10orf119, Chromosome 10 open reading frame 119), Genebank AK094603 (Homo sapiens cDNA FLJ37284 fis, clone BRAMY2013590.  [AK094603], unnamed protein product; Homo sapiens cDNA FLJ37284 fis, clone BRAMY2013590. ), Gene Registration Number (Genebank) AK124768 (TNPO1, Transportin 1), Gene Registration Number (Genebank) BC000100 (SNX5, Sorting nexin 5), Gene Registration Number (Genebank) BC039468 (NUP50, Nucleoporin 50kDa), Gene Registration Number (Genebank) ) BC064351 (SRP9, Signal recognition particle 9kDa), Genebank BX091259 (UNQ9438, TIMM9), Genebank BX641063 (DEK, DEK oncogene (DNA binding)), Genebank BX648363 (Genebank) SNX10, Sorting nexin 10), Gene Registration Number (Genebank) CR618609 (NOP5 / NOP58, Nucleolar protein NOP5 / NOP58), Gene Registration Number (Genebank) NM_002156 (HSPD1, Heat shock 60kDa protein 1 (chaperonin)), Gene Registration Number ( Genebank) NM_006380 (APPBP2, Amyloid beta precursor protein (cytoplasmic tail) binding protein 2), Gene Registration Number (Genebank) NM_007214 (SEC63, SEC63-like (S.  cerevisiae)), gene registration number (Genebank) NM_012460 (TIMM9, Translocase of inner mitochondrial membrane 9 homolog (yeast)), gene registration number (Genebank) NM_014765 (TOMM20, Translocase of outer mitochondrial membrane 20 homolog (yeast)), gene registration Genebank NM_020401 (NUP107, Nucleoporin 107kDa), Gene Registration Number (Genebank) NM_021807 (SEC8L1, Exocyst complex component 4), Gene Registration Number (Genebank) NM_031296 (RAB33B, RAB33B, member RAS oncogene family), Gene Registration Number ( Genebank) NM_145261 (TIM14, DnaJ (Hsp40) homolog, subfamily C, member 19), Gene Accession Number (Genebank) NM_173827 (FLJ38991, Mitochondrial COX18), Gene Accession Number (Genebank) AL162068 (NAP1L1, Nucleosome assembly protein 1-like 1 ), Genebank AL834186 (CDCA7, Cell division cycle associated 7), Genebank (Genebank) BC065520 (TCFL5, Transcription factor-like 5 (basic helix-loop-helix)), Genebank (Genebank) CR620626 (FGG, Fibrinogen gamma chain), gene Genebank M58569 (Homo sapiens fibrinogen, A alpha polypeptide (FGA), transcript variant alpha-E, mRNA [NM_000508]), Genebank NM_002291 (LAMB1, Laminin, beta 1), gene registration number ( Genebank) NM_005141 (FGB, Fibrinogen beta chain), Genebank (Genebank) NM_005746 (PBEF1, Pre-B-cell colony enhancing factor 1), Genebank (Kenebank) AK002156 (WDR33, WD repeat domain 33), Gene registration Number (Genebank) AK074377 (UHRF1, Chromosome 19 open reading frame 31), Gene accession number (Genebank) AK122825 (HMGB1, High-mobility group box 1), Gene accession number (Genebank) BC032617 (POLI, Polymerase (DNA directed) iota ), Gene registration number (Genebank) CR600021 (HMGB2, High-mobility group box 2), gene registration number (Genebank) NM_001067 (TOP2A, Topoisomerase (DNA) II alpha 170kDa), gene registration number (Genebank) NM_002916 (RFC4, Replication) factor C (activator 1) 4, 37 kDa), Genebank (Genebank) NM_003368 (USP1, Ubiquitin specific peptidase 1 Genebank NM_006904 (PRKDC, Protein kinase, DNA-activated, catalytic polypeptide), Genebank NM_138271 (ATRX, Alpha thalassemia / mental retardation syndrome X-linked (RAD54 homolog, S.  cerevisiae)), Genebank AF285167 (ABCA1, ATP-binding cassette, sub-family A (ABC1), member 1), Genebank AK124635 (PCSK9, Proprotein convertase subtilisin / kexin type 9), Genebank (Genebank) NM_000236 (LIPC, Lipase, hepatic), Genebank (Genebank) AF062341 (CTNND1, Catenin (cadherin-associated protein), delta 1), Genebank AF480883 (PPAP2B, Phosphatidic acid phosphatase type 2B), gene registration number (Genebank) BC035638 (LSS, Lanosterol synthase (2,3-oxidosqualene-lanosterol cyclase)), gene registration number (Genebank) BX648473 (PIGK, Phosphhatidylinositol glycan, class K), gene registration number (Genebank) ) NM_001444 (FABP5, Fatty acid binding protein 5 (psoriasis-associated)), gene accession number (Genebank) NM_003129 (SQLE, Squalene epoxidase), gene accession number (Genebank) NM_003580 (NSMAF, Neutral sphingomyelinase (N-SMase) activation associated) factor, Genebank NM_018361 (AGPAT5,1-acylgly cerol-3-phosphate O-acyltransferase 5 (lysophosphatidic acid acyltransferase (epsilon)), gene registration number (Genebank) NM_020918 (GPAM, Glycerol-3-phosphate acyltransferase, mitochondrial), gene registration number (Genebank) AB209031 (C5, Complement component 5), Genebank AF130100 (SERPINC1, Serpin peptidase inhibitor, clade C (antithrombin), member 1), Genebank AK122686 (IF, I factor (complement), Genebank (Genebank) BC022312 (C4BPA, Complement component 4 binding protein, alpha), gene registration number (Genebank) M75106 (CPB2, Carboxypeptidase B2 (plasma, carboxypeptidase U)), gene registration number (Genebank) NM_000893 (KNG1, Kininogen 1), gene registration number (Genebank) AK055619 (GNAQ, Guanine nucleotide binding protein (G protein), q polypeptide), Gene Registration Number (GeneQ) AL832747 (GNAQ, Guanine nucleotide binding protein (G protein), q Polypeptide), Gene Registration Number (Genebank) (IL17D, Interleukin 17D), gene registration number (Genebank) AK000972 (C9orf40, Chromosome 9 open reading frame 40), Genebank AK023675 (UTRN, Utrophin (homologous to dystrophin), Genebank AK026095 (SNTB1, Syntrophin, Beta 1 (dystrophin-) associated protein A1, 59kDa, basic component 1)), Genebank AL117472 (SORBS1, Sorbin and SH3 domain containing 1), Genebank NM_018728 (MYO5C, Myosin VC), Gene accession number (Genebank) XM_371116 (MYO5B, Myosin VB), Gene Registration Number (Genebank) BC026320 (OGDHL, Oxoglutarate dehydrogenase-like), Gene Registration Number (Genebank) BC033391 (PP1665, Glycerophosphodiester phosphodiesterase domain containing 5), Gene Registration Number (GenebankK BC042421 (GenebankK) , Glycerol kinase, Genebank M15943 (ADH4, Alcohol dehydrogenase 4 (class II), pi polypeptide), Gene accession number (Genebank) NM_000671 (ADH5, Alcohol dehydrogenase 5 (class III), chi polypeptide), Gene Registration Number (Genebank) NM_002610 (PDK1, Pyruvate dehydrogenase kinase, isozyme 1), Genebank AK026927 (MGC5297, Hypothetical protein MGC5297), Genebank AK127326 (PHF17, PHD finger protein 17), Genebank BC039110 (SMNDC1, Survival motor neuron domain containing 1), Genebank BC041849 (ROCK1, Rho-associated, coiled-coil containing protein kinase 1), Genebank BX537500 (PDCD4, Programmed cell death 4 (neoplastic transformation inhibitor)), Genebank (Genebank) CR596268 (ITGB3BP, Integrin beta 3 binding protein (beta3-endonexin)), Genebank (Genebank) NM_004938 (DAPK1, Death-associated protein kinase 1), Genebank (Menebank) NM_012238 (SIRT1, Sirtuin (silent mating type information regulation 2 homolog) 1 (S.  cerevisiae)), gene registration number (Genebank) NM_130837 (OPA1, Optic atrophy 1 (autosomal dominant)), gene registration number (Genebank) NM_148957 (TNFRSF19, Tumor necrosis factor receptor superfamily, member 19), gene registration number (Genebank) AB208919 (FGFR1, Fibroblast growth factor receptor 1 (fms-related tyrosine kinase 2, Pfeiffer syndrome)), Genebank AB209601 (TIZ, Zinc finger protein 675), Genebank AK125150 (MAPK8, Mitogen-activated) protein kinase 8), gene bank number (Genebank) BC027881 (AFP, Alpha-fetoprotein), gene bank number (Genebank) NM_020995 (HPR, Hipgloglobin-related protein), gene bank number (Genebank) AF167706 (CRIM1, Cysteine rich transmembrane BMP) regulator 1 (chordin-like), Genebank BC045655 (MAC30, Hypothetical protein MAC30), Genebank BX537509 (NET1, Neuroepithelial cell transforming gene 1), Genebank BX640958 (YEATS4 YEATS domain containing 4) Genebank BX647757 (Homo sapiens sex comb on midleg-like 1 (Drosophila) (SCML1), mRNA [NM_006746], sex comb on midleg-like 1 (Drosophila), gene registration number (Genebank) NM_006548 (IMP -2, IGF-II mRNA-binding protein 2), Genebank AY376439 (ECT2, Epithelial cell transforming sequence 2 oncogene), Genebank AY596970 (GARNL1, GTPase activating Rap / RanGAP domain-like 1 ), Genebank BC050630 (RAB3-GAP150, RAB3 GTPase activating protein subunit 2 (non-catalytic)), Genebank NM_001001132 (ITSN1, Intersectin 1 (SH3 domain protein)), Gene registry number ( Genebank) NM_016340 (KIAA1961, KIAA1961 gene), Genebank NM_145290 (GPR125, G protein-coupled receptor 125), Genebank NM_003574 (VAPA, VAMP (vesicle-associated membrane protein) -associated protein A , 33kDa), Genebank M28016 (cytochrome b, Human mitochondrial cytochrome b gene, partial c ds. ), Gene registration number (Genebank) NM_013277 (RACGAP1, Rac GTPase activating protein 1), gene registration number (Genebank) AB096248 (SNF1LK2, SNF1-like kinase 2), gene registration number (Genebank) NM_001698 (AUH, AU RNA binding protein / enoyl-Coenzyme A hydratase), Genebank AB091343 (C10orf3, Centrosomal protein 55kDa).

1) 상기 바이오마커 중에서 다이벤조에이에이취안트라센의 노출에 의해 발현이 증가하는 바이오마커 유전자는 하기와 같다: 1) Among the biomarkers, biomarker genes whose expression is increased by the exposure of dibenzoAchanthracene are as follows:

유전자 등록번호(Genebank) AB209605(SKIV2L, Superkiller viralicidic activity 2-like(S. cerevisiae)), 유전자 등록번호(Genebank) AI200373(HIST1H2AL, Histone 1, H2al), 유전자 등록번호(Genebank) AK001594(AKAP8L, A kinase(PRKA) anchor protein 8-like), 유전자 등록번호(Genebank) AK057577(IRF3, Interferon regulatory factor 3), 유전자 등록번호(Genebank) AL832659(FLJ22833, Hypothetical protein FLJ22833), 유전자 등록번호(Genebank) BC034487(HIST1H2AK, Histone 1, H2ak), 유전자 등록번호(Genebank) BC034569(ZNF337, Zinc finger protein 337), 유전자 등록번호(Genebank) BC038432(RARA, Retinoic acid receptor, alpha), 유전자 등록번호(Genebank) BC067782(HIST1H2AG, Histone 1, H2ag), 유전자 등록번호(Genebank) BC069193(HIST2H2BE, Histone 2, H2be), 유전자 등록번호(Genebank) BC071638(HIST2H2BE, Histone 2, H2be), 유전자 등록번호(Genebank) BC082232(HIST1H2BG, Histone 1, H2bg), 유전자 등록번호(Genebank) BC101655(HIST1H2BI, Histone 1, H2bi), 유전자 등록번호(Genebank) BE741093(HIST1H2AE ,Histone 1, H2ae), 유전자 등록번호(Genebank) BE973853(HIST1H4J, Histone 1, H4j), 유전자 등록번호(Genebank) BM752802(HIST1H2BM, Histone 1, H2bm), 유전자 등록번호(Genebank) BM919305(POLR2L, Polymerase(RNA) II(DNA directed) polypeptide L, 7.6kDa), 유전자 등록번호(Genebank) BU603483(HIST1H1E, Histone 1, H1e), 유전자 등록번호(Genebank) BX436525(HIST1H2BH, Histone 1, H2bh), 유전자 등록번호(Genebank) BX647290(HIST1H2BO, Histone 1, H2bo), 유전자 등록번호(Genebank) CB529694(HIST2H2BE, Histone 2, H2be), 유전자 등록번호(Genebank) CD710576(HIST2H2AC, Histone 2, H2ac), 유전자 등록번호(Genebank) CK000930(HIST1H2AI, Histone 1, H2ai), 유전자 등록번호(Genebank) CR608156(HIST1H2AC, Histone 1, H2ac), 유전자 등록번호(Genebank) NM_002515(NOVA1, Neuro-oncological ventral antigen 1), 유전자 등록번호(Genebank) NM_003516(HIST2H2AA, Histone 2, H2aa), 유전자 등록번호(Genebank) NM_003519(HIST1H2BL, Histone 1, H2bl), 유전자 등록번호(Genebank) NM_003670(BHLHB2, Basic helix-loop-helix domain containing, class B, 2), 유전자 등록번호(Genebank) NM_004660(DDX3Y, DEAD(Asp-Glu-Ala-Asp) box polypeptide 3, Y-linked), 유전자 등록번호(Genebank) NM_005319(HIST1H1C, Histone 1, H1c), 유전자 등록번호(Genebank) NM_005320(HIST1H1D, Histone 1, H1d), 유전자 등록번호(Genebank) NM_005524(HES1, Hairy and enhancer of split 1,(Drosophila)), 유전자 등록번호(Genebank) NM_006442(DRAP1, DR1-associated protein 1(negative cofactor 2 alpha)), 유전자 등록번호(Genebank) NM_021035(KIAA1404, KIAA1404 protein), 유전자 등록번호(Genebank) U86136(TEP1, Telomerase-associated protein 1), 유전자 등록번호(Genebank) AB209586(MAPK13, Mitogen-activated protein kinase 13), 유전자 등록번호(Genebank) AK074652(SERTAD1, SERTA domain containing 1), 유전자 등록번호(Genebank) AK122829(GAS2L1, Growth arrest-specific 2 like 1), 유전자 등록번호(Genebank) AK129595(GADD45B, Growth arrest and DNA-damage-inducible, beta), 유전자 등록번호(Genebank) BC018266(CDC42, Cell division cycle 42(GTP binding protein, 25kDa)), 유전자 등록번호(Genebank) BC041022(SCAND1, SCAN domain containing 1), 유전자 등록번 호(Genebank) BM904612(S100A6, S100 calcium binding protein A6(calcyclin)), 유전자 등록번호(Genebank) BM913048(TIMP1, TIMP metallopeptidase inhibitor 1), 유전자 등록번호(Genebank) CR612719(GADD45A, Growth arrest and DNA-damage-inducible, alpha), 유전자 등록번호(Genebank) NM_001007271(DUSP13, Dual specificity phosphatase 13), 유전자 등록번호(Genebank) NM_001015053(HDAC5, Histone deacetylase 5), 유전자 등록번호(Genebank) NM_001953(ECGF1, Endothelial cell growth factor 1(platelet-derived)), 유전자 등록번호(Genebank) NM_003255(TIMP2, TIMP metallopeptidase inhibitor 2), 유전자 등록번호(Genebank) NM_005072(SLC12A4, Solute carrier family 12(potassium/chloride transporters), member 4), 유전자 등록번호(Genebank) NM_005343(HRAS, V-Ha-ras Harvey rat sarcoma viral oncogene homolog), 유전자 등록번호(Genebank) NM_005736(ACTR1A, ARP1 actin-related protein 1 homolog A, centractin alpha(yeast)), 유전자 등록번호(Genebank) NM_007065(CDC37, CDC37 cell division cycle 37 homolog(S. cerevisiae)), 유전자 등록번호(Genebank) NM_078467(CDKN1A, Cyclin-dependent kinase inhibitor 1A(p21, Cip1)), 유전자 등록번호(Genebank) U68019(SMAD3, SMAD, mothers against DPP homolog 3(Drosophila)), 유전자 등록번호(Genebank) X02812(TGFB1, Transforming growth factor, beta 1(Camurati-Engelmann disease)), 유전자 등록번호(Genebank) AB033060(PDCD6, Aryl-hydrocarbon receptor repressor), 유전자 등록번호(Genebank) AB209361(FAS, Fas(TNF receptor superfamily, member 6)), 유전자 등록번호(Genebank) AF332558(BBC3, BCL2 binding component 3), 유전자 등록번호(Genebank) AY028896(CARD10, Caspase recruitment domain family, member 10), 유전자 등록번호(Genebank) BC063507(HSPA1B, Heat shock 70kDa protein 1B), 유전자 등록번호(Genebank) BM557864(HSPB1, Heat shock 27kDa protein 1), 유전자 등록번호(Genebank) NM_001003940(BMF ,Bcl2 modifying factor), 유전자 등록번호(Genebank) NM_001165(BIRC3, Baculoviral IAP repeat-containing 3), 유전자 등록번호(Genebank) NM_001197(BIK, BCL2-interacting killer(apoptosis-inducing)), 유전자 등록번호(Genebank) NM_002305(LGALS1, Lectin, galactoside-binding, soluble, 1(galectin 1)), 유전자 등록번호(Genebank) NM_003311(PHLDA2, Pleckstrin homology-like domain, family A, member 2), 유전자 등록번호(Genebank) NM_003639(IKBKG, Inhibitor of kappa light polypeptide gene enhancer in B-cells, kinase gamma), 유전자 등록번호(Genebank) NM_003820(TNFRSF14, Tumor necrosis factor receptor superfamily, member 14(herpesvirus entry mediator)), 유전자 등록번호(Genebank) NM_003897(IER3, Immediate early response 3), 유전자 등록번호(Genebank) NM_004401(DFFA, DNA fragmentation factor, 45kDa, alpha polypeptide), 유전자 등록번호(Genebank) NM_016639(TNFRSF12A, Tumor necrosis factor receptor superfamily, member 12A), 유전자 등록번호(Genebank) BC048334(MT1G, Metallothionein 1G), 유전자 등록번호(Genebank) BC053882(MT1X, Metallothionein 1X), 유전자 등록번호(Genebank) BI488702(MT1K, Metallothionein 1M), 유전자 등록번호(Genebank) NM_005947(MT1B, Metallothionein 1B(functional)), 유전자 등록번호(Genebank) AK055088(CYP2J2, Cytochrome P450, family 2, subfamily J, polypeptide 2), 유전자 등록번호(Genebank) AK094474(RHOC, Ras homolog gene family, member C), 유전자 등록번호(Genebank) BC015041(VAT1, Family with sequence similarity 82, member C), 유전자 등록번호(Genebank) NM_000499(CYP1A1, Cytochrome P450, family 1, subfamily A, polypeptide 1), 유전자 등록번호(Genebank) NM_004881(TP53I3, Tumor protein p53 inducible protein 3), 유전자 등록번호(Genebank) NM_201397(GPX1, Glutathione peroxidase 1), 유전자 등록번호(Genebank) XM_498018(LOC391827, Similar to Keratin, type I cytoskeletal 18(Cytokeratin 18)(K18)(CK 18)), 유전자 등록번호(Genebank) AF524864(AKR1B10, Aldo-keto reductase family 1, member B10(aldose reductase)), 유전자 등록번호(Genebank) AL833205(ETFB, Electron-transfer-flavoprotein, beta polypeptide), 유전자 등록번호(Genebank) BC034763(FDXR, Ferredoxin reductase), 유전자 등록번호(Genebank) CR610878(AKR1B1, Aldo-keto reductase family 1, member B1(aldose reductase)), 유전자 등록번호(Genebank) NM_003330(TXNRD1, Thioredoxin reductase 1), 유전자 등록번호(Genebank) NM_004199(P4HA2, Procollagen-proline, 2-oxoglutarate 4-dioxygenase(proline 4-hydroxylase), alpha polypeptide II), 유전자 등록번호(Genebank) NM_004753(DHRS3, Dehydrogenase/reductase(SDR family) member 3), 유전자 등록번호(Genebank) NM_031226(CYP19A1, Cytochrome P450, family 19, subfamily A, polypeptide 1), 유전자 등록번호(Genebank) NM_032468(ASPH, Aspartate beta-hydroxylase), 유전자 등록번호(Genebank) AB209112(SLC2A8, Solute carrier family 2,(facilitated glucose transporter) member 8), 유전자 등록번호(Genebank) BC011409(UGT1A6, UDP glucuronosyltransferase 1 family, polypeptide A9), 유전자 등록번호(Genebank) H18681(C20orf139, Sulfiredoxin 1 homolog(S. cerevisiae)), 유전자 등록번호(Genebank) NM_002658(PLAU, Plasminogen activator, urokinase), 유전자 등록번호(Genebank) NM_005064(CCL23, Chemokine(C-C motif) ligand 23), 유전자 등록번호(Genebank) NM_032965(CCL14, Chemokine(C-C motif) ligand 15), 유전자 등록번호(Genebank) Y11307(CYR61, Cysteine-rich, angiogenic inducer, 61), 유전자 등록번호(Genebank) AB209808(AP1M1, Adaptor-related protein complex 1, mu 1 subunit), 유전자 등록번호(Genebank) AK074154(SYTL1, Synaptotagmin-like 1), 유전자 등록번호(Genebank) AK098475(GRPEL1, GrpE-like 1, mitochondrial(E. coli)), 유전자 등록번호(Genebank) AK123405(GDI1, GDP dissociation inhibitor 1), 유전자 등록번호(Genebank) BC000786(ARFGAP1, ADP-ribosylation factor GTPase activating protein 1), 유전자 등록번호(Genebank) BC042390(VTI1B, Vesicle transport through interaction with t-SNAREs homolog 1B(yeast)), 유전자 등록번호(Genebank) BG036385(RAMP1, Receptor(calcitonin) activity modifying protein 1), 유전자 등록번호(Genebank) BX648781(GABARAPL1, GABA(A) receptor-associated protein like 1), 유전자 등록번호(Genebank) NM_001013839(EXOC7, Exocyst complex component 7), 유전자 등록번호(Genebank) NM_002926(RGS12, Regulator of G-protein signalling 12), 유전자 등록번호(Genebank) NM_007097(CLTB, Clathrin, light polypeptide(Lcb)), 유전자 등록번호(Genebank) NM_013336(SEC61A1, Sec61 alpha 1 subunit(S. cerevisiae)), 유전자 등록번호(Genebank) NM_024101(MLPH, Melanophilin), 유전자 등록번호(Genebank) NM_032872(SYTL1, Synaptotagmin-like 1), 유전자 등록번호(Genebank) NM_000596(IGFBP1, Insulin-like growth factor binding protein 1), 유전자 등록번호(Genebank) NM_001553(IGFBP7, Insulin-like growth factor binding protein 7), 유전자 등록번호(Genebank) NM_001712(CEACAM1, Carcinoembryonic antigen-related cell adhesion molecule 1(biliary glycoprotein)), 유전자 등록번호(Genebank) NM_012396(PHLDA3, Pleckstrin homology-like domain, family A, member 3), 유전자 등록번호(Genebank) Y12692(WNT11, Wingless-type MMTV integration site family, member 11), 유전자 등록번호(Genebank) BC014470(AZGP1, Alpha-2-glycoprotein 1, zinc), 유전자 등록번호(Genebank) BQ683841(S100A11, S100 calcium binding protein A11(calgizzarin)), 유전자 등록번호(Genebank) NM_002337(LRPAP1, Low density lipoprotein receptor-related protein associated protein 1), 유전자 등록번호(Genebank) AF059617(PLK2, Polo-like kinase 2(Drosophila)), 유전자 등록번호(Genebank) AK128553(ZZANK1, Mindbomb homolog 2(Drosophila)), 유전자 등록번호(Genebank) BX649164(PAI; PAI1; PAI-1; PLANH1, serpin peptidase inhibitor, clade E(nexin, plasminogen activator inhibitor type 1), member 1), 유전자 등록번호(Genebank) NM_000602(SERPINE1, Serpin peptidase inhibitor, clade E(nexin, plasminogen activator inhibitor type 1), member 1), 유전자 등록번호(Genebank) BI767815(GP9, Glycoprotein IX(platelet)), 유전자 등록번호(Genebank) BM918324(LY96, Lymphocyte antigen 96), 유전자 등록번호(Genebank) NM_006404(PROCR, Protein C receptor, endothelial(EPCR)), 유전자 등록번호(Genebank) AF031469(MR1, Major histocompatibility complex, class I-related), 유전자 등록번호(Genebank) BF569086(NK4, Interleukin 32), 유전자 등록번호(Genebank) BG564326(SAA4, Serum amyloid A4, constitutive), 유전자 등록번호(Genebank) NM_001633(AMBP, Alpha-1-microglobulin/bikunin precursor), 유전자 등록번호(Genebank) NM_005532(IFI27, Interferon, alpha-inducible protein 27), 유전자 등록번호(Genebank) NM_017670(OTUB1, OTU domain, ubiquitin aldehyde binding 1), 유전자 등록번호(Genebank) AK130130(CAPG, Capping protein(actin filament), gelsolin-like), 유전자 등록번호(Genebank) BX648190(WDR1, WD repeat domain 1), 유전자 등록번호(Genebank) CF552540(TNNI2, Troponin I type 2(skeletal, fast)), 유전자 등록번호(Genebank) NM_001006946(SDC1, Syndecan 1), 유전자 등록번호(Genebank) NM_007284(PTK9L, PTK9L protein tyrosine kinase 9-like(A6-related protein)), 유전자 등록번호(Genebank) NM_015990(KLHL5, Kelch-like 5(Drosophila)), 유전자 등록번호(Genebank) BM467105(CIB1, Calcium and integrin binding 1(calmyrin)), 유전자 등록번호(Genebank) CF553054(TNNC1, Troponin C type 1(slow)), 유전자 등록번호(Genebank) NM_006384(CIB1, Calcium and integrin binding 1(calmyrin)), 유전자 등록번호(Genebank) NM_080388(S100A16, S100 calcium binding protein A16), 유전자 등록번호(Genebank) NM_005817(M6PRBP1, Mannose-6-phosphate receptor binding protein 1), 유전자 등록번호(Genebank) NM_006555(YKT6, SNARE protein Ykt6), 유전자 등록번호(Genebank) AK093461(ISYNA1, Myo-inositol 1-phosphate synthase A1), 유전자 등록번호(Genebank) AK097009(PLTP,phospholipid transfer protein), 유전자 등록번호(Genebank) BC030207(NR0B2, Nuclear receptor subfamily 0, group B, member 2), 유전자 등록번호(Genebank) BC035124(UNQ2541, MSFL2541), 유전자 등록번호(Genebank) NM_145323(OSBPL3, Oxysterol binding protein-like 3), 유전자 등록번호(Genebank) BC050455(DDB2, LIM homeobox 3), 유전자 등록번호(Genebank) BC068535(TP53AP1, TP53 activated protein 1), 유전자 등록번호(Genebank) NM_016440(VRK3, Vaccinia related kinase 3), 유전자 등록번호(Genebank) NM_001124(ADM, Adrenomedullin), 유전자 등록번호(Genebank) NM_170707(LMNA, Lamin A/C), 유전자 등록번호(Genebank) NM_004633(IL1R2, Interleukin 1 receptor, type II), 유전자 등록번호(Genebank) NM_004864(GDF15, Growth differentiation factor 15), 유전자 등록번호(Genebank) NM_017572(MKNK2, MAP kinase interacting serine/threonine kinase 2), 유전자 등록번호(Genebank) AA669162(AMPD3, Transcribed locus), 유전자 등록번호(Genebank) AB033073(SULF2, Sulfatase 2), 유전자 등록번호(Genebank) AB208949(LRDD, Leucine-rich repeats and death domain containing), 유전자 등록번호(Genebank) AK022712(FLJ12650, Family with sequence similarity 77, member C), 유전자 등록번호(Genebank) AK095363(AQP3, Aquaporin 3), 유전자 등록번호(Genebank) AY368150(CHR2SYT, Family with sequence similarity 62(C2 domain containing) member B), 유전자 등록번호(Genebank) BU587578(RGS10, Regulator of G-protein signalling 10), 유전자 등록번호(Genebank) BU945318(MT2A, Hypothetical gene supported by X97260; BC070289), 유전자 등록번호(Genebank) NM_001013632(LOC343521, Similar to hypothetical protein 4833401D15), 유전자 등록번호(Genebank) NM_006426(DPYSL4, Dihydropyrimidinase-like 4), 유전자 등록번호(Genebank) NM_133493(CD109, CD109 antigen(Gov platelet alloantigens)), 유전자 등록번호(Genebank) NM_145256(LRRC25, Leucine rich repeat containing 25).Genebank Number AB209605 (SKIV2L, Superkiller viralicidic activity 2-like (S. cerevisiae), Genebank Number AI200373 (HIST1H2AL, Histone 1, H2al), Genebank Number AK001594 (AKAP8L, A kinase (PRKA) anchor protein 8-like), Genebank AK057577 (IRF3, Interferon regulatory factor 3), Genebank AL832659 (FLJ22833, Hypothetical protein FLJ22833), Genebank BC034487 (Genebank) HIST1H2AK, Histone 1, H2ak), Genebank BC034569 (ZNF337, Zinc finger protein 337), Genebank BC038432 (RARA, Retinoic acid receptor, alpha), Genebank BC067782 (HIST1H2AG , Histone 1, H2ag), Gene Registration Number (Genebank) BC069193 (HIST2H2BE, Histone 2, H2be), Gene Registration Number (Genebank) BC071638 (HIST2H2BE, Histone 2, H2be), Gene Registration Number (Genebank) BC082232 (HIST1H2BG, Histone 1, H2bg), Genebank BC101655 (HIST1H2BI, His tone 1, H2bi, Genebank BE741093 (HIST1H2AE, Histone 1, H2ae), Genebank BE973853 (HIST1H4J, Histone 1, H4j), Genebank BM752802 (HIST1H2BM, Histone 1 , H2bm), Genebank BM919305 (POLR2L, Polymerase (RNA) II (DNA directed) polypeptide L, 7.6kDa), Genebank (Benebank) BU603483 (HIST1H1E, Histone 1, H1e), Gene Registry Number ( Genebank) BX436525 (HIST1H2BH, Histone 1, H2bh), Gene Registration Number (Genebank) BX647290 (HIST1H2BO, Histone 1, H2bo), Gene Registration Number (Genebank) CB529694 (HIST2H2BE, Histone 2, H2be), Gene Registration Number (Genebank) CD710576 (HIST2H2AC, Histone 2, H2ac), Gene Registration Number (Genebank) CK000930 (HIST1H2AI, Histone 1, H2ai), Gene Registration Number (Genebank) CR608156 (HIST1H2AC, Histone 1, H2ac), Gene Registration Number (Genebank) NM_002515 ( NOVA1, Neuro-oncological ventral antigen 1), Genebank NM_003516 (HIST2H2AA, Histone 2, H2aa), gene Lock number (Genebank) NM_003519 (HIST1H2BL, Histone 1, H2bl), gene registration number (Genebank) NM_003670 (BHLHB2, Basic helix-loop-helix domain containing, class B, 2), gene registration number (Genebank) NM_004660 (DDX3Y, DEAD (Asp-Glu-Ala-Asp) box polypeptide 3, Y-linked), gene accession number (Genebank) NM_005319 (HIST1H1C, Histone 1, H1c), gene accession number (Genebank) NM_005320 (HIST1H1D, Histone 1, H1d) , Gene Registration Number (Genebank) NM_005524 (HES1, Hairy and Enhancer of Split 1, (Drosophila)), Gene Registration Number (Genebank) NM_006442 (DRAP1, DR1-associated protein 1 (negative cofactor 2 alpha)), Gene Registration Number ( Genebank) NM_021035 (KIAA1404, KIAA1404 protein), Genebank U86136 (TEP1, Telomerase-associated protein 1), Genebank AB209586 (MAPK13, Mitogen-activated protein kinase 13), Gene accession number (Genebank) ) AK074652 (SERTAD1, SERTA domain containing 1), Genebank AK122829 (GAS2L1, Growth arrest-specific 2 like 1), Genebank AK129595 (GADD45B, Growth arrest and DNA-damage-inducible, beta), Genebank BC018266 (CDC42, Cell division cycle 42 (GTP binding protein, 25kDa)), Gene Genebank BC041022 (SCAND1, SCAN domain containing 1), Genebank BM904612 (S100A6, S100 calcium binding protein A6 (calcyclin)), Genebank BM913048 (TIMP1, TIMP metallopeptidase inhibitor 1 ), Gene Registration Number (Genebank) CR612719 (GADD45A, Growth arrest and DNA-damage-inducible, alpha), Gene Registration Number (Genebank) NM_001007271 (DUSP13, Dual specificity phosphatase 13), Gene Registration Number (Genebank) NM_001015053 (HDAC5, Histone deacetylase 5), Genebank NM_001953 (ECGF1, Endothelial cell growth factor 1 (platelet-derived)), Genebank NM_003255 (TIMP2, TIMP metallopeptidase inhibitor 2), Genebank NM_005072 (SLC12A4, Solute carrier family 12 (po tassium / chloride transporters), member 4), Genebank NM_005343 (HRAS, V-Ha-ras Harvey rat sarcoma viral oncogene homolog), Genebank NM_005736 (ACTR1A, ARP1 actin-related protein 1 homolog A, centractin alpha (yeast), Genebank NM_007065 (CDC37, CDC37 cell division cycle 37 homolog (S. cerevisiae)), Genebank NM_078467 (CDKN1A, Cyclin-dependent kinase inhibitor 1A (p21, Cip1)), Genebank U68019 (SMAD3, SMAD, mothers against DPP homolog 3 (Drosophila)), Gene Genebank X02812 (TGFB1, Transforming growth factor, beta 1 (Camurati-Engelmann disease), Genebank AB033060 (PDCD6, Aryl-hydrocarbon receptor repressor), Genebank AB209361 (FAS, Fas (TNF receptor superfamily, member 6)), Genebank AF332558 (BBC3, BCL2 binding component 3), Genebank AY028896 (CARD10, Caspase recruitment domain family, member 10), Gene entry number ( Genebank) BC063507 (HSPA1B, Heat shock 70kDa protein 1B), Gene Registration Number (Genebank) BM557864 (HSPB1, Heat Shock 27kDa protein 1), Gene Registration Number (Genebank) NM_001003940 (BMF, Bcl2 modifying factor), Gene Registration Number (Genebank) NM_001165 (BIRC3, Baculoviral IAP repeat-containing 3) Genebank NM_001197 (BIK, BCL2-interacting killer (apoptosis-inducing)), Genebank (Genebank) NM_002305 (LGALS1, Lectin, galactoside-binding, soluble, 1 (galectin 1)), Gene Registration Number ( Genebank) NM_003311 (PHLDA2, Pleckstrin homology-like domain, family A, member 2), Genebank NM_003639 (IKBKG, Inhibitor of kappa light polypeptide gene enhancer in B-cells, kinase gamma), Gene accession number (Genebank ) NM_003820 (TNFRSF14, Tumor necrosis factor receptor superfamily, member 14 (herpesvirus entry mediator), Genebank NM_003897 (IER3, Immediate early response 3), Genebank NM_004401 (DFFA, DNA fragmentation factor, 45 kDa, alpha polypeptide), Genebank NM_016639 (TNFRSF12A, Tumor necrosis factor receptor superfamily, member 12A), Genebank BC048334 (MT1G, Metallothionein 1G), Genebank BC053882 (MT1X, Metallothionein 1X), heredity Genebank BI488702 (MT1K, Metallothionein 1M), Gene Registration Number (Genebank) NM_005947 (MT1B, Metallothionein 1B (functional)), Gene Registration Number (Genebank) AK055088 (CYP2J2, Cytochrome P450, family 2, subfamily J, polypeptide 2), Genebank AK094474 (RHOC, Ras homolog gene family, member C), Genebank BC015041 (VAT1, Family with sequence similarity 82, member C), Genebank NM_000499 ( CYP1A1, Cytochrome P450, family 1, subfamily A, polypeptide 1), gene registration number (Genebank) NM_004881 (TP53I3, Tumor protein p53 inducible protein 3), gene registration number (Genebank) NM_201397 (GPX1, Glutathione peroxidase 1), gene registration Genebank XM_498018 (LOC391827, Similar to Keratin, type I cytoskeletal 18 (Cytokeratin 18) (K18) (CK 18)), Gene accession number (Genebank) AF524864 (AKR1B10, Aldo-keto reductase family 1, member B10 (aldose) reductase), Genebank AL833205 (ETFB, Electron- transfer-flavoprotein, beta polypeptide), genebank (Genebank) BC034763 (FDXR, Ferredoxin reductase), genebank (Genebank) CR610878 (AKR1B1, Aldo-keto reductase family 1, member B1 (aldose reductase), gene registration number (Genebank) NM_003330 (TXNRD1, Thioredoxin reductase 1), gene registration number (Genebank) NM_004199 (P4HA2, Procollagen-proline, 2-oxoglutarate 4-dioxygenase (proline 4-hydroxylase), alpha polypeptide II), gene registration number (Genebank) NM_004753 (DHRS3, Dehydrogenase / reductase (SDR family) member 3), gene registration number (Genebank) NM_031226 (CYP19A1, Cytochrome P450, family 19, subfamily A, polypeptide 1), gene registration number (Genebank) NM_032468 (ASPH, Aspartate beta -hydroxylase), Genebank AB209112 (SLC2A8, Solute carrier family 2, (facilitated glucose transporter) member 8), Genebank (Genebank) BC011409 (UGT1A6, UDP glucuronosyltransferase 1 family, polypeptide A9) (Genebank) H18681 (C20o rf139, Sulfiredoxin 1 homolog (S. cerevisiae)), Genebank NM_002658 (PLAU, Plasminogen activator, urokinase), Genebank NM_005064 (CCL23, Chemokine (CC motif) ligand 23), Genebank NM_032965 (CCL14, Chemokine) (CC motif) ligand 15), Genebank Y11307 (CYR61, Cysteine-rich, angiogenic inducer, 61), Genebank AB209808 (AP1M1, Adaptor-related protein complex 1, mu 1 subunit), Genebank (Genebank) AK074154 (SYTL1, Synaptotagmin-like 1), Genebank (Genebank) AK098475 (GRPEL1, GrpE-like 1, mitochondrial (E. coli)), Genebank (Genebank) AK123405 (GDI1, GDP dissociation inhibitor 1), Genebank BC000786 (ARFGAP1, ADP-ribosylation factor GTPase activating protein 1), Genebank BC042390 (VTI1B, Vesicle transport through interaction with t-SNAREs homolog 1B (yeast), Genebank BG036385 (RAMP1, Receptor (calcitonin) activity modify ing protein 1), Genebank BX648781 (GABARAPL1, GABA (A) receptor-associated protein like 1), Genebank NM_001013839 (EXOC7, Exocyst complex component 7), Genebank NM_002926 (RGS12, Regulator of G-protein signaling 12), Genebank NM_007097 (CLTB, Clathrin, light polypeptide (Lcb)), Genebank NM_013336 (SEC61A1, Sec61 alpha 1 subunit (S. cerevisiae)), gene accession number (Genebank) NM_024101 (MLPH, Melanophilin), gene accession number (Genebank) NM_032872 (SYTL1, Synaptotagmin-like 1), gene accession number (Genebank) NM_000596 (IGFBP1, Insulin-like growth factor binding protein 1), gene registration number (Genebank) NM_001553 (IGFBP7, Insulin-like growth factor binding protein 7), gene registration number (Genebank) NM_001712 (CEACAM1, Carcinoembryonic antigen-related cell adhesion molecule 1 (biliary glycoprotein)), gene registration number (Genebank) NM_012396 (PHLDA3, Pleckstrin homology-like domain, family A, member 3), Genebank Number Y12692 (WNT11, Wingless-type MMTV integration site family, member 11), Genebank Number BC014470 ( AZGP1, Alpha-2-glycoprotein 1, zinc), Genebank BG683841 (S100A11, S100 calcium binding protein A11 (calgizzarin)), Genebank NM_002337 (LRPAP1, Low density lipoprotein receptor-related protein associated protein 1), gene Genebank AF059617 (PLK2, Polo-like kinase 2 (Drosophila)), Gene Registration Number (Genebank) AK128553 (ZZANK1, Mindbomb homolog 2 (Drosophila)), Gene Registration Number (Genebank) BX649164 (PAI; PAI1; PAI-1; PLANH1, serpin peptidase inhibitor, clade E (nexin, plasminogen activator inhibitor type 1), member 1), gene accession number (Genebank) NM_000602 (SERPINE1, Serpin peptidase inhibitor, clade E (nexin, plasminogen activator inhibitor type 1), member 1 Genebank BI767815 (GP9, Glycoprotein IX (platelet)), Genebank (Genebank) BM918324 (LY96, Lymphocyte Antigen 96), Genebank NM_006404 (PROCR, Protein C receptor, endothelial ( EPCR)), Genebank AF031469 (MR1, Major histocompatibility complex, class I-related), Genebank (Genebank) BF569086 (NK4, Interleukin 32), Genebank BG564326 (SAA4, Serum amyloid A4, constitutive, Genebank NM_001633 (AMBP, Alpha-1-microglobulin / bikunin precursor), Genebank NM_005532 (IFI27, Interferon, alpha-inducible protein 27), Genebank (Genebank) NM_017670 (OTUB1, OTU domain, ubiquitin aldehyde bind ing 1), Gene Registration Number (Genebank) AK130130 (CAPG, Capping protein (actin filament), gelsolin-like), Gene Registration Number (Genebank) BX648190 (WDR1, WD repeat domain 1), Gene Registration Number (Genebank) CF552540 ( TNNI2, Troponin I type 2 (skeletal, fast)), Gene Registration Number (Genebank) NM_001006946 (SDC1, Syndecan 1), Gene Registration Number (Genebank) NM_007284 (PTK9L, PTK9L protein tyrosine kinase 9-like (A6-related protein) ), Gene Registration Number (Genebank) NM_015990 (KLHL5, Kelch-like 5 (Drosophila)), Gene Registration Number (Genebank) BM467105 (CIB1, Calcium and integrin binding 1 (calmyrin)), Gene Registration Number (Genebank) CF553054 (TNNC1) , Troponin C type 1 (slow)), Gene Registration Number (Genebank) NM_006384 (CIB1, Calcium and integrin binding 1 (calmyrin)), Gene Registration Number (Genebank) NM_080388 (S100A16, S100 calcium binding protein A16), Gene Registration Number (Genebank) NM_005817 (M6PRBP1, Mannose-6-phosphate receptor binding protein 1), gene accession number (Genebank) NM_006555 ( YKT6, SNARE protein Ykt6), Gene Registration Number (Genebank) AK093461 (ISYNA1, Myo-inositol 1-phosphate synthase A1), Gene Registration Number (Genebank) AK097009 (PLTP, phospholipid transfer protein), Gene Registration Number (Genebank) BC030207 ( NR0B2, Nuclear receptor subfamily 0, group B, member 2), Genebank BC035124 (UNQ2541, MSFL2541), Genebank NM_145323 (OSBPL3, Oxysterol binding protein-like 3), Genebank (Genebank) ) BC050455 (DDB2, LIM homeobox 3), Genebank BC068535 (TP53AP1, TP53 activated protein 1), Genebank NM_016440 (VRK3, Vaccinia related kinase 3), Genebank NM_001124 ( ADM, Adrenomedullin), Gene Registration Number (Genebank) NM_170707 (LMNA, Lamin A / C), Gene Registration Number (Genebank) NM_004633 (IL1R2, Interleukin 1 receptor, type II), Gene Registration Number (Genebank) NM_004864 (GDF15, Growth differentiation factor 15), Genebank NM_017572 ( MKNK2, MAP kinase interacting serine / threonine kinase 2), gene accession number (Genebank) AA669162 (AMPD3, Transcribed locus), gene accession number (Genebank) AB033073 (SULF2, Sulfatase 2), gene accession number (Genebank) AB208949 (LRDD, Leucine-rich repeats and death domain containing), Genebank AK022712 (FLJ12650, Family with sequence similarity 77, member C), Genebank AK095363 (AQP3, Aquaporin 3), Gene Registration Number (Genebank) AY368150 (CHR2SYT, Family with sequence similarity 62 (C2 domain containing) member B), Genebank BU587578 (RGS10, Regulator of G-protein signaling 10), Genebank BU945318 (MT2A, Hypothetical gene supported by X97260; BC070289), Gene Registration Number (Genebank) NM_001013632 (LOC343521, Similar to hypothetical protein 4833401D15), Gene Registration Number (Genebank) NM_006426 (DPYSL4, Dihydropyrimidinase-like 4), Gene Registration Number (Genebank) NM_133493 (CD109, CD109 antigen (Gov) platelet alloantigens)), Genebank NM_145256 (LRRC25, Leucine rich repeat containing 25).

2) 상기 바이오마커 중에서, 다이벤조에이에이취안트라센의 노출에 의해 발현이 감소하는 바이오마커 유전자는 하기와 같다: 2) Among the biomarkers, the biomarker genes whose expression is reduced by exposure of dibenzoAchanthracene are as follows:

유전자 등록번호(Genebank) AB033337(MPHOSPH1,M-phase phosphoprotein 1), 유전자 등록번호(Genebank) AB208875(Septin 10,Septin 10), 유전자 등록번호(Genebank) AF053305(BUB1,BUB1 budding uninhibited by benzimidazoles 1 homolog(yeast)), 유전자 등록번호(Genebank) AF053306(BUB1B,BUB1 budding uninhibited by benzimidazoles 1 homolog beta(yeast)), 유전자 등록번호(Genebank) AF345347(SPAG5,Sperm associated antigen 5), 유전자 등록번 호(Genebank) AK222819(NUSAP1,Nucleolar and spindle associated protein 1), 유전자 등록번호(Genebank) AY367065(ASPM,Asp(abnormal spindle)-like, microcephaly associated(Drosophila)), 유전자 등록번호(Genebank) BC004352(KIF22,Kinesin family member 22), 유전자 등록번호(Genebank) BC010607(IGF1R,Insulin-like growth factor 1 receptor), 유전자 등록번호(Genebank) BC011000(CDCA5,Cell division cycle associated 5), 유전자 등록번호(Genebank) BC013326(GAS2,Growth arrest-specific 2), 유전자 등록번호(Genebank) BC032677(UBE2C,Ubiquitin-conjugating enzyme E2C), 유전자 등록번호(Genebank) BC040991(TFDP2,Transcription factor Dp-2(E2F dimerization partner 2)), 유전자 등록번호(Genebank) BC050384(SUPT3H,Suppressor of Ty 3 homolog(S. cerevisiae)), 유전자 등록번호(Genebank) BC068483(RINT-1,Rad50-interacting protein 1), 유전자 등록번호(Genebank) BQ278454(CKS1B,CDC28 protein kinase regulatory subunit 1B), 유전자 등록번호(Genebank) BX647885(STMN1,Stathmin 1/oncoprotein 18), 유전자 등록번호(Genebank) CR604810(CCNA2,Cyclin A2), 유전자 등록번호(Genebank) CR933728(CDC2,Cell division cycle 2, G1 to S and G2 to M), 유전자 등록번호(Genebank) D42045(DCLRE1A,DNA cross-link repair 1A(PSO2 homolog, S. cerevisiae)), 유전자 등록번호(Genebank) NM_00089(HK2,Hexokinase 2), 유전자 등록번호(Genebank) NM_001005414(ZWINT,ZW10 interactor antisense), 유전자 등록번호(Genebank) NM_001018159(APPBP1,Amyloid beta precursor protein binding protein 1), 유전자 등록번호(Genebank) NM_001239(CCNH,Cyclin H), 유전자 등록번호(Genebank) NM_001790(CDC25C,Cell division cycle 25C), 유전자 등록번호(Genebank) NM_001827(CKS2,CDC28 protein kinase regulatory subunit 2), 유전자 등록번호(Genebank) NM_002431(MNAT1,Menage a trois 1(CAK assembly factor)), 유전자 등록번호(Genebank) NM_002467(MYC,V-myc myelocytomatosis viral oncogene homolog(avian)), 유전자 등록번호(Genebank) NM_002709(PPP1CB,Protein phosphatase 1, catalytic subunit, beta isoform), 유전자 등록번호(Genebank) NM_002737(PRKCA,Protein kinase C, alpha), 유전자 등록번호(Genebank) NM_002894(RBBP8,Retinoblastoma binding protein 8), 유전자 등록번호(Genebank) NM_003318(TTK,TTK protein kinase), 유전자 등록번호(Genebank) NM_003478(CUL5,Cullin 5), 유전자 등록번호(Genebank) NM_003981(PRC1,Protein regulator of cytokinesis 1), 유전자 등록번호(Genebank) NM_004064(CDKN1B,Cyclin-dependent kinase inhibitor 1B(p27, Kip1)), 유전자 등록번호(Genebank) NM_004354(CCNG2,Cyclin G2), 유전자 등록번호(Genebank) NM_004365(CETN3,Centrin, EF-hand protein, 3(CDC31 homolog, yeast)), 유전자 등록번호(Genebank) NM_004523(KIF11,Kinesin family member 11), 유전자 등록번호(Genebank) NM_004701(CCNB2,Cyclin B2), 유전자 등록번호(Genebank) NM_005504(BCAT1,Branched chain aminotransferase 1, cytosolic), 유전자 등록번호(Genebank) NM_005915(MCM6,MCM6 minichromosome maintenance deficient 6(MIS5 homolog, S. pombe)(S. cerevisiae)), 유전자 등록번호(Genebank) NM_006101(KNTC2,Kinetochore associated 2), 유전자 등록번호(Genebank) NM_006265(RAD21,RAD21 homolog(S. pombe)), 유전자 등록번호(Genebank) NM_014750(DLG7,Discs, large homolog 7(Drosophila)), 유전자 등록번호(Genebank) NM_014751(MTSS1,Metastasis suppressor 1), 유전자 등록번호(Genebank) NM_016343(CENPF,Centromere protein F, 350/400ka(mitosin)), 유전자 등록번호(Genebank) NM_018492(PBK,PDZ binding kinase), 유전자 등록번호(Genebank) NM_018685(ANLN,Anillin, actin binding protein(scraps homolog, Drosophila)), 유전자 등록번호(Genebank) NM_019001(XRN1,5'-3' exoribonuclease 1), 유전자 등록번호(Genebank) NM_019063(EML4,Echinoderm microtubule associated protein like 4), 유전자 등록번호(Genebank) NM_020242(KNSL7,Kinesin family member 15), 유전자 등록번호(Genebank) U65410(MAD2L1,MAD2 mitotic arrest deficient-like 1(yeast)), 유전자 등록번호(Genebank) AB096175(SP5,Sp5 transcription factor), 유전자 등록번호(Genebank) AB209086(ZNF493,Zinc finger protein 493), 유전자 등록번호(Genebank) AB209334(SP3,Sp3 transcription factor), 유전자 등록번호(Genebank) AB209892(ZFX,Zinc finger protein, X-linked), 유전자 등록번호(Genebank) AF279145(ANTXR1,Anthrax toxin receptor 1), 유전자 등록번호(Genebank) AK095600(FLJ38281,Zinc finger protein 564), 유전자 등록번호(Genebank) AK123010(RRM2,Ribonucleotide reductase M2 polypeptide), 유전자 등록번호(Genebank) AK126180(DTYMK,Deoxythymidylate kinase(thymidylate kinase)), 유전자 등록번호(Genebank) AK130071(HSPC063,BTB(POZ) domain containing 15), 유전자 등록번호(Genebank) AK131420(ZNF66,Zinc finger protein 66), 유전자 등록번호(Genebank) AK131472(Homo sapiens cDNA FLJ16640 fis, clone TESTI4028938, moderately similar to Zinc finger protein 85. [AK131472],CDNA FLJ16640 fis, clone TESTI4028938, moderately similar to Zinc finger protein 85), 유전자 등록번호(Genebank) AK131527(ZNF15L1,Zinc finger protein 708(KOX8)), 유전자 등록번호(Genebank) AK160373(DKFZp547K1113,Zinc finger protein 710), 유전자 등록번호(Genebank) AL832422(ZNF430,Zinc finger protein 430), 유전자 등록번호(Genebank) AY269786(ZNF429,Zinc finger protein 429), 유전자 등록번호(Genebank) BC035579(ZNF100,Zinc finger protein 100), 유전자 등록번호(Genebank) BC036394(ZNF85,Zinc finger protein 85(HPF4, HTF1)), 유전자 등록번호(Genebank) BM466459(DGKI,Diacylglycerol kinase, iota), 유전자 등록번호(Genebank) BX537574(FREM1,FRAS1 related extracellular matrix 1), 유전자 등록번호(Genebank) BX537987(TRIM59,Tripartite motif-containing 59), 유전자 등록번호(Genebank) BX648469(ATF2,Activating transcription factor 2), 유전자 등록번호(Genebank) CR608275(CBLL1,Cas-Br-M(murine) ecotropic retroviral transforming sequence-like 1), 유전자 등록번호(Genebank) CR749233(ZNF626,Zinc finger protein 626), 유전자 등록번호(Genebank) CR749832(IMPDH1,IMP(inosine monophosphate) dehydrogenase 1), 유전자 등록번호(Genebank) CR936615(MATR3,Matrin 3), 유전자 등록번호(Genebank) NM_000946(PRIM1,Primase, polypeptide 1, 49kDa), 유전자 등록번호(Genebank) NM_001123(ADK,Adenosine kinase), 유전자 등록번호(Genebank) NM_002317(LOX,Lysyl oxidase), 유전자 등록번호(Genebank) NM_002655(PLAG1,Pleiomorphic adenoma gene 1), 유전자 등록번호(Genebank) NM_003423(ZNF43,Zinc finger protein 43(HTF6)), 유전자 등록번호(Genebank) NM_005180(PCGF4,Polycomb group ring finger 4), 유전자 등록번호(Genebank) NM_014615(KIAA0182,KIAA0182 protein), 유전자 등록번호(Genebank) NM_014919(WHSC1,Wolf-Hirschhorn syndrome candidate 1), 유전자 등록번호(Genebank) NM_015040(PIP5K3, Phosphatidylinositol-3-phosphate/phosphatidylinositol 5-kinase, type III), 유전자 등록번호(Genebank) NM_015387(PREI3,Preimplantation protein 3), 유전자 등록번호(Genebank) NM_015905(TIF1,Tripartite motif-containing 24), 유전자 등록번호(Genebank) NM_016513(ICK,Intestinal cell(MAK-like) kinase), 유전자 등록번호(Genebank) NM_016626(RKHD2,Ring finger and KH domain containing 2), 유전자 등록번호(Genebank) NM_018660(ZNF395,Zinc finger protein 395), 유전자 등록번호(Genebank) NM_021129(PP,Pyrophosphatase(inorganic) 1), 유전자 등록번호(Genebank) NM_025074(FRAS1,Fraser syndrome 1), 유전자 등록번호(Genebank) NM_173694(ATP11C,ATPase, Class VI, type 11C), 유전자 등록번호(Genebank) NM_176869(PPA2,Pyrophosphatase(inorganic) 2), 유전자 등록번호(Genebank) NM_182851(CCNB1IP1,Cyclin B1 interacting protein 1), 유전자 등록번호(Genebank) NM_199040(NUDT4,Nudix(nucleoside diphosphate linked moiety X)-type motif 4 pseudogene 2), 유전자 등록번호(Genebank) AK122869(LOC148213,Zinc finger protein 681), 유전자 등록번호(Genebank) BC042500(MGC42493,Hypothetical protein MGC15634), 유전자 등록번호(Genebank) BC043147(ZNF539,Zinc finger protein 254), 유전자 등록번호(Genebank) BC044060(ZNF650,Zinc finger protein 650), 유전자 등록번호(Genebank) BC050340(ZNF230,Zinc finger protein 230), 유전자 등록번호(Genebank) CR749800(ZNFN1A5,Zinc finger protein, subfamily 1A, 5), 유전자 등록번호(Genebank) CR936695(ZNF468,Zinc finger protein ZNF468), 유전자 등록번호(Genebank) NM_001009881(ZCCHC11,Zinc finger, CCHC domain containing 11), 유전자 등록번호(Genebank) NM_003441(ZNF141,Zinc finger protein 141(clone pHZ-44)), 유전자 등록번호(Genebank) NM_006526(ZNF217,Zinc finger protein 217), 유전자 등록번호(Genebank) NM_007146(ZNF161,Zinc finger protein 161), 유전자 등록번호(Genebank) NM_015336(ZDHHC17,Zinc finger, DHHC-type containing 17), 유전자 등록번호(Genebank) NM_016220(ZNF588,Zinc finger protein 588), 유전자 등록번호(Genebank) NM_017742(ZCCHC2,Zinc finger, CCHC domain containing 2), 유전자 등록번호(Genebank) NM_021994(ZNF277,Zinc finger protein 277), 유전자 등록번호(Genebank) NM_024733(FLJ14345,Zinc finger protein 665), 유전자 등록번호(Genebank) NM_032367(ZBED3,Zinc finger, BED-type containing 3), 유전자 등록번호(Genebank) NM_033114(MADP-1,MADP-1 protein), 유전자 등록번호(Genebank) NM_133473(ZNF431,Zinc finger protein 431), 유전자 등록번호(Genebank) NM_152626(ZNF92,Zinc finger protein 92(HTF12)), 유전자 등록번호(Genebank) NM_178558(FLJ90430,Zinc finger protein 680), 유전자 등록번 호(Genebank) NM_198893(ZNF160,Zinc finger protein 160), 유전자 등록번호(Genebank) XM_047550(ZNF492,Zinc finger protein 492), 유전자 등록번호(Genebank) XM_290865(LOC163233,Similar to Zinc finger protein 93(Zinc finger protein HTF34)), 유전자 등록번호(Genebank) XM_371174(ZNF283,Zinc finger protein 283), 유전자 등록번호(Genebank) AB023141(ZNF652,Zinc finger protein 652), 유전자 등록번호(Genebank) AB209245(HMGN1,High-mobility group nucleosome binding domain 1), 유전자 등록번호(Genebank) AB209389(GTF2IRD1,GTF2I repeat domain containing 1), 유전자 등록번호(Genebank) AB209562(HNRPK,Heterogeneous nuclear ribonucleoprotein K), 유전자 등록번호(Genebank) AB209753(RBM7,RNA binding motif protein 7), 유전자 등록번호(Genebank) AF136171(EAP; HBP15; HBP15/L22,ribosomal protein L22), 유전자 등록번호(Genebank) AK001230(POT1,POT1 protection of telomeres 1 homolog(S. pombe)), 유전자 등록번호(Genebank) AK022942(LOC58486,Transposon-derived Buster1 transposase-like protein gene), 유전자 등록번호(Genebank) AK025758(NFATC2,Nuclear factor of activated T-cells, cytoplasmic, calcineurin-dependent 2), 유전자 등록번호(Genebank) AK056803(H2AFZ,H2A histone family, member Z), 유전자 등록번호(Genebank) AK074119(ZZZ3,Zinc finger, ZZ-type containing 3), 유전자 등록번호(Genebank) AK091927(SFRS3,Splicing factor, arginine/serine-rich 3), 유전자 등록번호(Genebank) AK095937(GC20,Translation factor sui1 homolog), 유전자 등록번 호(Genebank) AK124178(EIF3S6,Eukaryotic translation initiation factor 3, subunit 6 48kDa), 유전자 등록번호(Genebank) AL110212(H2AFV,H2A histone family, member V), 유전자 등록번호(Genebank) BC010266(HNRNPA1; MGC102835,Heterogeneous nuclear ribonucleoprotein A1), 유전자 등록번호(Genebank) BM464978(HMGN2,High-mobility group nucleosomal binding domain 2), 유전자 등록번호(Genebank) BM800367(RPL21,Ribosomal protein L21), 유전자 등록번호(Genebank) BU677381(RPL21,Ribosomal protein L21), 유전자 등록번호(Genebank) BX647205(HNRPH1,Heterogeneous nuclear ribonucleoprotein H1(H)), 유전자 등록번호(Genebank) BX647217(HNRPA3,Heterogeneous nuclear ribonucleoprotein A3), 유전자 등록번호(Genebank) CR625990(PC4,SUB1 homolog(S. cerevisiae)), 유전자 등록번호(Genebank) CR627133(LOC342892,Hypothetical protein LOC342892), 유전자 등록번호(Genebank) NM_000947(PRIM2A,Primase, polypeptide 2A, 58kDa), 유전자 등록번호(Genebank) NM_000983(RPL22,Ribosomal protein L22), 유전자 등록번호(Genebank) NM_001015886(HMGA2,High mobility group AT-hook 2), 유전자 등록번호(Genebank) NM_001017430(RBM3,RNA binding motif(RNP1, RRM) protein 3), 유전자 등록번호(Genebank) NM_001018067(PAI-RBP1,SERPINE1 mRNA binding protein 1), 유전자 등록번호(Genebank) NM_001412(EIF1AX,Eukaryotic translation initiation factor 1A, X-linked), 유전자 등록번호(Genebank) NM_001809(CENPA,Centromere protein A, 17kDa), 유전자 등록번호(Genebank) NM_002139(RBMX,RNA binding motif protein, X-linked), 유전자 등록번호(Genebank) NM_002568(PABPC1,Poly(A) binding protein, cytoplasmic 1), 유전자 등록번호(Genebank) NM_003972(BTAF1,BTAF1 RNA polymerase II, B-TFIID transcription factor-associated, 170kDa(Mot1 homolog, S. cerevisiae)), 유전자 등록번호(Genebank) NM_004454(ETV5,Ets variant gene 5(ets-related molecule)), 유전자 등록번호(Genebank) NM_005463(HNRPDL,Heterogeneous nuclear ribonucleoprotein D-like), 유전자 등록번호(Genebank) NM_006047(CPNE1,RNA binding motif protein 12), 유전자 등록번호(Genebank) NM_006345(SLC30A9,Solute carrier family 30(zinc transporter), member 9), 유전자 등록번호(Genebank) NM_006451(PAIP1,Poly(A) binding protein interacting protein 1), 유전자 등록번호(Genebank) NM_006546(IMP-1,IGF-II mRNA-binding protein 1), 유전자 등록번호(Genebank) NM_006716(ASK,DBF4 homolog(S. cerevisiae)), 유전자 등록번호(Genebank) NM_006775(QKI,Quaking homolog, KH domain RNA binding(mouse)), 유전자 등록번호(Genebank) NM_007080(LSM6,LSM6 homolog, U6 small nuclear RNA associated(S. cerevisiae)), 유전자 등록번호(Genebank) NM_007208(MRPL3,Mitochondrial ribosomal protein L3), 유전자 등록번호(Genebank) NM_012207(HNRPH3,Heterogeneous nuclear ribonucleoprotein H3(2H9)), 유전자 등록번호(Genebank) NM_014321(ORC6L,Origin recognition complex, subunit 6 homolog-like(yeast)), 유전자 등록번호(Genebank) NM_014393(STAU2,Staufen, RNA binding protein, homolog 2(Drosophila)), 유전자 등록번호(Genebank) NM_014892(RBM16,RNA binding motif protein 16), 유전자 등록 번호(Genebank) NM_015361(R3HDM,R3H domain containing 1), 유전자 등록번호(Genebank) NM_015975(TAF9L,TAF9-like RNA polymerase II, TATA box binding protein(TBP)-associated factor, 31kDa), 유전자 등록번호(Genebank) NM_016200(LSM8,LSM8 homolog, U6 small nuclear RNA associated(S. cerevisiae)), 유전자 등록번호(Genebank) NM_017437(CPSF2,Cleavage and polyadenylation specific factor 2, 100kDa), 유전자 등록번호(Genebank) NM_018048(FLJ10292,Mago-nashi homolog), 유전자 등록번호(Genebank) NM_018237(CCAR1,Cell division cycle and apoptosis regulator 1), 유전자 등록번호(Genebank) NM_031157(HNRPA1,Heterogeneous nuclear ribonucleoprotein A1), 유전자 등록번호(Genebank) NM_032390(MKI67IP,MKI67(FHA domain) interacting nucleolar phosphoprotein), 유전자 등록번호(Genebank) NM_033222(PSIP1,PC4 and SFRS1 interacting protein 1), 유전자 등록번호(Genebank) NM_054016(FUSIP1,FUS interacting protein(serine/arginine-rich) 1), 유전자 등록번호(Genebank) NM_145018(FLJ25416,Hypothetical protein FLJ25416), 유전자 등록번호(Genebank) NM_153333(TCEAL8,Transcription elongation factor A(SII)-like 8), 유전자 등록번호(Genebank) NM_203463(LASS6,LAG1 longevity assurance homolog 6(S. cerevisiae)), 유전자 등록번호(Genebank) NM_206866(BACH1,BTB and CNC homology 1, basic leucine zipper transcription factor 1), 유전자 등록번호(Genebank) U38847(TARBP1,TAR(HIV) RNA binding protein 1), 유전자 등록번호(Genebank) XM_371470(LOC388907,Similar to ribosomal protein L5; 60S ribosomal protein L5), 유전자 등록번호(Genebank) XM_372050(LOC389674,Heterogeneous nuclear ribonucleoprotein A1 pseudogene 4), 유전자 등록번호(Genebank) XM_372396(LOC390158,Olfactory receptor, family 8, subfamily K, member 1), 유전자 등록번호(Genebank) XM_496355(LOC440577,Similar to nucleophosmin 1; nucleolar phosphoprotein B23; numatrin; nucleophosmin/nucleoplasmin family, member 1), 유전자 등록번호(Genebank) XM_498328(LOC392345,Similar to PRED65), 유전자 등록번호(Genebank) XM_499298(FLJ46189,similar to Zinc finger protein 479(Zinc finger protein Kr19)(HKr19)), 유전자 등록번호(Genebank) XM_499343(PEG10,Paternally expressed 10), 유전자 등록번호(Genebank) AB013380(ABCB10,ATP-binding cassette, sub-family B(MDR/TAP), member 10), 유전자 등록번호(Genebank) AB018342(MYO10,Myosin X), 유전자 등록번호(Genebank) AK025258(UMP-CMPK,Cytidylate kinase), 유전자 등록번호(Genebank) AK098205(AK3L1,Adenylate kinase 3), 유전자 등록번호(Genebank) AK122685(GLUD1,Glutamate dehydrogenase 1), 유전자 등록번호(Genebank) AK122695(RRM1,Ribonucleotide reductase M1 polypeptide), 유전자 등록번호(Genebank) AK126343(STK39,Serine threonine kinase 39(STE20/SPS1 homolog, yeast)), 유전자 등록번호(Genebank) BC051861(SPATA5L1,Spermatogenesis associated 5-like 1), 유전자 등록번호(Genebank) BC064610(SEPHS1,Selenophosphate synthetase 1), 유전자 등록번호(Genebank) BX640965(SLC22A3,Solute carrier family 22(extraneuronal monoamine transporter), member 3), 유전자 등록번호(Genebank) D86550(DYRK1A,Dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 1A), 유전자 등록번호(Genebank) NM_006343(MERTK,C-mer proto-oncogene tyrosine kinase), 유전자 등록번호(Genebank) NM_012073(CCT5,Chaperonin containing TCP1, subunit 5(epsilon)), 유전자 등록번호(Genebank) NM_020326(ABCD4,ATP-binding cassette, sub-family D(ALD), member 4), 유전자 등록번호(Genebank) NM_030752(TCP1,T-complex 1), 유전자 등록번호(Genebank) NM_030919(C20orf129,Chromosome 20 open reading frame 129), 유전자 등록번호(Genebank) NM_182964(NAV2,Neuron navigator 2), 유전자 등록번호(Genebank) AF020038(IDH1,Isocitrate dehydrogenase 1(NADP+), soluble), 유전자 등록번호(Genebank) AK093311(ACAA2,Acetyl-Coenzyme A acyltransferase 2(mitochondrial 3-oxoacyl-Coenzyme A thiolase)), 유전자 등록번호(Genebank) BC008366(DDC,Dopa decarboxylase(aromatic L-amino acid decarboxylase)), 유전자 등록번호(Genebank) BC012616(BHMT,Betaine-homocysteine methyltransferase), 유전자 등록번호(Genebank) BC015062(MTHFD2,Methylenetetrahydrofolate dehydrogenase(NADP+ dependent) 2, methenyltetrahydrofolate cyclohydrolase), 유전자 등록번호(Genebank) BC033320(TAF9,TAF9 RNA polymerase II, TATA box binding protein(TBP)-associated factor, 32kDa), 유전자 등록번호(Genebank) BC033517(ACOX2,Acyl-Coenzyme A oxidase 2, branched chain), 유전자 등록번호(Genebank) BC034481(BCKDHB,Branched chain keto acid dehydrogenase E1, beta polypeptide(maple syrup urine disease)), 유전자 등록번호(Genebank) BC035654(NR1H4,Nuclear receptor subfamily 1, group H, member 4), 유전자 등록번호(Genebank) BC042453(MCCC1,Methylcrotonoyl-Coenzyme A carboxylase 1(alpha)), 유전자 등록번호(Genebank) BC045541(LOC200895,Dihydrofolate reductase-like 1), 유전자 등록번호(Genebank) CR609484(KYNU,Kynureninase(L-kynurenine hydrolase)), 유전자 등록번호(Genebank) CR749593(GLS,Glutaminase), 유전자 등록번호(Genebank) NM_000016(ACADM,Acyl-Coenzyme A dehydrogenase, C-4 to C-12 straight chain), 유전자 등록번호(Genebank) NM_000277(PAH,Phenylalanine hydroxylase), 유전자 등록번호(Genebank) NM_001801(CDO1,Cysteine dioxygenase, type I), 유전자 등록번호(Genebank) NM_002860(ALDH18A1,Aldehyde dehydrogenase 18 family, member A1), 유전자 등록번호(Genebank) NM_004169(SHMT1,Serine hydroxymethyltransferase 1(soluble)), 유전자 등록번호(Genebank) NM_004457(ACSL3,Acyl-CoA synthetase long-chain family member 3), 유전자 등록번호(Genebank) NM_005589(ALDH6A1,Aldehyde dehydrogenase 6 family, member A1), 유전자 등록번호(Genebank) NM_013261(PPARGC1A,Peroxisome proliferative activated receptor, gamma, coactivator 1, alpha), 유전자 등록번호(Genebank) NM_018122(FLJ10514,Aspartyl-tRNA synthetase 2(mitochondrial)), 유전자 등록번호(Genebank) NM_080820(HARS2,Histidyl-tRNA synthetase 2), 유전자 등록번호(Genebank) U73338(MTR,5-methyltetrahydrofolate-homocysteine methyltransferase), 유전자 등록번호(Genebank) AK001676(NUP133,Nucleoporin 133kDa), 유전자 등록번호(Genebank) AK002165(DKFZP564O123,Chromatin modifying protein 2B), 유전자 등록번호(Genebank) AK023143(C10orf119,Chromosome 10 open reading frame 119), 유전자 등록번호(Genebank) AK094603(Homo sapiens cDNA FLJ37284 fis, clone BRAMY2013590. [AK094603],unnamed protein product; Homo sapiens cDNA FLJ37284 fis, clone BRAMY2013590.), 유전자 등록번호(Genebank) AK124768(TNPO1,Transportin 1), 유전자 등록번호(Genebank) BC000100(SNX5,Sorting nexin 5), 유전자 등록번호(Genebank) BC039468(NUP50,Nucleoporin 50kDa), 유전자 등록번호(Genebank) BC064351(SRP9,Signal recognition particle 9kDa), 유전자 등록번호(Genebank) BX091259(UNQ9438,TIMM9), 유전자 등록번호(Genebank) BX641063(DEK,DEK oncogene(DNA binding)), 유전자 등록번호(Genebank) BX648363(SNX10,Sorting nexin 10), 유전자 등록번호(Genebank) CR618609(NOP5/NOP58,Nucleolar protein NOP5/NOP58), 유전자 등록번호(Genebank) NM_002156(HSPD1,Heat shock 60kDa protein 1(chaperonin)), 유전자 등록번호(Genebank) NM_006380(APPBP2,Amyloid beta precursor protein(cytoplasmic tail) binding protein 2), 유전자 등록번호(Genebank) NM_007214(SEC63,SEC63-like(S. cerevisiae)), 유전자 등록번호(Genebank) NM_012460(TIMM9,Translocase of inner mitochondrial membrane 9 homolog(yeast)), 유전자 등록번호(Genebank) NM_014765(TOMM20,Translocase of outer mitochondrial membrane 20 homolog(yeast)), 유전자 등록번호(Genebank) NM_020401(NUP107,Nucleoporin 107kDa), 유전자 등록번호(Genebank) NM_021807(SEC8L1,Exocyst complex component 4), 유전자 등록번호(Genebank) NM_031296(RAB33B,RAB33B, member RAS oncogene family), 유전자 등록번호(Genebank) NM_145261(TIM14,DnaJ(Hsp40) homolog, subfamily C, member 19), 유전자 등록번호(Genebank) NM_173827(FLJ38991,Mitochondrial COX18), 유전자 등록번호(Genebank) AL162068(NAP1L1,Nucleosome assembly protein 1-like 1), 유전자 등록번호(Genebank) AL834186(CDCA7,Cell division cycle associated 7), 유전자 등록번호(Genebank) BC065520(TCFL5,Transcription factor-like 5(basic helix-loop-helix)), 유전자 등록번호(Genebank) CR620626(FGG,Fibrinogen gamma chain), 유전자 등록번호(Genebank) M58569(Homo sapiens fibrinogen, A alpha polypeptide(FGA), transcript variant alpha-E, mRNA [NM_000508]), 유전자 등록번호(Genebank) NM_002291(LAMB1,Laminin, beta 1), 유전자 등록번호(Genebank) NM_005141(FGB,Fibrinogen beta chain), 유전자 등록번호(Genebank) NM_005746(PBEF1,Pre-B-cell colony enhancing factor 1), 유전자 등록번호(Genebank) AK002156(WDR33,WD repeat domain 33), 유전자 등록번호(Genebank) AK074377(UHRF1,Chromosome 19 open reading frame 31), 유전자 등록번호(Genebank) AK122825(HMGB1,High-mobility group box 1), 유전자 등록번호(Genebank) BC032617(POLI,Polymerase(DNA directed) iota), 유전자 등록번호(Genebank) CR600021(HMGB2,High-mobility group box 2), 유전자 등록번호(Genebank) NM_001067(TOP2A,Topoisomerase(DNA) II alpha 170kDa), 유전자 등 록번호(Genebank) NM_002916(RFC4,Replication factor C(activator 1) 4, 37kDa), 유전자 등록번호(Genebank) NM_003368(USP1,Ubiquitin specific peptidase 1), 유전자 등록번호(Genebank) NM_006904(PRKDC,Protein kinase, DNA-activated, catalytic polypeptide), 유전자 등록번호(Genebank) NM_138271(ATRX,Alpha thalassemia/mental retardation syndrome X-linked(RAD54 homolog, S. cerevisiae)), 유전자 등록번호(Genebank) AF285167(ABCA1,ATP-binding cassette, sub-family A(ABC1), member 1), 유전자 등록번호(Genebank) AK124635(PCSK9,Proprotein convertase subtilisin/kexin type 9), 유전자 등록번호(Genebank) NM_000236(LIPC,Lipase, hepatic), 유전자 등록번호(Genebank) AF062341(CTNND1,Catenin(cadherin-associated protein), delta 1), 유전자 등록번호(Genebank) AF480883(PPAP2B,Phosphatidic acid phosphatase type 2B), 유전자 등록번호(Genebank) BC035638(LSS,Lanosterol synthase(2,3-oxidosqualene-lanosterol cyclase)), 유전자 등록번호(Genebank) BX648473(PIGK,Phosphatidylinositol glycan, class K), 유전자 등록번호(Genebank) NM_001444(FABP5,Fatty acid binding protein 5(psoriasis-associated)), 유전자 등록번호(Genebank) NM_003129(SQLE,Squalene epoxidase), 유전자 등록번호(Genebank) NM_003580(NSMAF,Neutral sphingomyelinase(N-SMase) activation associated factor), 유전자 등록번호(Genebank) NM_018361(AGPAT5,1-acylglycerol-3-phosphate O-acyltransferase 5(lysophosphatidic acid acyltransferase, epsilon)), 유전자 등록번호(Genebank) NM_020918(GPAM,Glycerol-3-phosphate acyltransferase, mitochondrial), 유전자 등록번호(Genebank) AB209031(C5,Complement component 5), 유전자 등록번호(Genebank) AF130100(SERPINC1,Serpin peptidase inhibitor, clade C(antithrombin), member 1), 유전자 등록번호(Genebank) AK122686(IF,I factor(complement)), 유전자 등록번호(Genebank) BC022312(C4BPA,Complement component 4 binding protein, alpha), 유전자 등록번호(Genebank) M75106(CPB2,Carboxypeptidase B2(plasma, carboxypeptidase U)), 유전자 등록번호(Genebank) NM_000893(KNG1,Kininogen 1), 유전자 등록번호(Genebank) AK055619(GNAQ,Guanine nucleotide binding protein(G protein), q polypeptide), 유전자 등록번호(Genebank) AL832747(GNAQ,Guanine nucleotide binding protein(G protein), q polypeptide), 유전자 등록번호(Genebank) CR596712(IL17D,Interleukin 17D), 유전자 등록번호(Genebank) AK000972(C9orf40,Chromosome 9 open reading frame 40), 유전자 등록번호(Genebank) AK023675(UTRN,Utrophin(homologous to dystrophin)), 유전자 등록번호(Genebank) AK026095(SNTB1,Syntrophin, beta 1(dystrophin-associated protein A1, 59kDa, basic component 1)), 유전자 등록번호(Genebank) AL117472(SORBS1,Sorbin and SH3 domain containing 1), 유전자 등록번호(Genebank) NM_018728(MYO5C,Myosin VC), 유전자 등록번호(Genebank) XM_371116(MYO5B,Myosin VB), 유전자 등록번호(Genebank) BC026320(OGDHL,Oxoglutarate dehydrogenase-like), 유전자 등록번호(Genebank) BC033391(PP1665,Glycerophosphodiester phosphodiesterase domain containing 5), 유전자 등록번호(Genebank) BC042421(GK,Glycerol kinase), 유전자 등록번호(Genebank) M15943(ADH4,Alcohol dehydrogenase 4(class II), pi polypeptide), 유전자 등록번호(Genebank) NM_000671(ADH5,Alcohol dehydrogenase 5(class III), chi polypeptide), 유전자 등록번호(Genebank) NM_002610(PDK1,Pyruvate dehydrogenase kinase, isozyme 1), 유전자 등록번호(Genebank) AK026927(MGC5297,Hypothetical protein MGC5297), 유전자 등록번호(Genebank) AK127326(PHF17,PHD finger protein 17), 유전자 등록번호(Genebank) BC039110(SMNDC1,Survival motor neuron domain containing 1), 유전자 등록번호(Genebank) BC041849(ROCK1,Rho-associated, coiled-coil containing protein kinase 1), 유전자 등록번호(Genebank) BX537500(PDCD4,Programmed cell death 4(neoplastic transformation inhibitor)), 유전자 등록번호(Genebank) CR596268(ITGB3BP,Integrin beta 3 binding protein(beta3-endonexin)), 유전자 등록번호(Genebank) NM_004938(DAPK1,Death-associated protein kinase 1), 유전자 등록번호(Genebank) NM_012238(SIRT1,Sirtuin(silent mating type information regulation 2 homolog) 1(S. cerevisiae)), 유전자 등록번호(Genebank) NM_130837(OPA1,Optic atrophy 1(autosomal dominant)), 유전자 등록번호(Genebank) NM_148957(TNFRSF19,Tumor necrosis factor receptor superfamily, member 19), 유전자 등록번호(Genebank) AB208919(FGFR1,Fibroblast growth factor receptor 1(fms-related tyrosine kinase 2, Pfeiffer syndrome)), 유전자 등록번 호(Genebank) AB209601(TIZ,Zinc finger protein 675), 유전자 등록번호(Genebank) AK125150(MAPK8,Mitogen-activated protein kinase 8), 유전자 등록번호(Genebank) BC027881(AFP,Alpha-fetoprotein), 유전자 등록번호(Genebank) NM_020995(HPR,Haptoglobin-related protein), 유전자 등록번호(Genebank) AF167706(CRIM1,Cysteine rich transmembrane BMP regulator 1(chordin-like)), 유전자 등록번호(Genebank) BC045655(MAC30,Hypothetical protein MAC30), 유전자 등록번호(Genebank) BX537509(NET1,Neuroepithelial cell transforming gene 1), 유전자 등록번호(Genebank) BX640958(YEATS4,YEATS domain containing 4), 유전자 등록번호(Genebank) BX647757(Homo sapiens sex comb on midleg-like 1(Drosophila)(SCML1), mRNA [NM_006746],sex comb on midleg-like 1(Drosophila)), 유전자 등록번호(Genebank) NM_006548(IMP-2,IGF-II mRNA-binding protein 2), 유전자 등록번호(Genebank) AY376439(ECT2,Epithelial cell transforming sequence 2 oncogene), 유전자 등록번호(Genebank) AY596970(GARNL1,GTPase activating Rap/RanGAP domain-like 1), 유전자 등록번호(Genebank) BC050630(RAB3-GAP150,RAB3 GTPase activating protein subunit 2(non-catalytic)), 유전자 등록번호(Genebank) NM_001001132(ITSN1,Intersectin 1(SH3 domain protein)), 유전자 등록번호(Genebank) NM_016340(KIAA1961,KIAA1961 gene), 유전자 등록번호(Genebank) NM_145290(GPR125,G protein-coupled receptor 125), 유전자 등록번호(Genebank) NM_003574(VAPA,VAMP(vesicle-associated membrane protein)-associated protein A, 33kDa), 유전자 등록번호(Genebank) M28016(cytochrome b,Human mitochondrial cytochrome b gene, partial cds.), 유전자 등록번호(Genebank) NM_013277(RACGAP1,Rac GTPase activating protein 1), 유전자 등록번호(Genebank) AB096248(SNF1LK2,SNF1-like kinase 2), 유전자 등록번호(Genebank) NM_001698(AUH,AU RNA binding protein/enoyl-Coenzyme A hydratase), 유전자 등록번호(Genebank) AB091343(C10orf3,Centrosomal protein 55kDa). Genebank No. AB033337 (MPHOSPH1, M-phase phosphoprotein 1), Genebank No. AB208875 (Septin 10, Septin 10), Genebank No. AF053305 (BUB1, BUB1 budding uninhibited by benzimidazoles 1 homolog ( yeast)), Genebank AF053306 (BUB1B, BUB1 budding uninhibited by benzimidazoles 1 homolog beta (yeast), Genebank AF345347 (SPAG5, Sperm associated antigen 5), Genebank AK222819 (NUSAP1, Nucleolar and spindle associated protein 1), Genebank AY367065 (ASPM, Abnormal spindle) -like, microcephaly associated (Drosophila), Genebank BC004352 (KIF22, Kinesin family member 22), Genebank BC010607 (IGF1R, Insulin-like growth factor 1 receptor), Genebank BC011000 (CDCA5, Cell division cycle associated 5), Genebank BC013326 (GAS2, Groth arrest-specific 2), gene registration number (Geneba) nk) BC032677 (UBE2C, Ubiquitin-conjugating enzyme E2C), Gene Registration Number (Genebank) BC040991 (TFDP2, Transcription factor Dp-2 (E2F dimerization partner 2)), Gene Registration Number (Genebank) BC050384 (SUPT3H, Suppressor of Ty 3 homolog (S. cerevisiae)), Gene Banking Number BC068483 (RINT-1, Rad50-interacting protein 1), Gene Banking Number (Genebank) BQ278454 (CKS1B, CDC28 protein kinase regulatory subunit 1B), Gene Banking Number (Genebank) BX647885 (STMN1 , Stathmin 1 / oncoprotein 18), Genebank CR604810 (CCNA2, Cyclin A2), Genebank CR933728 (CDC2, Cell division cycle 2, G1 to S and G2 to M), Gene registry number ( Genebank) D42045 (DCLRE1A, DNA cross-link repair 1A (PSO2 homolog, S. cerevisiae)), gene accession number (Genebank) NM_00089 (HK2, Hexokinase 2), gene accession number (Genebank) NM_001005414 (ZWINT, ZW10 interactor antisense) , Gene Registration Number (Genebank) NM_001018159 (APPBP1, Amyloid beta precursor protein binding protein 1), Gene Registration Number (Genebank) NM_001239 (CCNH, Cyclin H), Gene Registration Number (Genebank) NM_001790 (CDC25C, Cell division cycle 25C), Genebank NM_001827 (CKS2, CDC28 protein kinase regulatory subunit 2), gene Genebank NM_002431 (MNAT1, Menage a trois 1 (CAK assembly factor)), Genebank NM_002467 (MYC, V-myc myelocytomatosis viral oncogene homolog (avian)), Genebank NM_002709 (Genebank) PPP1CB, Protein phosphatase 1, catalytic subunit, beta isoform), Gene Registration Number (Genebank) NM_002737 (PRKCA, Protein kinase C, alpha), Gene Registration Number (Genebank) NM_002894 (RBBP8, Retinoblastoma binding protein 8), Gene Registration Number ( Genebank) NM_003318 (TTK, TTK protein kinase), Genebank NM_003478 (CUL5, Cullin 5), Genebank NM_003981 (PRC1, Protein regulator of cytokinesis 1), Genebank NM_004064 ( CDKN1B, Cyclin-dependent kinase inhibitor 1B (p27, Kip1)), Gene Registration Number (Genebank) NM_004354 (CCNG2, Cyclin G2), Gene Registration Number (Genebank) NM_004365 (CETN3, Centrin, EF-hand protein, 3 (CDC31 homolog) , yeast)), Genebank NM_004523 (KIF11, Kinesin family member 11), Genebank NM_004701 (CCNB2, Cyclin B2), Genebank NM_005504 (BCAT1, Branched chain aminotransferase 1, cytosolic), Genebank NM_005915 (MCM6, MCM6 minichromosome maintenance deficient 6 (MIS5 homolog) , S. pombe (S. cerevisiae)), Genebank NM_006101 (KNTC2, Kinetochore associated 2), Genebank NM_006265 (RAD21, RAD21 homolog (S. pombe)), Genebank NM_014750 (DLG7, Discs, large homolog 7 (Drosophila)), gene registration number (Genebank) NM_014751 (MTSS1, Metastasis suppressor 1), gene registration number (Genebank) NM_016343 (CENPF, Centromere protein F, 350 / 400ka (mitosin)), gene registration number (Genebank) ) NM_018492 (PBK, PDZ binding kinase), gene registration number (Genebank) NM_018685 (ANLN, Anillin, actin binding protein (scraps homolog, Drosophila)), gene registration number (Genebank) NM_019001 (XRN1,5'-3 'exoribonuclease 1 ), Gene registration number (Genebank) NM_019063 (EML4, Echinoderm microtubule associated protein like 4), gene registration number (Genebank) NM_020242 (KNSL7, Kinesin family member 15), gene registration number (Genebank) U65410 (MAD2L1, MAD2 mitotic arrest deficient -like 1 (yeast), Genebank AB096175 (SP5, Sp5 transcription) factor), Genebank AB209086 (ZNF493, Zinc finger protein 493), Genebank AB209334 (SP3, Spp transcription factor), Genebank AB209892 (ZFX, Zinc finger protein, X- linked), Genebank AF279145 (ANTXR1, Anthrax toxin receptor 1), Genebank AK095600 (FLJ38281, Zinc finger protein 564), Genebank AK123010 (RRM2, Ribonucleotide reductase M2 polypeptide) , Genebank AK126180 (DTYMK, Deoxythymidylate kinase (thymidylate kinase)), Genebank A (Genebank) AK130071 (HSPC063, BTB (POZ) domain containing 15), Genebank AK131420 (ZNF66, Zinc finger protein 66), Genebank AK131472 (Homo sapiens cDNA FLJ16640 fis, clone TESTI4028938, moderately similar to Zinc finger protein 85. [AK131472], CDNA FLJ16640 fis, clone TESTI4028938, moderately similar to Zinc finger protein 85), gene Registration Number (Genebank) A K131527 (ZNF15L1, Zinc finger protein 708 (KOX8)), Gene Registration Number (Genebank) AK160373 (DKFZp547K1113, Zinc Finger Protein 710), Gene Registration Number (Genebank) AL832422 (ZNF430, Zinc finger protein 430), Gene Registration Number (Genebank) ) AY269786 (ZNF429, Zinc finger protein 429), Genebank BC035579 (ZNF100, Zinc finger protein 100), Genebank BC036394 (ZNF85, Zinc finger protein 85 (HPF4, HTF1)), Gene Registration Genebank BM466459 (DGKI, Diacylglycerol kinase, iota), Gene Registration Number (Genebank) BX537574 (FREM1, FRAS1 related extracellular matrix 1), Genebank BX537987 (TRIM59, Tripartite motif-containing 59), Gene Registration Genebank BX648469 (ATF2, activating transcription factor 2), Genebank (Genebank) CR608275 (CBLL1, Cas-Br-M (murine) ecotropic retroviral transforming sequence-like 1), Genebank (Genebank) CR749233 (ZNF626 , Zinc finger protein 626), Genebank CR7498 32 (IMPDH1, IMP (inosine monophosphate) dehydrogenase 1), Gene Registration Number (Genebank) CR936615 (MATR3, Matrin 3), Gene Registration Number (Genebank) NM_000946 (PRIM1, Primase, polypeptide 1, 49kDa), Gene Registration Number (Genebank ) NM_001123 (ADK, Adenosine kinase), Genebank (Genebank) NM_002317 (LOX, Lysyl oxidase), Genebank (Genebank) NM_002655 (PLAG1, Pleiomorphic adenoma gene 1), Genebank (Genebank) NM_003423 (ZNF43, Zinc finger protein 43 (HTF6)), Genebank NM_005180 (PCGF4, Polycomb group ring finger 4), Genebank NM_014615 (KIAA0182, KIAA0182 protein), Genebank NM_014919 (WHSC1, Wolf Hirschhorn syndrome candidate 1), gene registration number (Genebank) NM_015040 (PIP5K3, Phosphatidylinositol-3-phosphate / phosphatidylinositol 5-kinase, type III), gene registration number (Genebank) NM_015387 (PREI3, Preimplantation protein 3), gene registration number (Genebank) NM_015905 (TIF1, Tripartite motif-containin g 24), Genebank NM_016513 (ICK, Intestinal cell (MAK-like) kinase), Genebank (Genebank) NM_016626 (RKHD2, Ring finger and KH domain containing 2), Genebank NM_018660 (ZNF395, Zinc finger protein 395), Genebank NM_021129 (PP, Pyrophosphatase (inorganic) 1), Genebank NM_025074 (FRAS1, Fraser syndrome 1), Genebank NM_173694 (ATP11C , ATPase, Class VI, type 11C), Gene Registration Number (Genebank) NM_176869 (PPA2, Pyrophosphatase (inorganic) 2), Gene Registration Number (Genebank) NM_182851 (CCNB1IP1, Cyclin B1 interacting protein 1), Gene Registration Number (Genebank) NM_199040 (NUDT4, Nudix (nucleoside diphosphate linked moiety X) -type motif 4 pseudogene 2), gene accession number (Genebank) AK122869 (LOC148213, Zinc finger protein 681), gene accession number (Genebank) BC042500 (MGC42493, Hypothetical protein MGC15634) , Genebank BC043147 (ZNF539, Zinc finger protein 2 54), Genebank BC044060 (ZNF650, Zinc finger protein 650), Genebank BC050340 (ZNF230, Zinc finger protein 230), Genebank (Genebank) CR749800 (ZNFN1A5, Zinc finger protein, subfamily 1A, 5), Genebank CR936695 (ZNF468, Zinc finger protein ZNF468), Genebank NM_001009881 (ZCCHC11, Zinc finger, CCHC domain containing 11), Genebank NM_003441 (ZNF141, Zinc finger protein 141 (clone pHZ-44)), Genebank NM_006526 (ZNF217, Zinc finger protein 217), Genebank NM_007146 (ZNF161, Zinc finger protein 161), Genebank (Genebank) NM_015336 (ZDHHC17, Zinc finger, DHHC-type containing 17), gene registration number (Genebank) NM_016220 (ZNF588, Zinc finger protein 588), gene registration number (Genebank) NM_017742 (ZCCHC2, Zinc finger, CCHC domain containing 2), gene Genebank NM_021994 (ZNF277, Zinc finger protein 277), gene Genebank NM_024733 (FLJ14345, Zinc finger protein 665), Genebank NM_032367 (ZBED3, Zinc finger, BED-type containing 3), Genebank NM_033114 (MADP-1, MADP-1 protein, Genebank NM_133473 (ZNF431, Zinc finger protein 431), Genebank NM_152626 (ZNF92, Zinc finger protein 92 (HTF12)), Genebank NM_178558 (FLJ90430, Zinc finger protein 680, Genebank NM_198893 (ZNF160, Zinc finger protein 160), Genebank XM_047550 (ZNF492, Zinc finger protein 492), Genebank XM_290865 (LOC163233, Simlar to Zinc finger protein 93 (Zinc finger protein HTF34), Genebank XM_371174 (ZNF283, Zinc finger protein 283), Genebank AB023141 (ZNF652, Zinc finger protein 652), Genebank AB209245 (HMGN1, high-mobility group nucleosome binding domain 1), gene registration number (Ge nebank) AB209389 (GTF2IRD1, GTF2I repeat domain containing 1), gene registration number (Genebank) AB209562 (HNRPK, heterogeneous nuclear ribonucleoprotein K), gene registration number (Genebank) AB209753 (RBM7, RNA binding motif protein 7), gene registration number ( Genebank) AF136171 (EAP; HBP15; HBP15 / L22, ribosomal protein L22), Genebank AK001230 (POT1, POT1 protection of telomeres 1 homolog (S. pombe)), Gene Accession Number (Genebank) AK022942 (LOC58486, Transposon-derived Buster1 transposase-like protein gene), genebank AK025758 (NFATC2, Nuclear factor of activated T-cells, cytoplasmic, calcineurin-dependent 2), genebank AK056803 (H2AFZ, H2A histone family, member Z), gene registry number (Genebank) AK074119 (ZZZ3, Zinc finger, ZZ-type containing 3), Gene Registration Number (Genebank) AK091927 (SFRS3, Splicing factor, arginine / serine-rich 3), Gene Registration Number (Genebank) AK095937 (GC20, Translation factor sui1 homolog), Genebank AK124178 (EIF3S6, Eukaryotic translation initiation factor 3, subunit 6 48kDa), Genebank AL110212 (H2AFV, H2A histone family, member V), Genebank (Genebank) BC010266 (HNRNPA1; MGC102835, Heterogeneous nuclear ribonucleoprotein A1) Genebank BM464978 (HMGN2, High-mobility group nucleosomal binding domain 2), Genebank BM800367 (RPL21, Ribosomal protein L21), Genebank BU677381 (RPL21, Ribosomal protein L21), Genebank (Genebank) BX647205 (HNRPH1, Heterogeneous nuclear ribonucleoprotein H1 (H)), Gene Registry Number (Genebank) BX647217 (HNRPA3, Heterogeneous nuclear ribonucleoprotein A3), Gene accession number (Genebank) CR625990 (PC4, SUB1 homolog (S. cerevisiae)), Gene Registration Number (Genebank) CR627133 (LOC342892, Hypothetical protein LOC342892), Gene Registration Number (Genebank) NM_000947 (PRIM2A, Primase, polypeptide 2A, 58 kDa), Gene Registration Number (Genebank) NM_000983 (RPL22, Ribosomal protein L22) ), Gene registration number (Genebank) NM_001015886 (HMGA2, High mobility group AT-hook 2), gene registration number (Genebank) NM_001017430 (RBM3, RNA binding motif (RNP1, RRM) protein 3), gene registration number (Genebank) NM_001018067 (PAI-RBP1, SERPINE1 mRNA binding protein 1), Genebank NM_001412 (EIF1AX, Eukaryotic translation initiation factor 1A, X-linked), Genebank NM_001809 (CENPA, Centromere protein A, 17kDa), Genebank (Genebank) NM_002139 (RBMX, RNA binding motif protein, X-linked), Genebank (Genebank) NM_002568 (PABPC1, Poly (A) binding protein, cytoplasmic 1), Genebank (Menebank) NM_003972 (BTAF1 , BTAF1 RNA polymerase II, B-TFIID transcription factor-associated, 17 0 kDa (Mot1 homolog, S. cerevisiae)), Genebank NM_004454 (ETV5, Ets variant gene 5 (ets-related molecule)), Genebank NM_005463 (HNRPDL, Heterogeneous nuclear ribonucleoprotein D-like) , Gene Registration Number (Genebank) NM_006047 (CPNE1, RNA binding motif protein 12), Gene Registration Number (Genebank) NM_006345 (SLC30A9, Solute carrier family 30 (zinc transporter), member 9), Gene Registration Number (Genebank) NM_006451 (PAIP1 , Poly (A) binding protein interacting protein 1), Genebank NM_006546 (IMP-1, IGF-II mRNA-binding protein 1), Genebank NM_006716 (ASK, DBF4 homolog (S. cerevisiae)), Genebank NM_006775 (QKI, Quaking homolog, KH domain RNA binding (mouse)), Genebank NM_007080 (LSM6, LSM6 homolog, U6 small nuclear RNA associated (S. cerevisiae)) , Gene Registration Number (Genebank) NM_007208 (MRPL3, Mitochondrial ribosomal protein L3), Gene Registration Number (Genebank) NM_012207 (HNRPH3, Heterogeneous nuclear ribonucleoprotein H3 (2H9)), Gene Registration Number (Genebank) NM_014321 (ORC6L, Origin recognition complex, subunit 6 homolog-like (yeast)), gene registration number (Genebank) NM_014393 (STAU2, Staufen, RNA binding protein, homolog 2 (Drosophila)), gene registration number (Genebank) NM_014892 (RBM16, RNA binding motif protein 16), Genebank (Genebank) NM_015361 (R3HDM, R3H domain containing 1), Genebank (Genebank) NM_015975 (TAF9L, TAF9-like RNA polymerase II, TATA box binding protein (TBP) -associated factor, 31kDa), Gene Registration Number (Genebank) NM_016200 (LSM8, LSM8 homolog, U6 small nuclear RNA associat ed (S. cerevisiae)), Genebank NM_017437 (CPSF2, Cleavage and polyadenylation specific factor 2, 100 kDa), Genebank NM_018048 (FLJ10292, Mago-nashi homolog), Gene Registry Number (Genebank) NM_018237 (CCAR1, Cell division cycle and apoptosis regulator 1), gene registration number (Genebank) NM_031157 (HNRPA1, heterogeneous nuclear ribonucleoprotein A1), gene registration number (Genebank) NM_032390 (MKI67IP, MKI67 (FHA domain) interacting nucleolar phosphoprotein), gene Genebank NM_033222 (PSIP1, PC4 and SFRS1 interacting protein 1), Gene Registration Number (Genebank) NM_054016 (FUSIP1, FUS interacting protein (serine / arginine-rich) 1), Gene Registration Number (Genebank) NM_145018 (FLJ25416, Hypothetical protein FLJ25416), Genebank NM_153333 (TCEAL8, Transcription elongation factor A (SII) -like 8), Genebank NM_203463 (LASS6, LAG1 longevity assurance homolog 6 (S. cerevisiae)), Genebank NM_206866 (BACH1, BTB and CNC homology 1, basic leucine zipper transcription factor 1), Genebank U38847 (TARBP1, TAR (HIV) RNA binding protein 1), Gene registration Number (Genebank) XM_371470 (LOC388907, Simallar to ribosomal protein L5; 60S ribosomal protein L5), Gene accession number (Genebank) XM_372050 (LOC389674, Heterogeneous nuclear ribonucleoprotein A1 pseudogene 4), Gene accession number (Genebank) XM_372396 (LOC390158, Ol) , family 8, subfamily K, member 1), Genebank XM_496355 (LOC440577, Similar to nucleophosmin 1; nucleolar phosphoprotein B23; numatrin; nucleophosmin / nucleoplasmin family, member 1), Genebank XM_498328 (LOC392345 , Similar to PRED65), Genebank XM_499298 (FLJ46189, similar to Zinc finger protein 479 (Zinc finger protein Kr19) (HKr19)), Genebank XM_499343 (PEG10, Paternally expressed 10), Gene Registration Genebank AB013380 (ABCB10, ATP-binding cassette, sub-family B (MDR / TAP), member 10), Gene Registration Number (Genebank) AB018342 (MYO10, Myosin X), Gene Registration Number (Genebank) AK025258 (UMP -CMPK, Cyidylate kinase, Genebank AK098205 (AK3L1, Adenylate kinase 3), Gene Accession Number (Genebank) AK122685 (GLUD1, Glutamate dehydrogenase 1), Gene Accession Number (Genebank) AK122695 (RRM1, Ribonucleotide reductase M1 polypeptide), Genebank AK126343 (STK39, Serine threonine kinase 39 (STE20 / SPS1 homolog, yeast)), Genebank (Genebank) BC051861 (SPATA5L1, Spermatogenesis associated 5-like 1), Gene accession number (Genebank) ) BC064610 (SEPHS1, Selenophosphate synthetase 1), Gene Registration Number (Genebank) BX640965 (SLC22A3, Solute carrier family 22 (extraneuronal monoamine transporter), member 3), Gene Registration Number (Genebank) D86550 (DYRK1A, Dual-specificity tyrosine- ( Y) -phosphorylation regulated kinase 1A), Genebank N M_006343 (MERTK, C-mer proto-oncogene tyrosine kinase), gene registration number (Genebank) NM_012073 (CCT5, Chaperonin containing TCP1, subunit 5 (epsilon)), gene registration number (Genebank) NM_020326 (ABCD4, ATP-binding cassette, sub-family D (ALD), member 4), Genebank NM_030752 (TCP1, T-complex 1), Genebank NM_030919 (C20orf129, Chromosome 20 open reading frame 129), Gene Registry Number ( Genebank) NM_182964 (NAV2, Neuron navigator 2), Gene Registration Number (Genebank) AF020038 (IDH1, Isocitrate dehydrogenase 1 (NADP +), Soluble), Gene Registration Number (Genebank) AK093311 (ACAA2, Acetyl-Coenzyme A acyltransferal 2 3mitochon -oxoacyl-Coenzyme A thiolase)), Gene Registration Number (Genebank) BC008366 (DDC, Dopa decarboxylase (aromatic L-amino acid decarboxylase)), Gene Registration Number (Genebank) BC012616 (BHMT, Betaine-homocysteine methyltransferase), Gene Registration Number Genebank BC015062 (MTHFD2, Methylenetetrahydrofolate dehydrogenase (NADP + dependent) 2, m ethenyltetrahydrofolate cyclohydrolase), Genebank BC033320 (TAF9, TAF9 RNA polymerase II, TATA box binding protein (TBP) -associated factor, 32kDa), Genebank BC033517 (ACOX2, Acyl-Coenzyme A oxidase 2, branched chain, Genebank BC034481 (BCKDHB, Branched chain keto acid dehydrogenase E1, beta polypeptide (maple syrup urine disease)), Gene accession (Genebank) BC035654 (NR1H4, Nuclear receptor subfamily 1, group H, member 4) Gene Registration Number (Genebank) BC042453 (MCCC1, Methylcrotonoyl-Coenzyme A carboxylase 1 (alpha)), Gene Registration Number (Genebank) BC045541 (LOC200895, Dihydrofolate reductase-like 1), Gene Registration Number (Genebank) CR609484 (KYNU Kynureninase (L-kynurenine hydrolase), Genebank (Genebank) CR749593 (GLS, Glutaminase), Genebank (Genebank) NM_000016 (ACADM, Acyl-Coenzyme A dehydrogenase, C-4 to C-12 straight chain), Genebank Number (Genebank) NM_000277 (PAH, Phenylalanine hyd roxylase), Gene Registration Number (Genebank) NM_001801 (CDO1, Cysteine dioxygenase, type I), Gene Registration Number (Genebank) NM_002860 (ALDH18A1, Aldehyde dehydrogenase 18 family, member A1), Gene Registration Number (Genebank) NM_004169 (SHMT1, Serrine hydroxymethyltransferase 1 (soluble)), gene registration number (Genebank) NM_004457 (ACSL3, Acyl-CoA synthetase long-chain family member 3), gene registration number (Genebank) NM_005589 (ALDH6A1, Aldehyde dehydrogenase 6 family, member A1), gene registration Number (Genebank) NM_013261 (PPARGC1A, Peroxisome proliferative activated receptor, gamma, coactivator 1, alpha), Gene Registration Number (Genebank) NM_018122 (FLJ10514, Aspartyl-tRNA synthetase 2 (mitochondrial)), Gene Registration Number (Genebank) NM_080820 (HARS2 , Histidyl-tRNA synthetase 2), Gene Registration Number (Genebank) U73338 (MTR, 5-methyltetrahydrofolate-homocysteine methyltransferase), Gene Registration Number (Genebank) AK001676 (NUP133, Nucleoporin 133kDa), Gene Registration Number (Genebank) AK002165 (DKFZP564 O123, Chromatin modifying protein 2B), Genebank AK023143 (C10orf119, Chromosome 10 open reading frame 119), Gene Accession Number (Genebank) AK094603 (Homo sapiens cDNA FLJ37284 fis, clone BRAMY2013590. [AK094603], unnamed protein product; Homo sapiens cDNA FLJ37284 fis, clone BRAMY2013590.), Gene Registration Number (Genebank) AK124768 (TNPO1, Transportin 1), Gene Registration Number (Genebank) BC000100 (SNX5, Sorting nexin 5), Gene Registration Number (Genebank) BC039468 (NUP50, Nucleoporin 50kDa), Genebank BC064351 (SRP9, Signal recognition particle 9kDa), Genebank BX091259 (UNQ9438, TIMM9), Genebank BX641063 (DEK, DEK oncogene (DNA binding)) , Gene Registration Number (Genebank) BX648363 (SNX10, Sorting nexin 10), Gene Registration Number (Genebank) CR618609 (NOP5 / NOP58, Nucleolar protein NOP5 / NOP58), Gene Registration Number (Genebank) NM_002156 (HSPD1, Heat shock 60kDa protein 1 (chaperonin)), gene registration number (Genebank) NM_006380 (APPBP2, Amyloid beta precursor protein (cytoplasmic tail) binding protein 2), gene registration number (Genebank) NM_007214 (SEC63, SEC63-like (S. cerevisiae)), gene registration Number (Genebank) NM_012460 (TIMM9, Translocase of inner mitochondrial membrane 9 hom olog (yeast), Genebank NM_014765 (TOMM20, Translocase of outer mitochondrial membrane 20 homolog (yeast)), Genebank NM_020401 (NUP107, Nucleoporin 107kDa), Genebank NM_021807 (Genebank) SEC8L1, Exocyst complex component 4), gene registration number (Genebank) NM_031296 (RAB33B, RAB33B, member RAS oncogene family), gene registration number (Genebank) NM_145261 (TIM14, DnaJ (Hsp40) homolog, subfamily C, member 19), gene Genebank NM_173827 (FLJ38991, Mitocchondrial COX18), Genebank AL162068 (NAP1L1, Nucleosome assembly protein 1-like 1), Genebank AL834186 (CDCA7, Cell division cycle associated 7), Gene Genebank BC065520 (TCFL5, Transcription factor-like 5 (basic helix-loop-helix), Genebank CR620626 (FGG, Fibrinogen gamma chain), Genebank M58569 (Homo sapiens fibrinogen , A alpha polypeptide (FGA), transcript variant alpha-E, m RNA [NM_000508]), gene registration number (Genebank) NM_002291 (LAMB1, Laminin, beta 1), gene registration number (Genebank) NM_005141 (FGB, Fibrinogen beta chain), gene registration number (Genebank) NM_005746 (PBEF1, Pre-B -cell colony enhancing factor 1), Genebank AK002156 (WDR33, WD repeat domain 33), Genebank AK074377 (UHRF1, Chromosome 19 open reading frame 31), Genebank AK122825 ( HMGB1, High-mobility group box 1), Genebank (Genebank) BC032617 (POLI, Polymerase (DNA directed) iota), Genebank (Genebank) CR600021 (HMGB2, High-mobility group box 2), Gene Registration Number ( Genebank) NM_001067 (TOP2A, Topoisomerase (DNA) II alpha 170kDa), Gene Registration Number (Genebank) NM_002916 (RFC4, Replication factor C (activator 1) 4, 37kDa), Gene Registration Number (Genebank) NM_003368 (USP1, Ubiquitin specific) peptidase 1), Genebank NM_006904 (PRKDC, Protein kinase, DNA-activated, catalytic polypeptide), Genebank NM_138271 (ATRX, Alpha thalassemia / mental retardation syndrome X-linked (RAD54 homolog, S. cerevisiae)), Genebank AF285167 (ABCA1, ATP-binding cassette, sub-family A (ABC1) ), member 1), Gene Registration Number (Genebank) AK124635 (PCSK9, Proprotein convertase subtilisin / kexin type 9), Gene Registration Number (Genebank) NM_000236 (LIPC, Lipase, hepatic), Gene Registration Number (Genebank) AF062341 (CTNND1, Catenin (cadherin-associated protein), delta 1), Genebank (Genebank) AF480883 (PPAP2B, Phosphatidic acid phosphatase type 2B), Genebank (Genebank) BC035638 (LSS, Lanosterol synthase (2,3-oxidosqualene-lanosterol cyclase) Genebank BX648473 (PIGK, Phosphhatidylinositol glycan, class K), Genebank NM_001444 (FABP5, Fatty acid binding protein 5 (psoriasis-associated), Genebank NM_003129 ( SQLE, Squalene epoxidase, Genebank NM_003580 (NSMAF, Neutral sphingomyelinase (N-SMase) activation associated factor), genebank (Genebank) NM_018361 (AGPAT5,1-acylglycerol-3-phosphate O-acyltransferase 5 (lysophosphatidic acid acyltransferase, epsilon)), gene accession number (Genebank) NM_020918 (GPAM , Glycerol-3-phosphate acyltransferase, mitochondrial), Genebank AB209031 (C5, Complement component 5), Genebank AF130100 (SERPINC1, Serpin peptidase inhibitor, clade C (antithrombin), member 1), Genebank AK122686 (IF, I factor (complement), Genebank BC022312 (C4BPA, Complement component 4 binding protein, alpha), Genebank M75106 (CPB2, Carboxypeptidase B2 (plasma) , carboxypeptidase U)), Genebank NM_000893 (KNG1, Kininogen 1), Genebank AK055619 (GNAQ, Guanine nucleotide binding protein (G protein), q polypeptide), Genebank (Genebank) AL832747 (GNAQ, Guanine nucleotide binding prote in (G protein), q polypeptide), Genebank CR596712 (IL17D, Interleukin 17D), Genebank AK000972 (C9orf40, Chromosome 9 open reading frame 40), Genebank AK023675 ( UTRN, Utrophin (homologous to dystrophin), Genebank AK026095 (SNTB1, Syntrophin, beta 1 (dystrophin-associated protein A1, 59kDa, basic component 1)), Genebank AL117472 (SORBS1, Sorbin) and SH3 domain containing 1), gene accession number (Genebank) NM_018728 (MYO5C, Myosin VC), gene accession number (Genebank) XM_371116 (MYO5B, Myosin VB), gene accession number (Genebank) BC026320 (OGDHL, Oxoglutarate dehydrogenase-like) , Gene Registration Number (Genebank) BC033391 (PP1665, Glycerophosphodiester phosphodiesterase domain containing 5), Gene Registration Number (Genebank) BC042421 (GK, Glycerol kinase), Gene Registration Number (Genebank) M15943 (ADH4, Alcohol dehydrogenase 4 (class II), pi polypeptide), Gene Accession Number (Genebank) NM_00067 1 (ADH5, Alcohol dehydrogenase 5 (class III), chi polypeptide), gene registration number (Genebank) NM_002610 (PDK1, Pyruvate dehydrogenase kinase, isozyme 1), gene registration number (Genebank) AK026927 (MGC5297, Hypothetical protein MGC5297), gene Genebank AK127326 (PHF17, PHD finger protein 17), Genebank BC039110 (SMNDC1, Survival motor neuron domain containing 1), Genebank BC041849 (ROCK1, Rho-associated, coiled-coil containing protein kinase 1), genebank BX537500 (PDCD4, Programmed cell death 4 (neoplastic transformation inhibitor)), genebank (Genebank) CR596268 (ITGB3BP, Integrin beta 3 binding protein (beta3-endonexin)), gene Genebank NM_004938 (DAPK1, Death-associated protein kinase 1), Genebank NM_012238 (SIRT1, Sirtuin (silent mating type information regulation 2 homolog) 1 (S. cerevisiae)), gene registration number (Genebank) NM_130837 (OPA1, Optic atrophy 1 (autosomal dominant)), gene registration number (Genebank) NM_148957 (TNFRSF19, Tumor necrosis factor receptor superfamily, member 19), gene registration number (Genebank) AB208919 (FGFR1, Fibroblast growth factor receptor 1 (fms-related tyrosine kinase 2, Pfeiffer syndrome)), genebank AB209601 (TIZ, zinc finger protein 675), genebank AK125150 (MAPK8, Mitogen- activated protein kinase 8), gene accession number (Genebank) BC027881 (AFP, Alpha-fetoprotein), gene accession number (Genebank) NM_020995 (HPR, Hiptoglobin-related protein), gene accession number (Genebank) AF167706 (CRIM1, Cysteine rich transmembrane) BMP regulator 1 (chordin-like), Genebank BC045655 (MAC30, Hypothetical protein MAC30), Genebank BX537509 (NET1, Neuroepithelial cell transforming gene 1), Genebank BX640958 ( YEATS 4, YEATS domain containing 4) Genebank BX647757 (Homo sapiens sex comb on midleg-like 1 (Drosophila) (SCML1), mRNA [NM_006746], sex comb on midleg-like 1 (Drosophila), gene registration number (Genebank) NM_006548 (IMP -2, IGF-II mRNA-binding protein 2), Genebank AY376439 (ECT2, Epithelial cell transforming sequence 2 oncogene), Genebank AY596970 (GARNL1, GTPase activating Rap / RanGAP domain-like 1 ), Genebank BC050630 (RAB3-GAP150, RAB3 GTPase activating protein subunit 2 (non-catalytic)), Genebank NM_001001132 (ITSN1, Intersectin 1 (SH3 domain protein)), Gene registry number ( Genebank) NM_016340 (KIAA1961, KIAA1961 gene), Genebank NM_145290 (GPR125, G protein-coupled receptor 125), Genebank NM_003574 (VAPA, VAMP (vesicle-associated membrane protein) -associated protein A , 33kDa), Genebank M28016 (cytochrome b, Human mitochondrial cytochrome b gene, partial cds.), Gene Registration Number (Genebank) NM_013277 (RACGAP1, Rac GTPase activating protein 1), Gene Registration Number (Genebank) AB096248 (SNF1LK2, SNF1-like kinase 2), Gene Registration Number (Genebank) NM_001698 (AUH, AU RNA binding protein / enoyl-Coenzyme A hydratase), Genebank AB091343 (C10orf3, Centrosomal protein 55kDa).

본 발명자들은 다이벤조에이에이취안트라센에 대한 노출 여부 확인용 바이오마커를 발굴하기 위하여, 다이벤조에이에이취안트라센을 인간 간암 세포주(HepG2)에 처리하여 세포 독성을 확인하였다. 그 결과, 상기 다이벤조에이에이취안트라센은 인간 간암 세포주에 독성을 가짐이 확인되었고(도 1 참조), 상기 실험을 바탕으로 다이벤조에이에이취안트라센의 농도를 결정하였다. 이후 상기 결정된 농도로 다이벤조에이에이취안트라센을 인간 간암 세포주에 처리하고, 상기 물질을 처리한 세포주에서 mRNA를 분리하여 cDNA를 합성하면서 형광물질(Cy5)로 표지하였으며, 약물을 처리하지 않은 대조군의 경우 Cy3로 표지하였다. 상기 형광표지된 cDNA를 44 k 올리고마이크로어레이 칩 Human whole genome microarray(Agilent, USA)와 혼성화하였고, 형광 이미지를 스캔하여 유전자 발현 양상의 차이를 분석하였다(도 2 참조). 분석시 Cy5/Cy3 비율이 2.0배 이상인 경우 발현 증가된 유전자로 분류하였고, 0.5배 이하인 경우 발현 감소된 유전자로 분류하였다. 분석 결과, 발현 증가된 유전자는 0.39%(44,000개의 유전자 중 170개) 발현이 감소된 유전자는 0.77%(44,000개의 유전자 중 338개)임을 확인하였다. 이때, 다이벤조에이에이취안트라센에 의해 2배 이상 과발현 혹은 저발현 되는 유전자들을 분류한 기능별로 분류하면, 세포 주기(cell cycle), 핵산 결합(nucleic acid binding), 금속원소 결합(metal binding), 산화 환원 효소 활성(Oxidoreductase activity), I-kappaB 키나아제(kinase)/NF-kappaB 캐스케이드(cascade), 암(Cancer), 외부 자극에 대한 반응(Response to external stimulus), 세포골격 단백질 결합(Cytoskeletal protein binding), 칼슘 이온 결합(Calcium ion binding), 소낭-매개 수송(Vesicle-mediated transport), 징크-핑거(Zinc-finger), 뉴클레오티드 결합(Nucleotide binding), 유기산 대사(Organic acid metabolism), 보체 및 응고 캐스케이드(Complement and coagulation cascades), 알코올 대사(Alcohol metabolism), MAPKKK 캐스케이드(cascade), GTPase 조절 활성(regulator activity), 아팝토시스(apoptosis), 단백질 전달(protein transport), 형태 형성(morphogenesis), 면역반응(immune response), 세포 증식(cell proliferation), 지방산 대사(lipid metabolism), 화학물질 자극 반응(response to chemical stimulus) 또는 DNA 손상 반응(response to DNA damage stimulus) 등의 관련 유전자들이었다(표 2 및 표 3참조). 상기 유전자들은 본 발명에서 사용한 다이벤조에이에이취안트라센을 처리했을 때, 인간 간암 세포에서 독성과 관련이 있다는 보고는 없다.The inventors of the present invention was treated with human liver cancer cell line (HepG2) to confirm cytotoxicity, in order to discover a biomarker for confirming the exposure to dibenzoaquaanthracene. As a result, it was confirmed that the dibenzoAchianthracene is toxic to human liver cancer cell line (see Fig. 1), based on the experiment to determine the concentration of dibenzoAichanthracene. Subsequently, dibenzoAH-anthracene was treated to the human liver cancer cell line at the determined concentration, mRNA was isolated from the cell line treated with the substance, and labeled with fluorescent substance (Cy5) while synthesizing cDNA. Labeled with Cy3. The fluorescently labeled cDNA was hybridized with a 44 k oligomicroarray chip, Human whole genome microarray (Agilent, USA), and analyzed for differences in gene expression patterns by scanning fluorescent images (see FIG. 2). In the analysis, when the Cy5 / Cy3 ratio was 2.0 times or more, the expression was increased. As a result, it was confirmed that the gene with increased expression was 0.39% (170 of 44,000 genes) and the gene with reduced expression was 0.77% (338 of 44,000 genes). In this case, when the genes classified by the function of over-expression or low-expression by dibenzoA-anthanthracene more than two times are classified by function, the cell cycle, nucleic acid binding, metal binding, and oxidation Oxidoreductase activity, I-kappaB kinase / NF-kappaB cascade, Cancer, Response to external stimulus, Cytoskeletal protein binding Calcium ion binding, vesicle-mediated transport, zinc-finger, Nucleotide binding, organic acid metabolism, complement and coagulation cascade Complement and coagulation cascades, alcohol metabolism, MAPKKK cascade, GTPase regulator activity, apoptosis, protein transport, morph formation Related genes such as ogenesis, immune response, cell proliferation, fatty acid metabolism, response to chemical stimulus, or response to DNA damage stimulus (See Table 2 and Table 3). The genes have not been reported to be associated with toxicity in human liver cancer cells when treated with dibenzoAchanthracene used in the present invention.

본 발명자들은 상기 유전자 중 과발현된 유전자 30종과 저발현된 유전자 18종을 분리하여 실시간 RT-PCR(real-time reverse transcript polymerase chain reaction) 방법으로 발현 양상을 조사하였다. 그 결과, 30종의 과발현 유전자들과 18종의 저발현 유전자의 발현 양상이 올리고마이크로어레이 칩 결과와 유사하게 나타남을 확인하였다(표 5 참조). 이들 유전자들은 유전자 등록번호(Genebank) BM913048(TIMP metallopeptidase inhibitor 1), 유전자 등록번호(Genebank) NM_004864(Growth differentiation factor 15), 유전자 등록번호(Genebank) AK095363(Aquaporin 3), 유전자 등록번호(Genebank) NM_003516(Histone 2, H2aa), 유전자 등록번호(Genebank) NM_001013632(Similar to hypothetical protein 4833401D15), 유전자 등록번호(Genebank) Y11307(Cysteine-rich, angiogenic inducer, 61), 유전자 등록번호(Genebank) NM_001769 (CD9 antigen(p24)), 유전자 등록번호(Genebank) AY368150(Family with sequence similarity 62(C2 domain containing) member B), 유전자 등록번호(Genebank) NM_000499(Cytochrome P450, family 1, subfamily A, polypeptide 1), 유전자 등록번호(Genebank) BC035124 (MSFL2541), 유전자 등록번호(Genebank) AK097009(phospholipid transfer protein), 유전자 등록번호(Genebank) NM_000596(Insulin-like growth factor binding protein 1), 유전자 등록번호(Genebank) NM_006426(Dihydropyrimidinase-like 4), 유전자 등록번호(Genebank) NM_021603(FXYD domain containing ion transport regulator 2), 유전자 등록번호(Genebank) AB033073(Sulfatase 2), 유전자 등록번호(Genebank) NM_004881(Tumor protein p53 inducible protein 3), 유전자 등록번호(Genebank) NM_001553(Insulin-like growth factor binding protein 7), 유전자 등록번호(Genebank) NM_032872(Synaptotagmin-like 1), 유전자 등록번 호(Genebank) BU945318(Hypothetical gene supported by X97260; BC070289 (metallothionein 2A )), 유전자 등록번호(Genebank) X02812(Transforming growth factor, beta 1(Camurati-Engelmann disease)), 유전자 등록번호(Genebank) NM_003897(Immediate early response 3), 유전자 등록번호(Genebank) NM_145256(Leucine rich repeat containing 25), 유전자 등록번호(Genebank) BU587578(Regulator of G-protein signalling 10), 유전자 등록번호(Genebank) NM_133493(CD109 antigen (Gov platelet alloantigens)), 유전자 등록번호(Genebank) NM_005319(Histone 1, H1c), 유전자 등록번호(Genebank) BG036385(Receptor(calcitonin) activity modifying protein 1), 유전자 등록번호(Genebank) NM_012396(Pleckstrin homology-like domain, family A, member 3), 유전자 등록번호(Genebank) AB208949(Leucine-rich repeats and death domain containing), 유전자 등록번호(Genebank) BU603483(Histone 1, H1e), 유전자 등록번호(Genebank) Y12692(Wingless-type MMTV integration site family, member 11), 유전자 등록번호(Genebank) BC022255(Spindle pole body component 25 homolog (S. cerevisiae)), 유전자 등록번호(Genebank) AB013380(ATP-binding cassette, sub-family B(MDR/TAP), member 10), 유전자 등록번호(Genebank) AB046861 (KIAA1641), 유전자 등록번호(Genebank) BX640965(Solute carrier family 22(extraneuronal monoamine transporter), member 3), 유전자 등록번호(Genebank) XM_291202(Zinc finger protein 479), 유전자 등록번호(Genebank) NM_018492(PDZ binding kinase), 유전자 등록번호(Genebank) NM_145697(Cell division cycle associated 1), 유전자 등록번호(Genebank) NM_017768(Leucine rich repeat containing 40), 유전자 등록번호(Genebank) BX640888(Glypican 6), 유전자 등록번호(Genebank) U65410 (MAD2 mitotic arrest deficient-like 1(yeast)), 유전자 등록번호(Genebank) CR600021 (High-mobility group box 2), 유전자 등록번호(Genebank) AK074377(Chromosome 19 open reading frame 31), 유전자 등록번호(Genebank) NM_180991(Solute carrier organic anion transporter family, member 4C1), 유전자 등록번호(Genebank) NM_006101 (Kinetochore associated 2), 유전자 등록번호(Genebank) AB091343(Centrosomal protein 55kDa), 유전자 등록번호(Genebank) NM_001067(Topoisomerase (DNA) II alpha 170kDa), 유전자 등록번호(Genebank) NM_003318(TTK protein kinase), 유전자 등록번호(Genebank) NM_032117(GAJ protein)이다.The present inventors separated 30 overexpressed genes and 18 low expressed genes, and examined expression patterns by real-time reverse transcript polymerase chain reaction (RT-PCR). As a result, it was confirmed that the expression patterns of 30 overexpression genes and 18 low expression genes were similar to those of the oligomicroarray chip (see Table 5). These genes include Genebank BM913048 (TIMP metallopeptidase inhibitor 1), Genebank NM_004864 (Growth differentiation factor 15), Genebank AK095363 (Aquaporin 3), Genebank NM_003516 (Histone 2, H2aa), Genebank NM_001013632 (Similar to hypothetical protein 4833401D15), Genebank Y11307 (Cysteine-rich, angiogenic inducer, 61), Genebank NM_001769 (CD9 antigen (p24)), Genebank AY368150 (Family with sequence similarity 62 (C2 domain containing) member B), Gene accession number (Genebank) NM_000499 (Cytochrome P450, family 1, subfamily A, polypeptide 1), Gene registration Number (Genebank) BC035124 (MSFL2541), Gene Registration Number (Genebank) AK097009 (phospholipid transfer protein), Gene Registration Number (Genebank) NM_000596 (Insulin-like growth factor binding protein 1), Gene Registration Number (Genebank) NM_006426 ( Dihydropyrimidinase-like 4), Genebank NM_021603 (FXYD domain containing ion transport regulator 2), Genebank AB033073 (Sulfatase 2), Genebank NM_004881 (Tumor protein p53 inducible protein 3) , Genebank NM_001553 (Insulin-like growth factor binding protein 7), Genebank NM_032872 (Synaptotagmin-like 1), Genebank BU945318 (Hypothetical gene supported by X97260; BC070289 (metallothionein 2A)), Genebank X02812 (Transforming growth factor, beta 1 (Camurati-Engelmann disease)), Genebank NM_003897 (Immediate early response 3), Gene accession number (Genebank) NM_145256 (Leucine rich repeat containing 25), Genebank (Genebank) BU587578 (Regulator of G-protein signaling 10), Gene Registration Number (Genebank) NM_133493 (CD109 antigen (Gov platelet alloantigens)), Gene Registration Number (Genebank) NM_005319 ( Histone 1, H1c), Genebank BG036385 (Receptor (calcitonin) activity modifying protein 1), Genebank (Genebank) NM_012396 (Pleckstrin homology-like domain, family A, member 3), Genebank (Genebank) ) AB208949 (Leucine-rich repeats and death domain containing), Genebank BU603483 (Histone 1, H1e), Genebank (Genebank) Y12692 (Wingless-type MMTV integration site family, member 11), Gene accession number (Genebank) BC022255 (Sp indle pole body component 25 homolog (S. cerevisiae)), Genebank AB013380 (ATP-binding cassette, sub-family B (MDR / TAP), member 10), Genebank AB046861 (KIAA1641) , Genebank BX640965 (Solute carrier family 22 (extraneuronal monoamine transporter), member 3), Genebank (Genebank) XM_291202 (Zinc finger protein 479), Genebank (Genebank) NM_018492 (PDZ binding kinase), Genebank (Genebank) NM_145697 (Cell division cycle associated 1), Genebank (Genebank) NM_017768 (Leucine rich repeat containing 40), Genebank (Genebank) BX640888 (Glypican 6), Genebank (Genebank) U65410 ( MAD2 mitotic arrest deficient-like 1 (yeast), genebank (Genebank) CR600021 (High-mobility group box 2), genebank (Genebank) AK074377 (Chromosome 19 open reading frame 31), genebank (Genebank) NM_180991 (Solute carrier organic anion transporter family, member 4C1), Genebank NM_006101 (Kinetochore associated 2), Genebank AB091343 (Centrosomal protein 55kDa), Genebank NM_001067 (Topoisomerase (DNA) II alpha 170kDa), Gene registry number (Genebank) NM_003318 (TTK protein kinase), gene accession number (Genebank) NM_032117 (GAJ protein).

또한, 본 발명은 상기 바이오마커 유전자 서열의 전부 또는 일부를 포함하는 올리고뉴클레오티드 또는 그의 상보 가닥 분자가 집적된 다이벤조에이에이취안트라센에 대한 노출 여부 확인용 DNA 마이크로어레이 칩을 제공한다.The present invention also provides a DNA microarray chip for confirming exposure to a dibenzoAichanthracene in which an oligonucleotide including all or part of the biomarker gene sequence or its complementary strand molecule is integrated.

상기 올리고 뉴클레오티드 또는 이의 상보가닥 분자는 상기 바이오마커 유전자의 18 내지 30개의 핵산을 포함하고, 바람직하게는 20 내지 25개의 핵산을 포함한다. The oligonucleotide or complementary strand molecule thereof comprises 18 to 30 nucleic acids of the biomarker gene, preferably 20 to 25 nucleic acids.

본 발명의 다이벤조에이에이취안트라센 검색용 DNA 마이크로어레이 칩은 당업자에게 알려진 방법으로 제작할 수 있다. 상기 마이크로어레이 칩을 제작하는 방법은 하기와 같다. 상기 탐색된 바이오마커를 탐침 DNA 분자로 이용하여 DNA 칩의 기판상에 고정화시키기 위해 파이조일렉트릭(piezoelectric) 방식을 이용한 마이크로피펫팅(micropipetting)법 또는 핀(pin) 형태의 스폿터(spotter)를 이용한 방법 등을 사용하는 것이 바람직하나 이에 한정되는 것은 아니며, 본 발명의 바람직한 실시예에서는 핀 형태의 스폿터인 마이크로어레이를 이용하였다. 상기 DNA 마이크로어레이 칩의 기판은 아미노-실란(amino-silane), 폴리-L-라이신(poly-L-lysine) 및 알데히드(aldehyde)로 이루어진 군에서 선택되는 하나의 활성기가 코팅된 것이 바람직하나 이에 한정되는 것은 아니다. 또한, 상기 기판은 슬라이드 글래스, 플라스틱, 금속, 실리콘, 나일론 막, 및 니트로셀룰로스 막(nitrocellulose membrane)으로 이루어진 군에서 선택될 수 있으나 이에 제한되는 것은 아니며, 본 발명의 바람직한 실시예에서는 아미노-실란이 코팅된 슬라이드 글래스를 이용하였다. The DNA microarray chip for dibenzoAchanthracene retrieval of the present invention can be produced by a method known to those skilled in the art. The method of manufacturing the microarray chip is as follows. In order to immobilize the detected biomarker as a probe DNA molecule on a substrate of a DNA chip, a micropipetting method or a pin-shaped spotter using a piezoelectric method is used. It is preferable to use the method, but the present invention is not limited thereto. In a preferred embodiment of the present invention, a microarray, which is a pin-shaped spotter, is used. The substrate of the DNA microarray chip is preferably coated with one active group selected from the group consisting of amino-silane, poly-L-lysine, and aldehyde. It is not limited. In addition, the substrate may be selected from the group consisting of slide glass, plastic, metal, silicon, nylon membrane, and nitrocellulose membrane, but is not limited thereto, and in the preferred embodiment of the present invention, amino-silane may be used. Coated slide glass was used.

또한, 본 발명은 상기 바이오마커를 이용한 다이벤조에이에이취안트라센에 대한 노출 여부를 확인하는 방법을 제공한다.In another aspect, the present invention provides a method for confirming the exposure to dibenzoAh anthracene using the biomarker.

본 발명은 하기와 같은 과정을 포함하는 다이벤조에이에이취안트라센에 대한 노출 여부를 확인하는 방법을 제공한다: The present invention provides a method for confirming exposure to dibenzoaquaanthracene comprising the following steps:

1) 인간 체세포에 피검화합물을 처리하는 단계;1) treating the test compound to human somatic cells;

2) 단계 1)의 피검 화합물을 처리한 실험군 세포와 피검화합물을 처리하지 않은 대조군 세포에서 RNA를 분리하는 단계;2) separating RNA from the experimental group cells treated with the test compound of step 1) and control cells not treated with the test compound;

3) 단계 2)의 실험군과 대조군의 RNA를 cDNA로 합성하면서 실험군과 대조군을 각기 다른 형광물질을 표지하는 단계;3) synthesizing RNA of the experimental group and the control group of step 2) with cDNA and labeling the fluorescent substance of the experimental group and the control group, respectively;

4) 단계 3)의 각기 다른 형광물질로 표지된 cDNA를 DNA 마이크로어레이칩과 혼성화시키는 단계;4) hybridizing cDNA labeled with different fluorescent materials of step 3) with DNA microarray chips;

5) 단계 4)의 반응한 DNA 마이크로어레이 칩을 분석하는 단계; 및 5) analyzing the reacted DNA microarray chip of step 4); And

6) 단계 5)의 분석한 데이터에서 본 발명의 바이오마커의 발현 정도를 대조군과 비교하여 확인하는 단계,6) confirming the expression level of the biomarker of the present invention in the analyzed data of step 5) compared to the control,

상기 노출 여부를 확인하는 방법에 있어서, 단계 1)의 체세포는 인간 간암 세포주(HepG2)를 사용하는 것이 바람직하나 이에 한정되는 것은 아니며, 인간의 간 또는 간암의 세포 및 조직에서 유래한 세포라면 모두 사용 가능하다.In the method for confirming the exposure, the somatic cell of step 1) is preferably a human liver cancer cell line (HepG2), but is not limited thereto, and any cell derived from human liver or liver cancer cells and tissues may be used. It is possible.

상기 노출 여부를 확인하는 방법에 있어서, 단계 3)의 형광물질은 Cy3, Cy5, FITC(poly L-lysine-fluorescein isothiocyanate), RITC(rhodamine-B-isothiocyanate) 및 로다민(rhodamine)으로 이루어진 군으로부터 선택되어지는 것이 바람직하나 이에 한정되는 것은 아니며, 당업자에게 알려진 형광물질은 모두 사용 가능하다.In the method for confirming the exposure, the fluorescent material of step 3) is Cy3, Cy5, poly L-lysine-fluorescein isothiocyanate (FITC), rhodamine-B-isothiocyanate (RITC) and rhodamine (rhodamine) It is preferable to be selected but not limited thereto, and any fluorescent material known to those skilled in the art may be used.

상기 노출 여부를 확인하는 방법에 있어서, 단계 5)의 DNA 마이크로어레이 칩은 Whole Human Genome Oligo Microarray(Agilent, USA)등을 사용하는 것이 바람직하나 이에 한정되는 것은 아니며, 인간 게놈 중 본 발명에서 상기 공통적으로 과발현 또는 저발현 유전자(표 2 및 포 3 참조)가 탑재된 마이크로어레이 칩이라면 사용 가능하고, 상기 본 발명자가 제작한 DNA 마이크로어레이 칩을 사용하는 것이 가장 바람직하다. 또한, 단계 5)의 분석 방법은 GenePix 4.1 소프트웨어(Axon Instruments, USA)를 사용하는 것이 바람직하나 이에 한정되는 것은 아니며, 당업자에게 알려진 분석 소프트웨어를 사용하여도 무방하다.In the method of confirming the exposure, the DNA microarray chip of step 5) is preferably used, such as Whole Human Genome Oligo Microarray (Agilent, USA), but is not limited thereto, the common in the present invention of the human genome As long as it is a microarray chip loaded with over- or low-expression genes (see Tables 2 and 3), it is most preferable to use a DNA microarray chip produced by the present inventors. In addition, the analysis method of step 5) preferably uses GenePix 4.1 software (Axon Instruments, USA), but is not limited thereto, and analysis software known to those skilled in the art may be used.

또한, 본 발명은 하기와 같은 과정을 포함하는 다이벤조에이에이취안트라센에 대한 노출 여부를 확인하는 방법을 제공한다: In addition, the present invention provides a method for confirming the exposure to dibenzoaquaanthracene comprising the following steps:

1) 인간 체세포에 피검화합물을 처리하는 단계;1) treating the test compound to human somatic cells;

2) 단계 1)의 피검화합물을 처리한 실험군 세포와 피검화합물을 처리하지 않은 대조군 세포에서 RNA를 분리하는 단계;2) separating RNA from the test cell treated with the test compound of step 1) and the control cell not treated with the test compound;

3) 단계 2)의 RNA를, 본 발명의 바이오마커 유전자에 상보적이고 바이오마커 유전자를 증폭할 수 있는 프라이머를 사용하여 실시간 RT-PCR(Real-time reverse transcript polymerase chain reaction)을 수행하는 단계; 및3) performing a real-time reverse transcript polymerase chain reaction (RT-PCR) using the RNA of step 2) using a primer complementary to the biomarker gene of the present invention and capable of amplifying the biomarker gene; And

4) 단계 3)의 유전자 산물을 대조군과 비교하여 발현 정도를 확인하는 단계,4) checking the expression level by comparing the gene product of step 3) with the control group,

상기 노출 여부를 확인하는 방법에 있어서, 단계 1)의 체세포는 인간 간암 세포주(HepG2)를 사용하는 것이 바람직하나 이에 한정되는 것은 아니며, 인간의 간 또는 간암의 세포 및 조직에서 유래한 세포라면 모두 사용 가능하다.In the method for confirming the exposure, the somatic cell of step 1) is preferably a human liver cancer cell line (HepG2), but is not limited thereto, and any cell derived from human liver or liver cancer cells and tissues may be used. It is possible.

상기 노출 여부를 확인하는 방법에 있어서, 단계 3)의 프라이머는 본 발명에서 탐색된 바이오마커 유전자와 상보적이고, 바이오마커를 증폭할 수 있는 프라이머라면 모두 사용가능하다. 본 발명에서는 서열번호 1 내지 50으로 기재되는 정방향 및 역방향의 프라이머 25쌍을 제시하였으나 이에 한정되는 것은 아니다.In the method for confirming the exposure, the primer of step 3) is complementary to the biomarker gene found in the present invention, any primer that can amplify the biomarker can be used. In the present invention, 25 pairs of forward and reverse primers set forth in SEQ ID NOs: 1 to 50 are provided, but the present invention is not limited thereto.

또한, 본 발명은 다이벤조에이에이취안트라센에 대한 노출 여부 확인용 키트를 제공한다.In another aspect, the present invention provides a kit for confirming the exposure to the dibenzoAchanthracene.

본 발명은 상기 본 발명에서 제작한 DNA 마이크로어레이 칩을 포함하는 다이벤조에이에이취안트라센에 대한 노출 여부 확인용 키트를 제공한다. The present invention provides a kit for confirming the exposure to dibenzoaquaanthracene comprising the DNA microarray chip prepared in the present invention.

상기 확인용 키트에 추가적으로 인간 간세포를 포함하는 다이벤조에이에이취안트라센에 대한 노출 여부 확인용 키트를 제공한다. 상기 인간 간세포는 HepG2를 사용하는 것이 바람직하나 이에 한정되는 것은 아니며, 인간의 간 또는 간암의 세포 및 조직에서 유래한 세포라면 모두 사용 가능하다. In addition to the identification kit provides a kit for confirming the exposure to dibenzoAchanthracene containing human hepatocytes. The human hepatocyte is preferably HepG2, but is not limited thereto. Any human hepatocyte may be used as long as it is derived from cells and tissues of human liver or liver cancer.

상기 키트에 추가적으로 형광물질을 포함할 수 있으며, 상기 형광물질은 스트렙아비딘-알칼리 탈인화효소 접합물질(strepavidin-like phosphatease conjugate), 화학형광물질(chemiflurorensce) 및 화학발광물질(chemiluminescent)로 이루어진 군으로부터 선택되는 것이 바람직하나 이에 한정되는 것은 아니며, 본 발명의 바람직한 실시예에서는 Cy3와 Cy5를 사용하였다. The kit may further include a fluorescent material, wherein the fluorescent material is selected from the group consisting of a strepavidin-like phosphatease conjugate, a chemiflurorensce and a chemiluminescent material. Preferably, but not limited thereto, Cy3 and Cy5 were used in the preferred embodiment of the present invention.

상기 키트에 추가적으로 반응 시약을 포함시킬 수 있으며, 상기 반응 시약은 혼성화에 사용되는 완충용액, RNA로부터 cDNA를 합성하기 위한 역전사효소, cNTPs 및 rNTP(사전 혼합형 또는 분리 공급형), 형광 염색제의 화학적 유도제와 같은 표식시약, 세척 완충용액 등으로 구성될 수 있으나 이에 한정된 것은 아니며, 당업자에게 알려진 DNA 마이크로어레이 칩의 혼성화 반응에 필요한 반응 시약은 모두 포함시킬 수 있다.The kit may additionally include a reaction reagent, which is a buffer used for hybridization, reverse transcriptase for synthesizing cDNA from RNA, cNTPs and rNTP (premixed or separated feed), chemical inducer of fluorescent dyes It may be composed of a labeling reagent, such as a washing buffer, but is not limited thereto, and may include all reaction reagents required for hybridization of DNA microarray chips known to those skilled in the art.

아울러, 본 발명은 상기 바이오마커 유전자에 상보적이고, 바이오마커 유전자를 증폭할 수 있는 프라이머를 포함하는 다이벤조에이에이취안트라센에 대한 노출 여부 확인용 키트를 제공한다. In addition, the present invention provides a kit for confirming the exposure to dibenzoAh-anthanthracene, which is complementary to the biomarker gene and includes a primer capable of amplifying the biomarker gene.

상기 확인용 키트의 프라이머는 서열번호 1 내지 96으로 기재되는 서열로 구성된 군으로부터 선택되는 2개 이상의 정방향 및 역방향의 프라이머를 사용하는 것이 바람직하나 이에 한정되는 것은 아니며, 상기 바이오마커 유전자에 상보적이며, 바이오마커 유전자를 증폭할 수 있으며 증폭산물이 100 내지 300bp가 되도록 설계된 정방향 및 역방향 프라이머쌍은 모두 사용 가능하다. Primer of the identification kit is preferably used two or more forward and reverse primers selected from the group consisting of the sequences set forth in SEQ ID NOs: 1 to 96, but is not limited thereto, and is complementary to the biomarker gene In addition, both forward and reverse primer pairs designed to amplify the biomarker gene and have an amplification product of 100 to 300 bp can be used.

이하, 본 발명을 실시예에 의해 상세히 설명한다.Hereinafter, the present invention will be described in detail by way of examples.

단, 하기 실시예는 본 발명을 예시하는 것일 뿐, 본 발명의 내용이 하기 실시예에 한정되는 것은 아니다.However, the following examples are merely to illustrate the invention, but the content of the present invention is not limited to the following examples.

<실시예 1> 세포 배양 및 화학물질 처리Example 1 Cell Culture and Chemical Treatment

<1-1> 세포배양<1-1> Cell Culture

인간 간암 세포주인 HepG2 세포(한국 세포주 은행)를 10% FBS가 첨가된 DMEM 배지(Gibro-BRL, USA)를 이용하여 100 ㎜ 디쉬(dish)에서 80% 정도 자랄 때까지 배양하였다. 본 발명자들은 기존의 연구와 보고를 통해 다환방향족 탄화수소류의 하나로서 발암성을 가지고 있는 물질인 다이벤조에이에이취안트라센을 선정하였으며, DMSO에 용해시켰다. 매질(vehicle) 농도는 모든 실험에서 0.1% 이하였다.HepG2 cells (Korea Cell Line Bank), which is a human liver cancer cell line, were cultured in DMEM medium (Gibro-BRL, USA) to which 10% FBS was added until 80% growth in 100 mm dish. The inventors of the present invention have selected dibenzoAh anthanthracene, a substance having carcinogenicity, as one of the polycyclic aromatic hydrocarbons, and dissolved in DMSO. Vehicle concentration was less than 0.1% in all experiments.

<1-2> 세포 독성 실험(<1-2> cytotoxicity test ( MTTMTT assayassay ) 및 화학 물질 처리) And chemical processing

Mossman 등(J. Immunol. Methods, 65, 55-63, 1983)의 방법으로 HepG2 세포주를 이용한 MTT 실험을 수행하였다. 세포는 24-웰 플레이트에 4× 105/웰 세포수로 DMEM 배지(Gibro-BRL, USA)에서 DMSO에 용해된 다이벤조에이에이취안트라센을 처리하고 48시간 후에 MTT(3-4,5-dimethylthiazol-2,5-diphenyltetra zolium bromide) 5 ㎎/㎖을 혼합하여 튜브에 가하여 37℃에서 3 시간 동안 배양하였다. 이 후 배지를 제거하고 형성된 포르마잔 크리스탈(formazan crystal)을 DMSO 500 ㎕에 용해하였다. 96-웰 플레이트로 옮겨 분주(aliquot)하고 흡광도 540 nm에서 O.D.값을 측정하였다.MTT experiment using HepG2 cell line was performed by the method of Mossman et al. ( J. Immunol. Methods , 65, 55-63, 1983). Cells were treated with dibenzoacianthracene dissolved in DMSO in DMEM medium (Gibro-BRL, USA) at 4 × 10 5 / well cell counts in 24-well plates and after 48 hours of MTT (3-4,5-dimethylthiazol) 5 mg / ml of -2,5-diphenyltetra zolium bromide) was added to the tube and incubated at 37 ° C. for 3 hours. Thereafter, the medium was removed and the formed formazan crystal was dissolved in 500 µl of DMSO. Transfer to a 96-well plate was aliquoted and the OD value was measured at absorbance 540 nm.

HepG2 세포주에서 다이벤조에이에이취안트라센의 세포독성을 살펴본 결과, 20% 생존율을 보이는 농도(IC20)는 3.79 uM 이었으며(도 1 참조), 상기 농도들로 결정하여 마이크로어레이 실험을 수행하였다. As a result of examining the cytotoxicity of the dibenzoAchanthracene in the HepG2 cell line, the concentration showing 20% survival rate (IC 20 ) was 3.79 uM (see FIG. 1).

<실시예 2> 마이크로어레이 실험Example 2 Microarray Experiment

<2-1> 표적 <2-1> target RNARNA 의 분리 및 형광 물질 표지Isolation and Labeling of Fluorescent Materials

6 × 106 cell/㎖ 농도로 100 mm 디쉬에 HepG2 세포를 분주한 후, 실시예 1-2에서 결정된 다이벤조에이에이취안트라센의 농도를 48 시간 동안 처리하였다. 이 후, 상기 처리한 세포에서 트리졸(trizol) 시약(Invitrogen life technologies, USA)을 사용하여 제조사의 방법대로 전체 RNA를 분리하고, RNeasy mini kit(Qiagen, USA)를 사용하여 정제하였다. 게놈 DNA는 RNA 정제 동안 RNase-free DNase set(Qiagen, USA)를 사용하여 제거하였다. 각 전체 RNA 시료의 양은 분광광도계로 측정하였고, 농도는 Agilent 2100 Bioanalyzer(Agilent Technologies, USA)와 아가로스 젤 전기영동으로 확인하였다. After dispensing HepG2 cells in a 100 mm dish at a concentration of 6 × 10 6 cells / ml, the concentration of dibenzoAh-anthanthracene determined in Example 1-2 was treated for 48 hours. Subsequently, total RNA was isolated from the treated cells using a trizol reagent (Invitrogen life technologies, USA) according to the manufacturer's method, and purified using an RNeasy mini kit (Qiagen, USA). Genomic DNA was removed using RNase-free DNase set (Qiagen, USA) during RNA purification. The amount of each total RNA sample was measured by spectrophotometer and the concentration was confirmed by Agilent 2100 Bioanalyzer (Agilent Technologies, USA) and agarose gel electrophoresis.

<2-2> <2-2> 표지된Labeled cDNAcDNA 제조  Produce

올리고 마이크로어레이 분석을 위하여 실시예 2-1에서 수득한 다이벤조에이에이취안트라센 처리군의 전체 RNA를 사용하여 cDNA를 제조하였다. 상기 수득한 전체 RNA 30 ㎍과 올리고(dT) 프라이머 2 ㎍(1 ㎍/㎕)과 혼합하고 65℃에서 10분간 반응시킨 후 바로 얼음에 넣어 어닐링(annealing)시켰다. 상기 어닐링된 RNA의 역전사(Reverse Transcript) 반응을 위해 표 1과 같이 시약을 혼합하였다. For oligo microarray analysis, cDNA was prepared using the total RNA of the dibenzoaichanthracene treatment group obtained in Example 2-1. The total RNA obtained above was mixed with 30 μg of oligo (dT) primer and 2 μg (1 μg / μl), reacted at 65 ° C. for 10 minutes, and then annealed in ice. Reagents were mixed as shown in Table 1 for Reverse Transcript reaction of the annealed RNA.

구성Configuration 부피(㎕)Volume (μl) 5X first strand buffer5X first strand buffer 66 dNTPsdNTPs 0.60.6 0.1 M DDT0.1 M DDT 33 SuperScript II enzymeSuperScript II enzyme 33 Cy-3 or Cy-5 dUTPCy-3 or Cy-5 dUTP 22

대조군인 HepG2 세포주에서 분리한 전체 RNA는 Cy3-dUTP(녹색)로 표지화하였고, 다이벤조에이에이취안트라센을 처리한 HepG2 세포주로부터 분리한 RNA는 Cy5-dUTP(적색)로 표지화하였다. 이때 두 시료는 Microcon YM-30 컬럼(Millipore, USA)을 사용하여 혼합, 정제되었다. Total RNA isolated from the control HepG2 cell line was labeled with Cy3-dUTP (green), and RNA isolated from the HepG2 cell line treated with dibenzoAh etanthracene was labeled with Cy5-dUTP (red). At this time, the two samples were mixed and purified using a Microcon YM-30 column (Millipore, USA).

<2-3> <2-3> 혼성화Hybridization 반응 reaction

혼성화 및 세척 과정은 지노첵(주)의 지시방법에 따라 수행되었다. 혼성화는 12시간 동안 62℃ 오븐에서 수행되었다. DNA 마이크로어레이 칩으로는 44 k Whole Human Genome Oligo Microarray(Agilent, USA)를 이용하였다. 세척(2분간 2× SSC/0.1% SDS에 세척, 3분간 1× SSC, 2분간 0.2× SSC에 세척) 후 슬라이드는 3분간 800 rpm으로 원심분리하여 건조하였다. Hybridization and washing procedures were carried out according to the instructions of Genome Co., Ltd .. Hybridization was performed in a 62 ° C. oven for 12 hours. 44 k Whole Human Genome Oligo Microarray (Agilent, USA) was used as the DNA microarray chip. After washing (washing in 2 × SSC / 0.1% SDS for 2 minutes, washing in 1 × SSC for 3 minutes, 0.2 × SSC for 2 minutes), the slides were dried by centrifugation at 800 rpm for 3 minutes.

<2-4> 형광 이미지 획득<2-4> Fluorescence Image Acquisition

슬라이드 상의 혼성화 이미지는 Genepix 4000B(Axon Instruments, USA)로 스캔하였다. 결합하지 않은 유전자를 세척한 칩은 레이저 광 스캐너(laser fluorescence scanner)를 사용하여 형광 이미지를 획득하였다. 이때 녹색 형광 이미지는 대조군에서, 적색 형광 이미지는 실험군에서만 특이하게 발현되는 유전자의 활성정도를 나타내게 되며, 노란색 형광 이미지는 녹색과 적색의 보색으로 두 군의 발현이 큰 차이가 없음을 의미한다. 스캔한 이미지들은 유전자 발현 비율을 얻기 위하여 GenePix 4.1 소프트웨어(Axon Instruments, USA)로 분석하였다. 이렇게 하여 얻어진 데이터로부터 다이벤조에이에이취안트라센에 대한 마커 유전자를 선별하였다(도 2 참조). Hybridization images on the slides were scanned with the Genepix 4000B (Axon Instruments, USA). Chips washed with unbound genes were obtained with a fluorescence image using a laser fluorescence scanner. In this case, the green fluorescence image in the control group, the red fluorescence image represents the activity level of the gene specifically expressed only in the experimental group, and the yellow fluorescence image is the complementary color of green and red, which means that there is no significant difference between the two groups. Scanned images were analyzed with GenePix 4.1 software (Axon Instruments, USA) to obtain gene expression rates. From the data obtained in this way, marker genes for dibenzoaichanthracene were selected (see FIG. 2).

그 결과, 올리고 칩 상에 존재하는 대략 4만 4천 개의 유전자 중에서 다이벤조에이에이취안트라센에 의해 Cy5/Cy3의 비율이 2.0배 이상으로 유전자 발현 증가를 보이는 유전자는 0.39%(44,000개의 유전자 중 170개) 발현이 감소된 유전자는 0.77%(44,000개의 유전자 중 338개)임을 확인하였다. As a result, among the approximately 44,000 genes present on the oligo chip, the ratio of Cy5 / Cy3 increased by 2.0 times or more by dibenzoA-Q anthracene was 0.39% (170 out of 44,000 genes). ), The reduced gene expression was 0.77% (338 of 44,000 genes).

이때, 다이벤조에이에이취안트라센에 의해 2배 이상 과발현 혹은 저발현 되는 유전자들을 기능별로 분류한 결과, 세포 주기(cell cycle), 핵산 결합(nucleic acid binding), 금속원소 결합(metal binding), 산화 환원 효소 활성(Oxidoreductase activity), I-kappaB 키나아제(kinase)/NF-kappaB 캐스케이드(cascade), 암(Cancer), 외부 자극에 대한 반응(Response to external stimulus), 세포골격 단백질 결합(Cytoskeletal protein binding), 칼슘 이온 결합(Calcium ion binding), 소낭-매개 수송(Vesicle-mediated transport), 징크-핑거(Zinc-finger), 뉴클레오티드 결합(Nucleotide binding), 유기산 대사(Organic acid metabolism), 보체 및 응고 캐스케이드(Complement and coagulation cascades), 알코올 대사(Alcohol metabolism), MAPKKK 캐스케이드(cascade), GTPase 조절 활성(regulator activity), 아팝토시스(apoptosis), 단백질 전달(protein transport), 형태 형성(morphogenesis), 면역반응(immune response), 세포 증식(cell proliferation), 지방산 대사(lipid metabolism), 화학물질 자극 반응(response to chemical stimulus) 또는 DNA 손상 반응(response to DNA damage stimulus)등의 관련 유전자로 선별되었다(표 2 및 3). 상기 유전자들은 본 발명에서 사용한 다이벤조에이에이취안트라센을 처리 했을 때, 인간 간암 세포에서 독성과 관련이 있다는 보고는 없다. In this case, as a result of dividing the genes overexpressed or underexpressed by dibenzoA-ethanthracene more than two times by function, cell cycle, nucleic acid binding, metal binding, redox Oxidoreductase activity, I-kappaB kinase / NF-kappaB cascade, Cancer, Response to external stimulus, Cytoskeletal protein binding, Calcium ion binding, Vesicle-mediated transport, Zinc-finger, Nucleotide binding, Organic acid metabolism, Complement and coagulation cascade and coagulation cascades, alcohol metabolism, MAPKKK cascade, GTPase regulator activity, apoptosis, protein transport, morphogenes is, related genes such as immune response, cell proliferation, lipid metabolism, response to chemical stimulus, or response to DNA damage stimulus. Selected (Tables 2 and 3). The genes have not been reported to be associated with toxicity in human liver cancer cells when treated with dibenzoA-anthanthracene.

다이벤조에이에이취안트라센에To dibenzoaylanthracene 의해 발현이 증가하는 유전자 Genes with increased expression 등록번호Registration Number 유전자 약어Gene abbreviation 유전자 명Gene name 중간값의 비Ratio of medians (a) 핵산 결합(Nucleic acid binding)(a) Nucleic acid binding AB209605AB209605 SKIV2LSKIV2L Superkiller viralicidic activity 2-like(S. cerevisiae)Superkiller viralicidic activity 2-like (S. Cerevisiae) 2.10182.1018 AI200373AI200373 HIST1H2ALHIST1H2AL Histone 1, H2alHistone 1, H2al 2.62352.6235 AK001594AK001594 AKAP8LAKAP8L A kinase (PRKA) anchor protein 8-likeA kinase (PRKA) anchor protein 8-like 2.0132.013 AK057577AK057577 IRF3IRF3 Interferon regulatory factor 3Interferon regulatory factor 3 2.06472.0647 AL832659AL832659 FLJ22833FLJ22833 Hypothetical protein FLJ22833Hypothetical protein FLJ22833 2.13292.1329 BC034487BC034487 HIST1H2AKHIST1H2AK Histone 1, H2akHistone 1, H2ak 2.27262.2726 BC034569BC034569 ZNF337ZNF337 Zinc finger protein 337Zinc finger protein 337 2.13492.1349 BC038432BC038432 RARARARA Retinoic acid receptor, alphaRetinoic acid receptor, alpha 2.37642.3764 BC067782BC067782 HIST1H2AGHIST1H2AG Histone 1, H2agHistone 1, H2ag 2.33852.3385 BC069193BC069193 HIST2H2BEHIST2H2BE Histone 2, H2beHistone 2, H2be 2.61072.6107 BC071638BC071638 HIST2H2BEHIST2H2BE Histone 2, H2beHistone 2, H2be 2.07282.0728 BC082232BC082232 HIST1H2BGHIST1H2BG Histone 1, H2bgHistone 1, H2bg 2.96742.9674 BC101655BC101655 HIST1H2BIHIST1H2BI Histone 1, H2biHistone 1, H2bi 2.4972.497 BE741093BE741093 HIST1H2AEHIST1H2AE Histone 1, H2aeHistone 1, H2ae 2.51712.5171 BE973853BE973853 HIST1H4JHIST1H4J Histone 1, H4jHistone 1, H4j 2.02692.0269 BM752802BM752802 HIST1H2BMHIST1H2BM Histone 1, H2bmHistone 1, H2bm 2.39562.3956 BM919305BM919305 POLR2LPOLR2L Polymerase(RNA) II(DNA directed) polypeptide L, 7.6kDaPolymerase (RNA) II (DNA directed) polypeptide L, 7.6kDa 2.01522.0152 BU603483BU603483 HIST1H1EHIST1H1E Histone 1, H1eHistone 1, H1e 2.90782.9078 BX436525BX436525 HIST1H2BHHIST1H2BH Histone 1, H2bhHistone 1, H2bh 2.65282.6528 BX647290BX647290 HIST1H2BOHIST1H2BO Histone 1, H2boHistone 1, H2bo 2.43612.4361 CB529694CB529694 HIST2H2BEHIST2H2BE Histone 2, H2beHistone 2, H2be 2.52922.5292 CD710576CD710576 HIST2H2ACHIST2H2AC Histone 2, H2acHistone 2, H2ac 2.48172.4817 CK000930CK000930 HIST1H2AIHIST1H2AI Histone 1, H2aiHistone 1, H2ai 3.04033.0403 CR608156CR608156 HIST1H2ACHIST1H2AC Histone 1, H2acHistone 1, H2ac 2.71162.7116 NM_002515NM_002515 NOVA1NOVA1 Neuro-oncological ventral antigen 1Neuro-oncological ventral antigen 1 2.05592.0559 NM_003516NM_003516 HIST2H2AAHIST2H2AA Histone 2, H2aaHistone 2, H2aa 3.66873.6687 NM_003519NM_003519 HIST1H2BLHIST1H2BL Histone 1, H2blHistone 1, H2bl 2.67132.6713 NM_003670NM_003670 BHLHB2BHLHB2 Basic helix-loop-helix domain containing, class B, 2Basic helix-loop-helix domain containing, class B, 2 2.08582.0858 NM_004660NM_004660 DDX3YDDX3Y DEAD(Asp-Glu-Ala-Asp) box polypeptide 3, Y-linkedDEAD (Asp-Glu-Ala-Asp) box polypeptide 3, Y-linked 2.31662.3166 NM_005319NM_005319 HIST1H1CHIST1H1C Histone 1, H1cHistone 1, H1c 4.53714.5371 NM_005320NM_005320 HIST1H1DHIST1H1D Histone 1, H1dHistone 1, H1d 3.87043.8704 NM_005524NM_005524 HES1HES1 Hairy and enhancer of split 1,(Drosophila)Hairy and enhancer of split 1, (Drosophila) 2.30722.3072 NM_006442NM_006442 DRAP1DRAP1 DR1-associated protein 1(negative cofactor 2 alpha)DR1-associated protein 1 (negative cofactor 2 alpha) 2.16322.1632 NM_021035NM_021035 KIAA1404KIAA1404 KIAA1404 proteinKIAA1404 protein 2.02442.0244 U86136U86136 TEP1TEP1 Telomerase-associated protein 1Telomerase-associated protein 1 3.73573.7357 (b) 세포 주기(Cell cycle)(b) Cell cycle AB209586AB209586 MAPK13MAPK13 Mitogen-activated protein kinase 13Mitogen-activated protein kinase 13 2.23082.2308 AK074652AK074652 SERTAD1SERTAD1 SERTA domain containing 1SERTA domain containing 1 4.18474.1847 AK122829AK122829 GAS2L1GAS2L1 Growth arrest-specific 2 like 1Growth arrest-specific 2 like 1 2.51822.5182 AK129595AK129595 GADD45BGADD45B Growth arrest and DNA-damage-inducible, betaGrowth arrest and DNA-damage-inducible, beta 2.4672.467 BC018266BC018266 CDC42CDC42 Cell division cycle 42(GTP binding protein, 25kDa)Cell division cycle 42 (GTP binding protein, 25kDa) 2.10732.1073 BC041022BC041022 SCAND1SCAND1 SCAN domain containing 1SCAN domain containing 1 2.45812.4581 BM904612BM904612 S100A6S100A6 S100 calcium binding protein A6(calcyclin)S100 calcium binding protein A6 (calcyclin) 4.17944.1794 BM913048BM913048 TIMP1TIMP1 TIMP metallopeptidase inhibitor 1TIMP metallopeptidase inhibitor 1 7.14517.1451 CR612719CR612719 GADD45AGADD45A Growth arrest and DNA-damage-inducible, alphaGrowth arrest and DNA-damage-inducible, alpha 2.25172.2517 NM_001007271NM_001007271 DUSP13DUSP13 Dual specificity phosphatase 13Dual specificity phosphatase 13 2.88622.8862 NM_001015053NM_001015053 HDAC5HDAC5 Histone deacetylase 5Histone deacetylase 5 2.37422.3742 NM_001953NM_001953 ECGF1ECGF1 Endothelial cell growth factor 1(platelet-derived)Endothelial cell growth factor 1 (platelet-derived) 2.36312.3631 NM_003255NM_003255 TIMP2TIMP2 TIMP metallopeptidase inhibitor 2TIMP metallopeptidase inhibitor 2 3.19923.1992 NM_005072NM_005072 SLC12A4SLC12A4 Solute carrier family 12(potassium/chloride transporters), member 4Solute carrier family 12 (potassium / chloride transporters), member 4 2.26532.2653 NM_005343NM_005343 HRASHRAS V-Ha-ras Harvey rat sarcoma viral oncogene homologV-Ha-ras Harvey rat sarcoma viral oncogene homolog 2.19442.1944 NM_005736NM_005736 ACTR1AACTR1A ARP1 actin-related protein 1 homolog A, centractin alpha(yeast)ARP1 actin-related protein 1 homolog A, centractin alpha (yeast) 2.41312.4131 NM_007065NM_007065 CDC37CDC37 CDC37 cell division cycle 37 homolog(S. cerevisiae)CDC37 cell division cycle 37 homolog (S. cerevisiae) 2.04482.0448 NM_078467NM_078467 CDKN1ACDKN1A Cyclin-dependent kinase inhibitor 1A(p21, Cip1)Cyclin-dependent kinase inhibitor 1A (p21, Cip1) 3.52643.5264 U68019U68019 SMAD3SMAD3 SMAD, mothers against DPP homolog 3(Drosophila)SMAD, mothers against DPP homolog 3 (Drosophila) 2.03412.0341 X02812X02812 TGFB1TGFB1 Transforming growth factor, beta 1(Camurati-Engelmann disease)Transforming growth factor, beta 1 (Camurati-Engelmann disease) 2.41162.4116 (c) 세포자살(Apoptosis)(c) Apoptosis AB033060AB033060 PDCD6PDCD6 Aryl-hydrocarbon receptor repressorAryl-hydrocarbon receptor repressor 2.60412.6041 AB209361AB209361 FASFAS Fas(TNF receptor superfamily, member 6)Fas (TNF receptor superfamily, member 6) 2.60842.6084 AF332558AF332558 BBC3BBC3 BCL2 binding component 3BCL2 binding component 3 2.26272.2627 AY028896AY028896 CARD10CARD10 Caspase recruitment domain family, member 10Caspase recruitment domain family, member 10 2.14682.1468 BC063507BC063507 HSPA1BHSPA1B Heat shock 70kDa protein 1BHeat shock 70kDa protein 1B 2.40052.4005 BM557864BM557864 HSPB1HSPB1 Heat shock 27kDa protein 1Heat shock 27kDa protein 1 2.5452.545 NM_001003940NM_001003940 BMFBMF Bcl2 modifying factorBcl2 modifying factor 2.78052.7805 NM_001165NM_001165 BIRC3BIRC3 Baculoviral IAP repeat-containing 3Baculoviral IAP repeat-containing 3 2.79282.7928 NM_001197NM_001197 BIKBIK BCL2-interacting killer (apoptosis-inducing)BCL2-interacting killer (apoptosis-inducing) 2.85762.8576 NM_002305NM_002305 LGALS1LGALS1 Lectin, galactoside-binding, soluble, 1(galectin 1)Lectin, galactoside-binding, soluble, 1 (galectin 1) 2.68992.6899 NM_003311NM_003311 PHLDA2PHLDA2 Pleckstrin homology-like domain, family A, member 2Pleckstrin homology-like domain, family A, member 2 2.81122.8112 NM_003639NM_003639 IKBKGIKBKG Inhibitor of kappa light polypeptide gene enhancer in B-cells, kinase gammaInhibitor of kappa light polypeptide gene enhancer in B-cells, kinase gamma 2.1622.162 NM_003820NM_003820 TNFRSF14TNFRSF14 Tumor necrosis factor receptor superfamily, member 14 (herpesvirus entry mediator)Tumor necrosis factor receptor superfamily, member 14 (herpesvirus entry mediator) 2.29112.2911 NM_003897NM_003897 IER3IER3 Immediate early response 3Immediate early response 3 2.86082.8608 NM_004401NM_004401 DFFADFFA DNA fragmentation factor, 45kDa, alpha polypeptideDNA fragmentation factor, 45kDa, alpha polypeptide 2.31772.3177 NM_016639NM_016639 TNFRSF12ATNFRSF12A Tumor necrosis factor receptor superfamily, member 12ATumor necrosis factor receptor superfamily, member 12A 2.32772.3277 (d) 금속원소 결합(Heavy metal binding)(d) Heavy metal binding BC048334BC048334 MT1GMT1G Metallothionein 1GMetallothionein 1G 3.27793.2779 BC053882BC053882 MT1XMT1X Metallothionein 1XMetallothionein 1X 2.80432.8043 BI488702BI488702 MT1KMT1K Metallothionein 1MMetallothionein 1M 2.69222.6922 NM_005947NM_005947 MT1BMT1B Metallothionein 1B(functional)Metallothionein 1B (functional) 3.12093.1209 (e) 산화환원효소 활성(Oxidoreductase activity)(e) Oxidoreductase activity AK055088AK055088 CYP2J2CYP2J2 Cytochrome P450, family 2, subfamily J, polypeptide 2Cytochrome P450, family 2, subfamily J, polypeptide 2 2.01642.0164 AK094474AK094474 RHOCRHOC Ras homolog gene family, member CRas homolog gene family, member C 3.18093.1809 BC015041BC015041 VAT1VAT1 Family with sequence similarity 82, member CFamily with sequence similarity 82, member C 2.28052.2805 NM_000499NM_000499 CYP1A1CYP1A1 Cytochrome P450, family 1, subfamily A, polypeptide 1Cytochrome P450, family 1, subfamily A, polypeptide 1 28.79528.795 NM_004881NM_004881 TP53I3TP53I3 Tumor protein p53 inducible protein 3Tumor protein p53 inducible protein 3 6.07586.0758 NM_201397NM_201397 GPX1GPX1 Glutathione peroxidase 1Glutathione peroxidase 1 2.14042.1404 XM_498018XM_498018 LOC391827LOC391827 Similar to Keratin, type I cytoskeletal 18 (Cytokeratin 18)(K18)(CK 18)Similar to Keratin, type I cytoskeletal 18 (Cytokeratin 18) (K18) (CK 18) 2.59272.5927 AF524864AF524864 AKR1B10AKR1B10 Aldo-keto reductase family 1, member B10(aldose reductase)Aldo-keto reductase family 1, member B10 (aldose reductase) 3.29663.2966 AL833205AL833205 ETFBETFB Electron-transfer-flavoprotein, beta polypeptideElectron-transfer-flavoprotein, beta polypeptide 3.75223.7522 BC034763BC034763 FDXRFDXR Ferredoxin reductaseFerredoxin reductase 2.99512.9951 CR610878CR610878 AKR1B1AKR1B1 Aldo-keto reductase family 1, member B1(aldose reductase)Aldo-keto reductase family 1, member B1 (aldose reductase) 2.33232.3323 NM_003330NM_003330 TXNRD1TXNRD1 Thioredoxin reductase 1Thioredoxin reductase 1 2.37352.3735 NM_004199NM_004199 P4HA2P4HA2 Procollagen-proline, 2-oxoglutarate 4-dioxygenase(proline 4-hydroxylase), alpha polypeptide IIProcollagen-proline, 2-oxoglutarate 4-dioxygenase (proline 4-hydroxylase), alpha polypeptide II 2.51572.5157 NM_004753NM_004753 DHRS3DHRS3 Dehydrogenase/reductase(SDR family) member 3Dehydrogenase / reductase (SDR family) member 3 2.61552.6155 NM_031226NM_031226 CYP19A1CYP19A1 Cytochrome P450, family 19, subfamily A, polypeptide 1Cytochrome P450, family 19, subfamily A, polypeptide 1 2.8362.836 NM_032468NM_032468 ASPHASPH Aspartate beta-hydroxylaseAspartate beta-hydroxylase 1.684791.68479 (f) 화학적 자극에 대한 반응(Response to chemical stimulus)(f) Response to chemical stimulus AB209112AB209112 SLC2A8SLC2A8 Solute carrier family 2,(facilitated glucose transporter) member 8Solute carrier family 2, (facilitated glucose transporter) member 8 2.4412.441 BC011409BC011409 UGT1A6UGT1A6 UDP glucuronosyltransferase 1 family, polypeptide A9UDP glucuronosyltransferase 1 family, polypeptide A9 2.17352.1735 H18681H18681 C20orf139C20orf139 Sulfiredoxin 1 homolog(S. cerevisiae)Sulfiredoxin 1 homolog (S. cerevisiae) 2.19762.1976 NM_002658NM_002658 PLAUPLAU Plasminogen activator, urokinasePlasminogen activator, urokinase 2.75152.7515 NM_005064NM_005064 CCL23CCL23 Chemokine(C-C motif) ligand 23Chemokine (C-C motif) ligand 23 2.05622.0562 NM_032965NM_032965 CCL14CCL14 Chemokine(C-C motif) ligand 15Chemokine (C-C motif) ligand 15 2.03222.0322 Y11307Y11307 CYR61CYR61 Cysteine-rich, angiogenic inducer, 61Cysteine-rich, angiogenic inducer, 61 3.21563.2156 (g) 단백질 전달(Protein transport)(g) Protein transport AB209808AB209808 AP1M1AP1M1 Adaptor-related protein complex 1, mu 1 subunitAdaptor-related protein complex 1, mu 1 subunit 2.32532.3253 AK074154AK074154 SYTL1SYTL1 Synaptotagmin-like 1Synaptotagmin-like 1 3.90723.9072 AK098475AK098475 GRPEL1GRPEL1 GrpE-like 1, mitochondrial(E. coli)GrpE-like 1, mitochondrial (E. coli) 2.18532.1853 AK123405AK123405 GDI1GDI1 GDP dissociation inhibitor 1GDP dissociation inhibitor 1 2.16932.1693 BC000786BC000786 ARFGAP1ARFGAP1 ADP-ribosylation factor GTPase activating protein 1ADP-ribosylation factor GTPase activating protein 1 2.07622.0762 BC042390BC042390 VTI1BVTI1B Vesicle transport through interaction with t-SNAREs homolog 1B(yeast)Vesicle transport through interaction with t-SNAREs homolog 1B (yeast) 1.951581.95158 BG036385BG036385 RAMP1RAMP1 Receptor(calcitonin) activity modifying protein 1Receptor (calcitonin) activity modifying protein 1 4.77244.7724 BX648781BX648781 GABARAPL1GABARAPL1 GABA(A) receptor-associated protein like 1GABA (A) receptor-associated protein like 1 2.16222.1622 NM_001013839NM_001013839 EXOC7EXOC7 Exocyst complex component 7Exocyst complex component 7 2.0882.088 NM_002926NM_002926 RGS12RGS12 Regulator of G-protein signalling 12Regulator of G-protein signaling 12 2.20912.2091 NM_007097NM_007097 CLTBCLTB Clathrin, light polypeptide(Lcb)Clathrin, light polypeptide (Lcb) 2.14132.1413 NM_013336NM_013336 SEC61A1SEC61A1 Sec61 alpha 1 subunit(S. cerevisiae)Sec61 alpha 1 subunit (S. cerevisiae) 2.13862.1386 NM_024101NM_024101 MLPHMLPH MelanophilinMelanophilin 2.22742.2274 NM_032872NM_032872 SYTL1SYTL1 Synaptotagmin-like 1Synaptotagmin-like 1 3.48093.4809 (h) 형태형성(Morphogenesis)(h) Morphogenesis NM_000596NM_000596 IGFBP1IGFBP1 Insulin-like growth factor binding protein 1Insulin-like growth factor binding protein 1 2.4392.439 NM_001553NM_001553 IGFBP7IGFBP7 Insulin-like growth factor binding protein 7Insulin-like growth factor binding protein 7 2.6162.616 NM_001712NM_001712 CEACAM1CEACAM1 Carcinoembryonic antigen-related cell adhesion molecule 1(biliary glycoprotein)Carcinoembryonic antigen-related cell adhesion molecule 1 (biliary glycoprotein) 2.14612.1461 NM_012396NM_012396 PHLDA3PHLDA3 Pleckstrin homology-like domain, family A, member 3Pleckstrin homology-like domain, family A, member 3 4.68844.6884 Y12692Y12692 WNT11WNT11 Wingless-type MMTV integration site family, member 11Wingless-type MMTV integration site family, member 11 5.03065.0306 (i) 세포증식(Cell proliferation)(i) Cell proliferation BC014470BC014470 AZGP1AZGP1 Alpha-2-glycoprotein 1, zincAlpha-2-glycoprotein 1, zinc 2.56542.5654 BQ683841BQ683841 S100A11S100A11 S100 calcium binding protein A11 (calgizzarin)S100 calcium binding protein A11 (calgizzarin) 2.98922.9892 NM_002337NM_002337 LRPAP1LRPAP1 Low density lipoprotein receptor-related protein associated protein 1Low density lipoprotein receptor-related protein associated protein 1 2.60622.6062 (j) I-kappaB 키나아제(kinase)/NF-kappaB 캐스케이드(cascade)(j) I-kappaB kinase / NF-kappaB cascade AF059617AF059617 PLK2PLK2 Polo-like kinase 2(Drosophila)Polo-like kinase 2 (Drosophila) 2.14122.1412 AK128553AK128553 ZZANK1ZZANK1 Mindbomb homolog 2(Drosophila)Mindbomb homolog 2 (Drosophila) 2.54432.5443 (k) 암(Cancer)(k) Cancer BX649164BX649164 PAI; PAI1; PAI-1; PLANH1PAI; PAI1; PAI-1; PLANH1 serpin peptidase inhibitor, clade E(nexin, plasminogen activator inhibitor type 1), member 1serpin peptidase inhibitor, clade E (nexin, plasminogen activator inhibitor type 1), member 1 4.69114.6911 NM_000602NM_000602 SERPINE1SERPINE1 Serpin peptidase inhibitor, clade E(nexin, plasminogen activator inhibitor type 1), member 1Serpin peptidase inhibitor, clade E (nexin, plasminogen activator inhibitor type 1), member 1 8.53528.5352 (l) 외부자극에 대한 반응(Response to external stimulus)(l) Response to external stimulus BI767815BI767815 GP9GP9 Glycoprotein IX(platelet)Glycoprotein IX (platelet) 2.03922.0392 BM918324BM918324 LY96LY96 Lymphocyte antigen 96Lymphocyte antigen 96 2.10912.1091 NM_006404NM_006404 PROCRPROCR Protein C receptor, endothelial(EPCR)Protein C receptor, endothelial (EPCR) 3.69593.6959 (m) 면역반응(Immune response)(m) Immune response AF031469AF031469 MR1MR1 Major histocompatibility complex, class I-relatedMajor histocompatibility complex, class I-related 2.91062.9106 BF569086BF569086 NK4NK4 Interleukin 32Interleukin 32 2.52632.5263 BG564326BG564326 SAA4SAA4 Serum amyloid A4, constitutiveSerum amyloid A4, constitutive 2.20772.2077 NM_001633NM_001633 AMBPAMBP Alpha-1-microglobulin/bikunin precursorAlpha-1-microglobulin / bikunin precursor 2.25392.2539 NM_005532NM_005532 IFI27IFI27 Interferon, alpha-inducible protein 27Interferon, alpha-inducible protein 27 2.25592.2559 NM_017670NM_017670 OTUB1OTUB1 OTU domain, ubiquitin aldehyde binding 1OTU domain, ubiquitin aldehyde binding 1 2.25282.2528 (n) 세포골격 단백질 결합(Cytoskeletal protein binding)(n) Cytoskeletal protein binding AK130130AK130130 CAPGCAPG Capping protein(actin filament), gelsolin-likeCapping protein (actin filament), gelsolin-like 3.33763.3376 BX648190BX648190 WDR1WDR1 WD repeat domain 1WD repeat domain 1 2.10512.1051 CF552540CF552540 TNNI2TNNI2 Troponin I type 2(skeletal, fast)Troponin I type 2 (skeletal, fast) 2.13652.1365 NM_001006946NM_001006946 SDC1SDC1 Syndecan 1Syndecan 1 2.13522.1352 NM_007284NM_007284 PTK9LPTK9L PTK9L protein tyrosine kinase 9-like(A6-related protein)PTK9L protein tyrosine kinase 9-like (A6-related protein) 2.35822.3582 NM_015990NM_015990 KLHL5KLHL5 Kelch-like 5(Drosophila)Kelch-like 5 (Drosophila) 2.4792.479 (o) 칼슘 이온 결합(Calcium ion binding)(o) Calcium ion binding BM467105BM467105 CIB1CIB1 Calcium and integrin binding 1(calmyrin)Calcium and integrin binding 1 (calmyrin) 2.03552.0355 CF553054CF553054 TNNC1TNNC1 Troponin C type 1(slow)Troponin C type 1 (slow) 2.92442.9244 NM_006384NM_006384 CIB1CIB1 Calcium and integrin binding 1(calmyrin)Calcium and integrin binding 1 (calmyrin) 2.38272.3827 NM_080388NM_080388 S100A16S100A16 S100 calcium binding protein A16S100 calcium binding protein A16 2.39562.3956 (p) 소낭 매개 수송(Vesicle-mediated transport)(p) Vesicle-mediated transport NM_005817NM_005817 M6PRBP1M6PRBP1 Mannose-6-phosphate receptor binding protein 1Mannose-6-phosphate receptor binding protein 1 2.11462.1146 NM_006555NM_006555 YKT6YKT6 SNARE protein Ykt6SNARE protein Ykt6 2.11962.1196 (q) 지질 대사(Lipid metabolism)(q) Lipid metabolism AK093461AK093461 ISYNA1ISYNA1 Myo-inositol 1-phosphate synthase A1Myo-inositol 1-phosphate synthase A1 2.88452.8845 AK097009AK097009 PLTPPLTP phospholipid transfer proteinphospholipid transfer protein 4.62864.6286 BC030207BC030207 NR0B2NR0B2 Nuclear receptor subfamily 0, group B, member 2Nuclear receptor subfamily 0, group B, member 2 2.38312.3831 BC035124BC035124 UNQ2541UNQ2541 MSFL2541MSFL2541 5.24275.2427 NM_145323NM_145323 OSBPL3OSBPL3 Oxysterol binding protein-like 3Oxysterol binding protein-like 3 2.69022.6902 (r) DNA 손상 자극에 대한 반응(Response to DNA damage stimulus)(r) Response to DNA damage stimulus BC050455BC050455 DDB2DDB2 LIM homeobox 3LIM homeobox 3 3.32943.3294 BC068535BC068535 TP53AP1TP53AP1 TP53 activated protein 1TP53 activated protein 1 2.9592.959 NM_016440NM_016440 VRK3VRK3 Vaccinia related kinase 3Vaccinia related kinase 3 2.34712.3471 (o) 기타(The others)(o) The others NM_001124NM_001124 ADMADM AdrenomedullinAdrenomedullin 2.03982.0398 NM_170707NM_170707 LMNALMNA Lamin A/CLamin A / C 2.20572.2057 NM_004633NM_004633 IL1R2IL1R2 Interleukin 1 receptor, type IIInterleukin 1 receptor, type II 3.08363.0836 NM_004864NM_004864 GDF15GDF15 Growth differentiation factor 15Growth differentiation factor 15 11.0911.09 NM_017572NM_017572 MKNK2MKNK2 MAP kinase interacting serine/threonine kinase 2MAP kinase interacting serine / threonine kinase 2 1.583731.58373 AA669162AA669162 AMPD3AMPD3 Transcribed locusTranscribed locus 1.9131.913 AB033073AB033073 SULF2SULF2 Sulfatase 2Sulfatase 2 3.42813.4281 AB208949AB208949 LRDDLRDD Leucine-rich repeats and death domain containingLeucine-rich repeats and death domain containing 3.95013.9501 AK022712AK022712 FLJ12650FLJ12650 Family with sequence similarity 77, member CFamily with sequence similarity 77, member C 4.51364.5136 AK095363AK095363 AQP3AQP3 Aquaporin 3Aquaporin 3 5.83115.8311 AY368150AY368150 CHR2SYTCHR2SYT Family with sequence similarity 62(C2 domain containing) member BFamily with sequence similarity 62 (C2 domain containing) member B 2.60182.6018 BU587578BU587578 RGS10RGS10 Regulator of G-protein signalling 10Regulator of G-protein signaling 10 6.77726.7772 BU945318BU945318 MT2AMT2A Hypothetical gene supported by X97260; BC070289Hypothetical gene supported by X97260; BC070289 8.2598.259 NM_001013632NM_001013632 LOC343521LOC343521 Similar to hypothetical protein 4833401D15Similar to hypothetical protein 4833401D15 3.07663.0766 NM_006426NM_006426 DPYSL4DPYSL4 Dihydropyrimidinase-like 4Dihydropyrimidinase-like 4 5.43075.4307 NM_133493NM_133493 CD109CD109 CD109 antigen(Gov platelet alloantigens)CD109 antigen (Gov platelet alloantigens) 6.73436.7343 NM_145256NM_145256 LRRC25LRRC25 Leucine rich repeat containing 25Leucine rich repeat containing 25 9.56779.5677

다이벤조에이에이취안트라센에To dibenzoaylanthracene 의해 발현이 감소하는 유전자 Genes whose expression is reduced 등록번호Registration Number 유전자 약어Gene abbreviation 유전자명Gene name 중간값의 비Ratio of medians (a)세포주기(cell cycle)(a) cell cycle AB033337AB033337 MPHOSPH1MPHOSPH1 M-phase phosphoprotein 1M-phase phosphoprotein 1 0.350830.35083 AB208875AB208875 Septin 10Septin 10 Septin 10Septin 10 0.303270.30327 AF053305AF053305 BUB1BUB1 BUB1 budding uninhibited by benzimidazoles 1 homolog (yeast)BUB1 budding uninhibited by benzimidazoles 1 homolog (yeast) 0.253680.25368 AF053306AF053306 BUB1BBUB1B BUB1 budding uninhibited by benzimidazoles 1 homolog beta(yeast)BUB1 budding uninhibited by benzimidazoles 1 homolog beta (yeast) 0.451690.45169 AF345347AF345347 SPAG5SPAG5 Sperm associated antigen 5Sperm associated antigen 5 0.307510.30751 AK222819AK222819 NUSAP1NUSAP1 Nucleolar and spindle associated protein 1Nucleolar and spindle associated protein 1 0.39510.3951 AY367065AY367065 ASPMASPM Asp(abnormal spindle)-like, microcephaly associated(Drosophila)Asp (abnormal spindle) -like, microcephaly associated (Drosophila) 0.232120.23212 BC004352BC004352 KIF22KIF22 Kinesin family member 22Kinesin family member 22 0.471120.47112 BC010607BC010607 IGF1RIGF1R Insulin-like growth factor 1 receptorInsulin-like growth factor 1 receptor 0.256850.25685 BC011000BC011000 CDCA5CDCA5 Cell division cycle associated 5Cell division cycle associated 5 0.203350.20335 BC013326BC013326 GAS2GAS2 Growth arrest-specific 2Growth arrest-specific 2 0.327710.32771 BC032677BC032677 UBE2CUBE2C Ubiquitin-conjugating enzyme E2CUbiquitin-conjugating enzyme E2C 0.252780.25278 BC040991BC040991 TFDP2TFDP2 Transcription factor Dp-2(E2F dimerization partner 2)Transcription factor Dp-2 (E2F dimerization partner 2) 0.373760.37376 BC050384BC050384 SUPT3HSUPT3H Suppressor of Ty 3 homolog(S. cerevisiae)Suppressor of Ty 3 homolog (S. cerevisiae) 0.351690.35169 BC068483BC068483 RINT-1RINT-1 Rad50-interacting protein 1Rad50-interacting protein 1 0.456730.45673 BQ278454BQ278454 CKS1BCKS1B CDC28 protein kinase regulatory subunit 1BCDC28 protein kinase regulatory subunit 1B 0.445410.44541 BX647885BX647885 STMN1STMN1 Stathmin 1/oncoprotein 18Stathmin 1 / oncoprotein 18 0.370730.37073 CR604810CR604810 CCNA2CCNA2 Cyclin A2Cyclin A2 0.237770.23777 CR933728CR933728 CDC2CDC2 Cell division cycle 2, G1 to S and G2 to MCell division cycle 2, G1 to S and G2 to M 0.258180.25818 D42045D42045 DCLRE1ADCLRE1A DNA cross-link repair 1A(PSO2 homolog, S. cerevisiae)DNA cross-link repair 1A (PSO2 homolog, S. cerevisiae) 0.497450.49745 NM_000189NM_000189 HK2HK2 Hexokinase 2Hexokinase 2 0.338610.33861 NM_001005414NM_001005414 ZWINTZWINT ZW10 interactor antisenseZW10 interactor antisense 0.274380.27438 NM_001018159NM_001018159 APPBP1APPBP1 Amyloid beta precursor protein binding protein 1Amyloid beta precursor protein binding protein 1 0.465130.46513 NM_001239NM_001239 CCNHCCNH Cyclin HCyclin h 0.476530.47653 NM_001790NM_001790 CDC25CCDC25C Cell division cycle 25CCell division cycle 25C 0.415020.41502 NM_001827NM_001827 CKS2CKS2 CDC28 protein kinase regulatory subunit 2CDC28 protein kinase regulatory subunit 2 0.47830.4783 NM_002431NM_002431 MNAT1MNAT1 Menage a trois 1 (CAK assembly factor)Menage a trois 1 (CAK assembly factor) 0.452640.45264 NM_002467NM_002467 MYCMYC V-myc myelocytomatosis viral oncogene homolog (avian)V-myc myelocytomatosis viral oncogene homolog (avian) 0.386250.38625 NM_002709NM_002709 PPP1CBPPP1CB Protein phosphatase 1, catalytic subunit, beta isoformProtein phosphatase 1, catalytic subunit, beta isoform 0.421710.42171 NM_002737NM_002737 PRKCAPRKCA Protein kinase C, alphaProtein kinase C, alpha 0.338060.33806 NM_002894NM_002894 RBBP8RBBP8 Retinoblastoma binding protein 8Retinoblastoma binding protein 8 0.374740.37474 NM_003318NM_003318 TTKTTK TTK protein kinaseTTK protein kinase 0.19780.1978 NM_003478NM_003478 CUL5CUL5 Cullin 5Cullin 5 0.417950.41795 NM_003981NM_003981 PRC1PRC1 Protein regulator of cytokinesis 1Protein regulator of cytokinesis 1 0.426620.42662 NM_004064NM_004064 CDKN1BCDKN1B Cyclin-dependent kinase inhibitor 1B(p27, Kip1)Cyclin-dependent kinase inhibitor 1B (p27, Kip1) 0.333020.33302 NM_004354NM_004354 CCNG2CCNG2 Cyclin G2Cyclin G2 0.357560.35756 NM_004365NM_004365 CETN3CETN3 Centrin, EF-hand protein, 3(CDC31 homolog, yeast)Centrin, EF-hand protein, 3 (CDC31 homolog, yeast) 0.463830.46383 NM_004523NM_004523 KIF11KIF11 Kinesin family member 11Kinesin family member 11 0.40940.4094 NM_004701NM_004701 CCNB2CCNB2 Cyclin B2Cyclin B2 0.428820.42882 NM_005504NM_005504 BCAT1BCAT1 Branched chain aminotransferase 1, cytosolicBranched chain aminotransferase 1, cytosolic 0.36460.3646 NM_005915NM_005915 MCM6MCM6 MCM6 minichromosome maintenance deficient 6 (MIS5 homolog, S. pombe)(S. cerevisiae)MCM6 minichromosome maintenance deficient 6 (MIS5 homolog, S. pombe) (S. cerevisiae) 0.411930.41193 NM_006101NM_006101 KNTC2KNTC2 Kinetochore associated 2Kinetochore associated 2 0.184290.18429 NM_006265NM_006265 RAD21RAD21 RAD21 homolog(S. pombe)RAD21 homolog (S. pombe) 0.459060.45906 NM_014750NM_014750 DLG7DLG7 Discs, large homolog 7(Drosophila)Discs, large homolog 7 (Drosophila) 0.202560.20256 NM_014751NM_014751 MTSS1MTSS1 Metastasis suppressor 1Metastasis suppressor 1 0.245650.24565 NM_016343NM_016343 CENPFCENPF Centromere protein F, 350/400ka(mitosin)Centromere protein F, 350 / 400ka (mitosin) 0.146070.14607 NM_018492NM_018492 PBKPBK PDZ binding kinasePDZ binding kinase 0.080770.08077 NM_018685NM_018685 ANLNANLN Anillin, actin binding protein(scraps homolog, Drosophila)Anillin, actin binding protein (scraps homolog, Drosophila) 0.357490.35749 NM_019001NM_019001 XRN1XRN1 5'-3' exoribonuclease 15'-3 'exoribonuclease 1 0.437470.43747 NM_019063NM_019063 EML4EML4 Echinoderm microtubule associated protein like 4Echinoderm microtubule associated protein like 4 0.458290.45829 NM_020242NM_020242 KNSL7KNSL7 Kinesin family member 15Kinesin family member 15 0.427060.42706 U65410U65410 MAD2L1MAD2L1 MAD2 mitotic arrest deficient-like 1(yeast)MAD2 mitotic arrest deficient-like 1 (yeast) 0.165760.16576 (b) 금속원소 결합(Metal-binding)(b) Metal-binding AB096175AB096175 SP5SP5 Sp5 transcription factorSp5 transcription factor 0.436650.43665 AB209086AB209086 ZNF493ZNF493 Zinc finger protein 493Zinc finger protein 493 0.356980.35698 AB209334AB209334 SP3SP3 Sp3 transcription factorSp3 transcription factor 0.457640.45764 AB209892AB209892 ZFXZFX Zinc finger protein, X-linkedZinc finger protein, X-linked 0.348650.34865 AF279145AF279145 ANTXR1ANTXR1 Anthrax toxin receptor 1Anthrax toxin receptor 1 0.138750.13875 AK095600AK095600 FLJ38281FLJ38281 Zinc finger protein 564Zinc finger protein 564 0.478410.47841 AK123010AK123010 RRM2RRM2 Ribonucleotide reductase M2 polypeptideRibonucleotide reductase M2 polypeptide 0.365560.36556 AK126180AK126180 DTYMKDTYMK Deoxythymidylate kinase (thymidylate kinase)Deoxythymidylate kinase (thymidylate kinase) 0.469110.46911 AK130071AK130071 HSPC063HSPC063 BTB(POZ) domain containing 15BTB (POZ) domain containing 15 0.318550.31855 AK131420AK131420 ZNF66ZNF66 Zinc finger protein 66Zinc finger protein 66 0.466570.46657 AK131472AK131472 cDNA FLJ16640 fiscDNA FLJ16640 fis CDNAFLJ16640fis,cloneTESTI4028938,moderately similar to Zinc finger protein 85CDNAFLJ16640fis, cloneTESTI4028938, moderately similar to Zinc finger protein 85 0.479330.47933 AK131527AK131527 ZNF15L1ZNF15L1 Zinc finger protein 708(KOX8)Zinc finger protein 708 (KOX8) 0.328050.32805 AK160373AK160373 DKFZp547K1113DKFZp547K1113 Zinc finger protein 710Zinc finger protein 710 0.471760.47176 AL832422AL832422 ZNF430ZNF430 Zinc finger protein 430Zinc finger protein 430 0.432560.43256 AY269786AY269786 ZNF429ZNF429 Zinc finger protein 429Zinc finger protein 429 0.384640.38464 BC035579BC035579 ZNF100ZNF100 Zinc finger protein 100Zinc finger protein 100 0.440540.44054 BC036394BC036394 ZNF85ZNF85 Zinc finger protein 85(HPF4, HTF1)Zinc finger protein 85 (HPF4, HTF1) 0.415130.41513 BM466459BM466459 DGKIDGKI Diacylglycerol kinase, iotaDiacylglycerol kinase, iota 0.386960.38696 BX537574BX537574 FREM1FREM1 FRAS1 related extracellular matrix 1FRAS1 related extracellular matrix 1 0.441860.44186 BX537987BX537987 TRIM59TRIM59 Tripartite motif-containing 59Tripartite motif-containing 59 0.318920.31892 BX648469BX648469 ATF2ATF2 Activating transcription factor 2Activating transcription factor 2 0.369780.36978 CR608275CR608275 CBLL1CBLL1 Cas-Br-M(murine) ecotropic retroviral transforming sequence-like 1Cas-Br-M (murine) ecotropic retroviral transforming sequence-like 1 0.466090.46609 CR749233CR749233 ZNF626ZNF626 Zinc finger protein 626Zinc finger protein 626 0.30240.3024 CR749832CR749832 IMPDH1IMPDH1 IMP(inosine monophosphate) dehydrogenase 1Inosine monophosphate (IMP) dehydrogenase 1 0.391930.39193 CR936615CR936615 MATR3MATR3 Matrin 3Matrin 3 0.334450.33445 NM_000946NM_000946 PRIM1PRIM1 Primase, polypeptide 1, 49kDaPrimase, polypeptide 1, 49kDa 0.438980.43898 NM_001123NM_001123 ADKADK Adenosine kinaseAdenosine kinase 0.478580.47858 NM_002317NM_002317 LOXLOX Lysyl oxidaseLysyl oxidase 0.461070.46107 NM_002655NM_002655 PLAG1PLAG1 Pleiomorphic adenoma gene 1Pleiomorphic adenoma gene 1 0.45950.4595 NM_003423NM_003423 ZNF43ZNF43 Zinc finger protein 43(HTF6)Zinc finger protein 43 (HTF6) 0.28720.2872 NM_005180NM_005180 PCGF4PCGF4 Polycomb group ring finger 4Polycomb group ring finger 4 0.493570.49357 NM_014615NM_014615 KIAA0182KIAA0182 KIAA0182 proteinKIAA0182 protein 0.477990.47799 NM_014919NM_014919 WHSC1WHSC1 Wolf-Hirschhorn syndrome candidate 1Wolf-Hirschhorn syndrome candidate 1 0.464080.46408 NM_015040NM_015040 PIP5K3PIP5K3 Phosphatidylinositol-3-phosphate/phosphatidylinositol 5-kinase, type IIIPhosphatidylinositol-3-phosphate / phosphatidylinositol 5-kinase, type III 0.453760.45376 NM_015387NM_015387 PREI3PREI3 Preimplantation protein 3Preimplantation protein 3 0.494810.49481 NM_015905NM_015905 TIF1TIF1 Tripartite motif-containing 24Tripartite motif-containing 24 0.463450.46345 NM_016513NM_016513 ICKICK Intestinal cell(MAK-like) kinaseIntestinal cell (MAK-like) kinase 0.415750.41575 NM_016626NM_016626 RKHD2RKHD2 Ring finger and KH domain containing 2Ring finger and KH domain containing 2 0.362160.36216 NM_018660NM_018660 ZNF395ZNF395 Zinc finger protein 395Zinc finger protein 395 0.443420.44342 NM_021129NM_021129 PPPP Pyrophosphatase(inorganic) 1Pyrophosphatase (inorganic) 1 0.444130.44413 NM_025074NM_025074 FRAS1FRAS1 Fraser syndrome 1Fraser syndrome 1 0.359880.35988 NM_173694NM_173694 ATP11CATP11C ATPase, Class VI, type 11CATPase, Class VI, type 11C 0.439510.43951 NM_176869NM_176869 PPA2PPA2 Pyrophosphatase(inorganic) 2Pyrophosphatase (inorganic) 2 0.377730.37773 NM_182851NM_182851 CCNB1IP1CCNB1IP1 Cyclin B1 interacting protein 1Cyclin B1 interacting protein 1 0.499480.49948 NM_199040NM_199040 NUDT4NUDT4 Nudix(nucleoside diphosphate linked moiety X)-type motif 4 pseudogene 2Nudix (nucleoside diphosphate linked moiety X) -type motif 4 pseudogene 2 0.415250.41525 (c) 징크-핑거(Zinc-finger)(c) Zinc-finger AK122869AK122869 LOC148213LOC148213 Zinc finger protein 681Zinc finger protein 681 0.393140.39314 BC042500BC042500 MGC42493MGC42493 Hypothetical protein MGC15634Hypothetical protein MGC15634 0.438790.43879 BC043147BC043147 ZNF539ZNF539 Zinc finger protein 254Zinc finger protein 254 0.406770.40677 BC044060BC044060 ZNF650ZNF650 Zinc finger protein 650Zinc finger protein 650 0.4440.444 BC050340BC050340 ZNF230ZNF230 Zinc finger protein 230Zinc finger protein 230 0.357560.35756 CR749800CR749800 ZNFN1A5ZNFN1A5 Zinc finger protein, subfamily 1A, 5Zinc finger protein, subfamily 1A, 5 0.494610.49461 CR936695CR936695 ZNF468ZNF468 Zinc finger protein ZNF468Zinc finger protein ZNF468 0.444790.44479 NM_001009881NM_001009881 ZCCHC11ZCCHC11 Zinc finger, CCHC domain containing 11Zinc finger, CCHC domain containing 11 0.486340.48634 NM_003441NM_003441 ZNF141ZNF141 Zinc finger protein 141(clone pHZ-44)Zinc finger protein 141 (clone pHZ-44) 0.357260.35726 NM_006526NM_006526 ZNF217ZNF217 Zinc finger protein 217Zinc finger protein 217 0.472370.47237 NM_007146NM_007146 ZNF161ZNF161 Zinc finger protein 161Zinc finger protein 161 0.481070.48107 NM_015336NM_015336 ZDHHC17ZDHHC17 Zinc finger, DHHC-type containing 17Zinc finger, DHHC-type containing 17 0.44290.4429 NM_016220NM_016220 ZNF588ZNF588 Zinc finger protein 588Zinc finger protein 588 0.315650.31565 NM_017742NM_017742 ZCCHC2ZCCHC2 Zinc finger, CCHC domain containing 2Zinc finger, CCHC domain containing 2 0.368620.36862 NM_021994NM_021994 ZNF277ZNF277 Zinc finger protein 277Zinc finger protein 277 0.480770.48077 NM_024733NM_024733 FLJ14345FLJ14345 Zinc finger protein 665Zinc finger protein 665 0.429340.42934 NM_032367NM_032367 ZBED3ZBED3 Zinc finger, BED-type containing 3Zinc finger, BED-type containing 3 0.497460.49746 NM_033114NM_033114 MADP-1MADP-1 MADP-1 proteinMADP-1 protein 0.423410.42341 NM_133473NM_133473 ZNF431ZNF431 Zinc finger protein 431Zinc finger protein 431 0.38170.3817 NM_152626NM_152626 ZNF92ZNF92 Zinc finger protein 92 (HTF12)Zinc finger protein 92 (HTF12) 0.406560.40656 NM_178558NM_178558 FLJ90430FLJ90430 Zinc finger protein 680Zinc finger protein 680 0.377270.37727 NM_198893NM_198893 ZNF160ZNF160 Zinc finger protein 160Zinc finger protein 160 0.347760.34776 XM_047550XM_047550 ZNF492ZNF492 Zinc finger protein 492Zinc finger protein 492 0.397690.39769 XM_290865XM_290865 LOC163233LOC163233 Similar to Zinc finger protein 93 (Zinc finger protein HTF34)Similar to Zinc finger protein 93 (Zinc finger protein HTF34) 0.338750.33875 XM_371174XM_371174 ZNF283ZNF283 Zinc finger protein 283Zinc finger protein 283 0.422540.42254 AB023141AB023141 ZNF652ZNF652 Zinc finger protein 652Zinc finger protein 652 0.388550.38855 (d) 핵산결합(Nucleic acid binding)(d) Nucleic acid binding AB209245AB209245 HMGN1HMGN1 High-mobility group nucleosome binding domain 1High-mobility group nucleosome binding domain 1 0.468590.46859 AB209389AB209389 GTF2IRD1GTF2IRD1 GTF2I repeat domain containing 1GTF2I repeat domain containing 1 0.465810.46581 AB209562AB209562 HNRPKHNRPK Heterogeneous nuclear ribonucleoprotein KHeterogeneous nuclear ribonucleoprotein K 0.433570.43357 AB209753AB209753 RBM7RBM7 RNA binding motif protein 7RNA binding motif protein 7 0.450830.45083 AF136171AF136171 EAP; HBP15; HBP15/L22EAP; HBP15; HBP15 / L22 ribosomal protein L22ribosomal protein L22 0.430090.43009 AK001230AK001230 POT1POT1 POT1 protection of telomeres 1 homolog(S. pombe)POT1 protection of telomeres 1 homolog (S. pombe) 0.428580.42858 AK022942AK022942 LOC58486LOC58486 Transposon-derived Buster1 transposase-like protein geneTransposon-derived Buster1 transposase-like protein gene 0.487680.48768 AK025758AK025758 NFATC2NFATC2 Nuclear factor of activated T-cells, cytoplasmic, calcineurin-dependent 2Nuclear factor of activated T-cells, cytoplasmic, calcineurin-dependent 2 0.205760.20576 AK056803AK056803 H2AFZH2AFZ H2A histone family, member ZH2A histone family, member Z 0.449170.44917 AK074119AK074119 ZZZ3ZZZ3 Zinc finger, ZZ-type containing 3Zinc finger, ZZ-type containing 3 0.444050.44405 AK091927AK091927 SFRS3SFRS3 Splicing factor, arginine/serine-rich 3Splicing factor, arginine / serine-rich 3 0.275470.27547 AK095937AK095937 GC20GC20 Translation factor sui1 homologTranslation factor sui1 homolog 0.459450.45945 AK124178AK124178 EIF3S6EIF3S6 Eukaryotic translation initiation factor 3, subunit 6 48kDaEukaryotic translation initiation factor 3, subunit 6 48kDa 0.431230.43123 AL110212AL110212 H2AFVH2AFV H2A histone family, member VH2A histone family, member V 0.376670.37667 BC010266BC010266 HNRNPA1; MGC102835HNRNPA1; MGC102835 Heterogeneous nuclear ribonucleoprotein A1Heterogeneous nuclear ribonucleoprotein A1 0.205090.20509 BM464978BM464978 HMGN2HMGN2 High-mobility group nucleosomal binding domain 2High-mobility group nucleosomal binding domain 2 0.45330.4533 BM800367BM800367 RPL21RPL21 Ribosomal protein L21Ribosomal protein L21 0.203940.20394 BU677381BU677381 RPL21RPL21 Ribosomal protein L21Ribosomal protein L21 0.471540.47154 BX647205BX647205 HNRPH1HNRPH1 Heterogeneous nuclear ribonucleoprotein H1 (H)Heterogeneous nuclear ribonucleoprotein H1 (H) 0.372710.37271 BX647217BX647217 HNRPA3HNRPA3 Heterogeneous nuclear ribonucleoprotein A3Heterogeneous nuclear ribonucleoprotein A3 0.339040.33904 CR625990CR625990 PC4PC4 SUB1 homolog (S. cerevisiae)SUB1 homolog (S. cerevisiae) 0.410440.41044 CR627133CR627133 LOC342892LOC342892 Hypothetical protein LOC342892Hypothetical protein LOC342892 0.483110.48311 NM_000947NM_000947 PRIM2APRIM2A Primase, polypeptide 2A, 58kDaPrimase, polypeptide 2A, 58kDa 0.400110.40011 NM_000983NM_000983 RPL22RPL22 Ribosomal protein L22Ribosomal protein L22 0.420250.42025 NM_001015886NM_001015886 HMGA2HMGA2 High mobility group AT-hook 2High mobility group AT-hook 2 0.30270.3027 NM_001017430NM_001017430 RBM3RBM3 RNA binding motif (RNP1, RRM) protein 3RNA binding motif (RNP1, RRM) protein 3 0.340160.34016 NM_001018067NM_001018067 PAI-RBP1PAI-RBP1 SERPINE1 mRNA binding protein 1SERPINE1 mRNA binding protein 1 0.425130.42513 NM_001412NM_001412 EIF1AXEIF1AX Eukaryotic translation initiation factor 1A, X-linkedEukaryotic translation initiation factor 1A, X-linked 0.350670.35067 NM_001809NM_001809 CENPACENPA Centromere protein A, 17kDaCentromere protein A, 17kDa 0.19570.1957 NM_002139NM_002139 RBMXRBMX RNA binding motif protein, X-linkedRNA binding motif protein, X-linked 0.325460.32546 NM_002568NM_002568 PABPC1PABPC1 Poly(A) binding protein, cytoplasmic 1Poly (A) binding protein, cytoplasmic 1 0.493160.49316 NM_003972NM_003972 BTAF1BTAF1 BTAF1 RNA polymerase II, B-TFIID transcription factor-associated, 170kDa (Mot1 homolog, S. cerevisiae)BTAF1 RNA polymerase II, B-TFIID transcription factor-associated, 170 kDa (Mot1 homolog, S. cerevisiae) 0.409190.40919 NM_004454NM_004454 ETV5ETV5 Ets variant gene 5(ets-related molecule)Ets variant gene 5 (ets-related molecule) 0.413380.41338 NM_005463NM_005463 HNRPDLHNRPDL Heterogeneous nuclear ribonucleoprotein D-likeHeterogeneous nuclear ribonucleoprotein D-like 0.367260.36726 NM_006047NM_006047 CPNE1CPNE1 RNA binding motif protein 12RNA binding motif protein 12 0.363650.36365 NM_006345NM_006345 SLC30A9SLC30A9 Solute carrier family 30(zinc transporter), member 9Solute carrier family 30 (zinc transporter), member 9 0.48040.4804 NM_006451NM_006451 PAIP1PAIP1 Poly(A) binding protein interacting protein 1Poly (A) binding protein interacting protein 1 0.481980.48198 NM_006546NM_006546 IMP-1IMP-1 IGF-II mRNA-binding protein 1IGF-II mRNA-binding protein 1 0.374680.37468 NM_006716NM_006716 ASKASK DBF4 homolog(S. cerevisiae)DBF4 homolog (S. cerevisiae) 0.112980.11298 NM_006775NM_006775 QKIQKI Quaking homolog, KH domain RNA binding(mouse)Quaking homolog, KH domain RNA binding (mouse) 0.401790.40179 NM_007080NM_007080 LSM6LSM6 LSM6 homolog, U6 small nuclear RNA associated (S. cerevisiae)LSM6 homolog, U6 small nuclear RNA associated (S. cerevisiae) 0.419730.41973 NM_007208NM_007208 MRPL3MRPL3 Mitochondrial ribosomal protein L3Mitochondrial ribosomal protein L3 0.471430.47143 NM_012207NM_012207 HNRPH3HNRPH3 Heterogeneous nuclear ribonucleoprotein H3(2H9)Heterogeneous nuclear ribonucleoprotein H3 (2H9) 0.347410.34741 NM_014321NM_014321 ORC6LORC6L Origin recognition complex, subunit 6 homolog-like(yeast)Origin recognition complex, subunit 6 homolog-like (yeast) 0.38820.3882 NM_014393NM_014393 STAU2STAU2 Staufen, RNA binding protein, homolog 2 (Drosophila)Staufen, RNA binding protein, homolog 2 (Drosophila) 0.473070.47307 NM_014892NM_014892 RBM16RBM16 RNA binding motif protein 16RNA binding motif protein 16 0.487390.48739 NM_015361NM_015361 R3HDMR3HDM R3H domain containing 1R3H domain containing 1 0.424120.42412 NM_015975NM_015975 TAF9LTAF9L TAF9-like RNA polymerase II, TATA box binding protein (TBP)-associated factor, 31kDaTAF9-like RNA polymerase II, TATA box binding protein (TBP) -associated factor, 31kDa 0.419560.41956 NM_016200NM_016200 LSM8LSM8 LSM8 homolog, U6 small nuclear RNA associated (S. cerevisiae)LSM8 homolog, U6 small nuclear RNA associated (S. cerevisiae) 0.484470.48447 NM_017437NM_017437 CPSF2CPSF2 Cleavage and polyadenylation specific factor 2, 100kDaCleavage and polyadenylation specific factor 2, 100 kDa 0.322740.32274 NM_018048NM_018048 FLJ10292FLJ10292 Mago-nashi homologMago-nashi homolog 0.46580.4658 NM_018237NM_018237 CCAR1CCAR1 Cell division cycle and apoptosis regulator 1Cell division cycle and apoptosis regulator 1 0.356340.35634 NM_031157NM_031157 HNRPA1HNRPA1 Heterogeneous nuclear ribonucleoprotein A1Heterogeneous nuclear ribonucleoprotein A1 0.479760.47976 NM_032390NM_032390 MKI67IPMKI67IP MKI67(FHA domain) interacting nucleolar phosphoproteinMKI67 (FHA domain) interacting nucleolar phosphoprotein 0.38590.3859 NM_033222NM_033222 PSIP1PSIP1 PC4 and SFRS1 interacting protein 1PC4 and SFRS1 interacting protein 1 0.355580.35558 NM_054016NM_054016 FUSIP1FUSIP1 FUS interacting protein(serine/arginine-rich) 1FUS interacting protein (serine / arginine-rich) 1 0.46030.4603 NM_145018NM_145018 FLJ25416FLJ25416 Hypothetical protein FLJ25416Hypothetical protein FLJ25416 0.482660.48266 NM_153333NM_153333 TCEAL8TCEAL8 Transcription elongation factor A(SII)-like 8Transcription elongation factor A (SII) -like 8 0.337580.33758 NM_203463NM_203463 LASS6LASS6 LAG1 longevity assurance homolog 6 (S. cerevisiae)LAG1 longevity assurance homolog 6 (S. cerevisiae) 0.414920.41492 NM_206866NM_206866 BACH1BACH1 BTB and CNC homology 1, basic leucine zipper transcription factor 1BTB and CNC homology 1, basic leucine zipper transcription factor 1 0.450490.45049 U38847U38847 TARBP1TARBP1 TAR(HIV) RNA binding protein 1TAR (HIV) RNA binding protein 1 0.491610.49161 XM_371470XM_371470 LOC388907LOC388907 Similar to ribosomal protein L5; 60S ribosomal protein L5Similar to ribosomal protein L5; 60S ribosomal protein L5 0.273420.27342 XM_372050XM_372050 LOC389674LOC389674 Heterogeneous nuclear ribonucleoprotein A1 pseudogene 4Heterogeneous nuclear ribonucleoprotein A1 pseudogene 4 0.401310.40131 XM_372396XM_372396 LOC390158LOC390158 Olfactory receptor, family 8, subfamily K, member 1Olfactory receptor, family 8, subfamily K, member 1 0.395980.39598 XM_496355XM_496355 LOC440577LOC440577 Similar to nucleophosmin 1; nucleolar phosphoprotein B23; numatrin; nucleophosmin/nucleoplasmin family, member 1Similar to nucleophosmin 1; nucleolar phosphoprotein B23; numatrin; nucleophosmin / nucleoplasmin family, member 1 0.287140.28714 XM_498328XM_498328 LOC392345LOC392345 Similar to PRED65Similar to PRED65 0.207010.20701 XM_499298XM_499298 FLJ46189FLJ46189 similar to Zinc finger protein 479(Zinc finger protein Kr19)(HKr19)similar to Zinc finger protein 479 (Zinc finger protein Kr19) (HKr19) 0.418980.41898 XM_499343XM_499343 PEG10PEG10 Paternally expressed 10Paternally expressed 10 0.412850.41285 (e) 뉴클레오티드 결합(Nucleotide binding)(e) Nucleotide binding AB013380AB013380 ABCB10ABCB10 ATP-binding cassette, sub-family B(MDR/TAP), member 10ATP-binding cassette, sub-family B (MDR / TAP), member 10 0.27960.2796 AB018342AB018342 MYO10MYO10 Myosin XMyosin x 0.214880.21488 AK025258AK025258 UMP-CMPKUMP-CMPK Cytidylate kinaseCytidylate kinase 0.481140.48114 AK098205AK098205 AK3L1AK3L1 Adenylate kinase 3Adenylate kinase 3 0.388330.38833 AK122685AK122685 GLUD1GLUD1 Glutamate dehydrogenase 1Glutamate dehydrogenase 1 0.358850.35885 AK122695AK122695 RRM1RRM1 Ribonucleotide reductase M1 polypeptideRibonucleotide reductase M1 polypeptide 0.346010.34601 AK126343AK126343 STK39STK39 Serine threonine kinase 39 (STE20/SPS1 homolog, yeast)Serine threonine kinase 39 (STE20 / SPS1 homolog, yeast) 0.487590.48759 BC051861BC051861 SPATA5L1SPATA5L1 Spermatogenesis associated 5-like 1Spermatogenesis associated 5-like 1 0.497160.49716 BC064610BC064610 SEPHS1SEPHS1 Selenophosphate synthetase 1Selenophosphate synthetase 1 0.434610.43461 BX640965BX640965 SLC22A3SLC22A3 Solute carrier family 22(extraneuronal monoamine transporter), member 3Solute carrier family 22 (extraneuronal monoamine transporter), member 3 0.172250.17225 D86550D86550 DYRK1ADYRK1A Dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 1ADual-specificity tyrosine- (Y) -phosphorylation regulated kinase 1A 0.384090.38409 NM_006343NM_006343 MERTKMERTK C-mer proto-oncogene tyrosine kinaseC-mer proto-oncogene tyrosine kinase 0.375290.37529 NM_012073NM_012073 CCT5CCT5 Chaperonin containing TCP1, subunit 5(epsilon)Chaperonin containing TCP1, subunit 5 (epsilon) 0.46260.4626 NM_020326NM_020326 ABCD4ABCD4 ATP-binding cassette, sub-family D(ALD), member 4ATP-binding cassette, sub-family D (ALD), member 4 0.463710.46371 NM_030752NM_030752 TCP1TCP1 T-complex 1T-complex 1 0.363560.36356 NM_030919NM_030919 C20orf129C20orf129 Chromosome 20 open reading frame 129Chromosome 20 open reading frame 129 0.278220.27822 NM_182964NM_182964 NAV2NAV2 Neuron navigator 2Neuron navigator 2 0.425240.42524 (f) 유기산 대사(Organic acid metabolism)(f) Organic acid metabolism AF020038AF020038 IDH1IDH1 Isocitrate dehydrogenase 1(NADP+), solubleIsocitrate dehydrogenase 1 (NADP +), soluble 0.39140.3914 AK093311AK093311 ACAA2ACAA2 Acetyl-Coenzyme A acyltransferase 2 (mitochondrial 3-oxoacyl-Coenzyme A thiolase)Acetyl-Coenzyme A acyltransferase 2 (mitochondrial 3-oxoacyl-Coenzyme A thiolase) 0.356630.35663 BC008366BC008366 DDCDDC Dopa decarboxylase(aromatic L-amino acid decarboxylase)Dopa decarboxylase (aromatic L-amino acid decarboxylase) 0.287330.28733 BC012616BC012616 BHMTBHMT Betaine-homocysteine methyltransferaseBetaine-homocysteine methyltransferase 0.363070.36307 BC015062BC015062 MTHFD2MTHFD2 Methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 2, methenyltetrahydrofolate cyclohydrolaseMethylenetetrahydrofolate dehydrogenase (NADP + dependent) 2, methenyltetrahydrofolate cyclohydrolase 0.460880.46088 BC033320BC033320 TAF9TAF9 TAF9 RNA polymerase II, TATA box binding protein(TBP)-associated factor, 32kDaTAF9 RNA polymerase II, TATA box binding protein (TBP) -associated factor, 32 kDa 0.394690.39469 BC033517BC033517 ACOX2ACOX2 Acyl-Coenzyme A oxidase 2, branched chainAcyl-Coenzyme A oxidase 2, branched chain 0.417120.41712 BC034481BC034481 BCKDHBBCKDHB Branched chain keto acid dehydrogenase E1, beta polypeptide(maple syrup urine disease)Branched chain keto acid dehydrogenase E1, beta polypeptide (maple syrup urine disease) 0.168330.16833 BC035654BC035654 NR1H4NR1H4 Nuclear receptor subfamily 1, group H, member 4Nuclear receptor subfamily 1, group H, member 4 0.448210.44821 BC042453BC042453 MCCC1MCCC1 Methylcrotonoyl-Coenzyme A carboxylase 1 (alpha)Methylcrotonoyl-Coenzyme A carboxylase 1 (alpha) 0.422710.42271 BC045541BC045541 LOC200895LOC200895 Dihydrofolate reductase-like 1Dihydrofolate reductase-like 1 0.317550.31755 CR609484CR609484 KYNUKYNU Kynureninase(L-kynurenine hydrolase)Kynureninase (L-kynurenine hydrolase) 0.493240.49324 CR749593CR749593 GLSGLS GlutaminaseGlutaminase 0.471790.47179 NM_000016NM_000016 ACADMACADM Acyl-Coenzyme A dehydrogenase, C-4 to C-12 straight chainAcyl-Coenzyme A dehydrogenase, C-4 to C-12 straight chain 0.403710.40371 NM_000277NM_000277 PAHPAH Phenylalanine hydroxylasePhenylalanine hydroxylase 0.215190.21519 NM_001801NM_001801 CDO1CDO1 Cysteine dioxygenase, type ICysteine dioxygenase, type I 0.359590.35959 NM_002860NM_002860 ALDH18A1ALDH18A1 Aldehyde dehydrogenase 18 family, member A1Aldehyde dehydrogenase 18 family, member A1 0.498580.49858 NM_004169NM_004169 SHMT1SHMT1 Serine hydroxymethyltransferase 1(soluble)Serine hydroxymethyltransferase 1 (soluble) 0.429050.42905 NM_004457NM_004457 ACSL3ACSL3 Acyl-CoA synthetase long-chain family member 3Acyl-CoA synthetase long-chain family member 3 0.180360.18036 NM_005589NM_005589 ALDH6A1ALDH6A1 Aldehyde dehydrogenase 6 family, member A1Aldehyde dehydrogenase 6 family, member A1 0.471260.47126 NM_013261NM_013261 PPARGC1APPARGC1A Peroxisome proliferative activated receptor, gamma, coactivator 1, alphaPeroxisome proliferative activated receptor, gamma, coactivator 1, alpha 0.403140.40314 NM_018122NM_018122 FLJ10514FLJ10514 Aspartyl-tRNA synthetase 2(mitochondrial)Aspartyl-tRNA synthetase 2 (mitochondrial) 0.469970.46997 NM_080820NM_080820 HARS2HARS2 Histidyl-tRNA synthetase 2Histidyl-tRNA synthetase 2 0.448510.44851 U73338U73338 MTRMTR 5-methyltetrahydrofolate-homocysteine methyltransferase5-methyltetrahydrofolate-homocysteine methyltransferase 0.394350.39435 (g) 단백질 전달(Protein transport)(g) Protein transport AK001676AK001676 NUP133NUP133 Nucleoporin 133kDaNucleoporin 133kDa 0.456330.45633 AK002165AK002165 DKFZP564O123DKFZP564O123 Chromatin modifying protein 2BChromatin modifying protein 2B 0.488630.48863 AK023143AK023143 C10orf119C10orf119 Chromosome 10 open reading frame 119Chromosome 10 open reading frame 119 0.368330.36833 AK094603AK094603 cDNA FLJ37284 fiscDNA FLJ37284 fis unnamed protein product; Homo sapiens cDNA FLJ37284 fis, clone BRAMY2013590.unnamed protein product; Homo sapiens cDNA FLJ37284 fis, clone BRAMY2013590. 0.300090.30009 AK124768AK124768 TNPO1TNPO1 Transportin 1Transportin 1 0.417330.41733 BC000100BC000100 SNX5SNX5 Sorting nexin 5Sorting nexin 5 0.412910.41291 BC039468BC039468 NUP50NUP50 Nucleoporin 50kDaNucleoporin 50kDa 0.451220.45122 BC064351BC064351 SRP9SRP9 Signal recognition particle 9kDaSignal recognition particle 9kDa 0.363590.36359 BX091259BX091259 UNQ9438UNQ9438 TIMM9TIMM9 0.404790.40479 BX641063BX641063 DEKDEK DEK oncogene(DNA binding)DEK oncogene (DNA binding) 0.383830.38383 BX648363BX648363 SNX10SNX10 Sorting nexin 10Sorting nexin 10 0.340630.34063 CR618609CR618609 NOP5/NOP58NOP5 / NOP58 Nucleolar protein NOP5/NOP58Nucleolar protein NOP5 / NOP58 0.465730.46573 NM_002156NM_002156 HSPD1HSPD1 Heat shock 60kDa protein 1(chaperonin)Heat shock 60kDa protein 1 (chaperonin) 0.480550.48055 NM_006380NM_006380 APPBP2APPBP2 Amyloid beta precursor protein(cytoplasmic tail) binding protein 2Amyloid beta precursor protein (cytoplasmic tail) binding protein 2 0.44940.4494 NM_007214NM_007214 SEC63SEC63 SEC63-like(S. cerevisiae)SEC63-like (S. cerevisiae) 0.459930.45993 NM_012460NM_012460 TIMM9TIMM9 Translocase of inner mitochondrial membrane 9 homolog(yeast)Translocase of inner mitochondrial membrane 9 homolog (yeast) 0.454490.45449 NM_014765NM_014765 TOMM20TOMM20 Translocase of outer mitochondrial membrane 20 homolog(yeast)Translocase of outer mitochondrial membrane 20 homolog (yeast) 0.431370.43137 NM_020401NM_020401 NUP107NUP107 Nucleoporin 107kDaNucleoporin 107kDa 0.442060.44206 NM_021807NM_021807 SEC8L1SEC8L1 Exocyst complex component 4Exocyst complex component 4 0.29950.2995 NM_031296NM_031296 RAB33BRAB33B RAB33B, member RAS oncogene familyRAB33B, member RAS oncogene family 0.476660.47666 NM_145261NM_145261 TIM14TIM14 DnaJ(Hsp40) homolog, subfamily C, member 19DnaJ (Hsp40) homolog, subfamily C, member 19 0.376230.37623 NM_173827NM_173827 FLJ38991FLJ38991 Mitochondrial COX18Mitochondrial COX18 0.42020.4202 (h) 세포증식(Cell proliferation)(h) Cell proliferation AL162068AL162068 NAP1L1NAP1L1 Nucleosome assembly protein 1-like 1Nucleosome assembly protein 1-like 1 0.384120.38412 AL834186AL834186 CDCA7CDCA7 Cell division cycle associated 7Cell division cycle associated 7 0.297490.29749 BC065520BC065520 TCFL5TCFL5 Transcription factor-like 5(basic helix-loop-helix)Transcription factor-like 5 (basic helix-loop-helix) 0.463820.46382 CR620626CR620626 FGGFGG Fibrinogen gamma chainFibrinogen gamma chain 0.471560.47156 M58569M58569 FGAFGA fibrinogen, A alpha polypeptide(FGA), transcript variant alpha-E, mRNA[NM_000508]fibrinogen, A alpha polypeptide (FGA), transcript variant alpha-E, mRNA [NM_000508] 0.178610.17861 NM_002291NM_002291 LAMB1LAMB1 Laminin, beta 1Laminin, beta 1 0.443920.44392 NM_005141NM_005141 FGBFGB Fibrinogen beta chainFibrinogen beta chain 0.468280.46828 NM_005746NM_005746 PBEF1PBEF1 Pre-B-cell colony enhancing factor 1Pre-B-cell colony enhancing factor 1 0.4550.455 (i) DNA 손상 자극에 대한 반응(Response to DNA damage stimulus)(i) Response to DNA damage stimulus AK002156AK002156 WDR33WDR33 WD repeat domain 33WD repeat domain 33 0.439470.43947 AK074377AK074377 UHRF1UHRF1 Chromosome 19 open reading frame 31Chromosome 19 open reading frame 31 0.128540.12854 AK122825AK122825 HMGB1HMGB1 High-mobility group box 1High-mobility group box 1 0.41480.4148 BC032617BC032617 POLIPOLI Polymerase(DNA directed) iotaPolymerase (DNA directed) iota 0.452430.45243 CR600021CR600021 HMGB2HMGB2 High-mobility group box 2High-mobility group box 2 0.136760.13676 NM_001067NM_001067 TOP2ATOP2A Topoisomerase(DNA) II alpha 170kDaTopoisomerase (DNA) II alpha 170kDa 0.215390.21539 NM_002916NM_002916 RFC4RFC4 Replication factor C(activator 1) 4, 37kDaReplication factor C (activator 1) 4, 37 kDa 0.358570.35857 NM_003368NM_003368 USP1USP1 Ubiquitin specific peptidase 1Ubiquitin specific peptidase 1 0.195370.19537 NM_006904NM_006904 PRKDCPRKDC Protein kinase, DNA-activated, catalytic polypeptideProtein kinase, DNA-activated, catalytic polypeptide 0.477320.47732 NM_138271NM_138271 ATRXATRX Alpha thalassemia/mental retardation syndrome X-linked(RAD54 homolog, S. cerevisiae)Alpha thalassemia / mental retardation syndrome X-linked (RAD54 homolog, S. cerevisiae) 0.357650.35765 (j) 지질대사(Lipid metabolism)(j) Lipid metabolism AF285167AF285167 ABCA1ABCA1 ATP-binding cassette, sub-family A(ABC1), member 1ATP-binding cassette, sub-family A (ABC1), member 1 0.313440.31344 AK124635AK124635 PCSK9PCSK9 Proprotein convertase subtilisin/kexin type 9Proprotein convertase subtilisin / kexin type 9 0.242010.24201 NM_000236NM_000236 LIPCLIPC Lipase, hepaticLipase, hepatic 0.41370.4137 AF062341AF062341 CTNND1CTNND1 Catenin(cadherin-associated protein), delta 1Catenin (cadherin-associated protein), delta 1 0.370720.37072 AF480883AF480883 PPAP2BPPAP2B Phosphatidic acid phosphatase type 2BPhosphatidic acid phosphatase type 2B 0.463240.46324 BC035638BC035638 LSSLSS Lanosterol synthase (2,3-oxidosqualene-lanosterol cyclase)Lanosterol synthase (2,3-oxidosqualene-lanosterol cyclase) 0.374380.37438 BX648473BX648473 PIGKPIGK Phosphatidylinositol glycan, class KPhosphatidylinositol glycan, class K 0.486930.48693 NM_001444NM_001444 FABP5FABP5 Fatty acid binding protein 5 (psoriasis-associated)Fatty acid binding protein 5 (psoriasis-associated) 0.46840.4684 NM_003129NM_003129 SQLESQLE Squalene epoxidaseSqualene epoxidase 0.445590.44559 NM_003580NM_003580 NSMAFNSMAF Neutral sphingomyelinase (N-SMase) activation associated factorNeutral sphingomyelinase (N-SMase) activation associated factor 0.48040.4804 NM_018361NM_018361 AGPAT5AGPAT5 1-acylglycerol-3-phosphate O-acyltransferase 5(lysophosphatidic acid acyltransferase, epsilon)1-acylglycerol-3-phosphate O-acyltransferase 5 (lysophosphatidic acid acyltransferase, epsilon) 0.491210.49121 NM_020918NM_020918 GPAMGPAM Glycerol-3-phosphate acyltransferase, mitochondrialGlycerol-3-phosphate acyltransferase, mitochondrial 0.451350.45135 (k) 보체 및 응고 캐그케이드(Complement and coagulation cascades)(k) Complement and coagulation cascades AB209031AB209031 C5C5 Complement component 5Complement component 5 0.499070.49907 AF130100AF130100 SERPINC1SERPINC1 Serpin peptidase inhibitor, clade C (antithrombin), member 1Serpin peptidase inhibitor, clade C (antithrombin), member 1 0.408840.40884 AK122686AK122686 IFIF I factor(complement)I factor (complement) 0.474130.47413 BC022312BC022312 C4BPAC4BPA Complement component 4 binding protein, alphaComplement component 4 binding protein, alpha 0.229480.22948 M75106M75106 CPB2CPB2 Carboxypeptidase B2(plasma, carboxypeptidase U)Carboxypeptidase B2 (plasma, carboxypeptidase U) 0.351020.35102 NM_000893NM_000893 KNG1KNG1 Kininogen 1Kininogen 1 0.361950.36195 (l) 외부 자극에 대한 반응(Response to external stimulus)(l) Response to external stimulus AK055619AK055619 GNAQGNAQ Guanine nucleotide binding protein(G protein), q polypeptideGuanine nucleotide binding protein (G protein), q polypeptide 0.457480.45748 AL832747AL832747 GNAQGNAQ Guanine nucleotide binding protein(G protein), q polypeptideGuanine nucleotide binding protein (G protein), q polypeptide 0.489380.48938 CR596712CR596712 IL17DIL17D Interleukin 17DInterleukin 17D 0.493520.49352 (m) 세포골격 단백질 결합(Cytoskeletal protein binding)(m) Cytoskeletal protein binding AK000972AK000972 C9orf40C9orf40 Chromosome 9 open reading frame 40Chromosome 9 open reading frame 40 0.389330.38933 AK023675AK023675 UTRNUTRN Utrophin(homologous to dystrophin)Utrophin (homologous to dystrophin) 0.379530.37953 AK026095AK026095 SNTB1SNTB1 Syntrophin, beta 1(dystrophin-associated protein A1, 59kDa, basic component 1)Syntrophin, beta 1 (dystrophin-associated protein A1, 59kDa, basic component 1) 0.475580.47558 AL117472AL117472 SORBS1SORBS1 Sorbin and SH3 domain containing 1Sorbin and SH3 domain containing 1 0.459760.45976 NM_018728NM_018728 MYO5CMYO5C Myosin VCMyosin VC 0.314170.31417 XM_371116XM_371116 MYO5BMYO5B Myosin VBMyosin VB 0.469880.46988 (n) 알코올 대사(Alcohol metabolism)(n) Alcohol metabolism BC026320BC026320 OGDHLOGDHL Oxoglutarate dehydrogenase-likeOxoglutarate dehydrogenase-like 0.41850.4185 BC033391BC033391 PP1665PP1665 Glycerophosphodiester phosphodiesterase domain containing 5Glycerophosphodiester phosphodiesterase domain containing 5 0.390650.39065 BC042421BC042421 GKGK Glycerol kinaseGlycerol kinase 0.482110.48211 M15943M15943 ADH4ADH4 Alcohol dehydrogenase 4(class II), pi polypeptideAlcohol dehydrogenase 4 (class II), pi polypeptide 0.303160.30316 NM_000671NM_000671 ADH5ADH5 Alcohol dehydrogenase 5(class III), chi polypeptideAlcohol dehydrogenase 5 (class III), chi polypeptide 0.386330.38633 NM_002610NM_002610 PDK1PDK1 Pyruvate dehydrogenase kinase, isozyme 1Pyruvate dehydrogenase kinase, isozyme 1 0.379710.37971 (o) 세포자살(Apoptosis)(o) Apoptosis AK026927AK026927 MGC5297MGC5297 Hypothetical protein MGC5297Hypothetical protein MGC5297 0.48030.4803 AK127326AK127326 PHF17PHF17 PHD finger protein 17PHD finger protein 17 0.347120.34712 BC039110BC039110 SMNDC1SMNDC1 Survival motor neuron domain containing 1Survival motor neuron domain containing 1 0.44660.4466 BC041849BC041849 ROCK1ROCK1 Rho-associated, coiled-coil containing protein kinase 1Rho-associated, coiled-coil containing protein kinase 1 0.342070.34207 BX537500BX537500 PDCD4PDCD4 Programmed cell death 4(neoplastic transformation inhibitor)Programmed cell death 4 (neoplastic transformation inhibitor) 0.433920.43392 CR596268CR596268 ITGB3BPITGB3BP Integrin beta 3 binding protein(beta3-endonexin)Integrin beta 3 binding protein (beta3-endonexin) 0.313790.31379 NM_004938NM_004938 DAPK1DAPK1 Death-associated protein kinase 1Death-associated protein kinase 1 0.423020.42302 NM_012238NM_012238 SIRT1SIRT1 Sirtuin(silent mating type information regulation 2 homolog) 1(S. cerevisiae)Sirtuin (silent mating type information regulation 2 homolog) 1 (S. cerevisiae) 0.436580.43658 NM_130837NM_130837 OPA1OPA1 Optic atrophy 1(autosomal dominant)Optic atrophy 1 (autosomal dominant) 0.482270.48227 NM_148957NM_148957 TNFRSF19TNFRSF19 Tumor necrosis factor receptor superfamily, member 19Tumor necrosis factor receptor superfamily, member 19 0.480940.48094 (p) MAPKKK 캐스케이드(cascade)(p) MAPKKK cascade AB208919AB208919 FGFR1FGFR1 Fibroblast growth factor receptor 1(fms-related tyrosine kinase 2, Pfeiffer syndrome)Fibroblast growth factor receptor 1 (fms-related tyrosine kinase 2, Pfeiffer syndrome) 0.439280.43928 AB209601AB209601 TIZTIZ Zinc finger protein 675Zinc finger protein 675 0.371440.37144 AK125150AK125150 MAPK8MAPK8 Mitogen-activated protein kinase 8Mitogen-activated protein kinase 8 0.402370.40237 (q) 면역반응(Immune response)(q) Immune response BC027881BC027881 AFPAFP Alpha-fetoproteinAlpha-fetoprotein 0.349950.34995 NM_020995NM_020995 HPRHPR Haptoglobin-related proteinHaptoglobin-related protein 0.302120.30212 (r) 형태형성(Morphogenesis)(r) Morphogenesis AF167706AF167706 CRIM1CRIM1 Cysteine rich transmembrane BMP regulator 1 (chordin-like)Cysteine rich transmembrane BMP regulator 1 (chordin-like) 0.189470.18947 BC045655BC045655 MAC30MAC30 Hypothetical protein MAC30Hypothetical protein MAC30 0.411530.41153 BX537509BX537509 NET1NET1 Neuroepithelial cell transforming gene 1Neuroepithelial cell transforming gene 1 0.497110.49711 BX640958BX640958 YEATS4YEATS4 YEATS domain containing 4YEATS domain containing 4 0.403870.40387 BX647757BX647757 SCMLSCML sex comb on midleg-like 1 (Drosophila)sex comb on midleg-like 1 (Drosophila) 0.432730.43273 NM_006548NM_006548 IMP-2IMP-2 IGF-II mRNA-binding protein 2IGF-II mRNA-binding protein 2 0.474290.47429 (s) GTPase 조절 활성(regulator activity)(s) GTPase regulator activity AY376439AY376439 ECT2ECT2 Epithelial cell transforming sequence 2 oncogeneEpithelial cell transforming sequence 2 oncogene 0.33740.3374 AY596970AY596970 GARNL1GARNL1 GTPase activating Rap/RanGAP domain-like 1GTPase activating Rap / RanGAP domain-like 1 0.480220.48022 BC050630BC050630 RAB3-GAP150RAB3-GAP150 RAB3 GTPase activating protein subunit 2 (non-catalytic)RAB3 GTPase activating protein subunit 2 (non-catalytic) 0.373130.37313 NM_001001132NM_001001132 ITSN1ITSN1 Intersectin 1(SH3 domain protein)Intersectin 1 (SH3 domain protein) 0.451150.45115 NM_016340NM_016340 KIAA1961KIAA1961 KIAA1961 geneKIAA1961 gene 0.430390.43039 NM_145290NM_145290 GPR125GPR125 G protein-coupled receptor 125G protein-coupled receptor 125 0.438940.43894 (t) 기타(The others)(t) The others NM_003574NM_003574 VAPAVAPA VAMP(vesicle-associated membrane protein)-associated protein A, 33kDaVAMP (vesicle-associated membrane protein) -associated protein A, 33kDa 0.376310.37631 M28016M28016 cytochrome bcytochrome b Human mitochondrial cytochrome b gene, partial cds.Human mitochondrial cytochrome b gene, partial cds. 0.406990.40699 NM_013277NM_013277 RACGAP1RACGAP1 Rac GTPase activating protein 1Rac GTPase activating protein 1 0.197670.19767 AB096248AB096248 SNF1LK2SNF1LK2 SNF1-like kinase 2SNF1-like kinase 2 0.418510.41851 NM_001698NM_001698 AUHAUH AU RNA binding protein/enoyl-Coenzyme A hydrataseAU RNA binding protein / enoyl-Coenzyme A hydratase 0.48930.4893 AB091343AB091343 C10orf3C10orf3 Centrosomal protein 55kDaCentrosomal protein 55kDa 0.182220.18222

<< 실시예Example 3> 실시간  3> Real time RTRT -PCR(-PCR ( RealReal -- timetime reversereverse transcriptasetranscriptase polymerasepolymerase chainchain reaction) 정량 reaction)

다이벤조에이에이취안트라센에 의해 발현 유도된 상기 실시예 2의 2배 이상 과발현 및 저발현된 유전자 중 다이벤조에이에이취안트라센에 의해 과발현되는 유전자 30종과 저발현 되는 유전자 18종을 선별하였다. 이들 유전자들은 유전자 등록번호(Genebank) BM913048(TIMP metallopeptidase inhibitor 1), 유전자 등록번호(Genebank) NM_004864(Growth differentiation factor 15), 유전자 등록번호(Genebank) AK095363(Aquaporin 3), 유전자 등록번호(Genebank) NM_003516(Histone 2, H2aa), 유전자 등록번호(Genebank) NM_001013632(Similar to hypothetical protein 4833401D15), 유전자 등록번호(Genebank) Y11307(Cysteine-rich, angiogenic inducer, 61), 유전자 등록번호(Genebank) NM_001769(CD9 antigen(p24)), 유전자 등록번호(Genebank) AY368150(Family with sequence similarity 62(C2 domain containing) member B), 유전자 등록번호(Genebank) NM_000499(Cytochrome P450, family 1, subfamily A, polypeptide 1), 유전자 등록번호(Genebank) BC035124(MSFL2541), 유전자 등록번호(Genebank) AK097009(phospholipid transfer protein), 유전자 등록번호(Genebank) NM_000596(Insulin-like growth factor binding protein 1), 유전자 등록번호(Genebank) NM_006426(Dihydropyrimidinase-like 4), 유전자 등록번호(Genebank) NM_021603(FXYD domain containing ion transport regulator 2), 유전자 등록번호(Genebank) AB033073(Sulfatase 2), 유전자 등록번호(Genebank) NM_004881(Tumor protein p53 inducible protein 3), 유전자 등록번호(Genebank) NM_001553(Insulin-like growth factor binding protein 7), 유전자 등록번호(Genebank) NM_032872(Synaptotagmin-like 1), 유전자 등록번호(Genebank) BU945318(Hypothetical gene supported by X97260; BC070289(metallothionein 2A )), 유전자 등록번호(Genebank) X02812(Transforming growth factor, beta 1(Camurati-Engelmann disease)), 유전자 등록번호(Genebank) NM_003897(Immediate early response 3), 유전자 등록번호(Genebank) NM_145256(Leucine rich repeat containing 25), 유전자 등록번호(Genebank) BU587578(Regulator of G-protein signalling 10), 유전자 등록번호(Genebank) NM_133493(CD109 antigen(Gov platelet alloantigens)), 유전자 등록번호(Genebank) NM_005319(Histone 1, H1c), 유전자 등록번호(Genebank) BG036385(Receptor(calcitonin) activity modifying protein 1), 유전자 등록번호(Genebank) NM_012396(Pleckstrin homology-like domain, family A, member 3), 유전자 등록번호(Genebank) AB208949(Leucine-rich repeats and death domain containing), 유전자 등록번호(Genebank) BU603483(Histone 1, H1e), 유전자 등록번호(Genebank) Y12692(Wingless-type MMTV integration site family, member 11), 유전자 등록번호(Genebank) BC022255(Spindle pole body component 25 homolog(S. cerevisiae)), 유전자 등록번호(Genebank) AB013380(ATP-binding cassette, sub-family B(MDR/TAP), member 10), 유전자 등록번호(Genebank) AB046861(KIAA1641), 유전자 등록번호(Genebank) BX640965(Solute carrier family 22(extraneuronal monoamine transporter), member 3), 유전자 등록번호(Genebank) XM_291202(Zinc finger protein 479), 유전자 등록번호(Genebank) NM_018492(PDZ binding kinase), 유전자 등록번호(Genebank) NM_145697(Cell division cycle associated 1), 유전자 등록번호(Genebank) NM_017768(Leucine rich repeat containing 40), 유전자 등록번호(Genebank) BX640888(Glypican 6), 유전자 등록번호(Genebank) U65410(MAD2 mitotic arrest deficient-like 1(yeast)), 유전자 등록번호(Genebank) CR600021(High-mobility group box 2), 유전자 등록번호(Genebank) AK074377(Chromosome 19 open reading frame 31), 유전자 등록번호(Genebank) NM_180991(Solute carrier organic anion transporter family, member 4C1), 유전자 등록번호(Genebank) NM_006101(Kinetochore associated 2), 유전자 등록번호(Genebank) AB091343(Centrosomal protein 55kDa), 유전자 등록번호(Genebank) NM_001067(Topoisomerase(DNA) II alpha 170kDa), 유전자 등록번호(Genebank) NM_003318(TTK protein kinase), 유전자 등록번호(Genebank) NM_032117(GAJ protein)이다.Among the genes overexpressed and underexpressed more than two times as in Example 2, the expression of which was induced by dibenzoAchianthracene, 30 genes overexpressed by dibenzoAHT anthracene and 18 genes that were low expressed were selected. These genes include Genebank BM913048 (TIMP metallopeptidase inhibitor 1), Genebank NM_004864 (Growth differentiation factor 15), Genebank AK095363 (Aquaporin 3), Genebank NM_003516 (Histone 2, H2aa), Genebank NM_001013632 (Similar to hypothetical protein 4833401D15), Genebank Y11307 (Cysteine-rich, angiogenic inducer, 61), Genebank NM_001769 (CD9 antigen (p24)), Genebank AY368150 (Family with sequence similarity 62 (C2 domain containing) member B), Gene accession number (Genebank) NM_000499 (Cytochrome P450, family 1, subfamily A, polypeptide 1), Gene registration Number (Genebank) BC035124 (MSFL2541), Gene Registration Number (Genebank) AK097009 (phospholipid transfer protein), Gene Registration Number (Genebank) NM_000596 (Insulin-like growth factor binding protein 1), Gene Registration Number (Genebank) NM_006426 (Di hydropyrimidinase-like 4), genebank NM_021603 (FXYD domain containing ion transport regulator 2), genebank AB033073 (Sulfatase 2), genebank NM_004881 (Tumor protein p53 inducible protein 3) Gene entry number (Genebank) NM_001553 (Insulin-like growth factor binding protein 7), gene registration number (Genebank) NM_032872 (Synaptotagmin-like 1), gene registration number (Genebank) BU945318 (Hypothetical gene supported by X97260; BC070289 (metallothionein 2A)), Genebank X02812 (Transforming growth factor, beta 1 (Camurati-Engelmann disease)), Genebank NM_003897 (Immediate early response 3), Genebank NM_145256 (Leucine rich repeat containing 25), Genebank (Genebank) BU587578 (Regulator of G-protein signaling 10), Gene Registration Number (Genebank) NM_133493 (CD109 antigen (Gov platelet alloantigens)), Gene Registration Number (Genebank) NM_005319 ( Histone 1, H1c), Genebank BG036385 (Receptor (calcitonin) activity modifying protein 1), Genebank (Genebank) NM_012396 (Pleckstrin homology-like domain, family A, member 3), Genebank (Genebank) ) AB208949 (Leucine-rich repeats and death domain containing), Genebank BU603483 (Histone 1, H1e), Genebank (Genebank) Y12692 (Wingless-type MMTV integration site family, member 11), Gene accession number (Genebank) BC022255 (Spin dle pole body component 25 homolog (S. cerevisiae)), gene registration number (Genebank) AB013380 (ATP-binding cassette, sub-family B (MDR / TAP), member 10), gene registration number (Genebank) AB046861 (KIAA1641) , Genebank BX640965 (Solute carrier family 22 (extraneuronal monoamine transporter), member 3), Genebank (Genebank) XM_291202 (Zinc finger protein 479), Genebank (Genebank) NM_018492 (PDZ binding kinase), Genebank (Genebank) NM_145697 (Cell division cycle associated 1), Genebank (Genebank) NM_017768 (Leucine rich repeat containing 40), Genebank (Genebank) BX640888 (Glypican 6), Genebank (Genebank) U65410 ( MAD2 mitotic arrest deficient-like 1 (yeast), Genebank (Genebank) CR600021 (High-mobility group box 2), Genebank (Genebank) AK074377 (Chromosome 19 open reading frame 31), Genebank (Genebank) NM_180991 (Solute carrier organic anion transporter family, member 4C1), Genebank NM_006101 (Kinetochore associated 2), Genebank AB091343 (Centrosomal protein 55kDa), Genebank NM_001067 (Topoisomerase (DNA) II alpha 170kDa), Gene Registry Number (Genebank) Genebank) NM_003318 (TTK protein kinase), Gene Accession Number (Genebank) NM_032117 (GAJ protein).

상기 유전자들의 발현변화 정도를 조사 및 정량하기 위해 My IQ 실시간 PCR(My IQ Real-time PCR)(Bio-rad, USA)을 이용하여 정량적인 실시간 RT-PCR을 실시하였다.Quantitative real-time RT-PCR was performed using My IQ Real-time PCR (Bio-rad, USA) to investigate and quantify the expression changes of the genes.

구체적으로, 올리고 dT 프라이머와 Superscript kit(Omniscipt™ kit, Qiagen, Co., USA)를 이용하여 역전사반응을 수행하여 cDNA를 합성하였다. PCR 산물을 정량하기 위하여 사이버그린(SYBR Green) I 염색(Bio-rad, USA)으로 염색하였다. 사이버그린 I 염색은 이중나선 DNA에 결합하는 염색법으로서, PCR 과정 동안 이중나선 DNA가 생성될수록 형광강도(fluroscense intensity)가 증가하게 된다. 먼저 PCR에 이용한 표적 유전자와 내재성(endogenous) 대조군(GAPDH)에 대한 프라이머를 사이버그린 마스터 믹스(Master mix)에 첨가하여 PCR을 실시한 후, 적절한 농도를 선택하는 프라이머 적합화(primer optimization) 과정을 수행하였다. 합성된 cDNA 시료와 각각의 프라이머(표 4)를 혼합하고, 사이버그린 마스터 믹스를 첨가한 후 PCR를 수행하였고, 정량 소프트웨어(software)를 사용하여 분석하였다(표 5 참조).Specifically, cDNA was synthesized by performing reverse transcription using an oligo dT primer and a Superscript kit (Omniscipt ™ kit, Qiagen, Co., USA). To quantify the PCR products were stained with SYBR Green I stain (Bio-rad, USA). Cyberrin I staining is a staining method that binds to double-stranded DNA. As the double-stranded DNA is generated during PCR, the fluorescence intensity increases. First, primers for the target gene and endogenous control (GAPDH) used for PCR were added to the Cyberrin master mix, followed by PCR, followed by a primer optimization process to select an appropriate concentration. Was performed. Synthesized cDNA samples and respective primers (Table 4) were mixed, PCR was performed after the addition of the Cyberrin master mix and analyzed using quantification software (see Table 5).

프라이머primer 서열 order 등록번호Registration Number 유전자명Gene name PCRPCR 프라이머primer 서열 order BM913048BM913048 Homo sapiens TIMP metallopeptidase inhibitor 1(TIMP1), mRNA.Homo sapiens TIMP metallopeptidase inhibitor 1 (TIMP1), mRNA. 센스 (서열번호1)Sense (SEQ ID NO: 1) GATACTTCCACAGGTCCCACAACGATACTTCCACAGGTCCCACAAC 안티센스 (서열번호2)Antisense (SEQ ID NO: 2) GCAAGAGTCCATCCTGCAGTTGCAAGAGTCCATCCTGCAGTT NM_004864 NM_004864 Growth differentiation factor 15 Growth differentiation factor 15 센스 (서열번호3)Sense (SEQ ID NO: 3) CCTGAGACACCCGATTCCTCCTGAGACACCCGATTCCT 안티센스 (서열번호4)Antisense (SEQ ID NO: 4) ACAGTTCCATCAGACCAGCCACAGTTCCATCAGACCAGCC AK095363 AK095363 Aquaporin 3(Gill blood group) Aquaporin 3 (Gill blood group) 센스 (서열번호5)Sense (SEQ ID NO: 5) TTCACGATCCACCCTTTCAGGCTA TTCACGATCCACCCTTTCAGGCTA 안티센스 (서열번호6)Antisense (SEQ ID NO: 6) ACACATACCTGCTGCCCATTCTCT ACACATACCTGCTGCCCATTCTCT NM_003516 NM_003516 Histone 2, H2aa Histone 2, H2aa 센스 (서열번호7)Sense (SEQ ID NO: 7) GAACTGAACAAGCTGCTGGGCAAA GAACTGAACAAGCTGCTGGGCAAA 안티센스 (서열번호8)Antisense (SEQ ID NO: 8) TCTCCGTCTTCTTAGGGAGCAGTA TCTCCGTCTTCTTAGGGAGCAGTA NM_001013632 NM_001013632 Similar to hypothetical protein 4833401D15 Similar to hypothetical protein 4833401D15 센스 (서열번호9)Sense (SEQ ID NO: 9) GACTACTCCAATAAGTTCGGCTTTGGACTACTCCAATAAGTTCGGCTTTG 안티센스 (서열번호10)Antisense (SEQ ID NO: 10) CATATGTGTGCCATCGTTGAAGACATATGTGTGCCATCGTTGAAGA Y11307 Y11307 Cysteine-rich, angiogenic inducer, 61 Cysteine-rich, angiogenic inducer, 61 센스 (서열번호11)Sense (SEQ ID NO: 11) ATTGTAGAAAGGAAGCCTTGCTCATATTGTAGAAAGGAAGCCTTGCTCAT 안티센스 (서열번호12)Antisense (SEQ ID NO: 12) TCCAATCGTGGCTGCATTAGTCCAATCGTGGCTGCATTAG NM_001769 NM_001769 CD9 molecule CD9 molecule 센스 (서열번호13)Sense (SEQ ID NO: 13) GCACCAAGTGCATCAAATACCTGCGCACCAAGTGCATCAAATACCTGC 안티센스 (서열번호14)Antisense (SEQ ID NO: 14) AGCCATAGTCCAATGGCAAGGACA AGCCATAGTCCAATGGCAAGGACA AY368150 AY368150 Family with sequence similarity 62(C2 domain containing) member B Family with sequence similarity 62 (C2 domain containing) member B 센스 (서열번호15)Sense (SEQ ID NO: 15) GGAAAACACACGTGTCAAAGAAGGAAAACACACGTGTCAAAGAA 안티센스 (서열번호16)Antisense (SEQ ID NO: 16) TTCTTCACGGCAACGTCATTCTTCACGGCAACGTCA NM_000499 NM_000499 Homo sapiens cytochrome P450, family 1, subfamily A, polypeptide 1(CYP1A1), mRNA. Homo sapiens cytochrome P450, family 1, subfamily A, polypeptide 1 (CYP1A1), mRNA. 센스 (서열번호17)Sense (SEQ ID NO: 17) CACCATCCCCCACAGCACCACCATCCCCCACAGCAC 안티센스 (서열번호18)Antisense (SEQ ID NO: 18) ACAAAGACACAACGCCCCTTACAAAGACACAACGCCCCTT BC035124 BC035124 MSFL2541 MSFL2541 센스 (서열번호19)Sense (SEQ ID NO: 19) TTCGCCGTCCTTTACATCTACTTCGCCGTCCTTTACATCTAC 안티센스 (서열번호20)Antisense (SEQ ID NO: 20) AGAGCCTGGGGACTCACATAGAGCCTGGGGACTCACAT AK097009 AK097009 Phospholipid transfer protein Phospholipid transfer protein 센스 (서열번호21)Sense (SEQ ID NO: 21) TGCCACAGAGAAGACGGGATTTGATGCCACAGAGAAGACGGGATTTGA 안티센스 (서열번호22)Antisense (SEQ ID NO: 22) AGGTGGTGGACGGACTGTAATTGAAGGTGGTGGACGGACTGTAATTGA NM_000596 NM_000596 Homo sapiens insulin-like growth factor binding protein 1(IGFBP1), transcript variant 1, mRNA. Homo sapiens insulin-like growth factor binding protein 1 (IGFBP1), transcript variant 1, mRNA. 센스 (서열번호23)Sense (SEQ ID NO: 23) ATCATTCCATCCTTTGGGACGCCAATCATTCCATCCTTTGGGACGCCA 안티센스 (서열번호24)Antisense (SEQ ID NO: 24) TGTCTCCTGTGCCTTGGCTAAACTTGTCTCCTGTGCCTTGGCTAAACT NM_006426 NM_006426 Homo sapiens dihydropyrimidinase-like 4(DPYSL4), mRNA. Homo sapiens dihydropyrimidinase-like 4 (DPYSL4), mRNA. 센스 (서열번호25)Sense (SEQ ID NO: 25) TGGGAAGATGGACGAGAATGAGTTCGTGGGAAGATGGACGAGAATGAGTTCG 안티센스 (서열번호26)Antisense (SEQ ID NO: 26) ACTCCACTCCCTCGAAGATGTTGT ACTCCACTCCCTCGAAGATGTTGT NM_021603 NM_021603 FXYD domain containing ion transport regulator 2 FXYD domain containing ion transport regulator 2 센스 (서열번호27)Sense (SEQ ID NO: 27) GGCAATAAGAAGCGCAGGCAAATC GGCAATAAGAAGCGCAGGCAAATC 안티센스 (서열번호28)Antisense (SEQ ID NO: 28) AAGGTCTAAAGCCCAGGGAAGAAG AAGGTCTAAAGCCCAGGGAAGAAG AB033073 AB033073 Homo sapiens sulfatase 2(SULF2), transcript variant 1, mRNA. Homo sapiens sulfatase 2 (SULF2), transcript variant 1, mRNA. 센스 (서열번호29)Sense (SEQ ID NO: 29) TGCGGATATGGACGGGAAATCCAT TGCGGATATGGACGGGAAATCCAT 안티센스 (서열번호30)Antisense (SEQ ID NO: 30) TCTCTTGTGTAGCAGCTTGCCTCTTCTCTTGTGTAGCAGCTTGCCTCT NM_004881 NM_004881 Tumor protein p53 inducible protein 3 Tumor protein p53 inducible protein 3 센스 (서열번호31)Sense (SEQ ID NO: 31) AGGGTGAAGTCCTCCTGAAGGTAGGGTGAAGTCCTCCTGAAGGT 안티센스 (서열번호32)Antisense (SEQ ID NO: 32) GTGGGTCATACTGGCCTTGTCTGTGGGTCATACTGGCCTTGTCT NM_001553 NM_001553 Insulin-like growth factor binding protein 7 Insulin-like growth factor binding protein 7 센스 (서열번호33)Sense (SEQ ID NO: 33) ACTTGAGCTGTGAGGTCATCGGAAACTTGAGCTGTGAGGTCATCGGAA 안티센스 (서열번호34)Antisense (SEQ ID NO: 34) ATACCAGCACCCAGCCAGTTACTTATACCAGCACCCAGCCAGTTACTT NM_032872 NM_032872 Synaptotagmin-like 1 Synaptotagmin-like 1 센스 (서열번호35)Sense (SEQ ID NO: 35) GGCGGTGAAGAAACGGAATCTGAA GGCGGTGAAGAAACGGAATCTGAA 안티센스 (서열번호36)Antisense (SEQ ID NO: 36) GAAAGATGTTGCGACCCAGGCTTT GAAAGATGTTGCGACCCAGGCTTT BU945318 BU945318 Metallothionein 2A Metallothionein 2A 센스 (서열번호37)Sense (SEQ ID NO: 37) CTCTAGCCGCCTCTTCAGCCTCTAGCCGCCTCTTCAGC 안티센스 (서열번호38)Antisense (SEQ ID NO: 38) ACTCTTTGCATTTGCAGGAACACTCTTTGCATTTGCAGGAAC X02812 X02812 Transforming growth factor, beta 1(Camurati-Engelmann disease) Transforming growth factor, beta 1 (Camurati-Engelmann disease) 센스 (서열번호39)Sense (SEQ ID NO: 39) GCAGCACGTGGAGCTGTAGCAGCACGTGGAGCTGTA 안티센스 (서열번호40)Antisense (SEQ ID NO: 40) CAGCCGGTTGCTGAGGTA CAGCCGGTTGCTGAGGTA NM_003897  NM_003897 Immediate early response 3 Immediate early response 3 센스 (서열번호41)Sense (SEQ ID NO: 41) AGCCCTTTAATCTGACTTCGGAGCAGCCCTTTAATCTGACTTCGGAGC 안티센스 (서열번호42)Antisense (SEQ ID NO: 42) CAGGTACGCCTGGTGTTTCTTTGTCAGGTACGCCTGGTGTTTCTTTGT NM_145256  NM_145256 Leucine rich repeat containing 25 Leucine rich repeat containing 25 센스 (서열번호43)Sense (SEQ ID NO: 43) CCACTCCCGACTATGAGAACACCACTCCCGACTATGAGAACA 안티센스 (서열번호44)Antisense (SEQ ID NO: 44) TTGTCCTCTGAAGGGTGAGCTTGTCCTCTGAAGGGTGAGC BU587578 BU587578 Regulator of G-protein signalling 10 Regulator of G-protein signaling 10 센스 (서열번호45)Sense (SEQ ID NO: 45) CCGTGCCGGGTTTATCATTGCTTTCCGTGCCGGGTTTATCATTGCTTT 안티센스 (서열번호46)Antisense (SEQ ID NO: 46) TCGACGTGTCCAGTGTTGAAGGAATCGACGTGTCCAGTGTTGAAGGAA NM_133493 NM_133493 CD109 molecule CD109 molecule 센스 (서열번호47)Sense (SEQ ID NO: 47) GCCAAGATTTACCACGTTTGCCCA GCCAAGATTTACCACGTTTGCCCA 안티센스 (서열번호48)Antisense (SEQ ID NO: 48) TGAAGGACCAGAACTGAGCCACATTGAAGGACCAGAACTGAGCCACAT NM_005319 NM_005319 Histone 1, H1c Histone 1, H1c 센스 (서열번호49)Sense (SEQ ID NO: 49) ACCAAACCTAAGAAGCCAGTTGACCAAACCTAAGAAGCCAGTTG 안티센스 (서열번호50)Antisense (SEQ ID NO: 50) TAGCGCTCTTCTTCGGAGTTTAGCGCTCTTCTTCGGAGTT BG036385 BG036385 Receptor(calcitonin) activity modifying protein 1 Receptor (calcitonin) activity modifying protein 1 센스 (서열번호51)Sense (SEQ ID NO: 51) AAGAAGAGCTCACAGGAGTCCAGAAAGAAGAGCTCACAGGAGTCCAGA 안티센스 (서열번호52)Antisense (SEQ ID NO: 52) ACCCTTTCCAGAGGTAAGTCAAGGACCCTTTCCAGAGGTAAGTCAAGG NM_012396 NM_012396 Pleckstrin homology-like domain, family A, member 3 Pleckstrin homology-like domain, family A, member 3 센스 (서열번호53)Sense (SEQ ID NO: 53) CTACCCACCACCTCAGTGCTCTACCCACCACCTCAGTGCT 안티센스 (서열번호54)Antisense (SEQ ID NO: 54) CTCGTCCATTCCTTCAGCTCCTCGTCCATTCCTTCAGCTC AB208949 AB208949 Leucine-rich repeats and death domain containing Leucine-rich repeats and death domain containing 센스 (서열번호55)Sense (SEQ ID NO: 55) GGGGTGACCTGGAGACCTACGGGGTGACCTGGAGACCTAC 안티센스 (서열번호56)Antisense (SEQ ID NO: 56) CTGGCAGTGAGCCCAGAGCTGGCAGTGAGCCCAGAG BU603483 BU603483 Histone 1, H1e Histone 1, H1e 센스 (서열번호57)Sense (SEQ ID NO: 57) ACCCCAAAGAAGGCGAAGACCCCAAAGAAGGCGAAG 안티센스 (서열번호58)Antisense (SEQ ID NO: 58) GCCTTTTTCGGGCTTTTCGCCTTTTTCGGGCTTTTC Y12692 Y12692 Wingless-type MMTV integration site family, member 11 Wingless-type MMTV integration site family, member 11 센스 (서열번호59)Sense (SEQ ID NO: 59) TTCACTTGGAAGCCACCAGGAACATTCACTTGGAAGCCACCAGGAACA 안티센스 (서열번호60)Antisense (SEQ ID NO: 60) TGGCCCTGAAAGGTCAAGTCTGTA TGGCCCTGAAAGGTCAAGTCTGTA BC022255 BC022255 Spindle pole body component 25 homolog(S. cerevisiae) Spindle pole body component 25 homolog (S. cerevisiae) 센스 (서열번호61)Sense (SEQ ID NO: 61) GAATGGTTGAGATGTTTCTGGAGAATGGTTGAGATGTTTCTGGA 안티센스 (서열번호62)Antisense (SEQ ID NO: 62) GCAATCAATTTTAACAAGTTATCCTTTGCAATCAATTTTAACAAGTTATCCTTT AB013380 AB013380 ATP-binding cassette, sub-family B(MDR/TAP), member 10 ATP-binding cassette, sub-family B (MDR / TAP), member 10 센스 (서열번호63)Sense (SEQ ID NO: 63) TCAGCCTTTCCATTCCGTCAGGAT TCAGCCTTTCCATTCCGTCAGGAT 안티센스 (서열번호64)Antisense (SEQ ID NO: 64) TTTGGATCTCAGCCACACTGGGTTTTTGGATCTCAGCCACACTGGGTT AB046861 AB046861 KIAA1641 KIAA1641 센스 (서열번호65)Sense (SEQ ID NO: 65) AAGGAGGGACAACAATCTGGGACA AAGGAGGGACAACAATCTGGGACA 안티센스 (서열번호66)Antisense (SEQ ID NO: 66) TCACTTGTAGCCTTTGAGGGTGGT TCACTTGTAGCCTTTGAGGGTGGT BX640965 BX640965 Solute carrier family 22(extraneuronal monoamine transporter), member 3 Solute carrier family 22 (extraneuronal monoamine transporter), member 3 센스 (서열번호67)Sense (SEQ ID NO: 67) GCCCTGTTCCAGCAATAAGAGCCCTGTTCCAGCAATAAGA 안티센스 (서열번호68)Antisense (SEQ ID NO: 68) GAGAGCCAAAAATGTCCCAAGAGAGCCAAAAATGTCCCAA XM_291202 XM_291202 Zinc finger protein 479 Zinc finger protein 479 센스 (서열번호69)Sense (SEQ ID NO: 69) ATGGTAGCCAAACACCCAGTATGGTAGCCAAACACCCAGT 안티센스 (서열번호70)Antisense (SEQ ID NO: 70) TGAATCTTTGATGCCCTGCTTGAATCTTTGATGCCCTGCT NM_018492 NM_018492 PDZ binding kinase PDZ binding kinase 센스 (서열번호71)Sense (SEQ ID NO: 71) TCTGGACTGAGAGTGGCTTTCACATCTGGACTGAGAGTGGCTTTCACA 안티센스 (서열번호72)Antisense (SEQ ID NO: 72) AGCCAAGCTTCTGCATAAACGGAGAGCCAAGCTTCTGCATAAACGGAG NM_145697 NM_145697 Cell division cycle associated 1 Cell division cycle associated 1 센스 (서열번호73)Sense (SEQ ID NO: 73) TGCCTTCATGTCAGTTGGAAGTGCTGCCTTCATGTCAGTTGGAAGTGC 안티센스 (서열번호74)Antisense (SEQ ID NO: 74) TTTGGTCCTCCAAGTTCAGGCTCTTTTGGTCCTCCAAGTTCAGGCTCT NM_017768 NM_017768 Leucine rich repeat containing 40 Leucine rich repeat containing 40 센스 (서열번호75)Sense (SEQ ID NO: 75) TGCCGCAGTGTGTCTGGAGAATAATGCCGCAGTGTGTCTGGAGAATAA 안티센스 (서열번호76)Antisense (SEQ ID NO: 76) TGCTCCCACCATCTTTCAGTAGCATGCTCCCACCATCTTTCAGTAGCA BX640888 BX640888 Glypican 6 Glypican 6 센스 (서열번호77)Sense (SEQ ID NO: 77) ACACTGACCAGCTCAAGCCATTTGACACTGACCAGCTCAAGCCATTTG 안티센스 (서열번호78)Antisense (SEQ ID NO: 78) GACAAAGGTCCTGGCAGCAATGAA GACAAAGGTCCTGGCAGCAATGAA U65410 U65410 MAD2 mitotic arrest deficient-like 1(yeast) MAD2 mitotic arrest deficient-like 1 (yeast) 센스 (서열번호79)Sense (SEQ ID NO: 79) ACTTAAATATCTCCCTACCTATACTGAGTCAAACTTAAATATCTCCCTACCTATACTGAGTCAA 안티센스 (서열번호80)Antisense (SEQ ID NO: 80) TAGTAACTGTAGATGGAAAAACTTGTGCTATAGTAACTGTAGATGGAAAAACTTGTGCTA CR600021 CR600021 High-mobility group box 2 High-mobility group box 2 센스 (서열번호81)Sense (SEQ ID NO: 81) CTTGGCACGATATGCAGCAACTTGGCACGATATGCAGCAA 안티센스 (서열번호82)Antisense (SEQ ID NO: 82) CAGCCAAAGATAAACAACCATATGACAGCCAAAGATAAACAACCATATGA AK074377 AK074377 Ubiquitin-like, containing PHD and RING finger domains, 1 Ubiquitin-like, containing PHD and RING finger domains, 1 센스 (서열번호83)Sense (SEQ ID NO: 83) CTGGTACGACGCGGAGATCTGGTACGACGCGGAGAT 안티센스 (서열번호84)Antisense (SEQ ID NO: 84) CGACAGTCGTTCAGAGAATCACGACAGTCGTTCAGAGAATCA NM_180991 NM_180991 Solute carrier organic anion transporter family, member 4C1 Solute carrier organic anion transporter family, member 4C1 센스 (서열번호85)Sense (SEQ ID NO: 85) CCAGCTTCGCAGCTACTCTTCCAGCTTCGCAGCTACTCTT 안티센스 (서열번호86)Antisense (SEQ ID NO: 86) CCACCTAAAATTTGACCGAGAGCCACCTAAAATTTGACCGAGAG NM_006101 NM_006101 Kinetochore associated 2 Kinetochore associated 2 센스 (서열번호87)Sense (SEQ ID NO: 87) TGCTACACATGTTGGGTCTGTATGCTACACATGTTGGGTCTGTA 안티센스 (서열번호88)Antisense (SEQ ID NO: 88) CCGAGAGATCTTCTGACATGCCCGAGAGATCTTCTGACATGC AB091343 AB091343 Centrosomal protein 55kDa Centrosomal protein 55kDa 센스 (서열번호89)Sense (SEQ ID NO: 89) GCTGTGCATTTCTCTTGGCAGTGAGCTGTGCATTTCTCTTGGCAGTGA 안티센스 (서열번호90)Antisense (SEQ ID NO: 90) TAGACGCTGCTCACCACATTCTGT TAGACGCTGCTCACCACATTCTGT NM_001067 NM_001067 Topoisomerase(DNA) II alpha 170kDa Topoisomerase (DNA) II alpha 170kDa 센스 (서열번호91)Sense (SEQ ID NO: 91) CTAGTTAATGCTGCGGACAACACTAGTTAATGCTGCGGACAACA 안티센스 (서열번호92)Antisense (SEQ ID NO: 92) CATTTCGACCACCTGTCACTTCATTTCGACCACCTGTCACTT NM_003318 NM_003318 TTK protein kinase TTK protein kinase 센스 (서열번호93)Sense (SEQ ID NO: 93) TCATGCCCATTTGGAAGAGTCCCATCATGCCCATTTGGAAGAGTCCCA 안티센스 (서열번호94)Antisense (SEQ ID NO: 94) AGGCACAACCAAATCTCGGCATTC AGGCACAACCAAATCTCGGCATTC NM_032117 NM_032117 Meiotic nuclear divisions 1 homolog(S. cerevisiae) Meiotic nuclear divisions 1 homolog (S. cerevisiae) 센스 (서열번호95)Sense (SEQ ID NO: 95) TTCGAGACCAAAGGGAACAGTTCGAGACCAAAGGGAACAG 안티센스 (서열번호96)Antisense (SEQ ID NO: 96) CTTTGGCTACTTTATTTGCTTGGCTTTGGCTACTTTATTTGCTTGG

실시간 정량 Real time quantification PCRPCR 결과  result 등록번호Registration Number 유전자명Gene name 약어Abbreviation 마이크로어레이Microarray (( Cy3Cy3 /Of Cy5Cy5 비율) ratio) 실시간 real time PCRPCR (상대적 배율)(Relative magnification) 과발현 유전자Overexpression genes BM913048BM913048 TIMP metallopeptidase inhibitor 1TIMP metallopeptidase inhibitor 1 TIMP1TIMP1 7.15 7.15 5.57 5.57 NM_004864NM_004864 Growth differentiation factor 15Growth differentiation factor 15 GDF15GDF15 11.09 11.09 10.24 10.24 AK095363AK095363 Aquaporin 3Aquaporin 3 AQP3AQP3 5.88 5.88 174.85 174.85 NM_003516NM_003516 Histone 2, H2aaHistone 2, H2aa HIST2H2AAHIST2H2AA 3.67 3.67 2.28 2.28 NM_001013632NM_001013632 Similar to hypothetical protein 4833401D15Similar to hypothetical protein 4833401D15 LOC343521LOC343521 3.08 3.08 2.36 2.36 Y11307Y11307 Cysteine-rich, angiogenic inducer, 61Cysteine-rich, angiogenic inducer, 61 CYR61CYR61 3.79 3.79 3.52 3.52 NM_001769NM_001769 CD9 antigen(p24)CD9 antigen (p24) CD9CD9 2.56 2.56 6.56 6.56 AY368150AY368150 Family with sequence similarity 62 (C2 domain containing) member BFamily with sequence similarity 62 (C2 domain containing) member B CHR2SYTCHR2SYT 2.60 2.60 2.72 2.72 NM_000499NM_000499 Cytochrome P450, family 1, subfamily A, polypeptide 1Cytochrome P450, family 1, subfamily A, polypeptide 1 CYP1A1CYP1A1 28.79 28.79 344.10 344.10 BC035124BC035124 MSFL2541MSFL2541 UNQ2541UNQ2541 5.24 5.24 15.67 15.67 AK097009AK097009 phospholipid transfer proteinphospholipid transfer protein PLTPPLTP 4.63 4.63 8.07 8.07 NM_000596NM_000596 Insulin-like growth factor binding protein 1Insulin-like growth factor binding protein 1 IGFBP1IGFBP1 2.44 2.44 4.81 4.81 NM_006426NM_006426 Dihydropyrimidinase-like 4Dihydropyrimidinase-like 4 DPYSL4DPYSL4 5.43 5.43 7.08 7.08 NM_021603NM_021603 FXYD domain containing ion transport regulator 2FXYD domain containing ion transport regulator 2 FXYD2FXYD2 4.51 4.51 10.17 10.17 AB033073AB033073 Sulfatase 2Sulfatase 2 SULF2SULF2 3.43 3.43 5.60 5.60 NM_004881NM_004881 Tumor protein p53 inducible protein 3Tumor protein p53 inducible protein 3 TP53I3TP53I3 6.08 6.08 8.34 8.34 NM_001553NM_001553 Insulin-like growth factor binding protein 7Insulin-like growth factor binding protein 7 IGFBP7IGFBP7 2.62 2.62 7.30 7.30 NM_032872NM_032872 Synaptotagmin-like 1Synaptotagmin-like 1 SYTL1SYTL1 3.48 3.48 4.30 4.30 BU945318BU945318 Hypothetical gene supported by X97260; BC070289(metallothionein 2A)Hypothetical gene supported by X97260; BC070289 (metallothionein 2A) MT2AMT2A 7.12 7.12 8.59 8.59 X02812X02812 Transforming growth factor, beta 1(Camurati-Engelmann disease)Transforming growth factor, beta 1 (Camurati-Engelmann disease) TGFB1TGFB1 2.41 2.41 2.66 2.66 NM_003897NM_003897 Immediate early response 3Immediate early response 3 IER3IER3 2.86 2.86 4.29 4.29 NM_145256NM_145256 Leucine rich repeat containing 25Leucine rich repeat containing 25 LRRC25LRRC25 9.57 9.57 80.08 80.08 BU587578BU587578 Regulator of G-protein signalling 10Regulator of G-protein signaling 10 RGS10RGS10 6.78 6.78 31.38 31.38 NM_133493NM_133493 CD109 antigen(Gov platelet alloantigens)CD109 antigen (Gov platelet alloantigens) CD109CD109 6.73 6.73 24.14 24.14 NM_005319NM_005319 Histone 1, H1cHistone 1, H1c HIST1H1CHIST1H1C 4.54 4.54 3.40 3.40 BG036385BG036385 Receptor(calcitonin) activity modifying protein 1Receptor (calcitonin) activity modifying protein 1 RAMP1RAMP1 4.77 4.77 12.32 12.32 NM_012396NM_012396 Pleckstrin homology-like domain, family A, member 3Pleckstrin homology-like domain, family A, member 3 PHLDA3PHLDA3 4.69 4.69 3.69 3.69 AB208949AB208949 Leucine-rich repeats and death domain containingLeucine-rich repeats and death domain containing LRDDLRDD 3.95 3.95 49.12 49.12 BU603483BU603483 Histone 1, H1eHistone 1, H1e HIST1H1EHIST1H1E 3.92 3.92 10.98 10.98 Y12692Y12692 Wingless-type MMTV integration site family, member 11Wingless-type MMTV integration site family, member 11 WNT11WNT11 5.03 5.03 8.06 8.06 저발현Low expression 유전자  gene BC022255BC022255 Spindle pole body component 25 homolog(S. cerevisiae)Spindle pole body component 25 homolog (S. cerevisiae) Spc25Spc25 0.19 0.19 0.10 0.10 AB013380AB013380 ATP-binding cassette, sub-family B(MDR/TAP), member 10ATP-binding cassette, sub-family B (MDR / TAP), member 10 ABCB10ABCB10 0.28 0.28 0.50 0.50 AB046861AB046861 KIAA1641KIAA1641 KIAA1641KIAA1641 0.17 0.17 0.19 0.19 BX640965BX640965 Solute carrier family 22 (extraneuronal monoamine transporter), member 3Solute carrier family 22 (extraneuronal monoamine transporter), member 3 SLC22A3SLC22A3 0.17 0.17 0.28 0.28 XM_291202XM_291202 Zinc finger protein 479Zinc finger protein 479 ZNF479ZNF479 0.34 0.34 0.28 0.28 NM_018492NM_018492 PDZ binding kinasePDZ binding kinase PBKPBK 0.08 0.08 0.10 0.10 NM_145697NM_145697 Cell division cycle associated 1Cell division cycle associated 1 CDCA1CDCA1 0.13 0.13 0.09 0.09 NM_017768NM_017768 Leucine rich repeat containing 40Leucine rich repeat containing 40 LRRC40LRRC40 0.41 0.41 0.59 0.59 BX640888BX640888 Glypican 6Glypican 6 GPC6GPC6 0.06 0.06 0.13 0.13 U65410U65410 MAD2 mitotic arrest deficient-like 1(yeast)MAD2 mitotic arrest deficient-like 1 (yeast) MAD2L1MAD2L1 0.17 0.17 0.08 0.08 CR600021CR600021 High-mobility group box 2High-mobility group box 2 HMGB2HMGB2 0.14 0.14 0.06 0.06 AK074377AK074377 Chromosome 19 open reading frame 31Chromosome 19 open reading frame 31 UHRF1UHRF1 0.13 0.13 0.08 0.08 NM_180991NM_180991 Solute carrier organic anion transporter family, member 4C1Solute carrier organic anion transporter family, member 4C1 SLCO4C1SLCO4C1 0.21 0.21 0.54 0.54 NM_006101NM_006101 Kinetochore associated 2Kinetochore associated 2 KNTC2KNTC2 0.18 0.18 0.06 0.06 AB091343AB091343 Centrosomal protein 55kDaCentrosomal protein 55kDa C10orf3C10orf3 0.18 0.18 0.12 0.12 NM_001067NM_001067 Topoisomerase(DNA) II alpha 170kDaTopoisomerase (DNA) II alpha 170kDa TOP2ATOP2A 0.22 0.22 0.08 0.08 NM_003318NM_003318 TTK protein kinaseTTK protein kinase TTKTTK 0.20 0.20 0.09 0.09 NM_032117NM_032117 GAJ proteinGAJ protein GAJGAJ 0.15 0.15 0.17 0.17

그 결과, 30종의 과발현 유전자들 및 18종의 저발현 유전자의 유전자 발현 양상은 다이벤조에이에이취안트라센에 의한 유전자 발현을 조사한 올리고 마이크로어레이 결과와 매우 유사하게 나타남을 확인하였다.As a result, it was confirmed that the gene expression patterns of 30 overexpression genes and 18 low expression genes were very similar to those of oligo microarrays, which examined gene expression by dibenzoAH-anthracene.

도 1은 다이벤조에이에이취안트라센(dibenzo[a,h]anthracene)의 인간 간암 세포주에서의 세포 독성을 조사한 그래프이고,1 is a graph illustrating the cytotoxicity of dibenzo [a, h] anthracene in human liver cancer cell lines.

도 2는 마이크로어레이 칩을 이용한 다이벤조에이에이취안트라센을 처리한 인간 간암 세포주의 유전자 발현 양상을 분석한 결과를 나타내는 그림이다.Figure 2 is a diagram showing the results of analyzing the gene expression pattern of the human liver cancer cell line treated with dibenzoAquixanthracene using a microarray chip.

<110> Korea Institute of Science and Technology <120> Biomarker for identification of exposure to dibenzo[a, h]anthracene and the method of identification using thereof <130> 7p-08-66 <160> 96 <170> KopatentIn 1.71 <210> 1 <211> 23 <212> DNA <213> Homo sapiens TIMP metallopeptidase inhibitor 1 sense primer <400> 1 gatacttcca caggtcccac aac 23 <210> 2 <211> 21 <212> DNA <213> Homo sapiens TIMP metallopeptidase inhibitor 1 antisense primer <400> 2 gcaagagtcc atcctgcagt t 21 <210> 3 <211> 19 <212> DNA <213> Growth differentiation factor 15 sense primer <400> 3 cctgagacac ccgattcct 19 <210> 4 <211> 20 <212> DNA <213> Growth differentiation factor 15 antisense primer <400> 4 acagttccat cagaccagcc 20 <210> 5 <211> 24 <212> DNA <213> Aquaporin 3(Gill blood group) sense primer <400> 5 ttcacgatcc accctttcag gcta 24 <210> 6 <211> 24 <212> DNA <213> Aquaporin 3(Gill blood group) antisense primer <400> 6 acacatacct gctgcccatt ctct 24 <210> 7 <211> 24 <212> DNA <213> Histone 2, H2aa sense primer <400> 7 gaactgaaca agctgctggg caaa 24 <210> 8 <211> 24 <212> DNA <213> Histone 2, H2aa antisense primer <400> 8 tctccgtctt cttagggagc agta 24 <210> 9 <211> 25 <212> DNA <213> Similar to hypothetical protein 4833401D15 sense primer <400> 9 gactactcca ataagttcgg ctttg 25 <210> 10 <211> 23 <212> DNA <213> Similar to hypothetical protein 4833401D15 antisense primer <400> 10 catatgtgtg ccatcgttga aga 23 <210> 11 <211> 25 <212> DNA <213> Cysteine-rich, angiogenic inducer, 61 sense primer <400> 11 attgtagaaa ggaagccttg ctcat 25 <210> 12 <211> 20 <212> DNA <213> Cysteine-rich, angiogenic inducer, 61 antisense primer <400> 12 tccaatcgtg gctgcattag 20 <210> 13 <211> 24 <212> DNA <213> CD9 molecule sense primer <400> 13 gcaccaagtg catcaaatac ctgc 24 <210> 14 <211> 24 <212> DNA <213> CD9 molecule antisense primer <400> 14 agccatagtc caatggcaag gaca 24 <210> 15 <211> 22 <212> DNA <213> Family with sequence similarity 62(C2 domain containing) member B sense primer <400> 15 ggaaaacaca cgtgtcaaag aa 22 <210> 16 <211> 18 <212> DNA <213> Family with sequence similarity 62(C2 domain containing) member B antisense primer <400> 16 ttcttcacgg caacgtca 18 <210> 17 <211> 18 <212> DNA <213> Homo sapiens cytochrome P450, family 1, subfamily A, polypeptide 1 sense primer <400> 17 caccatcccc cacagcac 18 <210> 18 <211> 20 <212> DNA <213> Homo sapiens cytochrome P450, family 1, subfamily A, polypeptide 1 antisense primer <400> 18 acaaagacac aacgcccctt 20 <210> 19 <211> 21 <212> DNA <213> MSFL2541 sense primer <400> 19 ttcgccgtcc tttacatcta c 21 <210> 20 <211> 19 <212> DNA <213> MSFL2541 antisense primer <400> 20 agagcctggg gactcacat 19 <210> 21 <211> 24 <212> DNA <213> Phospholipid transfer protein sense primer <400> 21 tgccacagag aagacgggat ttga 24 <210> 22 <211> 24 <212> DNA <213> Phospholipid transfer protein antisense primer <400> 22 aggtggtgga cggactgtaa ttga 24 <210> 23 <211> 24 <212> DNA <213> Homo sapiens insulin-like growth factor binding protein 1 sense primer <400> 23 atcattccat cctttgggac gcca 24 <210> 24 <211> 24 <212> DNA <213> Homo sapiens insulin-like growth factor binding protein 1 antisense primer <400> 24 tgtctcctgt gccttggcta aact 24 <210> 25 <211> 26 <212> DNA <213> Homo sapiens dihydropyrimidinase-like 4 sense primer <400> 25 tgggaagatg gacgagaatg agttcg 26 <210> 26 <211> 24 <212> DNA <213> Homo sapiens dihydropyrimidinase-like 4 antisense primer <400> 26 actccactcc ctcgaagatg ttgt 24 <210> 27 <211> 24 <212> DNA <213> FXYD domain containing ion transport regulator 2 sense primer <400> 27 ggcaataaga agcgcaggca aatc 24 <210> 28 <211> 24 <212> DNA <213> FXYD domain containing ion transport regulator 2 antisense primer <400> 28 aaggtctaaa gcccagggaa gaag 24 <210> 29 <211> 24 <212> DNA <213> Homo sapiens sulfatase 2, transcript variant 1 sense primer <400> 29 tgcggatatg gacgggaaat ccat 24 <210> 30 <211> 24 <212> DNA <213> Homo sapiens sulfatase 2, transcript variant 1 antisense primer <400> 30 tctcttgtgt agcagcttgc ctct 24 <210> 31 <211> 22 <212> DNA <213> Tumor protein p53 inducible protein 3 sense primer <400> 31 agggtgaagt cctcctgaag gt 22 <210> 32 <211> 22 <212> DNA <213> Tumor protein p53 inducible protein 3 antisense primer <400> 32 gtgggtcata ctggccttgt ct 22 <210> 33 <211> 24 <212> DNA <213> Insulin-like growth factor binding protein 7 sense primer <400> 33 acttgagctg tgaggtcatc ggaa 24 <210> 34 <211> 24 <212> DNA <213> Insulin-like growth factor binding protein 7 antisense primer <400> 34 ataccagcac ccagccagtt actt 24 <210> 35 <211> 24 <212> DNA <213> Synaptotagmin-like 1 sense primer <400> 35 ggcggtgaag aaacggaatc tgaa 24 <210> 36 <211> 24 <212> DNA <213> Synaptotagmin-like 1 antisense primer <400> 36 gaaagatgtt gcgacccagg cttt 24 <210> 37 <211> 19 <212> DNA <213> Metallothionein 2A sense primer <400> 37 ctctagccgc ctcttcagc 19 <210> 38 <211> 21 <212> DNA <213> Metallothionein 2A antisense primer <400> 38 actctttgca tttgcaggaa c 21 <210> 39 <211> 18 <212> DNA <213> Transforming growth factor, beta 1 sense primer <400> 39 gcagcacgtg gagctgta 18 <210> 40 <211> 18 <212> DNA <213> Transforming growth factor, beta 1 antisense primer <400> 40 cagccggttg ctgaggta 18 <210> 41 <211> 24 <212> DNA <213> Immediate early response 3 sense primer <400> 41 agccctttaa tctgacttcg gagc 24 <210> 42 <211> 24 <212> DNA <213> Immediate early response 3 antisense primer <400> 42 caggtacgcc tggtgtttct ttgt 24 <210> 43 <211> 21 <212> DNA <213> Leucine rich repeat containing 25 sense primer <400> 43 ccactcccga ctatgagaac a 21 <210> 44 <211> 20 <212> DNA <213> Leucine rich repeat containing 25 antisense primer <400> 44 ttgtcctctg aagggtgagc 20 <210> 45 <211> 24 <212> DNA <213> Regulator of G-protein signalling 10 sense primer <400> 45 ccgtgccggg tttatcattg cttt 24 <210> 46 <211> 24 <212> DNA <213> Regulator of G-protein signalling 10 antisense primer <400> 46 tcgacgtgtc cagtgttgaa ggaa 24 <210> 47 <211> 24 <212> DNA <213> CD109 molecule sense primer <400> 47 gccaagattt accacgtttg ccca 24 <210> 48 <211> 24 <212> DNA <213> CD109 molecule antisense primer <400> 48 tgaaggacca gaactgagcc acat 24 <210> 49 <211> 22 <212> DNA <213> Histone 1, H1c sense primer <400> 49 accaaaccta agaagccagt tg 22 <210> 50 <211> 20 <212> DNA <213> Histone 1, H1c antisense primer <400> 50 tagcgctctt cttcggagtt 20 <210> 51 <211> 24 <212> DNA <213> Receptor(calcitonin) activity modifying protein 1 sense primer <400> 51 aagaagagct cacaggagtc caga 24 <210> 52 <211> 24 <212> DNA <213> Receptor(calcitonin) activity modifying protein 1 antisense primer <400> 52 accctttcca gaggtaagtc aagg 24 <210> 53 <211> 20 <212> DNA <213> Pleckstrin homology-like domain, family A, member 3 sense primer <400> 53 ctacccacca cctcagtgct 20 <210> 54 <211> 20 <212> DNA <213> Pleckstrin homology-like domain, family A, member 3 antisense primer <400> 54 ctcgtccatt ccttcagctc 20 <210> 55 <211> 20 <212> DNA <213> Leucine-rich repeats and death domain containing sense primer <400> 55 ggggtgacct ggagacctac 20 <210> 56 <211> 18 <212> DNA <213> Leucine-rich repeats and death domain containing antisense primer <400> 56 ctggcagtga gcccagag 18 <210> 57 <211> 18 <212> DNA <213> Histone 1, H1e sense primer <400> 57 accccaaaga aggcgaag 18 <210> 58 <211> 18 <212> DNA <213> Histone 1, H1e antisense primer <400> 58 gcctttttcg ggcttttc 18 <210> 59 <211> 24 <212> DNA <213> Wingless-type MMTV integration site family, member 11 sense primer <400> 59 ttcacttgga agccaccagg aaca 24 <210> 60 <211> 24 <212> DNA <213> Wingless-type MMTV integration site family, member 11 antisense primer <400> 60 tggccctgaa aggtcaagtc tgta 24 <210> 61 <211> 22 <212> DNA <213> Spindle pole body component 25 homolog(S. cerevisiae) sense primer <400> 61 gaatggttga gatgtttctg ga 22 <210> 62 <211> 27 <212> DNA <213> Spindle pole body component 25 homolog(S. cerevisiae) antisense primer <400> 62 gcaatcaatt ttaacaagtt atccttt 27 <210> 63 <211> 24 <212> DNA <213> ATP-binding cassette, sub-family B(MDR/TAP), member 10 sense primer <400> 63 tcagcctttc cattccgtca ggat 24 <210> 64 <211> 24 <212> DNA <213> ATP-binding cassette, sub-family B(MDR/TAP), member 10 antisense primer <400> 64 tttggatctc agccacactg ggtt 24 <210> 65 <211> 24 <212> DNA <213> KIAA1641 sense primer <400> 65 aaggagggac aacaatctgg gaca 24 <210> 66 <211> 24 <212> DNA <213> KIAA1641 antisense primer <400> 66 tcacttgtag cctttgaggg tggt 24 <210> 67 <211> 20 <212> DNA <213> Solute carrier family 22(extraneuronal monoamine transporter), member 3 sense primer <400> 67 gccctgttcc agcaataaga 20 <210> 68 <211> 20 <212> DNA <213> Solute carrier family 22(extraneuronal monoamine transporter), member 3 antisense primer <400> 68 gagagccaaa aatgtcccaa 20 <210> 69 <211> 20 <212> DNA <213> Zinc finger protein 479 sense primer <400> 69 atggtagcca aacacccagt 20 <210> 70 <211> 20 <212> DNA <213> Zinc finger protein 479 antisense primer <400> 70 tgaatctttg atgccctgct 20 <210> 71 <211> 24 <212> DNA <213> PDZ binding kinase sense primer <400> 71 tctggactga gagtggcttt caca 24 <210> 72 <211> 24 <212> DNA <213> PDZ binding kinase antisense primer <400> 72 agccaagctt ctgcataaac ggag 24 <210> 73 <211> 24 <212> DNA <213> Cell division cycle associated 1 sense primer <400> 73 tgccttcatg tcagttggaa gtgc 24 <210> 74 <211> 24 <212> DNA <213> Cell division cycle associated 1 antisense primer <400> 74 tttggtcctc caagttcagg ctct 24 <210> 75 <211> 24 <212> DNA <213> Leucine rich repeat containing 40 sense primer <400> 75 tgccgcagtg tgtctggaga ataa 24 <210> 76 <211> 24 <212> DNA <213> Leucine rich repeat containing 40 antisense primer <400> 76 tgctcccacc atctttcagt agca 24 <210> 77 <211> 24 <212> DNA <213> Glypican 6 sense primer <400> 77 acactgacca gctcaagcca tttg 24 <210> 78 <211> 24 <212> DNA <213> Glypican 6 antisense primer <400> 78 gacaaaggtc ctggcagcaa tgaa 24 <210> 79 <211> 32 <212> DNA <213> MAD2 mitotic arrest deficient-like 1(yeast) sense primer <400> 79 acttaaatat ctccctacct atactgagtc aa 32 <210> 80 <211> 30 <212> DNA <213> MAD2 mitotic arrest deficient-like 1(yeast) antisense primer <400> 80 tagtaactgt agatggaaaa acttgtgcta 30 <210> 81 <211> 20 <212> DNA <213> High-mobility group box 2 sense primer <400> 81 cttggcacga tatgcagcaa 20 <210> 82 <211> 25 <212> DNA <213> High-mobility group box 2 antisense primer <400> 82 cagccaaaga taaacaacca tatga 25 <210> 83 <211> 18 <212> DNA <213> Ubiquitin-like, containing PHD and RING finger domains, 1 sense primer <400> 83 ctggtacgac gcggagat 18 <210> 84 <211> 21 <212> DNA <213> Ubiquitin-like, containing PHD and RING finger domains, 1 antisense primer <400> 84 cgacagtcgt tcagagaatc a 21 <210> 85 <211> 20 <212> DNA <213> Solute carrier organic anion transporter family, member 4C1 sense primer <400> 85 ccagcttcgc agctactctt 20 <210> 86 <211> 22 <212> DNA <213> Solute carrier organic anion transporter family, member 4C1 antisense primer <400> 86 ccacctaaaa tttgaccgag ag 22 <210> 87 <211> 22 <212> DNA <213> Kinetochore associated 2 sense primer <400> 87 tgctacacat gttgggtctg ta 22 <210> 88 <211> 21 <212> DNA <213> Kinetochore associated 2 antisense primer <400> 88 ccgagagatc ttctgacatg c 21 <210> 89 <211> 24 <212> DNA <213> Centrosomal protein 55kDa sense primer <400> 89 gctgtgcatt tctcttggca gtga 24 <210> 90 <211> 24 <212> DNA <213> Centrosomal protein 55kDa antisense primer <400> 90 tagacgctgc tcaccacatt ctgt 24 <210> 91 <211> 22 <212> DNA <213> Topoisomerase(DNA) II alpha 170kDa sense primer <400> 91 ctagttaatg ctgcggacaa ca 22 <210> 92 <211> 21 <212> DNA <213> Topoisomerase(DNA) II alpha 170kDa antisense primer <400> 92 catttcgacc acctgtcact t 21 <210> 93 <211> 24 <212> DNA <213> TTK protein kinase sense primer <400> 93 tcatgcccat ttggaagagt ccca 24 <210> 94 <211> 24 <212> DNA <213> TTK protein kinase antisense primer <400> 94 aggcacaacc aaatctcggc attc 24 <210> 95 <211> 20 <212> DNA <213> Meiotic nuclear divisions 1 homolog(S. cerevisiae) sense primer <400> 95 ttcgagacca aagggaacag 20 <210> 96 <211> 23 <212> DNA <213> Meiotic nuclear divisions 1 homolog(S. cerevisiae) antisense primer <400> 96 ctttggctac tttatttgct tgg 23 <110> Korea Institute of Science and Technology <120> Biomarker for identification of exposure to dibenzo [a,          h] anthracene and the method of identification using <130> 7p-08-66 <160> 96 <170> KopatentIn 1.71 <210> 1 <211> 23 <212> DNA <213> Homo sapiens TIMP metallopeptidase inhibitor 1 sense primer <400> 1 gatacttcca caggtcccac aac 23 <210> 2 <211> 21 <212> DNA <213> Homo sapiens TIMP metallopeptidase inhibitor 1 antisense primer <400> 2 gcaagagtcc atcctgcagt t 21 <210> 3 <211> 19 <212> DNA <213> Growth differentiation factor 15 sense primer <400> 3 cctgagacac ccgattcct 19 <210> 4 <211> 20 <212> DNA <213> Growth differentiation factor 15 antisense primer <400> 4 acagttccat cagaccagcc 20 <210> 5 <211> 24 <212> DNA <213> Aquaporin 3 (Gill blood group) sense primer <400> 5 ttcacgatcc accctttcag gcta 24 <210> 6 <211> 24 <212> DNA <213> Aquaporin 3 (Gill blood group) antisense primer <400> 6 acacatacct gctgcccatt ctct 24 <210> 7 <211> 24 <212> DNA <213> Histone 2, H2aa sense primer <400> 7 gaactgaaca agctgctggg caaa 24 <210> 8 <211> 24 <212> DNA <213> Histone 2, H2aa antisense primer <400> 8 tctccgtctt cttagggagc agta 24 <210> 9 <211> 25 <212> DNA <213> Similar to hypothetical protein 4833401D15 sense primer <400> 9 gactactcca ataagttcgg ctttg 25 <210> 10 <211> 23 <212> DNA <213> Similar to hypothetical protein 4833401D15 antisense primer <400> 10 catatgtgtg ccatcgttga aga 23 <210> 11 <211> 25 <212> DNA <213> Cysteine-rich, angiogenic inducer, 61 sense primer <400> 11 attgtagaaa ggaagccttg ctcat 25 <210> 12 <211> 20 <212> DNA Cysteine-rich, angiogenic inducer, 61 antisense primer <400> 12 tccaatcgtg gctgcattag 20 <210> 13 <211> 24 <212> DNA <213> CD9 molecule sense primer <400> 13 gcaccaagtg catcaaatac ctgc 24 <210> 14 <211> 24 <212> DNA <213> CD9 molecule antisense primer <400> 14 agccatagtc caatggcaag gaca 24 <210> 15 <211> 22 <212> DNA <213> Family with sequence similarity 62 (C2 domain containing) member B sense primer <400> 15 ggaaaacaca cgtgtcaaag aa 22 <210> 16 <211> 18 <212> DNA <213> Family with sequence similarity 62 (C2 domain containing) member B antisense primer <400> 16 ttcttcacgg caacgtca 18 <210> 17 <211> 18 <212> DNA <213> Homo sapiens cytochrome P450, family 1, subfamily A, polypeptide 1 sense primer <400> 17 caccatcccc cacagcac 18 <210> 18 <211> 20 <212> DNA <213> Homo sapiens cytochrome P450, family 1, subfamily A, polypeptide 1 antisense primer <400> 18 acaaagacac aacgcccctt 20 <210> 19 <211> 21 <212> DNA <213> MSFL2541 sense primer <400> 19 ttcgccgtcc tttacatcta c 21 <210> 20 <211> 19 <212> DNA <213> MSFL2541 antisense primer <400> 20 agagcctggg gactcacat 19 <210> 21 <211> 24 <212> DNA <213> Phospholipid transfer protein sense primer <400> 21 tgccacagag aagacgggat ttga 24 <210> 22 <211> 24 <212> DNA <213> Phospholipid transfer protein antisense primer <400> 22 aggtggtgga cggactgtaa ttga 24 <210> 23 <211> 24 <212> DNA <213> Homo sapiens insulin-like growth factor binding protein 1 sense primer <400> 23 atcattccat cctttgggac gcca 24 <210> 24 <211> 24 <212> DNA <213> Homo sapiens insulin-like growth factor binding protein 1 antisense primer <400> 24 tgtctcctgt gccttggcta aact 24 <210> 25 <211> 26 <212> DNA <213> Homo sapiens dihydropyrimidinase-like 4 sense primer <400> 25 tgggaagatg gacgagaatg agttcg 26 <210> 26 <211> 24 <212> DNA <213> Homo sapiens dihydropyrimidinase-like 4 antisense primer <400> 26 actccactcc ctcgaagatg ttgt 24 <210> 27 <211> 24 <212> DNA <213> FXYD domain containing ion transport regulator 2 sense primer <400> 27 ggcaataaga agcgcaggca aatc 24 <210> 28 <211> 24 <212> DNA <213> FXYD domain containing ion transport regulator 2 antisense primer <400> 28 aaggtctaaa gcccagggaa gaag 24 <210> 29 <211> 24 <212> DNA <213> Homo sapiens sulfatase 2, transcript variant 1 sense primer <400> 29 tgcggatatg gacgggaaat ccat 24 <210> 30 <211> 24 <212> DNA <213> Homo sapiens sulfatase 2, transcript variant 1 antisense primer <400> 30 tctcttgtgt agcagcttgc ctct 24 <210> 31 <211> 22 <212> DNA <213> Tumor protein p53 inducible protein 3 sense primer <400> 31 agggtgaagt cctcctgaag gt 22 <210> 32 <211> 22 <212> DNA <213> Tumor protein p53 inducible protein 3 antisense primer <400> 32 gtgggtcata ctggccttgt ct 22 <210> 33 <211> 24 <212> DNA <213> Insulin-like growth factor binding protein 7 sense primer <400> 33 acttgagctg tgaggtcatc ggaa 24 <210> 34 <211> 24 <212> DNA <213> Insulin-like growth factor binding protein 7 antisense primer <400> 34 ataccagcac ccagccagtt actt 24 <210> 35 <211> 24 <212> DNA <213> Synaptotagmin-like 1 sense primer <400> 35 ggcggtgaag aaacggaatc tgaa 24 <210> 36 <211> 24 <212> DNA <213> Synaptotagmin-like 1 antisense primer <400> 36 gaaagatgtt gcgacccagg cttt 24 <210> 37 <211> 19 <212> DNA <213> Metallothionein 2A sense primer <400> 37 ctctagccgc ctcttcagc 19 <210> 38 <211> 21 <212> DNA <213> Metallothionein 2A antisense primer <400> 38 actctttgca tttgcaggaa c 21 <210> 39 <211> 18 <212> DNA <213> Transforming growth factor, beta 1 sense primer <400> 39 gcagcacgtg gagctgta 18 <210> 40 <211> 18 <212> DNA <213> Transforming growth factor, beta 1 antisense primer <400> 40 cagccggttg ctgaggta 18 <210> 41 <211> 24 <212> DNA <213> Immediate early response 3 sense primer <400> 41 agccctttaa tctgacttcg gagc 24 <210> 42 <211> 24 <212> DNA <213> Immediate early response 3 antisense primer <400> 42 caggtacgcc tggtgtttct ttgt 24 <210> 43 <211> 21 <212> DNA <213> Leucine rich repeat containing 25 sense primer <400> 43 ccactcccga ctatgagaac a 21 <210> 44 <211> 20 <212> DNA <213> Leucine rich repeat containing 25 antisense primer <400> 44 ttgtcctctg aagggtgagc 20 <210> 45 <211> 24 <212> DNA <213> Regulator of G-protein signaling 10 sense primer <400> 45 ccgtgccggg tttatcattg cttt 24 <210> 46 <211> 24 <212> DNA <213> Regulator of G-protein signaling 10 antisense primer <400> 46 tcgacgtgtc cagtgttgaa ggaa 24 <210> 47 <211> 24 <212> DNA <213> CD109 molecule sense primer <400> 47 gccaagattt accacgtttg ccca 24 <210> 48 <211> 24 <212> DNA <213> CD109 molecule antisense primer <400> 48 tgaaggacca gaactgagcc acat 24 <210> 49 <211> 22 <212> DNA <213> Histone 1, H1c sense primer <400> 49 accaaaccta agaagccagt tg 22 <210> 50 <211> 20 <212> DNA <213> Histone 1, H1c antisense primer <400> 50 tagcgctctt cttcggagtt 20 <210> 51 <211> 24 <212> DNA <213> Receptor (calcitonin) activity modifying protein 1 sense primer <400> 51 aagaagagct cacaggagtc caga 24 <210> 52 <211> 24 <212> DNA <213> Receptor (calcitonin) activity modifying protein 1 antisense primer <400> 52 accctttcca gaggtaagtc aagg 24 <210> 53 <211> 20 <212> DNA <213> Pleckstrin homology-like domain, family A, member 3 sense primer <400> 53 ctacccacca cctcagtgct 20 <210> 54 <211> 20 <212> DNA <213> Pleckstrin homology-like domain, family A, member 3 antisense primer <400> 54 ctcgtccatt ccttcagctc 20 <210> 55 <211> 20 <212> DNA <213> Leucine-rich repeats and death domain containing sense primer <400> 55 ggggtgacct ggagacctac 20 <210> 56 <211> 18 <212> DNA <213> Leucine-rich repeats and death domain containing antisense primer <400> 56 ctggcagtga gcccagag 18 <210> 57 <211> 18 <212> DNA <213> Histone 1, H1e sense primer <400> 57 accccaaaga aggcgaag 18 <210> 58 <211> 18 <212> DNA <213> Histone 1, H1e antisense primer <400> 58 gcctttttcg ggcttttc 18 <210> 59 <211> 24 <212> DNA <213> Wingless-type MMTV integration site family, member 11 sense primer <400> 59 ttcacttgga agccaccagg aaca 24 <210> 60 <211> 24 <212> DNA <213> Wingless-type MMTV integration site family, member 11 antisense primer <400> 60 tggccctgaa aggtcaagtc tgta 24 <210> 61 <211> 22 <212> DNA <213> Spindle pole body component 25 homolog (S. cerevisiae) sense primer <400> 61 gaatggttga gatgtttctg ga 22 <210> 62 <211> 27 <212> DNA <213> Spindle pole body component 25 homolog (S. cerevisiae) antisense primer <400> 62 gcaatcaatt ttaacaagtt atccttt 27 <210> 63 <211> 24 <212> DNA ATP-binding cassette, sub-family B (MDR / TAP), member 10 sense primer <400> 63 tcagcctttc cattccgtca ggat 24 <210> 64 <211> 24 <212> DNA <213> ATP-binding cassette, sub-family B (MDR / TAP), member 10 antisense primer <400> 64 tttggatctc agccacactg ggtt 24 <210> 65 <211> 24 <212> DNA <213> KIAA1641 sense primer <400> 65 aaggagggac aacaatctgg gaca 24 <210> 66 <211> 24 <212> DNA <213> KIAA1641 antisense primer <400> 66 tcacttgtag cctttgaggg tggt 24 <210> 67 <211> 20 <212> DNA <213> Solute carrier family 22 (extraneuronal monoamine transporter), member 3 sense primer <400> 67 gccctgttcc agcaataaga 20 <210> 68 <211> 20 <212> DNA <213> Solute carrier family 22 (extraneuronal monoamine transporter), member 3 antisense primer <400> 68 gagagccaaa aatgtcccaa 20 <210> 69 <211> 20 <212> DNA <213> Zinc finger protein 479 sense primer <400> 69 atggtagcca aacacccagt 20 <210> 70 <211> 20 <212> DNA <213> Zinc finger protein 479 antisense primer <400> 70 tgaatctttg atgccctgct 20 <210> 71 <211> 24 <212> DNA <213> PDZ binding kinase sense primer <400> 71 tctggactga gagtggcttt caca 24 <210> 72 <211> 24 <212> DNA <213> PDZ binding kinase antisense primer <400> 72 agccaagctt ctgcataaac ggag 24 <210> 73 <211> 24 <212> DNA <213> Cell division cycle associated 1 sense primer <400> 73 tgccttcatg tcagttggaa gtgc 24 <210> 74 <211> 24 <212> DNA <213> Cell division cycle associated 1 antisense primer <400> 74 tttggtcctc caagttcagg ctct 24 <210> 75 <211> 24 <212> DNA <213> Leucine rich repeat containing 40 sense primer <400> 75 tgccgcagtg tgtctggaga ataa 24 <210> 76 <211> 24 <212> DNA <213> Leucine rich repeat containing 40 antisense primer <400> 76 tgctcccacc atctttcagt agca 24 <210> 77 <211> 24 <212> DNA <213> Glypican 6 sense primer <400> 77 acactgacca gctcaagcca tttg 24 <210> 78 <211> 24 <212> DNA <213> Glypican 6 antisense primer <400> 78 gacaaaggtc ctggcagcaa tgaa 24 <210> 79 <211> 32 <212> DNA <213> MAD2 mitotic arrest deficient-like 1 (yeast) sense primer <400> 79 acttaaatat ctccctacct atactgagtc aa 32 <210> 80 <211> 30 <212> DNA <213> MAD2 mitotic arrest deficient-like 1 (yeast) antisense primer <400> 80 tagtaactgt agatggaaaa acttgtgcta 30 <210> 81 <211> 20 <212> DNA <213> High-mobility group box 2 sense primer <400> 81 cttggcacga tatgcagcaa 20 <210> 82 <211> 25 <212> DNA <213> High-mobility group box 2 antisense primer <400> 82 cagccaaaga taaacaacca tatga 25 <210> 83 <211> 18 <212> DNA <213> Ubiquitin-like, containing PHD and RING finger domains, 1 sense primer <400> 83 ctggtacgac gcggagat 18 <210> 84 <211> 21 <212> DNA <213> Ubiquitin-like, containing PHD and RING finger domains, 1 antisense primer <400> 84 cgacagtcgt tcagagaatc a 21 <210> 85 <211> 20 <212> DNA <213> Solute carrier organic anion transporter family, member 4C1 sense primer <400> 85 ccagcttcgc agctactctt 20 <210> 86 <211> 22 <212> DNA <213> Solute carrier organic anion transporter family, member 4C1 antisense primer <400> 86 ccacctaaaa tttgaccgag ag 22 <210> 87 <211> 22 <212> DNA <213> Kinetochore associated 2 sense primer <400> 87 tgctacacat gttgggtctg ta 22 <210> 88 <211> 21 <212> DNA <213> Kinetochore associated 2 antisense primer <400> 88 ccgagagatc ttctgacatg c 21 <210> 89 <211> 24 <212> DNA <213> Centrosomal protein 55kDa sense primer <400> 89 gctgtgcatt tctcttggca gtga 24 <210> 90 <211> 24 <212> DNA <213> Centrosomal protein 55kDa antisense primer <400> 90 tagacgctgc tcaccacatt ctgt 24 <210> 91 <211> 22 <212> DNA <213> Topoisomerase (DNA) II alpha 170kDa sense primer <400> 91 ctagttaatg ctgcggacaa ca 22 <210> 92 <211> 21 <212> DNA <213> Topoisomerase (DNA) II alpha 170kDa antisense primer <400> 92 catttcgacc acctgtcact t 21 <210> 93 <211> 24 <212> DNA <213> TTK protein kinase sense primer <400> 93 tcatgcccat ttggaagagt ccca 24 <210> 94 <211> 24 <212> DNA <213> TTK protein kinase antisense primer <400> 94 aggcacaacc aaatctcggc attc 24 <210> 95 <211> 20 <212> DNA Meitic nuclear divisions 1 homolog (S. cerevisiae) sense primer <400> 95 ttcgagacca aagggaacag 20 <210> 96 <211> 23 <212> DNA Meiotic nuclear divisions 1 homolog (S. cerevisiae) antisense primer <400> 96 ctttggctac tttatttgct tgg 23  

Claims (15)

하기의 군으로부터 선택되는 유전자를 포함하는 다이벤조에이에이취안트라센에 대한 노출 여부 확인용 바이오마커: A biomarker for confirming the exposure to dibenzoaichanthracene comprising a gene selected from the following groups: 유전자 등록번호(Genebank) AB209605(SKIV2L, Superkiller viralicidic activity 2-like(S. cerevisiae)), 유전자 등록번호(Genebank) AI200373(HIST1H2AL, Histone 1, H2al), 유전자 등록번호(Genebank) 호(Genebank) AK057577(IRF3, Interferon regulatory factor 3), 유전자 등록번호(Genebank) AL832659(FLJ22833, Hypothetical protein FLJ22833), 유전자 등록번호(Genebank) BC034487(HIST1H2AK, Histone 1, H2ak), 유전자 등록번호(Genebank) BC034569(ZNF337, Zinc finger protein 337), 유전자 등록번호(Genebank) BC038432(RARA, Retinoic acid receptor, alpha), 유전자 등록번호(Genebank) BC067782(HIST1H2AG, Histone 1, H2ag), 유전자 등록번호(Genebank) BC069193(HIST2H2BE, Histone 2, H2be), 유전자 등록번호(Genebank) BC071638(HIST2H2BE, Histone 2, H2be), 유전자 등록번호(Genebank) BC082232(HIST1H2BG, Histone 1, H2bg), 유전자 등록번호(Genebank) BC101655(HIST1H2BI, Histone 1, H2bi), 유전자 등록번호(Genebank) BE741093(HIST1H2AE ,Histone 1, H2ae), 유전자 등록번호(Genebank) BE973853(HIST1H4J, Histone 1, H4j), 유전자 등록번호(Genebank) BM752802(HIST1H2BM, Histone 1, H2bm), 유전자 등록번호(Genebank) BM919305(POLR2L, Polymerase(RNA) II(DNA directed) polypeptide L, 7.6kDa), 유전자 등록번호(Genebank) BU603483(HIST1H1E, Histone 1, H1e), 유전자 등록번호(Genebank) BX436525(HIST1H2BH, Histone 1, H2bh), 유전자 등록번호(Genebank) BX647290(HIST1H2BO, Histone 1, H2bo), 유전자 등록번호(Genebank) CB529694(HIST2H2BE, Histone 2, H2be), 유전자 등록번호(Genebank) CD710576(HIST2H2AC, Histone 2, H2ac), 유전자 등록번호(Genebank) CK000930(HIST1H2AI, Histone 1, H2ai), 유전자 등록번호(Genebank) CR608156(HIST1H2AC, Histone 1, H2ac), 유전자 등록번호(Genebank) NM_002515(NOVA1, Neuro-oncological ventral antigen 1), 유전자 등록번호(Genebank) NM_003516(HIST2H2AA, Histone 2, H2aa), 유전자 등록번호(Genebank) NM_003519(HIST1H2BL, Histone 1, H2bl), 유전자 등록번호(Genebank) NM_003670(BHLHB2, Basic helix-loop-helix domain containing, class B, 2), 유전자 등록번호(Genebank) NM_004660(DDX3Y, DEAD(Asp-Glu-Ala-Asp) box polypeptide 3, Y-linked), 유전자 등록번호(Genebank) NM_005319(HIST1H1C, Histone 1, H1c), 유전자 등록번호(Genebank) NM_005320(HIST1H1D, Histone 1, H1d), 유전자 등록번호(Genebank) NM_005524(HES1, Hairy and enhancer of split 1,(Drosophila)), 유전자 등록번호(Genebank) NM_006442(DRAP1, DR1-associated protein 1(negative cofactor 2 alpha)), 유전자 등록번호(Genebank) NM_021035 (KIAA1404, KIAA1404 protein), 유전자 등록번호(Genebank) U86136(TEP1, Telomerase-associated protein 1), 유전자 등록번호(Genebank) AB209586(MAPK13, Mitogen- activated protein kinase 13), 유전자 등록번호(Genebank) AK074652(SERTAD1, SERTA domain containing 1), 유전자 등록번호(Genebank) AK122829(GAS2L1, Growth arrest-specific 2 like 1), 유전자 등록번호(Genebank) AK129595(GADD45B, Growth arrest and DNA-damage-inducible, beta), 유전자 등록번호(Genebank) BC018266(CDC42, Cell division cycle 42(GTP binding protein, 25kDa)), 유전자 등록번호(Genebank) BC041022(SCAND1, SCAN domain containing 1), 유전자 등록번호(Genebank) BM904612(S100A6, S100 calcium binding protein A6(calcyclin)), 유전자 등록번호(Genebank) BM913048(TIMP1, TIMP metallopeptidase inhibitor 1), 유전자 등록번호(Genebank) CR612719(GADD45A, Growth arrest and DNA-damage-inducible, alpha), 유전자 등록번호(Genebank) NM_001007271(DUSP13, Dual specificity phosphatase 13), 유전자 등록번호(Genebank) NM_001015053(HDAC5, Histone deacetylase 5), 유전자 등록번호(Genebank) NM_001953(ECGF1, Endothelial cell growth factor 1(platelet-derived)), 유전자 등록번호(Genebank) NM_003255(TIMP2, TIMP metallopeptidase inhibitor 2), 유전자 등록번호(Genebank) NM_005072(SLC12A4, Solute carrier family 12(potassium/chloride transporters), member 4), 유전자 등록번호(Genebank) NM_005343(HRAS, V-Ha-ras Harvey rat sarcoma viral oncogene homolog), 유전자 등록번호(Genebank) NM_005736(ACTR1A, ARP1 actin-related protein 1 homolog A, centractin alpha(yeast)), 유전자 등록번호(Genebank) NM_007065(CDC37, CDC37 cell division cycle 37 homolog(S. cerevisiae)), 유전자 등록번호(Genebank) NM_078467(CDKN1A, Cyclin-dependent kinase inhibitor 1A(p21, Cip1)), 유전자 등록번호(Genebank) U68019(SMAD3, SMAD, mothers against DPP homolog 3(Drosophila)), 유전자 등록번호(Genebank) X02812(TGFB1, Transforming growth factor, beta 1(Camurati-Engelmann disease)), 유전자 등록번호(Genebank) AB033060(PDCD6, Aryl-hydrocarbon receptor repressor), 유전자 등록번호(Genebank) AB209361(FAS, Fas(TNF receptor superfamily, member 6)), 유전자 등록번호(Genebank) AF332558(BBC3, BCL2 binding component 3), 유전자 등록번호(Genebank) AY028896(CARD10, Caspase recruitment domain family, member 10), 유전자 등록번호(Genebank) BC063507(HSPA1B, Heat shock 70kDa protein 1B), 유전자 등록번호(Genebank) BM557864(HSPB1, Heat shock 27kDa protein 1), 유전자 등록번호(Genebank) NM_001003940(BMF ,Bcl2 modifying factor), 유전자 등록번호(Genebank) NM_001165(BIRC3, Baculoviral IAP repeat-containing 3), 유전자 등록번호(Genebank) NM_001197(BIK, BCL2-interacting killer(apoptosis-inducing)), 유전자 등록번호(Genebank) NM_002305(LGALS1, Lectin, galactoside-binding, soluble, 1(galectin 1)), 유전자 등록번호(Genebank) NM_003311(PHLDA2, Pleckstrin homology-like domain, family A, member 2), 유전자 등록번호(Genebank) NM_003639(IKBKG, Inhibitor of kappa light polypeptide gene enhancer in B-cells, kinase gamma), 유전자 등록번호(Genebank) NM_003820(TNFRSF14, Tumor necrosis factor receptor superfamily, member 14(herpesvirus entry mediator)), 유전자 등록번호(Genebank) NM_003897(IER3, Immediate early response 3), 유전자 등록번호(Genebank) NM_004401(DFFA, DNA fragmentation factor, 45kDa, alpha polypeptide), 유전자 등록번호(Genebank) NM_016639(TNFRSF12A, Tumor necrosis factor receptor superfamily, member 12A), 유전자 등록번호(Genebank) BC048334(MT1G, Metallothionein 1G), 유전자 등록번호(Genebank) BC053882(MT1X, Metallothionein 1X), 유전자 등록번호(Genebank) BI488702(MT1K, Metallothionein 1M), 유전자 등록번호(Genebank) NM_005947(MT1B, Metallothionein 1B(functional)), 유전자 등록번호(Genebank) AK055088(CYP2J2, Cytochrome P450, family 2, subfamily J, polypeptide 2), 유전자 등록번호(Genebank) AK094474(RHOC, Ras homolog gene family, member C), 유전자 등록번호(Genebank) BC015041(VAT1, Family with sequence similarity 82, member C), 유전자 등록번호(Genebank) NM_000499(CYP1A1, Cytochrome P450, family 1, subfamily A, polypeptide 1), 유전자 등록번호(Genebank) NM_004881(TP53I3, Tumor protein p53 inducible protein 3), 유전자 등록번호(Genebank) NM_201397(GPX1, Glutathione peroxidase 1), 유전자 등록번호(Genebank) XM_498018(LOC391827, Similar to Keratin, type I cytoskeletal 18(Cytokeratin 18)(K18)(CK 18)), 유전자 등록번호(Genebank) AF524864(AKR1B10, Aldo-keto reductase family 1, member B10(aldose reductase)), 유전자 등록번호(Genebank) AL833205(ETFB, Electron-transfer-flavoprotein, beta polypeptide), 유전자 등록번호(Genebank) BC034763(FDXR, Ferredoxin reductase), 유전자 등록번호(Genebank) CR610878(AKR1B1, Aldo-keto reductase family 1, member B1(aldose reductase)), 유전자 등록번호(Genebank) NM_003330(TXNRD1, Thioredoxin reductase 1), 유전자 등록번호(Genebank) NM_004199(P4HA2, Procollagen-proline, 2-oxoglutarate 4-dioxygenase(proline 4-hydroxylase), alpha polypeptide II), 유전자 등록번호(Genebank) NM_004753(DHRS3, Dehydrogenase/reductase(SDR family) member 3), 유전자 등록번호(Genebank) NM_031226(CYP19A1, Cytochrome P450, family 19, subfamily A, polypeptide 1), 유전자 등록번호(Genebank) NM_032468(ASPH, Aspartate beta-hydroxylase), 유전자 등록번호(Genebank) AB209112(SLC2A8, Solute carrier family 2,(facilitated glucose transporter) member 8), 유전자 등록번호(Genebank) BC011409(UGT1A6, UDP glucuronosyltransferase 1 family, polypeptide A9), 유전자 등록번호(Genebank) H18681(C20orf139, Sulfiredoxin 1 homolog(S. cerevisiae)), 유전자 등록번호(Genebank) NM_002658(PLAU, Plasminogen activator, urokinase), 유전자 등록번호(Genebank) NM_005064(CCL23, Chemokine(C-C motif) ligand 23), 유전자 등록번호(Genebank) NM_032965(CCL14, Chemokine(C-C motif) ligand 15), 유전자 등록번호(Genebank) Y11307(CYR61, Cysteine-rich, angiogenic inducer, 61), 유전자 등록번호(Genebank) AB209808(AP1M1, Adaptor-related protein complex 1, mu 1 subunit), 유전자 등록번호(Genebank) AK074154(SYTL1, Synaptotagmin-like 1), 유전자 등록번호(Genebank) AK098475(GRPEL1, GrpE-like 1, mitochondrial(E. coli)), 유전자 등록번호(Genebank) AK123405(GDI1, GDP dissociation inhibitor 1), 유전자 등록번 호(Genebank) BC000786(ARFGAP1, ADP-ribosylation factor GTPase activating protein 1), 유전자 등록번호(Genebank) BC042390(VTI1B, Vesicle transport through interaction with t-SNAREs homolog 1B(yeast)), 유전자 등록번호(Genebank) BG036385(RAMP1, Receptor(calcitonin) activity modifying protein 1), 유전자 등록번호(Genebank) BX648781(GABARAPL1, GABA(A) receptor-associated protein like 1), 유전자 등록번호(Genebank) NM_001013839(EXOC7, Exocyst complex component 7), 유전자 등록번호(Genebank) NM_002926(RGS12, Regulator of G-protein signalling 12), 유전자 등록번호(Genebank) NM_007097(CLTB, Clathrin, light polypeptide(Lcb)), 유전자 등록번호(Genebank) NM_013336(SEC61A1, Sec61 alpha 1 subunit(S. cerevisiae)), 유전자 등록번호(Genebank) NM_024101(MLPH, Melanophilin), 유전자 등록번호(Genebank) NM_032872(SYTL1, Synaptotagmin-like 1), 유전자 등록번호(Genebank) NM_000596(IGFBP1, Insulin-like growth factor binding protein 1), 유전자 등록번호(Genebank) NM_001553(IGFBP7, Insulin-like growth factor binding protein 7), 유전자 등록번호(Genebank) NM_001712(CEACAM1, Carcinoembryonic antigen-related cell adhesion molecule 1(biliary glycoprotein)), 유전자 등록번호(Genebank) NM_012396(PHLDA3, Pleckstrin homology-like domain, family A, member 3), 유전자 등록번호(Genebank) Y12692(WNT11, Wingless-type MMTV integration site family, member 11), 유전자 등록번호(Genebank) BC014470(AZGP1, Alpha-2-glycoprotein 1, zinc), 유전자 등록번호(Genebank) BQ683841(S100A11, S100 calcium binding protein A11(calgizzarin)), 유전자 등록번호(Genebank) NM_002337(LRPAP1, Low density lipoprotein receptor-related protein associated protein 1), 유전자 등록번호(Genebank) AF059617(PLK2, Polo-like kinase 2(Drosophila)), 유전자 등록번호(Genebank) AK128553(ZZANK1, Mindbomb homolog 2(Drosophila)), 유전자 등록번호(Genebank) BX649164(PAI; PAI1; PAI-1; PLANH1, serpin peptidase inhibitor, clade E(nexin, plasminogen activator inhibitor type 1), member 1), 유전자 등록번호(Genebank) NM_000602(SERPINE1, Serpin peptidase inhibitor, clade E(nexin, plasminogen activator inhibitor type 1), member 1), 유전자 등록번호(Genebank) BI767815(GP9, Glycoprotein IX(platelet)), 유전자 등록번호(Genebank) BM918324(LY96, Lymphocyte antigen 96), 유전자 등록번호(Genebank) NM_006404(PROCR, Protein C receptor, endothelial(EPCR)), 유전자 등록번호(Genebank) AF031469(MR1, Major histocompatibility complex, class I-related), 유전자 등록번호(Genebank) BF569086(NK4, Interleukin 32), 유전자 등록번호(Genebank) BG564326(SAA4, Serum amyloid A4, constitutive), 유전자 등록번호(Genebank) NM_001633(AMBP, Alpha-1-microglobulin/bikunin precursor), 유전자 등록번호(Genebank) NM_005532(IFI27, Interferon, alpha-inducible protein 27), 유전자 등록번호(Genebank) NM_017670(OTUB1, OTU domain, ubiquitin aldehyde binding 1), 유전자 등록번호(Genebank) AK130130(CAPG, Capping protein(actin filament), gelsolin-like), 유전자 등록번호(Genebank) BX648190(WDR1, WD repeat domain 1), 유전자 등록번호(Genebank) CF552540(TNNI2, Troponin I type 2(skeletal, fast)), 유전자 등록번호(Genebank) NM_001006946(SDC1, Syndecan 1), 유전자 등록번호(Genebank) NM_007284(PTK9L, PTK9L protein tyrosine kinase 9-like(A6-related protein)), 유전자 등록번호(Genebank) NM_015990(KLHL5, Kelch-like 5(Drosophila)), 유전자 등록번호(Genebank) BM467105(CIB1, Calcium and integrin binding 1(calmyrin)), 유전자 등록번호(Genebank) CF553054(TNNC1, Troponin C type 1(slow)), 유전자 등록번호(Genebank) NM_006384(CIB1, Calcium and integrin binding 1(calmyrin)), 유전자 등록번호(Genebank) NM_080388(S100A16, S100 calcium binding protein A16), 유전자 등록번호(Genebank) NM_005817(M6PRBP1, Mannose-6-phosphate receptor binding protein 1), 유전자 등록번호(Genebank) NM_006555(YKT6, SNARE protein Ykt6), 유전자 등록번호(Genebank) AK093461(ISYNA1, Myo-inositol 1-phosphate synthase A1), 유전자 등록번호(Genebank) AK097009(PLTP,phospholipid transfer protein), 유전자 등록번호(Genebank) BC030207(NR0B2, Nuclear receptor subfamily 0, group B, member 2), 유전자 등록번호(Genebank) BC035124(UNQ2541, MSFL2541), 유전자 등록번호(Genebank) NM_145323(OSBPL3, Oxysterol binding protein-like 3), 유전자 등록번호(Genebank) BC050455(DDB2, LIM homeobox 3), 유전자 등록번호(Genebank) BC068535(TP53AP1, TP53 activated protein 1), 유전자 등록번호(Genebank) NM_016440(VRK3, Vaccinia related kinase 3), 유전자 등록번호(Genebank) NM_001124(ADM, Adrenomedullin), 유전자 등록번호(Genebank) NM_170707(LMNA, Lamin A/C), 유전자 등록번호(Genebank) NM_004633(IL1R2, Interleukin 1 receptor, type II), 유전자 등록번호(Genebank) NM_004864(GDF15, Growth differentiation factor 15), 유전자 등록번호(Genebank) NM_017572(MKNK2, MAP kinase interacting serine/threonine kinase 2), 유전자 등록번호(Genebank) AA669162(AMPD3, Transcribed locus), 유전자 등록번호(Genebank) AB033073(SULF2, Sulfatase 2), 유전자 등록번호(Genebank) AB208949(LRDD, Leucine-rich repeats and death domain containing), 유전자 등록번호(Genebank) AK022712(FLJ12650, Family with sequence similarity 77, member C), 유전자 등록번호(Genebank) AK095363(AQP3, Aquaporin 3), 유전자 등록번호(Genebank) AY368150(CHR2SYT, Family with sequence similarity 62(C2 domain containing) member B), 유전자 등록번호(Genebank) BU587578(RGS10, Regulator of G-protein signalling 10), 유전자 등록번호(Genebank) BU945318(MT2A, Hypothetical gene supported by X97260; BC070289), 유전자 등록번호(Genebank) NM_001013632(LOC343521, Similar to hypothetical protein 4833401D15), 유전자 등록번호(Genebank) NM_006426(DPYSL4, Dihydropyrimidinase-like 4), 유전자 등록번호(Genebank) NM_133493(CD109, CD109 antigen(Gov platelet alloantigens)), 유전자 등록번호(Genebank) NM_145256(LRRC25, Leucine rich repeat containing 25), 유전자 등록번호(Genebank) AB033337(MPHOSPH1,M-phase phosphoprotein 1), 유전자 등록번호(Genebank) AB208875(Septin 10,Septin 10 ), 유전자 등록번호(Genebank) AF053305(BUB1,BUB1 budding uninhibited by benzimidazoles 1 homolog(yeast)), 유전자 등록번호(Genebank) AF053306(BUB1B,BUB1 budding uninhibited by benzimidazoles 1 homolog beta(yeast)), 유전자 등록번호(Genebank) AF345347(SPAG5,Sperm associated antigen 5), 유전자 등록번호(Genebank) AK222819(NUSAP1,Nucleolar and spindle associated protein 1), 유전자 등록번호(Genebank) AY367065(ASPM,Asp(abnormal spindle)-like, microcephaly associated(Drosophila)), 유전자 등록번호(Genebank) BC004352(KIF22,Kinesin family member 22), 유전자 등록번호(Genebank) BC010607(IGF1R,Insulin-like growth factor 1 receptor), 유전자 등록번호(Genebank) BC011000(CDCA5,Cell division cycle associated 5), 유전자 등록번호(Genebank) BC013326(GAS2,Growth arrest-specific 2), 유전자 등록번호(Genebank) BC032677(UBE2C,Ubiquitin-conjugating enzyme E2C), 유전자 등록번호(Genebank) BC040991(TFDP2,Transcription factor Dp-2(E2F dimerization partner 2)), 유전자 등록번호(Genebank) BC050384(SUPT3H,Suppressor of Ty 3 homolog(S. cerevisiae)), 유전자 등록번호(Genebank) BC068483(RINT-1,Rad50-interacting protein 1), 유전자 등록번호(Genebank) BQ278454(CKS1B,CDC28 protein kinase regulatory subunit 1B), 유전자 등록번호(Genebank) BX647885(STMN1,Stathmin 1/oncoprotein 18), 유전자 등록번호(Genebank) CR604810(CCNA2,Cyclin A2), 유전자 등록번호(Genebank) CR933728(CDC2,Cell division cycle 2, G1 to S and G2 to M), 유전자 등록번호(Genebank) D42045(DCLRE1A,DNA cross-link repair 1A(PSO2 homolog, S. cerevisiae)), 유전자 등록번호(Genebank) NM_00089(HK2,Hexokinase 2), 유전자 등록번호(Genebank) NM_001005414(ZWINT,ZW10 interactor antisense), 유전자 등록번호(Genebank) NM_001018159(APPBP1,Amyloid beta precursor protein binding protein 1), 유전자 등록번호(Genebank) NM_001239(CCNH,Cyclin H), 유전자 등록번호(Genebank) NM_001790(CDC25C,Cell division cycle 25C), 유전자 등록번호(Genebank) NM_001827(CKS2,CDC28 protein kinase regulatory subunit 2), 유전자 등록번호(Genebank) NM_002431(MNAT1,Menage a trois 1(CAK assembly factor)), 유전자 등록번호(Genebank) NM_002467(MYC,V-myc myelocytomatosis viral oncogene homolog(avian)), 유전자 등록번호(Genebank) NM_002709(PPP1CB,Protein phosphatase 1, catalytic subunit, beta isoform), 유전자 등록번호(Genebank) NM_002737(PRKCA,Protein kinase C, alpha), 유전자 등록번호(Genebank) NM_002894(RBBP8,Retinoblastoma binding protein 8), 유전자 등록번호(Genebank) NM_003318(TTK,TTK protein kinase), 유전자 등록번호(Genebank) NM_003478(CUL5,Cullin 5), 유전자 등록번호(Genebank) NM_003981(PRC1,Protein regulator of cytokinesis 1), 유전자 등록번호(Genebank) NM_004064(CDKN1B,Cyclin-dependent kinase inhibitor 1B(p27, Kip1)), 유전자 등록번호(Genebank) NM_004354(CCNG2,Cyclin G2), 유전자 등록번호(Genebank) NM_004365(CETN3,Centrin, EF-hand protein, 3(CDC31 homolog, yeast)), 유전자 등록번호(Genebank) NM_004523(KIF11,Kinesin family member 11), 유전자 등록번호(Genebank) NM_004701(CCNB2,Cyclin B2), 유전자 등록번호(Genebank) NM_005504(BCAT1,Branched chain aminotransferase 1, cytosolic), 유전자 등록번호(Genebank) NM_005915(MCM6,MCM6 minichromosome maintenance deficient 6(MIS5 homolog, S. pombe)(S. cerevisiae)), 유전자 등록번호(Genebank) NM_006101(KNTC2,Kinetochore associated 2), 유전자 등록번호(Genebank) NM_006265(RAD21,RAD21 homolog(S. pombe)), 유전자 등록번호(Genebank) NM_014750(DLG7,Discs, large homolog 7(Drosophila)), 유전자 등록번호(Genebank) NM_014751(MTSS1,Metastasis suppressor 1), 유전자 등록번호(Genebank) NM_016343(CENPF,Centromere protein F, 350/400ka(mitosin)), 유전자 등록번호(Genebank) NM_018492(PBK,PDZ binding kinase), 유전자 등록번호(Genebank) NM_018685(ANLN,Anillin, actin binding protein(scraps homolog, Drosophila)), 유전자 등록번호(Genebank) NM_019001(XRN1,5'-3' exoribonuclease 1), 유전자 등록번호(Genebank) NM_019063(EML4,Echinoderm microtubule associated protein like 4), 유전자 등록번호(Genebank) NM_020242(KNSL7,Kinesin family member 15), 유전자 등록번호(Genebank) U65410(MAD2L1,MAD2 mitotic arrest deficient-like 1(yeast)), 유전자 등록번호(Genebank) AB096175(SP5,Sp5 transcription factor), 유전자 등록번호(Genebank) AB209086(ZNF493,Zinc finger protein 493), 유전자 등록번호(Genebank) AB209334(SP3,Sp3 transcription factor), 유전자 등록번호(Genebank) AB209892(ZFX,Zinc finger protein, X-linked), 유전자 등록번호(Genebank) AF279145(ANTXR1,Anthrax toxin receptor 1), 유전자 등록번호(Genebank) AK095600(FLJ38281,Zinc finger protein 564), 유전자 등록번호(Genebank) AK123010(RRM2,Ribonucleotide reductase M2 polypeptide), 유전자 등록번호(Genebank) AK126180(DTYMK,Deoxythymidylate kinase(thymidylate kinase)), 유전자 등록번호(Genebank) AK130071(HSPC063,BTB(POZ) domain containing 15), 유전자 등록번호(Genebank) AK131420(ZNF66,Zinc finger protein 66), 유전자 등록번호(Genebank) AK131472(Homo sapiens cDNA FLJ16640 fis, clone TESTI4028938, moderately similar to Zinc finger protein 85. [AK131472],CDNA FLJ16640 fis, clone TESTI4028938, moderately similar to Zinc finger protein 85), 유전자 등록번호(Genebank) AK131527(ZNF15L1,Zinc finger protein 708(KOX8)), 유전자 등록번호(Genebank) AK160373(DKFZp547K1113,Zinc finger protein 710), 유전자 등록번호(Genebank) AL832422(ZNF430,Zinc finger protein 430), 유전자 등록번호(Genebank) AY269786(ZNF429,Zinc finger protein 429), 유전자 등록번호(Genebank) BC035579(ZNF100,Zinc finger protein 100), 유전자 등록번호(Genebank) BC036394(ZNF85,Zinc finger protein 85(HPF4, HTF1)), 유전자 등록번호(Genebank) BM466459(DGKI,Diacylglycerol kinase, iota), 유전자 등록번호(Genebank) BX537574(FREM1,FRAS1 related extracellular matrix 1), 유전자 등록번호(Genebank) BX537987(TRIM59,Tripartite motif-containing 59), 유전자 등록번호(Genebank) BX648469(ATF2,Activating transcription factor 2), 유전자 등록번호(Genebank) CR608275(CBLL1,Cas-Br-M(murine) ecotropic retroviral transforming sequence-like 1), 유전자 등록번호(Genebank) CR749233(ZNF626,Zinc finger protein 626), 유전자 등록번호(Genebank) CR749832(IMPDH1,IMP(inosine monophosphate) dehydrogenase 1), 유전자 등록번호(Genebank) CR936615(MATR3,Matrin 3), 유전자 등록번호(Genebank) NM_000946(PRIM1,Primase, polypeptide 1, 49kDa), 유전자 등록번호(Genebank) NM_001123(ADK,Adenosine kinase), 유전자 등록번호(Genebank) NM_002317(LOX,Lysyl oxidase), 유전자 등록번호(Genebank) NM_002655(PLAG1,Pleiomorphic adenoma gene 1), 유전자 등록번호(Genebank) NM_003423(ZNF43,Zinc finger protein 43(HTF6)), 유전자 등록번호(Genebank) NM_005180(PCGF4,Polycomb group ring finger 4), 유전자 등록번호(Genebank) NM_014615(KIAA0182,KIAA0182 protein), 유전자 등록번호(Genebank) NM_014919(WHSC1,Wolf-Hirschhorn syndrome candidate 1), 유전자 등록번호(Genebank) NM_015040(PIP5K3,Phosphatidylinositol-3-phosphate/phosphatidylinositol 5-kinase, type III), 유전자 등록번호(Genebank) NM_015387(PREI3,Preimplantation protein 3), 유전자 등록번호(Genebank) NM_015905(TIF1,Tripartite motif-containing 24), 유전자 등록번호(Genebank) NM_016513(ICK,Intestinal cell(MAK-like) kinase), 유전자 등록번호(Genebank) NM_016626(RKHD2,Ring finger and KH domain containing 2), 유전자 등록번호(Genebank) NM_018660(ZNF395,Zinc finger protein 395), 유전자 등록번호(Genebank) NM_021129(PP,Pyrophosphatase(inorganic) 1), 유전자 등록번호(Genebank) NM_025074(FRAS1,Fraser syndrome 1), 유전자 등록번호(Genebank) NM_173694(ATP11C,ATPase, Class VI, type 11C), 유전자 등록번호(Genebank) NM_176869(PPA2,Pyrophosphatase(inorganic) 2), 유전자 등록번호(Genebank) NM_182851(CCNB1IP1,Cyclin B1 interacting protein 1), 유전자 등록번호(Genebank) NM_199040(NUDT4,Nudix(nucleoside diphosphate linked moiety X)- type motif 4 pseudogene 2), 유전자 등록번호(Genebank) AK122869(LOC148213,Zinc finger protein 681), 유전자 등록번호(Genebank) BC042500(MGC42493,Hypothetical protein MGC15634), 유전자 등록번호(Genebank) BC043147(ZNF539,Zinc finger protein 254), 유전자 등록번호(Genebank) BC044060(ZNF650,Zinc finger protein 650), 유전자 등록번호(Genebank) BC050340(ZNF230,Zinc finger protein 230), 유전자 등록번호(Genebank) CR749800(ZNFN1A5,Zinc finger protein, subfamily 1A, 5), 유전자 등록번호(Genebank) CR936695(ZNF468,Zinc finger protein ZNF468), 유전자 등록번호(Genebank) NM_001009881(ZCCHC11,Zinc finger, CCHC domain containing 11), 유전자 등록번호(Genebank) NM_003441(ZNF141,Zinc finger protein 141(clone pHZ-44)), 유전자 등록번호(Genebank) NM_006526(ZNF217,Zinc finger protein 217), 유전자 등록번호(Genebank) NM_007146(ZNF161,Zinc finger protein 161), 유전자 등록번호(Genebank) NM_015336(ZDHHC17,Zinc finger, DHHC-type containing 17), 유전자 등록번호(Genebank) NM_016220(ZNF588,Zinc finger protein 588), 유전자 등록번호(Genebank) NM_017742(ZCCHC2,Zinc finger, CCHC domain containing 2), 유전자 등록번호(Genebank) NM_021994(ZNF277,Zinc finger protein 277), 유전자 등록번호(Genebank) NM_024733(FLJ14345,Zinc finger protein 665), 유전자 등록번호(Genebank) NM_032367(ZBED3,Zinc finger, BED-type containing 3), 유전자 등록번호(Genebank) NM_033114(MADP-1,MADP-1 protein), 유전자 등록번호(Genebank) NM_133473(ZNF431,Zinc finger protein 431), 유전자 등록번호(Genebank) NM_152626(ZNF92,Zinc finger protein 92(HTF12)), 유전자 등록 번호(Genebank) NM_178558(FLJ90430,Zinc finger protein 680), 유전자 등록번호(Genebank) NM_198893(ZNF160,Zinc finger protein 160), 유전자 등록번호(Genebank) XM_047550(ZNF492,Zinc finger protein 492), 유전자 등록번호(Genebank) XM_290865(LOC163233,Similar to Zinc finger protein 93(Zinc finger protein HTF34)), 유전자 등록번호(Genebank) XM_371174(ZNF283,Zinc finger protein 283), 유전자 등록번호(Genebank) AB023141(ZNF652,Zinc finger protein 652), 유전자 등록번호(Genebank) AB209245(HMGN1,High-mobility group nucleosome binding domain 1), 유전자 등록번호(Genebank) AB209389(GTF2IRD1,GTF2I repeat domain containing 1), 유전자 등록번호(Genebank) AB209562(HNRPK,Heterogeneous nuclear ribonucleoprotein K), 유전자 등록번호(Genebank) AB209753(RBM7,RNA binding motif protein 7), 유전자 등록번호(Genebank) AF136171(EAP; HBP15; HBP15/L22,ribosomal protein L22), 유전자 등록번호(Genebank) AK001230(POT1,POT1 protection of telomeres 1 homolog(S. pombe)), 유전자 등록번호(Genebank) AK022942(LOC58486,Transposon-derived Buster1 transposase-like protein gene), 유전자 등록번호(Genebank) AK025758(NFATC2,Nuclear factor of activated T-cells, cytoplasmic, calcineurin-dependent 2), 유전자 등록번호(Genebank) AK056803(H2AFZ,H2A histone family, member Z), 유전자 등록번호(Genebank) AK074119(ZZZ3,Zinc finger, ZZ-type containing 3), 유전자 등록번호(Genebank) AK091927(SFRS3,Splicing factor, arginine/serine-rich 3), 유전자 등록번 호(Genebank) AK095937(GC20,Translation factor sui1 homolog), 유전자 등록번호(Genebank) AK124178(EIF3S6,Eukaryotic translation initiation factor 3, subunit 6 48kDa), 유전자 등록번호(Genebank) AL110212(H2AFV,H2A histone family, member V), 유전자 등록번호(Genebank) BC010266(HNRNPA1; MGC102835,Heterogeneous nuclear ribonucleoprotein A1), 유전자 등록번호(Genebank) BM464978(HMGN2,High-mobility group nucleosomal binding domain 2), 유전자 등록번호(Genebank) BM800367(RPL21,Ribosomal protein L21), 유전자 등록번호(Genebank) BU677381(RPL21,Ribosomal protein L21), 유전자 등록번호(Genebank) BX647205(HNRPH1,Heterogeneous nuclear ribonucleoprotein H1(H)), 유전자 등록번호(Genebank) BX647217(HNRPA3,Heterogeneous nuclear ribonucleoprotein A3), 유전자 등록번호(Genebank) CR625990(PC4,SUB1 homolog(S. cerevisiae)), 유전자 등록번호(Genebank) CR627133(LOC342892,Hypothetical protein LOC342892), 유전자 등록번호(Genebank) NM_000947(PRIM2A,Primase, polypeptide 2A, 58kDa), 유전자 등록번호(Genebank) NM_000983(RPL22,Ribosomal protein L22), 유전자 등록번호(Genebank) NM_001015886(HMGA2,High mobility group AT-hook 2), 유전자 등록번호(Genebank) NM_001017430(RBM3,RNA binding motif(RNP1, RRM) protein 3), 유전자 등록번호(Genebank) NM_001018067(PAI-RBP1,SERPINE1 mRNA binding protein 1), 유전자 등록번호(Genebank) NM_001412(EIF1AX,Eukaryotic translation initiation factor 1A, X-linked), 유전자 등록번호(Genebank) NM_001809(CENPA,Centromere protein A, 17kDa), 유전자 등 록번호(Genebank) NM_002139(RBMX,RNA binding motif protein, X-linked), 유전자 등록번호(Genebank) NM_002568(PABPC1,Poly(A) binding protein, cytoplasmic 1), 유전자 등록번호(Genebank) NM_003972(BTAF1,BTAF1 RNA polymerase II, B-TFIID transcription factor-associated, 170kDa(Mot1 homolog, S. cerevisiae)), 유전자 등록번호(Genebank) NM_004454(ETV5,Ets variant gene 5(ets-related molecule)), 유전자 등록번호(Genebank) NM_005463(HNRPDL,Heterogeneous nuclear ribonucleoprotein D-like), 유전자 등록번호(Genebank) NM_006047(CPNE1,RNA binding motif protein 12), 유전자 등록번호(Genebank) NM_006345(SLC30A9,Solute carrier family 30(zinc transporter), member 9), 유전자 등록번호(Genebank) NM_006451(PAIP1,Poly(A) binding protein interacting protein 1), 유전자 등록번호(Genebank) NM_006546(IMP-1,IGF-II mRNA-binding protein 1), 유전자 등록번호(Genebank) NM_006716(ASK,DBF4 homolog(S. cerevisiae)), 유전자 등록번호(Genebank) NM_006775(QKI,Quaking homolog, KH domain RNA binding(mouse)), 유전자 등록번호(Genebank) NM_007080(LSM6,LSM6 homolog, U6 small nuclear RNA associated(S. cerevisiae)), 유전자 등록번호(Genebank) NM_007208(MRPL3,Mitochondrial ribosomal protein L3), 유전자 등록번호(Genebank) NM_012207(HNRPH3,Heterogeneous nuclear ribonucleoprotein H3(2H9)), 유전자 등록번호(Genebank) NM_014321(ORC6L,Origin recognition complex, subunit 6 homolog-like(yeast)), 유전자 등록번호(Genebank) NM_014393(STAU2,Staufen, RNA binding protein, homolog 2(Drosophila)), 유전자 등록번호(Genebank) NM_014892(RBM16,RNA binding motif protein 16), 유전자 등록번호(Genebank) NM_015361(R3HDM,R3H domain containing 1), 유전자 등록번호(Genebank) NM_015975(TAF9L,TAF9-like RNA polymerase II, TATA box binding protein(TBP)-associated factor, 31kDa), 유전자 등록번호(Genebank) NM_016200(LSM8,LSM8 homolog, U6 small nuclear RNA associated(S. cerevisiae)), 유전자 등록번호(Genebank) NM_017437(CPSF2,Cleavage and polyadenylation specific factor 2, 100kDa), 유전자 등록번호(Genebank) NM_018048(FLJ10292,Mago-nashi homolog), 유전자 등록번호(Genebank) NM_018237(CCAR1,Cell division cycle and apoptosis regulator 1), 유전자 등록번호(Genebank) NM_031157(HNRPA1,Heterogeneous nuclear ribonucleoprotein A1), 유전자 등록번호(Genebank) NM_032390(MKI67IP,MKI67(FHA domain) interacting nucleolar phosphoprotein), 유전자 등록번호(Genebank) NM_033222(PSIP1,PC4 and SFRS1 interacting protein 1), 유전자 등록번호(Genebank) NM_054016(FUSIP1,FUS interacting protein(serine/arginine-rich) 1), 유전자 등록번호(Genebank) NM_145018(FLJ25416,Hypothetical protein FLJ25416), 유전자 등록번호(Genebank) NM_153333(TCEAL8,Transcription elongation factor A(SII)-like 8), 유전자 등록번호(Genebank) NM_203463(LASS6,LAG1 longevity assurance homolog 6(S. cerevisiae)), 유전자 등록번호(Genebank) NM_206866(BACH1,BTB and CNC homology 1, basic leucine zipper transcription factor 1), 유전자 등록번호(Genebank) U38847(TARBP1,TAR(HIV) RNA binding protein 1), 유전자 등록번호(Genebank) XM_371470(LOC388907,Similar to ribosomal protein L5; 60S ribosomal protein L5), 유전자 등록번호(Genebank) XM_372050(LOC389674,Heterogeneous nuclear ribonucleoprotein A1 pseudogene 4), 유전자 등록번호(Genebank) XM_372396(LOC390158,Olfactory receptor, family 8, subfamily K, member 1), 유전자 등록번호(Genebank) XM_496355(LOC440577,Similar to nucleophosmin 1; nucleolar phosphoprotein B23; numatrin; nucleophosmin/nucleoplasmin family, member 1), 유전자 등록번호(Genebank) XM_498328(LOC392345,Similar to PRED65), 유전자 등록번호(Genebank) XM_499298(FLJ46189,similar to Zinc finger protein 479(Zinc finger protein Kr19)(HKr19)), 유전자 등록번호(Genebank) XM_499343(PEG10,Paternally expressed 10), 유전자 등록번호(Genebank) AB013380(ABCB10,ATP-binding cassette, sub-family B(MDR/TAP), member 10), 유전자 등록번호(Genebank) AB018342(MYO10,Myosin X), 유전자 등록번호(Genebank) AK025258(UMP-CMPK,Cytidylate kinase), 유전자 등록번호(Genebank) AK098205(AK3L1,Adenylate kinase 3), 유전자 등록번호(Genebank) AK122685(GLUD1,Glutamate dehydrogenase 1), 유전자 등록번호(Genebank) AK122695(RRM1,Ribonucleotide reductase M1 polypeptide), 유전자 등록번호(Genebank) AK126343(STK39,Serine threonine kinase 39(STE20/SPS1 homolog, yeast)), 유전자 등록번호(Genebank) BC051861(SPATA5L1,Spermatogenesis associated 5-like 1), 유전자 등록번호(Genebank) BC064610(SEPHS1,Selenophosphate synthetase 1), 유전자 등록번호(Genebank) BX640965(SLC22A3,Solute carrier family 22(extraneuronal monoamine transporter), member 3), 유전자 등록번호(Genebank) D86550(DYRK1A,Dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 1A), 유전자 등록번호(Genebank) NM_006343(MERTK,C-mer proto-oncogene tyrosine kinase), 유전자 등록번호(Genebank) NM_012073(CCT5,Chaperonin containing TCP1, subunit 5(epsilon)), 유전자 등록번호(Genebank) NM_020326(ABCD4,ATP-binding cassette, sub-family D(ALD), member 4), 유전자 등록번호(Genebank) NM_030752(TCP1,T-complex 1), 유전자 등록번호(Genebank) NM_030919(C20orf129,Chromosome 20 open reading frame 129), 유전자 등록번호(Genebank) NM_182964(NAV2,Neuron navigator 2), 유전자 등록번호(Genebank) AF020038(IDH1,Isocitrate dehydrogenase 1(NADP+), soluble), 유전자 등록번호(Genebank) AK093311(ACAA2,Acetyl-Coenzyme A acyltransferase 2(mitochondrial 3-oxoacyl-Coenzyme A thiolase)), 유전자 등록번호(Genebank) BC008366(DDC,Dopa decarboxylase(aromatic L-amino acid decarboxylase)), 유전자 등록번호(Genebank) BC012616(BHMT,Betaine-homocysteine methyltransferase), 유전자 등록번호(Genebank) BC015062(MTHFD2,Methylenetetrahydrofolate dehydrogenase(NADP+ dependent) 2, methenyltetrahydrofolate cyclohydrolase), 유전자 등록번호(Genebank) BC033320(TAF9,TAF9 RNA polymerase II, TATA box binding protein(TBP)-associated factor, 32kDa), 유전자 등록번호(Genebank) BC033517(ACOX2,Acyl-Coenzyme A oxidase 2, branched chain), 유전자 등록번호(Genebank) BC034481(BCKDHB,Branched chain keto acid dehydrogenase E1, beta polypeptide(maple syrup urine disease)), 유전자 등록번호(Genebank) BC035654(NR1H4,Nuclear receptor subfamily 1, group H, member 4), 유전자 등록번호(Genebank) BC042453(MCCC1,Methylcrotonoyl-Coenzyme A carboxylase 1(alpha)), 유전자 등록번호(Genebank) BC045541(LOC200895,Dihydrofolate reductase-like 1), 유전자 등록번호(Genebank) CR609484(KYNU,Kynureninase(L-kynurenine hydrolase)), 유전자 등록번호(Genebank) CR749593(GLS,Glutaminase), 유전자 등록번호(Genebank) NM_000016(ACADM,Acyl-Coenzyme A dehydrogenase, C-4 to C-12 straight chain), 유전자 등록번호(Genebank) NM_000277(PAH,Phenylalanine hydroxylase), 유전자 등록번호(Genebank) NM_001801(CDO1,Cysteine dioxygenase, type I), 유전자 등록번호(Genebank) NM_002860(ALDH18A1,Aldehyde dehydrogenase 18 family, member A1), 유전자 등록번호(Genebank) NM_004169(SHMT1,Serine hydroxymethyltransferase 1(soluble)), 유전자 등록번호(Genebank) NM_004457(ACSL3,Acyl-CoA synthetase long-chain family member 3), 유전자 등록번호(Genebank) NM_005589(ALDH6A1,Aldehyde dehydrogenase 6 family, member A1), 유전자 등록번호(Genebank) NM_013261(PPARGC1A,Peroxisome proliferative activated receptor, gamma, coactivator 1, alpha), 유전자 등록번호(Genebank) NM_018122(FLJ10514,Aspartyl-tRNA synthetase 2(mitochondrial)), 유전자 등록번호(Genebank) NM_080820(HARS2,Histidyl-tRNA synthetase 2), 유전자 등록번호(Genebank) U73338(MTR,5-methyltetrahydrofolate-homocysteine methyltransferase), 유전자 등록번호(Genebank) AK001676(NUP133,Nucleoporin 133kDa), 유전자 등록번호(Genebank) AK002165(DKFZP564O123,Chromatin modifying protein 2B), 유전자 등록번호(Genebank) AK023143(C10orf119,Chromosome 10 open reading frame 119), 유전자 등록번호(Genebank) AK094603(Homo sapiens cDNA FLJ37284 fis, clone BRAMY2013590. [AK094603],unnamed protein product; Homo sapiens cDNA FLJ37284 fis, clone BRAMY2013590.), 유전자 등록번호(Genebank) AK124768(TNPO1,Transportin 1), 유전자 등록번호(Genebank) BC000100(SNX5,Sorting nexin 5), 유전자 등록번호(Genebank) BC039468(NUP50,Nucleoporin 50kDa), 유전자 등록번호(Genebank) BC064351(SRP9,Signal recognition particle 9kDa), 유전자 등록번호(Genebank) BX091259(UNQ9438,TIMM9), 유전자 등록번호(Genebank) BX641063(DEK,DEK oncogene(DNA binding)), 유전자 등록번호(Genebank) BX648363(SNX10,Sorting nexin 10), 유전자 등록번호(Genebank) CR618609(NOP5/NOP58,Nucleolar protein NOP5/NOP58), 유전자 등록번호(Genebank) NM_002156(HSPD1,Heat shock 60kDa protein 1(chaperonin)), 유전자 등록번호(Genebank) NM_006380(APPBP2,Amyloid beta precursor protein(cytoplasmic tail) binding protein 2), 유전자 등록번호(Genebank) NM_007214(SEC63,SEC63-like(S. cerevisiae)), 유전자 등록번호(Genebank) NM_012460(TIMM9,Translocase of inner mitochondrial membrane 9 homolog(yeast)), 유전자 등록번호(Genebank) NM_014765(TOMM20,Translocase of outer mitochondrial membrane 20 homolog(yeast)), 유전자 등록번호(Genebank) NM_020401(NUP107,Nucleoporin 107kDa), 유전자 등록번호(Genebank) NM_021807(SEC8L1,Exocyst complex component 4), 유전자 등록번호(Genebank) NM_031296(RAB33B,RAB33B, member RAS oncogene family), 유전자 등록번호(Genebank) NM_145261(TIM14,DnaJ(Hsp40) homolog, subfamily C, member 19), 유전자 등록번호(Genebank) NM_173827(FLJ38991,Mitochondrial COX18), 유전자 등록번호(Genebank) AL162068(NAP1L1,Nucleosome assembly protein 1-like 1), 유전자 등록번호(Genebank) AL834186(CDCA7,Cell division cycle associated 7), 유전자 등록번호(Genebank) BC065520(TCFL5,Transcription factor-like 5(basic helix-loop-helix)), 유전자 등록번호(Genebank) CR620626(FGG,Fibrinogen gamma chain), 유전자 등록번호(Genebank) M58569(Homo sapiens fibrinogen, A alpha polypeptide(FGA), transcript variant alpha-E, mRNA [NM_000508]), 유전자 등록번호(Genebank) NM_002291(LAMB1,Laminin, beta 1), 유전자 등록번호(Genebank) NM_005141(FGB,Fibrinogen beta chain), 유전자 등록번호(Genebank) NM_005746(PBEF1,Pre-B-cell colony enhancing factor 1), 유전자 등록번호(Genebank) AK002156(WDR33,WD repeat domain 33), 유전자 등록번호(Genebank) AK074377(UHRF1,Chromosome 19 open reading frame 31), 유전자 등록번호(Genebank) AK122825(HMGB1,High-mobility group box 1), 유전자 등록번호(Genebank) BC032617(POLI,Polymerase(DNA directed) iota), 유전자 등록번호(Genebank) CR600021(HMGB2,High-mobility group box 2), 유전자 등록번 호(Genebank) NM_001067(TOP2A,Topoisomerase(DNA) II alpha 170kDa), 유전자 등록번호(Genebank) NM_002916(RFC4,Replication factor C(activator 1) 4, 37kDa), 유전자 등록번호(Genebank) NM_003368(USP1,Ubiquitin specific peptidase 1), 유전자 등록번호(Genebank) NM_006904(PRKDC,Protein kinase, DNA-activated, catalytic polypeptide), 유전자 등록번호(Genebank) NM_138271(ATRX,Alpha thalassemia/mental retardation syndrome X-linked(RAD54 homolog, S. cerevisiae)), 유전자 등록번호(Genebank) AF285167(ABCA1,ATP-binding cassette, sub-family A(ABC1), member 1), 유전자 등록번호(Genebank) AK124635(PCSK9,Proprotein convertase subtilisin/kexin type 9), 유전자 등록번호(Genebank) NM_000236(LIPC,Lipase, hepatic), 유전자 등록번호(Genebank) AF062341(CTNND1,Catenin(cadherin-associated protein), delta 1), 유전자 등록번호(Genebank) AF480883(PPAP2B,Phosphatidic acid phosphatase type 2B), 유전자 등록번호(Genebank) BC035638(LSS,Lanosterol synthase(2,3-oxidosqualene-lanosterol cyclase)), 유전자 등록번호(Genebank) BX648473(PIGK,Phosphatidylinositol glycan, class K), 유전자 등록번호(Genebank) NM_001444(FABP5,Fatty acid binding protein 5(psoriasis-associated)), 유전자 등록번호(Genebank) NM_003129(SQLE,Squalene epoxidase), 유전자 등록번호(Genebank) NM_003580(NSMAF,Neutral sphingomyelinase(N-SMase) activation associated factor), 유전자 등록번호(Genebank) NM_018361(AGPAT5,1-acylglycerol-3-phosphate O-acyltransferase 5(lysophosphatidic acid acyltransferase, epsilon)), 유전자 등록번호(Genebank) NM_020918(GPAM,Glycerol-3-phosphate acyltransferase, mitochondrial), 유전자 등록번호(Genebank) AB209031(C5,Complement component 5), 유전자 등록번호(Genebank) AF130100(SERPINC1,Serpin peptidase inhibitor, clade C(antithrombin), member 1), 유전자 등록번호(Genebank) AK122686(IF,I factor(complement)), 유전자 등록번호(Genebank) BC022312(C4BPA,Complement component 4 binding protein, alpha), 유전자 등록번호(Genebank) M75106(CPB2,Carboxypeptidase B2(plasma, carboxypeptidase U)), 유전자 등록번호(Genebank) NM_000893(KNG1,Kininogen 1), 유전자 등록번호(Genebank) AK055619(GNAQ,Guanine nucleotide binding protein(G protein), q polypeptide), 유전자 등록번호(Genebank) AL832747(GNAQ,Guanine nucleotide binding protein(G protein), q polypeptide), 유전자 등록번호(Genebank) CR596712(IL17D,Interleukin 17D), 유전자 등록번호(Genebank) AK000972(C9orf40,Chromosome 9 open reading frame 40), 유전자 등록번호(Genebank) AK023675(UTRN,Utrophin(homologous to dystrophin)), 유전자 등록번호(Genebank) AK026095(SNTB1,Syntrophin, beta 1(dystrophin-associated protein A1, 59kDa, basic component 1)), 유전자 등록번호(Genebank) AL117472(SORBS1,Sorbin and SH3 domain containing 1), 유전자 등록번호(Genebank) NM_018728(MYO5C,Myosin VC), 유전자 등록번호(Genebank) XM_371116(MYO5B,Myosin VB), 유전자 등록번호(Genebank) BC026320(OGDHL,Oxoglutarate dehydrogenase-like), 유전자 등록번호(Genebank) BC033391(PP1665,Glycerophosphodiester phosphodiesterase domain containing 5), 유전자 등록번호(Genebank) BC042421(GK,Glycerol kinase), 유전자 등록번호(Genebank) M15943(ADH4,Alcohol dehydrogenase 4(class II), pi polypeptide), 유전자 등록번호(Genebank) NM_000671(ADH5,Alcohol dehydrogenase 5(class III), chi polypeptide), 유전자 등록번호(Genebank) NM_002610(PDK1,Pyruvate dehydrogenase kinase, isozyme 1), 유전자 등록번호(Genebank) AK026927(MGC5297,Hypothetical protein MGC5297), 유전자 등록번호(Genebank) AK127326(PHF17,PHD finger protein 17), 유전자 등록번호(Genebank) BC039110(SMNDC1,Survival motor neuron domain containing 1), 유전자 등록번호(Genebank) BC041849(ROCK1,Rho-associated, coiled-coil containing protein kinase 1), 유전자 등록번호(Genebank) BX537500(PDCD4,Programmed cell death 4(neoplastic transformation inhibitor)), 유전자 등록번호(Genebank) CR596268(ITGB3BP,Integrin beta 3 binding protein(beta3-endonexin)), 유전자 등록번호(Genebank) NM_004938(DAPK1,Death-associated protein kinase 1), 유전자 등록번호(Genebank) NM_012238(SIRT1,Sirtuin(silent mating type information regulation 2 homolog) 1(S. cerevisiae)), 유전자 등록번호(Genebank) NM_130837(OPA1,Optic atrophy 1(autosomal dominant)), 유전자 등록번호(Genebank) NM_148957(TNFRSF19,Tumor necrosis factor receptor superfamily, member 19), 유전자 등록번호(Genebank) AB208919(FGFR1,Fibroblast growth factor receptor 1(fms-related tyrosine kinase 2, Pfeiffer syndrome)), 유전자 등록번호(Genebank) AB209601(TIZ,Zinc finger protein 675), 유전자 등록번호(Genebank) AK125150(MAPK8,Mitogen-activated protein kinase 8), 유전자 등록번호(Genebank) BC027881(AFP,Alpha-fetoprotein), 유전자 등록번호(Genebank) NM_020995(HPR,Haptoglobin-related protein), 유전자 등록번호(Genebank) AF167706(CRIM1,Cysteine rich transmembrane BMP regulator 1(chordin-like)), 유전자 등록번호(Genebank) BC045655(MAC30,Hypothetical protein MAC30), 유전자 등록번호(Genebank) BX537509(NET1,Neuroepithelial cell transforming gene 1), 유전자 등록번호(Genebank) BX640958(YEATS4,YEATS domain containing 4), 유전자 등록번호(Genebank) BX647757(Homo sapiens sex comb on midleg-like 1(Drosophila)(SCML1), mRNA [NM_006746],sex comb on midleg-like 1(Drosophila)), 유전자 등록번호(Genebank) NM_006548(IMP-2,IGF-II mRNA-binding protein 2), 유전자 등록번호(Genebank) AY376439(ECT2,Epithelial cell transforming sequence 2 oncogene), 유전자 등록번호(Genebank) AY596970(GARNL1,GTPase activating Rap/RanGAP domain-like 1), 유전자 등록번호(Genebank) BC050630(RAB3-GAP150,RAB3 GTPase activating protein subunit 2(non-catalytic)), 유전자 등록번호(Genebank) NM_001001132(ITSN1,Intersectin 1(SH3 domain protein)), 유전자 등록번호(Genebank) NM_016340(KIAA1961,KIAA1961 gene), 유전자 등록번호(Genebank) NM_145290(GPR125,G protein-coupled receptor 125), 유전자 등록번호(Genebank) NM_003574(VAPA,VAMP(vesicle-associated membrane protein)-associated protein A, 33kDa), 유전자 등록번호(Genebank) M28016(cytochrome b,Human mitochondrial cytochrome b gene, partial cds.), 유전자 등록번호(Genebank) NM_013277(RACGAP1,Rac GTPase activating protein 1), 유전자 등록번호(Genebank) AB096248(SNF1LK2,SNF1-like kinase 2), 유전자 등록번호(Genebank) NM_001698(AUH,AU RNA binding protein/enoyl-Coenzyme A hydratase), 유전자 등록번호(Genebank) AB091343(C10orf3,Centrosomal protein 55kDa).Genebank (Genebank) AB209605 (SKIV2L, Superkiller viralicidic activity 2-like (S.  cerevisiae)), Genebank AI200373 (HIST1H2AL, Histone 1, H2al), Genebank Number Genebank AK057577 (IRF3, Interferon regulatory factor 3), Genebank AL832659 (FLJ22833, Hypothetical protein FLJ22833), Genebank BC034487 (HIST1H2AK, Histone 1, H2ak), Genebank BC034569 (ZNF337, Zinc finger protein 337), Genebank BC038432 (RARA, Retinoic acid receptor , alpha), Gene Registration Number (Genebank) BC067782 (HIST1H2AG, Histone 1, H2ag), Gene Registration Number (Genebank) BC069193 (HIST2H2BE, Histone 2, H2be), Gene Registration Number (Genebank) BC071638 (HIST2H2BE, Histone 2, H2be ), Gene Registration Number (Genebank) BC082232 (HIST1H2BG, Histone 1, H2bg), Gene Registration Number (Genebank) BC101655 (HIST1H2BI, Histone 1, H2bi), Gene Registration Number (Genebank) BE741093 (HIST1H2AE, Histone 1, H2ae), Genebank Number (Genebank) BE973853 (HIST1H4J, Histone 1, H4j), genes, etc. Number (Genebank) BM752802 (HIST1H2BM, Histone 1, H2bm), gene registration number (Genebank) BM919305 (POLR2L, Polymerase (RNA) II (DNA directed) polypeptide L, 7. 6kDa), Gene Registration Number (Genebank) BU603483 (HIST1H1E, Histone 1, H1e), Gene Registration Number (Genebank) BX436525 (HIST1H2BH, Histone 1, H2bh), Gene Registration Number (Genebank) BX647290 (HIST1H2BO, Histone 1, H2bo) , Gene Registration Number (Genebank) CB529694 (HIST2H2BE, Histone 2, H2be), Gene Registration Number (Genebank) CD710576 (HIST2H2AC, Histone 2, H2ac), Gene Registration Number (Genebank) CK000930 (HIST1H2AI, Histone 1, H2ai), Gene Genebank CR608156 (HIST1H2AC, Histone 1, H2ac), Gene Registration Number (Genebank) NM_002515 (NOVA1, Neuro-oncological ventral antigen 1), Genebank NM_003516 (HIST2H2AA, Histone 2, H2aa), Gene Genebank NM_003519 (HIST1H2BL, Histone 1, H2bl), Genebank NG_003670 (BHLHB2, Basic helix-loop-helix domain containing, class B, 2), Genebank NM_004660 (DDX3Y, DEAD (Asp-Glu-Ala-Asp) box polypeptide 3, Y-linked), Gene Accession Number (Genebank) NM_005319 (HIST1H1C, Histo ne 1, H1c), Gene Registration Number (Genebank) NM_005320 (HIST1H1D, Histone 1, H1d), Gene Registration Number (Genebank) NM_005524 (HES1, Hairy and Enhancer of Split 1, (Drosophila)), Gene Registration Number (Genebank) NM_006442 (DRAP1, DR1-associated protein 1 (negative cofactor 2 alpha)), gene registration number (Genebank) NM_021035 (KIAA1404, KIAA1404 protein), gene registration number (Genebank) U86136 (TEP1, Telomerase-associated protein 1), gene registration Genebank AB209586 (MAPK13, Mitogen-activated protein kinase 13), Genebank AK074652 (SERTAD1, SERTA domain containing 1), Genebank AK122829 (GAS2L1, Growth arrest-specific 2 like 1) , Genebank AK129595 (GADD45B, Growth arrest and DNA-damage-inducible, beta), Genebank (Genebank) BC018266 (CDC42, Cell division cycle 42 (GTP binding protein, 25kDa)), Gene Registration Number ( Genebank) BC041022 (SCAND1, SCAN domain containing 1), Genebank BM904 612 (S100A6, S100 calcium binding protein A6 (calcyclin)), Genebank BM913048 (TIMP1, TIMP metallopeptidase inhibitor 1), Genebank CR612719 (GADD45A, Growth arrest and DNA-damage-inducible, alpha ), Gene Registration Number (Genebank) NM_001007271 (DUSP13, Dual specificity phosphatase 13), Gene Registration Number (Genebank) NM_001015053 (HDAC5, Histone deacetylase 5), Gene Registration Number (Genebank) NM_001953 (ECGF1, Endothelial cell growth factor 1 (platelet) -derived), Genebank NM_003255 (TIMP2, TIMP metallopeptidase inhibitor 2), Genebank NM_005072 (SLC12A4, Solute carrier family 12 (potassium / chloride transporters), member 4), Gene Registry Number ( Genebank) NM_005343 (HRAS, V-Ha-ras Harvey rat sarcoma viral oncogene homolog), Gene Registration Number (Genebank) NM_005736 (ACTR1A, ARP1 actin-related protein 1 homolog A, centractin alpha (yeast), Gene Registration Number (Genebank) ) NM_007065 (CDC37, CDC37 cell div ision cycle 37 homolog (S.  cerevisiae)), Genebank NM_078467 (CDKN1A, Cyclin-dependent kinase inhibitor 1A (p21, Cip1)), Genebank U68019 (SMAD3, SMAD, mothers against DPP homolog 3 (Drosophila)), Gene Genebank X02812 (TGFB1, Transforming growth factor, beta 1 (Camurati-Engelmann disease), Genebank AB033060 (PDCD6, Aryl-hydrocarbon receptor repressor), Genebank AB209361 (FAS, Fas (TNF receptor superfamily, member 6)), Genebank AF332558 (BBC3, BCL2 binding component 3), Genebank AY028896 (CARD10, Caspase recruitment domain family, member 10), Gene entry number ( Genebank) BC063507 (HSPA1B, Heat shock 70kDa protein 1B), Gene Registration Number (Genebank) BM557864 (HSPB1, Heat Shock 27kDa protein 1), Gene Registration Number (Genebank) NM_001003940 (BMF, Bcl2 modifying factor), Gene Registration Number (Genebank) NM_001165 (BIRC3, Baculoviral IAP repeat-containing 3) Genebank NM_001197 (BIK, BCL2-interacting killer (apoptosis-inducing)), Genebank (Genebank) NM_002305 (LGALS1, Lectin, galactoside-binding, soluble, 1 (galectin 1)), Gene Registration Number ( Genebank) NM_003311 (PHLDA2, Pleckstrin homology-like domain, family A, member 2), Genebank NM_003639 (IKBKG, Inhibitor of kappa light polypeptide gene enhancer in B-cells, kinase gamma), Gene accession number (Genebank ) NM_003820 (TNFRSF14, Tumor necrosis factor receptor superfamily, member 14 (herpesvirus entry mediator), Genebank NM_003897 (IER3, Immediate early response 3), Genebank NM_004401 (DFFA, DNA fragmentation factor, 45 kDa, alpha polypeptide), Genebank NM_016639 (TNFRSF12A, Tumor necrosis factor receptor superfamily, member 12A), Genebank BC048334 (MT1G, Metallothionein 1G), Genebank BC053882 (MT1X, Metallothionein 1X), heredity Genebank BI488702 (MT1K, Metallothionein 1M), Gene Registration Number (Genebank) NM_005947 (MT1B, Metallothionein 1B (functional)), Gene Registration Number (Genebank) AK055088 (CYP2J2, Cytochrome P450, family 2, subfamily J, polypeptide 2), Genebank AK094474 (RHOC, Ras homolog gene family, member C), Genebank BC015041 (VAT1, Family with sequence similarity 82, member C), Genebank NM_000499 (CYP1A1, Cytochrome P450, family 1, subfamily A, polypeptide 1), gene accession number (Genebank) NM_004881 (TP53I3, Tumor protein p53 inducible protein 3), gene accession number (Genebank) NM_201397 (GPX1, Glutathione peroxidase 1), gene Genebank XM_498018 (LOC391827, Similar to Keratin, type I cytoskeletal 18 (Cytokeratin 18) (K18) (CK 18)), Gene accession number (Genebank) AF524864 (AKR1B10, Aldo-keto reductase family 1, member B10 ( aldose reductase), Genebank AL833205 (ETFB, Electron- transfer-flavoprotein, beta polypeptide), genebank (Genebank) BC034763 (FDXR, Ferredoxin reductase), genebank (Genebank) CR610878 (AKR1B1, Aldo-keto reductase family 1, member B1 (aldose reductase), gene registration number (Genebank) NM_003330 (TXNRD1, Thioredoxin reductase 1), gene registration number (Genebank) NM_004199 (P4HA2, Procollagen-proline, 2-oxoglutarate 4-dioxygenase (proline 4-hydroxylase), alpha polypeptide II), gene registration number (Genebank) NM_004753 (DHRS3, Dehydrogenase / reductase (SDR family) member 3), gene registration number (Genebank) NM_031226 (CYP19A1, Cytochrome P450, family 19, subfamily A, polypeptide 1), gene registration number (Genebank) NM_032468 (ASPH, Aspartate beta -hydroxylase), Genebank AB209112 (SLC2A8, Solute carrier family 2, (facilitated glucose transporter) member 8), Genebank (Genebank) BC011409 (UGT1A6, UDP glucuronosyltransferase 1 family, polypeptide A9) (Genebank) H18681 (C20o rf139, Sulfiredoxin 1 homolog (S.  cerevisiae)), Genebank NM_002658 (PLAU, Plasminogen activator, urokinase), Genebank NM_005064 (CCL23, Chemokine (CC motif) ligand 23), Genebank NM_032965 (CCL14, Chemokine) (CC motif) ligand 15), Genebank Y11307 (CYR61, Cysteine-rich, angiogenic inducer, 61), Genebank AB209808 (AP1M1, Adaptor-related protein complex 1, mu 1 subunit), Genebank AK074154 (SYTL1, Synaptotagmin-like 1), Genebank AK098475 (GRPEL1, GrpE-like 1, mitochondrial (E.  coli)), Genebank AK123405 (GDI1, GDP dissociation inhibitor 1), Genebank BC000786 (ARFGAP1, ADP-ribosylation factor GTPase activating protein 1), Genebank BC042390 (VTI1B , Vesicle transport through interaction with t-SNAREs homolog 1B (yeast), Genebank BG036385 (RAMP1, Receptor (calcitonin) activity modifying protein 1), Genebank BX648781 (GABARAPL1, GABA (A) receptor-associated protein like 1), Genebank NM_001013839 (EXOC7, Exocyst complex component 7), Genebank NM_002926 (RGS12, Regulator of G-protein signaling 12), Genebank NM_007097 (CLTB, Clathrin, light polypeptide (Lcb)), Genebank (Genebank) NM_013336 (SEC61A1, Sec61 alpha 1 subunit (S.  cerevisiae)), gene accession number (Genebank) NM_024101 (MLPH, Melanophilin), gene accession number (Genebank) NM_032872 (SYTL1, Synaptotagmin-like 1), gene accession number (Genebank) NM_000596 (IGFBP1, Insulin-like growth factor binding protein 1), gene registration number (Genebank) NM_001553 (IGFBP7, Insulin-like growth factor binding protein 7), gene registration number (Genebank) NM_001712 (CEACAM1, Carcinoembryonic antigen-related cell adhesion molecule 1 (biliary glycoprotein)), gene registration number (Genebank) NM_012396 (PHLDA3, Pleckstrin homology-like domain, family A, member 3), Genebank Number Y12692 (WNT11, Wingless-type MMTV integration site family, member 11), Genebank Number BC014470 ( AZGP1, Alpha-2-glycoprotein 1, zinc), Genebank BG683841 (S100A11, S100 calcium binding protein A11 (calgizzarin)), Genebank NM_002337 (LRPAP1, Low density lipoprotein receptor-related protein associated protein 1), heredity Registration Number (Genebank) AF059617 (PLK2, Polo-like kinase 2 (Drosophila)), gene registration number (Genebank) AK128553 (ZZANK1, Mindbomb homolog 2 (Drosophila)), gene registration number (Genebank) BX649164 (PAI; PAI1; PAI-1; PLANH1, serpin peptidase inhibitor, clade E (nexin, plasminogen activator inhibitor type 1), member 1), gene accession number (Genebank) NM_000602 (SERPINE1, Serpin peptidase inhibitor, clade E (nexin, plasminogen activator inhibitor type 1), member 1 Genebank BI767815 (GP9, Glycoprotein IX (platelet)), Genebank (Genebank) BM918324 (LY96, Lymphocyte Antigen 96), Genebank NM_006404 (PROCR, Protein C receptor, endothelial ( EPCR)), Genebank AF031469 (MR1, Major histocompatibility complex, class I-related), Genebank (Genebank) BF569086 (NK4, Interleukin 32), Genebank BG564326 (SAA4, Serum amyloid A4, constitutive, Genebank NM_001633 (AMBP, Alpha-1-microglobulin / bikunin precursor), Genebank NM_005532 (IFI27, Interferon, alpha-inducible protein 27), Genebank (Genebank) NM_017670 (OTUB1, OTU domain, ubiquitin aldehyde bindi ng 1), Genebank AK130130 (CAPG, Capping protein (actin filament), gelsolin-like), Genebank (Genebank) BX648190 (WDR1, WD repeat domain 1), Genebank (Genebank) CF552540 ( TNNI2, Troponin I type 2 (skeletal, fast)), Gene Registration Number (Genebank) NM_001006946 (SDC1, Syndecan 1), Gene Registration Number (Genebank) NM_007284 (PTK9L, PTK9L protein tyrosine kinase 9-like (A6-related protein) ), Gene Registration Number (Genebank) NM_015990 (KLHL5, Kelch-like 5 (Drosophila)), Gene Registration Number (Genebank) BM467105 (CIB1, Calcium and integrin binding 1 (calmyrin)), Gene Registration Number (Genebank) CF553054 (TNNC1) , Troponin C type 1 (slow)), Gene Registration Number (Genebank) NM_006384 (CIB1, Calcium and integrin binding 1 (calmyrin)), Gene Registration Number (Genebank) NM_080388 (S100A16, S100 calcium binding protein A16), Gene Registration Number (Genebank) NM_005817 (M6PRBP1, Mannose-6-phosphate receptor binding protein 1), gene accession number (Genebank) NM_006555 (Y KT6, SNARE protein Ykt6), gene registration number (Genebank) AK093461 (ISYNA1, Myo-inositol 1-phosphate synthase A1), gene registration number (Genebank) AK097009 (PLTP, phospholipid transfer protein), gene registration number (Genebank) BC030207 ( NR0B2, Nuclear receptor subfamily 0, group B, member 2), Genebank BC035124 (UNQ2541, MSFL2541), Genebank NM_145323 (OSBPL3, Oxysterol binding protein-like 3), Genebank (Genebank) ) BC050455 (DDB2, LIM homeobox 3), Genebank BC068535 (TP53AP1, TP53 activated protein 1), Genebank NM_016440 (VRK3, Vaccinia related kinase 3), Genebank NM_001124 ( ADM, Adrenomedullin), Gene Registration Number (Genebank) NM_170707 (LMNA, Lamin A / C), Gene Registration Number (Genebank) NM_004633 (IL1R2, Interleukin 1 receptor, type II), Gene Registration Number (Genebank) NM_004864 (GDF15, Growth differentiation factor 15), Genebank NM_017572 ( MKNK2, MAP kinase interacting serine / threonine kinase 2), gene accession number (Genebank) AA669162 (AMPD3, Transcribed locus), gene accession number (Genebank) AB033073 (SULF2, Sulfatase 2), gene accession number (Genebank) AB208949 (LRDD, Leucine-rich repeats and death domain containing), Genebank AK022712 (FLJ12650, Family with sequence similarity 77, member C), Genebank AK095363 (AQP3, Aquaporin 3), Gene Registration Number (Genebank) AY368150 (CHR2SYT, Family with sequence similarity 62 (C2 domain containing) member B), Genebank BU587578 (RGS10, Regulator of G-protein signaling 10), Genebank BU945318 (MT2A, Hypothetical gene supported by X97260; BC070289), Gene Registration Number (Genebank) NM_001013632 (LOC343521, Similar to hypothetical protein 4833401D15), Gene Registration Number (Genebank) NM_006426 (DPYSL4, Dihydropyrimidinase-like 4), Gene Registration Number (Genebank) NM_133493 (CD109, CD109 antigen (Gov) platelet alloantigens)), Genebank NM_145256 (LRRC25, Leucine rich repeat containing 25), Genebank AB033337 (MPHOSPH1, M-phase phosphoprotein 1), Genebank AB208875 (Septin 10, Septin 10), Genebank AF053305 (BUB1, BUB1 budding uninhibited by benzimidazoles 1 homolog (yeast), Genebank AF053306 (BUB1B, BUB1 budding uninhibited by benzimidazoles 1 homolog beta (yeast), gene Genebank AF345347 (SPAG5, Spm associated antigen 5), Genebank AK222819 (NUSAP1, Nucleolar and spindle associated protein 1), Genebank AY367065 (ASPM, Asp (abnormal spindle) -like , microcephaly associated (Drosophila)), Genebank BC004352 (KIF22, Kinesin family member 22), Genebank BC010607 (IGF1R, Insulin-like growth factor 1 receptor), Genebank BC011000 (CDCA5 Cell division cycle associated 5), Genebank BC013326 (GAS2, Growth arrest-specific 2), Genebank BC032677 (UBE2C, Ubiquitin-conjugating enzyme E2C), Genebank BC040991 (Genebank) TFDP2, Transcription factor Dp-2 (E2F dimerization partner 2), Genebank BC050384 (SUPT3H, Suppressor of Ty 3 homolog (S.  cerevisiae)), Gene Banking Number BC068483 (RINT-1, Rad50-interacting protein 1), Gene Banking Number (Genebank) BQ278454 (CKS1B, CDC28 protein kinase regulatory subunit 1B), Gene Banking Number (Genebank) BX647885 (STMN1 , Stathmin 1 / oncoprotein 18), Genebank CR604810 (CCNA2, Cyclin A2), Genebank CR933728 (CDC2, Cell division cycle 2, G1 to S and G2 to M), Gene registry number ( Genebank) D42045 (DCLRE1A, DNA cross-link repair 1A (PSO2 homolog, S.  cerevisiae)), Gene Registration Number (Genebank) NM_00089 (HK2, Hexokinase 2), Gene Registration Number (Genebank) NM_001005414 (ZWINT, ZW10 interactor antisense), Gene Registration Number (Genebank) NM_001018159 (APPBP1, Amyloid beta precursor protein binding protein 1 ), Genebank NM_001239 (CCNH, Cyclin H), Genebank NM_001790 (CDC25C, Cell division cycle 25C), Genebank NM_001827 (CKS2, CDC28 protein kinase regulatory subunit 2), Genebank NM_002431 (MNAT1, Menage a trois 1 (CAK assembly factor)), Genebank NM_002467 (MYC, V-myc myelocytomatosis viral oncogene homolog (avian)), Genebank NM_002709 (PPP1CB, Protein phosphatase 1, catalytic subunit, beta isoform), Gene Registration Number (Genebank) NM_002737 (PRKCA, Protein kinase C, alpha), Gene Registration Number (Genebank) NM_002894 (RBBP8, Retinoblastoma binding protein 8), Gene Registration Number (Genebank) NM_003318 (TTK, TTK prote in kinase, Genebank NM_003478 (CUL5, Cullin 5), Genebank NM_003981 (PRC1, Protein regulator of cytokinesis 1), Genebank NM_004064 (CDKN1B, Cyclin-dependent kinase inhibitor 1B (p27, Kip1)), Gene Registration Number (Genebank) NM_004354 (CCNG2, Cyclin G2), Gene Registration Number (Genebank) NM_004365 (CETN3, Centrin, EF-hand protein, 3 (CDC31 homolog, yeast)), Gene Registration Number (Genebank) NM_004523 (KIF11, Kinesin family member 11), gene registration number (Genebank) NM_004701 (CCNB2, Cyclin B2), gene registration number (Genebank) NM_005504 (BCAT1, Branched chain aminotransferase 1, cytosolic), gene registration number ( Genebank) NM_005915 (MCM6, MCM6 minichromosome maintenance deficient 6 (MIS5 homolog, S.  pombe) (S.  cerevisiae)), Genebank NM_006101 (KNTC2, Kinetochore associated 2), Genebank NM_006265 (RAD21, RAD21 homolog (S.  pombe), Gene Registration Number (Genebank) NM_014750 (DLG7, Discs, large homolog 7 (Drosophila)), Gene Registration Number (Genebank) NM_014751 (MTSS1, Metastasis suppressor 1), Gene Registration Number (Genebank) NM_016343 (CENPF, Centromere protein F, 350 / 400ka (mitosin)), gene accession number (Genebank) NM_018492 (PBK, PDZ binding kinase), gene accession number (Genebank) NM_018685 (ANLN, Anillin, actin binding protein (scraps homolog, Drosophila)), gene Genebank NM_019001 (XRN1,5'-3 'exoribonuclease 1), Gene Registration Number (Genebank) NM_019063 (EML4, Echinoderm microtubule associated protein like 4), Genebank Number NM_020242 (KNSL7, Kinesin family member 15 ), Genebank number U65410 (MAD2L1, MAD2 mitotic arrest deficient-like 1 (yeast)), Genebank number (Genebank) AB096175 (SP5, Sp5 transcription factor), Genebank number AB209086 (ZNF493, Zinc) finger protein 493), Genebank AB209334 (SP3, Sp3 transcription factor), Genebank AB209892 (ZFX, Zinc finger protein, X-linked), Genebank AF279145 (ANTXR1, Anthrax toxin receptor 1), Genebank AK095600 (FLJ38281, Zinc finger protein 564) Genebank AK123010 (RRM2, Ribonucleotide reductase M2 polypeptide), Genebank AK126180 (DTYMK, Deoxythymidylate kinase (thymidylate kinase), Genebank AK130071 (HSPC063, BTB (POZ) domain) containing 15), Genebank AK131420 (ZNF66, Zinc finger protein 66), Genebank AK131472 (Homo sapiens cDNA FLJ16640 fis, clone TESTI4028938, moderately similar to Zinc finger protein 85.  [AK131472], CDNA FLJ16640 fis, clone TESTI4028938, moderately similar to Zinc finger protein 85), gene accession number (Genebank) AK131527 (ZNF15L1, Zinc finger protein 708 (KOX8)), gene accession number (Genebank) AK160373 (DKFZp547K1113, Zinc finger protein 710, Genebank AL832422 (ZNF430, Zinc finger protein 430), Genebank AY269786 (ZNF429, Zinc finger protein 429), Genebank BC035579 (ZNF100, Zinc finger protein) 100), Gene Registration Number (Genebank) BC036394 (ZNF85, Zinc finger protein 85 (HPF4, HTF1)), Gene Registration Number (Genebank) BM466459 (DGKI, Diacylglycerol kinase, iota), Gene Registration Number (Genebank) BX537574 (FREM1, FRAS1 related extracellular matrix 1), Genebank BX537987 (TRIM59, Tripartite motif-containing 59), Genebank BX648469 (ATF2, activating transcription factor 2), Genebank CR608275 (CBLL1, Cas-Br-M (murine) ecotropic retroviral transforming sequence-like 1), gene accession number (Genebank) CR749233 (ZNF626, Zinc finger protein 626), gene accession number (Genebank) CR749832 (IMPDH1, IMP (inosine monophosphate) dehydrogenase 1), gene accession number (Genebank) CR936615 (MATR3) , Matrin 3), Gene Registration Number (Genebank) NM_000946 (PRIM1, Primase, polypeptide 1, 49 kDa), Gene Registration Number (Genebank) NM_001123 (ADK, Adenosine kinase), Gene Registration Number (Genebank) NM_002317 (LOX, Lysyl oxidase) , Gene Registration Number (Genebank) NM_002655 (PLAG1, Pleiomorphic adenoma gene 1), Gene Registration Number (Genebank) NM_003423 (ZNF43, Zinc finger protein 43 (HTF6)), Gene Registration Number (Genebank) NM_005180 (PCGF4, Polycomb group ring finger 4), Gene Registration Number (Genebank) NM_014615 (KIAA0182, KIAA0182 protein), Gene Registration Number (Genebank) NM_014919 (WHSC1, Wolff-Hirschhorn syndrome candidate 1), Gene Registration Number (Genebank) NM_015040 (PIP5K3, Phosphhatidylinositol-3-phosphate / phosphatidylinositol 5-kinase, type III), gene registration number Genebank NM_015387 (PREI3, Preimplantation protein 3), Genebank NM_015905 (TIF1, Tripartite motif-containing 24), Genebank NM_016513 (ICK, Intestinal cell (MAK-like) kinase), Gene Genebank NM_016626 (RKHD2, Ring finger and KH domain containing 2), Genebank NM_018660 (ZNF395, Zinc finger protein 395), Genebank NM_021129 (PP, Pyrophosphatase (inorganic) 1) , Gene Registration Number (Genebank) NM_025074 (FRAS1, Fraser syndrome 1), Gene Registration Number (Genebank) NM_173694 (ATP11C, ATPase, Class VI, type 11C), Gene Registration Number (Genebank) NM_176869 (PPA2, Pyrophosphatase (inorganic) 2 ), Gene registration number (Genebank) NM_182851 (CCNB1IP1, Cyclin B1 interacting protein 1), gene registration number (Genebank) NM_199040 (NUDT4, Nudix (nucleoside diphosphate linked moiety X)-type motif 4 pseudogene 2), gene registration number (Genebank) ) AK122869 (LOC148213, Zinc finger protein 681), gene registration number Genebank BC042500 (MGC42493, Hypothetical protein MGC15634), Genebank BC043147 (ZNF539, Zinc finger protein 254), Genebank BC044060 (ZNF650, Zinc finger protein 650), Genebank (Genebank) BC050340 (ZNF230, Zinc finger protein 230), Genebank (Genebank) CR749800 (ZNFN1A5, Zinc finger protein, subfamily 1A, 5), Genebank (Genebank) CR936695 (ZNF468, Zinc finger protein ZNF468), Gene Registration Number ( Genebank) NM_001009881 (ZCCHC11, Zinc finger, CCHC domain containing 11), Gene Registration Number (Genebank) NM_003441 (ZNF141, Zinc Finger Protein 141 (clone pHZ-44)), Gene Registration Number (Genebank) NM_006526 (ZNF217, Zinc finger protein 217), Genebank NM_007146 (ZNF161, Zinc finger protein 161), Genebank NM_015336 (ZDHHC17, Zinc finger, DHHC-type containing 17), Genebank NM_016220 (ZNF588, Zinc finger protein 588), gene accession number (Genebank) NM_017742 (Z CCHC2, Zinc finger, CCHC domain containing 2), Genebank NM_021994 (ZNF277, Zinc finger protein 277), Genebank NM_024733 (FLJ14345, Zinc finger protein 665), Genebank NM_032367 (ZBED3, Zinc finger, BED-type containing 3), Genebank NM_033114 (MADP-1, MADP-1 protein), Genebank NM_133473 (ZNF431, Zinc finger protein 431), Gene Registry Number (Genebank) NM_152626 (ZNF92, Zinc finger protein 92 (HTF12)), gene registration number (Genebank) NM_178558 (FLJ90430, Zinc finger protein 680), gene registration number (Genebank) NM_198893 (ZNF160, Zinc finger protein 160), gene registration Number (Genebank) XM_047550 (ZNF492, Zinc finger protein 492), Gene Registration Number (Genebank) XM_290865 (LOC163233, Similar to Zinc finger protein 93 (Zinc finger protein HTF34)), Gene Registration Number (Genebank) XM_371174 (ZNF283, Zinc finger protein 283), Genebank AB023141 (ZNF652, Zinc finger protei 652), Genebank AB209245 (HMGN1, High-mobility group nucleosome binding domain 1), Genebank AB209389 (GTF2IRD1, GTF2I repeat domain containing 1), Genebank AB209562 (HNRPK , Heterogeneous nuclear ribonucleoprotein K, Genebank AB209753 (RBM7, RNA binding motif protein 7), Genebank AF136171 (EAP; HBP15; HBP15 / L22, ribosomal protein L22), Genebank AK001230 (POT1, POT1 protection of telomeres 1 homolog (S.  pombe), Genebank AK022942 (LOC58486, Transposon-derived Buster1 transposase-like protein gene), Genebank AK025758 (NFATC2, Nuclear factor of activated T-cells, cytoplasmic, calcineurin-dependent 2) , Genebank AK056803 (H2AFZ, H2A histone family, member Z), Genebank AK074119 (ZZZ3, Zinc finger, ZZ-type containing 3), Genebank AK091927 (SFRS3, Splicing factor, arginine / serine-rich 3), Genebank AK095937 (GC20, Translation factor sui1 homolog), Genebank AK124178 (EIF3S6, Eukaryotic translation initiation factor 3, subunit 6 48kDa), Gene registration Number (Genebank) AL110212 (H2AFV, H2A histone family, member V), gene registration number (Genebank) BC010266 (HNRNPA1; MGC102835, Heterogeneous nuclear ribonucleoprotein A1), gene registration number (Genebank) BM464978 (HMGN2, High-mobility group nucleosomal binding domain 2), Gene Registration Number (Gene bank) BM800367 (RPL21, Ribosomal protein L21), Gene Registration Number (Genebank) BU677381 (RPL21, Ribosomal protein L21), Gene Registration Number (Genebank) BX647205 (HNRPH1, Heterogeneous nuclear ribonucleoprotein H1 (H)), Gene Registration Number (Genebank) ) BX647217 (HNRPA3, Heterogeneous nuclear ribonucleoprotein A3), Gene Accession Number (Genebank) CR625990 (PC4, SUB1 homolog (S.  cerevisiae)), Gene Registration Number (Genebank) CR627133 (LOC342892, Hypothetical protein LOC342892), Gene Registration Number (Genebank) NM_000947 (PRIM2A, Primase, polypeptide 2A, 58 kDa), Gene Registration Number (Genebank) NM_000983 (RPL22, Ribosomal protein L22) ), Gene registration number (Genebank) NM_001015886 (HMGA2, High mobility group AT-hook 2), gene registration number (Genebank) NM_001017430 (RBM3, RNA binding motif (RNP1, RRM) protein 3), gene registration number (Genebank) NM_001018067 (PAI-RBP1, SERPINE1 mRNA binding protein 1), Genebank NM_001412 (EIF1AX, Eukaryotic translation initiation factor 1A, X-linked), Genebank NM_001809 (CENPA, Centromere protein A, 17kDa), Genebank NM_002139 (RBMX, RNA binding motif protein, X-linked), Genebank NM_002568 (PABPC1, Poly (A) binding protein, cytoplasmic 1), Genebank NM_003972 ( BTAF1, BTAF1 RNA polymerase II, B-TFIID transcription factor-associated, 17 0 kDa (Mot1 homolog, S.  cerevisiae)), Genebank NM_004454 (ETV5, Ets variant gene 5 (ets-related molecule)), Genebank NM_005463 (HNRPDL, Heterogeneous nuclear ribonucleoprotein D-like), Genebank (Genebank) NM_006047 (CPNE1, RNA binding motif protein 12), gene registration number (Genebank) NM_006345 (SLC30A9, Solute carrier family 30 (zinc transporter), member 9), gene registration number (Genebank) NM_006451 (PAIP1, Poly (A) binding protein interacting protein 1), Genebank NM_006546 (IMP-1, IGF-II mRNA-binding protein 1), Genebank NM_006716 (ASK, DBF4 homolog (S.  cerevisiae)), Genebank NM_006775 (QKI, Quing homolog, KH domain RNA binding (mouse)), Genebank NM_007080 (LSM6, LSM6 homolog, U6 small nuclear RNA associated (S.  cerevisiae)), gene registration number (Genebank) NM_007208 (MRPL3, Mitochondrial ribosomal protein L3), gene registration number (Genebank) NM_012207 (HNRPH3, heterogeneous nuclear ribonucleoprotein H3 (2H9)), gene registration number (Genebank) NM_014321 (ORC6L, Origin recognition complex, subunit 6 homolog-like (yeast), Genebank NM_014393 (STAU2, Staufen, RNA binding protein, homolog 2 (Drosophila)), Genebank NM_014892 (RBM16, RNA binding motif protein 16), Genebank NM_015361 (R3HDM, R3H domain containing 1), Genebank NM_015975 (TAF9L, TAF9-like RNA polymerase II, TATA box binding protein (TBP) -associated factor, 31kDa), Genebank (Genebank) NM_016200 (LSM8, LSM8 homolog, U6 small nuclear RNA associated (S.  cerevisiae)), Genebank NM_017437 (CPSF2, Cleavage and polyadenylation specific factor 2, 100kDa), Genebank NM_018048 (FLJ10292, Mago-nashi homolog), Genebank NM_018237 (CCAR1, Cell division cycle and apoptosis regulator 1), gene registration number (Genebank) NM_031157 (HNRPA1, Heterogeneous nuclear ribonucleoprotein A1), gene registration number (Genebank) NM_032390 (MKI67IP, MKI67 (FHA domain) interacting nucleolar phosphoprotein), gene registration number (Genebank) NM_033222 (PSIP1, PC4 and SFRS1 interacting protein 1), Genebank NM_054016 (FUSIP1, FUS interacting protein (serine / arginine-rich) 1), Genebank NM_145018 (FLJ25416, Hypothetical protein FLJ25416) , Genebank NM_153333 (TCEAL8, Transcription elongation factor A (SII) -like 8), Genebank NM_203463 (LASS6, LAG1 longevity assurance homolog 6 (S.  cerevisiae)), Genebank NM_206866 (BACH1, BTB and CNC homology 1, basic leucine zipper transcription factor 1), Genebank U38847 (TARBP1, TAR (HIV) RNA binding protein 1), Gene registration Number (Genebank) XM_371470 (LOC388907, Simallar to ribosomal protein L5; 60S ribosomal protein L5), Gene accession number (Genebank) XM_372050 (LOC389674, Heterogeneous nuclear ribonucleoprotein A1 pseudogene 4), Gene accession number (Genebank) XM_372396 (LOC390158, Ol) , family 8, subfamily K, member 1), Genebank XM_496355 (LOC440577, Similar to nucleophosmin 1; nucleolar phosphoprotein B23; numatrin; nucleophosmin / nucleoplasmin family, member 1), Genebank XM_498328 (LOC392345 , Similar to PRED65), Genebank XM_499298 (FLJ46189, similar to Zinc finger protein 479 (Zinc finger protein Kr19) (HKr19)), Genebank XM_499343 (PEG10, Paternally expressed 10), Gene Registration Genebank AB013380 (ABCB10, ATP-binding cassette, sub-family B (MDR / TAP), member 10), Gene Registration Number (Genebank) AB018342 (MYO10, Myosin X), Gene Registration Number (Genebank) AK025258 (UMP -CMPK, Cyidylate kinase, Genebank AK098205 (AK3L1, Adenylate kinase 3), Gene Accession Number (Genebank) AK122685 (GLUD1, Glutamate dehydrogenase 1), Gene Accession Number (Genebank) AK122695 (RRM1, Ribonucleotide reductase M1 polypeptide), Genebank AK126343 (STK39, Serine threonine kinase 39 (STE20 / SPS1 homolog, yeast)), Genebank (Genebank) BC051861 (SPATA5L1, Spermatogenesis associated 5-like 1), Gene accession number (Genebank) ) BC064610 (SEPHS1, Selenophosphate synthetase 1), Gene Registration Number (Genebank) BX640965 (SLC22A3, Solute carrier family 22 (extraneuronal monoamine transporter), member 3), Gene Registration Number (Genebank) D86550 (DYRK1A, Dual-specificity tyrosine- ( Y) -phosphorylation regulated kinase 1A), Genebank N M_006343 (MERTK, C-mer proto-oncogene tyrosine kinase), gene registration number (Genebank) NM_012073 (CCT5, Chaperonin containing TCP1, subunit 5 (epsilon)), gene registration number (Genebank) NM_020326 (ABCD4, ATP-binding cassette, sub-family D (ALD), member 4), Genebank NM_030752 (TCP1, T-complex 1), Genebank NM_030919 (C20orf129, Chromosome 20 open reading frame 129), Gene Registry Number ( Genebank) NM_182964 (NAV2, Neuron navigator 2), Gene Registration Number (Genebank) AF020038 (IDH1, Isocitrate dehydrogenase 1 (NADP +), Soluble), Gene Registration Number (Genebank) AK093311 (ACAA2, Acetyl-Coenzyme A acyltransferal 2 3mitochon -oxoacyl-Coenzyme A thiolase)), Gene Registration Number (Genebank) BC008366 (DDC, Dopa decarboxylase (aromatic L-amino acid decarboxylase)), Gene Registration Number (Genebank) BC012616 (BHMT, Betaine-homocysteine methyltransferase), Gene Registration Number Genebank BC015062 (MTHFD2, Methylenetetrahydrofolate dehydrogenase (NADP + dependent) 2, m ethenyltetrahydrofolate cyclohydrolase), Genebank BC033320 (TAF9, TAF9 RNA polymerase II, TATA box binding protein (TBP) -associated factor, 32kDa), Genebank BC033517 (ACOX2, Acyl-Coenzyme A oxidase 2, branched chain, Genebank BC034481 (BCKDHB, Branched chain keto acid dehydrogenase E1, beta polypeptide (maple syrup urine disease)), Gene accession (Genebank) BC035654 (NR1H4, Nuclear receptor subfamily 1, group H, member 4) Gene Registration Number (Genebank) BC042453 (MCCC1, Methylcrotonoyl-Coenzyme A carboxylase 1 (alpha)), Gene Registration Number (Genebank) BC045541 (LOC200895, Dihydrofolate reductase-like 1), Gene Registration Number (Genebank) CR609484 (KYNU Kynureninase (L-kynurenine hydrolase), Genebank (Genebank) CR749593 (GLS, Glutaminase), Genebank (Genebank) NM_000016 (ACADM, Acyl-Coenzyme A dehydrogenase, C-4 to C-12 straight chain), Genebank Number (Genebank) NM_000277 (PAH, Phenylalanine hyd roxylase), Gene Registration Number (Genebank) NM_001801 (CDO1, Cysteine dioxygenase, type I), Gene Registration Number (Genebank) NM_002860 (ALDH18A1, Aldehyde dehydrogenase 18 family, member A1), Gene Registration Number (Genebank) NM_004169 (SHMT1, Serrine hydroxymethyltransferase 1 (soluble)), gene registration number (Genebank) NM_004457 (ACSL3, Acyl-CoA synthetase long-chain family member 3), gene registration number (Genebank) NM_005589 (ALDH6A1, Aldehyde dehydrogenase 6 family, member A1), gene registration Number (Genebank) NM_013261 (PPARGC1A, Peroxisome proliferative activated receptor, gamma, coactivator 1, alpha), Gene Registration Number (Genebank) NM_018122 (FLJ10514, Aspartyl-tRNA synthetase 2 (mitochondrial)), Gene Registration Number (Genebank) NM_080820 (HARS2 , Histidyl-tRNA synthetase 2), Gene Registration Number (Genebank) U73338 (MTR, 5-methyltetrahydrofolate-homocysteine methyltransferase), Gene Registration Number (Genebank) AK001676 (NUP133, Nucleoporin 133kDa), Gene Registration Number (Genebank) AK002165 (DKFZP564 O123, Chromatin modifying protein 2B), Genebank AK023143 (C10orf119, Chromosome 10 open reading frame 119), Gene Accession Number (Genebank) AK094603 (Homo sapiens cDNA FLJ37284 fis, clone BRAMY2013590.  [AK094603], unnamed protein product; Homo sapiens cDNA FLJ37284 fis, clone BRAMY2013590. ), Gene Registration Number (Genebank) AK124768 (TNPO1, Transportin 1), Gene Registration Number (Genebank) BC000100 (SNX5, Sorting nexin 5), Gene Registration Number (Genebank) BC039468 (NUP50, Nucleoporin 50kDa), Gene Registration Number (Genebank) ) BC064351 (SRP9, Signal recognition particle 9kDa), Genebank BX091259 (UNQ9438, TIMM9), Genebank BX641063 (DEK, DEK oncogene (DNA binding)), Genebank BX648363 (Genebank) SNX10, Sorting nexin 10), Gene Registration Number (Genebank) CR618609 (NOP5 / NOP58, Nucleolar protein NOP5 / NOP58), Gene Registration Number (Genebank) NM_002156 (HSPD1, Heat shock 60kDa protein 1 (chaperonin)), Gene Registration Number ( Genebank) NM_006380 (APPBP2, Amyloid beta precursor protein (cytoplasmic tail) binding protein 2), Gene Registration Number (Genebank) NM_007214 (SEC63, SEC63-like (S.  cerevisiae)), gene registration number (Genebank) NM_012460 (TIMM9, Translocase of inner mitochondrial membrane 9 homolog (yeast)), gene registration number (Genebank) NM_014765 (TOMM20, Translocase of outer mitochondrial membrane 20 homolog (yeast)), gene registration Genebank NM_020401 (NUP107, Nucleoporin 107kDa), Gene Registration Number (Genebank) NM_021807 (SEC8L1, Exocyst complex component 4), Gene Registration Number (Genebank) NM_031296 (RAB33B, RAB33B, member RAS oncogene family), Gene Registration Number ( Genebank) NM_145261 (TIM14, DnaJ (Hsp40) homolog, subfamily C, member 19), Gene Accession Number (Genebank) NM_173827 (FLJ38991, Mitochondrial COX18), Gene Accession Number (Genebank) AL162068 (NAP1L1, Nucleosome assembly protein 1-like 1 ), Genebank AL834186 (CDCA7, Cell division cycle associated 7), Genebank (Genebank) BC065520 (TCFL5, Transcription factor-like 5 (basic helix-loop-helix)), Genebank (Genebank) CR620626 (FGG, Fibrinogen gamma chain), heredity Genebank M58569 (Homo sapiens fibrinogen, A alpha polypeptide (FGA), transcript variant alpha-E, mRNA [NM_000508]), Genebank NM_002291 (LAMB1, Laminin, beta 1), gene registration number ( Genebank) NM_005141 (FGB, Fibrinogen beta chain), Genebank (Genebank) NM_005746 (PBEF1, Pre-B-cell colony enhancing factor 1), Genebank (Kenebank) AK002156 (WDR33, WD repeat domain 33), Gene registration Number (Genebank) AK074377 (UHRF1, Chromosome 19 open reading frame 31), Gene accession number (Genebank) AK122825 (HMGB1, High-mobility group box 1), Gene accession number (Genebank) BC032617 (POLI, Polymerase (DNA directed) iota ), Gene registration number (Genebank) CR600021 (HMGB2, High-mobility group box 2), gene registration number (Genebank) NM_001067 (TOP2A, Topoisomerase (DNA) II alpha 170kDa), gene registration number (Genebank) NM_002916 (RFC4, Replication factor C (activator 1) 4, 37kDa), gene accession number (Genebank) NM_003368 (USP1, Ubiquitin specific peptidase 1), Genebank NM_006904 (PRKDC, Protein kinase, DNA-activated, catalytic polypeptide), Genebank NM_138271 (ATRX, Alpha thalassemia / mental retardation syndrome X-linked (RAD54 homolog, S.  cerevisiae)), Genebank AF285167 (ABCA1, ATP-binding cassette, sub-family A (ABC1), member 1), Genebank AK124635 (PCSK9, Proprotein convertase subtilisin / kexin type 9), Genebank (Genebank) NM_000236 (LIPC, Lipase, hepatic), Genebank (Genebank) AF062341 (CTNND1, Catenin (cadherin-associated protein), delta 1), Genebank AF480883 (PPAP2B, Phosphatidic acid phosphatase type 2B), gene registration number (Genebank) BC035638 (LSS, Lanosterol synthase (2,3-oxidosqualene-lanosterol cyclase)), gene registration number (Genebank) BX648473 (PIGK, Phosphhatidylinositol glycan, class K), gene registration number (Genebank) ) NM_001444 (FABP5, Fatty acid binding protein 5 (psoriasis-associated)), gene accession number (Genebank) NM_003129 (SQLE, Squalene epoxidase), gene accession number (Genebank) NM_003580 (NSMAF, Neutral sphingomyelinase (N-SMase) activation associated) factor), Gene Accession Number (Genebank) NM_018361 (AGPAT5,1-acylglyc erol-3-phosphate O-acyltransferase 5 (lysophosphatidic acid acyltransferase (epsilon)), gene registration number (Genebank) NM_020918 (GPAM, Glycerol-3-phosphate acyltransferase, mitochondrial), gene registration number (Genebank) AB209031 (C5, Complement component 5), Genebank AF130100 (SERPINC1, Serpin peptidase inhibitor, clade C (antithrombin), member 1), Genebank AK122686 (IF, I factor (complement), Genebank (Genebank) BC022312 (C4BPA, Complement component 4 binding protein, alpha), gene registration number (Genebank) M75106 (CPB2, Carboxypeptidase B2 (plasma, carboxypeptidase U)), gene registration number (Genebank) NM_000893 (KNG1, Kininogen 1), gene registration number (Genebank) AK055619 (GNAQ, Guanine nucleotide binding protein (G protein), q polypeptide), Gene Registration Number (Genebank) AL832747 (GNAQ, Guanine nucleotide binding protein (G protein), q polypeptide), Gene Registration Number (Genebank) CR596712 (IL17D, Interleukin 17D), gene registration number (Genebank) AK000972 (C9orf40, Chromosome 9 open reading frame 40), Genebank AK023675 (UTRN, Utrophin (homologous to dystrophin), Genebank AK026095 (SNTB1, Syntrophin, Beta 1 (dystrophin-) associated protein A1, 59kDa, basic component 1)), Genebank AL117472 (SORBS1, Sorbin and SH3 domain containing 1), Genebank NM_018728 (MYO5C, Myosin VC), Gene accession number (Genebank) XM_371116 (MYO5B, Myosin VB), Gene Registration Number (Genebank) BC026320 (OGDHL, Oxoglutarate dehydrogenase-like), Gene Registration Number (Genebank) BC033391 (PP1665, Glycerophosphodiester phosphodiesterase domain containing 5), Gene Registration Number (GenebankK BC042421 (GenebankK) , Glycerol kinase, Genebank M15943 (ADH4, Alcohol dehydrogenase 4 (class II), pi polypeptide), Gene accession number (Genebank) NM_000671 (ADH5, Alcohol dehydrogenase 5 (class III), chi polypeptide), Gene Registration Number (Genebank) NM_002610 (PDK1, Pyruvate dehydrogenase kinase, isozyme 1), Genebank AK026927 (MGC5297, Hypothetical protein MGC5297), Genebank AK127326 (PHF17, PHD finger protein 17), Genebank BC039110 (SMNDC1, Survival motor neuron domain containing 1), Genebank BC041849 (ROCK1, Rho-associated, coiled-coil containing protein kinase 1), Genebank BX537500 (PDCD4, Programmed cell death 4 (neoplastic transformation inhibitor)), Genebank (Genebank) CR596268 (ITGB3BP, Integrin beta 3 binding protein (beta3-endonexin)), Genebank (Genebank) NM_004938 (DAPK1, Death-associated protein kinase 1), Genebank (Menebank) NM_012238 (SIRT1, Sirtuin (silent mating type information regulation 2 homolog) 1 (S.  cerevisiae)), gene registration number (Genebank) NM_130837 (OPA1, Optic atrophy 1 (autosomal dominant)), gene registration number (Genebank) NM_148957 (TNFRSF19, Tumor necrosis factor receptor superfamily, member 19), gene registration number (Genebank) AB208919 (FGFR1, Fibroblast growth factor receptor 1 (fms-related tyrosine kinase 2, Pfeiffer syndrome)), Genebank AB209601 (TIZ, Zinc finger protein 675), Genebank AK125150 (MAPK8, Mitogen-activated) protein kinase 8), gene bank number (Genebank) BC027881 (AFP, Alpha-fetoprotein), gene bank number (Genebank) NM_020995 (HPR, Hipgloglobin-related protein), gene bank number (Genebank) AF167706 (CRIM1, Cysteine rich transmembrane BMP) regulator 1 (chordin-like), Genebank BC045655 (MAC30, Hypothetical protein MAC30), Genebank BX537509 (NET1, Neuroepithelial cell transforming gene 1), Genebank BX640958 (YEATS4 YEATS domain containing 4) Genebank BX647757 (Homo sapiens sex comb on midleg-like 1 (Drosophila) (SCML1), mRNA [NM_006746], sex comb on midleg-like 1 (Drosophila), gene registration number (Genebank) NM_006548 (IMP -2, IGF-II mRNA-binding protein 2), Genebank AY376439 (ECT2, Epithelial cell transforming sequence 2 oncogene), Genebank AY596970 (GARNL1, GTPase activating Rap / RanGAP domain-like 1 ), Genebank BC050630 (RAB3-GAP150, RAB3 GTPase activating protein subunit 2 (non-catalytic)), Genebank NM_001001132 (ITSN1, Intersectin 1 (SH3 domain protein)), Gene registry number ( Genebank) NM_016340 (KIAA1961, KIAA1961 gene), Genebank NM_145290 (GPR125, G protein-coupled receptor 125), Genebank NM_003574 (VAPA, VAMP (vesicle-associated membrane protein) -associated protein A , 33kDa), Genebank M28016 (cytochrome b, Human mitochondrial cytochrome b gene, partial cds. ), Gene registration number (Genebank) NM_013277 (RACGAP1, Rac GTPase activating protein 1), gene registration number (Genebank) AB096248 (SNF1LK2, SNF1-like kinase 2), gene registration number (Genebank) NM_001698 (AUH, AU RNA binding protein / enoyl-Coenzyme A hydratase), Genebank AB091343 (C10orf3, Centrosomal protein 55kDa). 제 1항에 있어서, 하기 유전자가 다이벤조에이에이취안트라센의 노출에 의해 발현이 증가하는 것을 특징으로 하는 바이오마커:The biomarker according to claim 1, wherein the following genes are increased in expression by exposure to dibenzoaichanthracene: 유전자 등록번호(Genebank) AB209605(SKIV2L, Superkiller viralicidic activity 2-like(S. cerevisiae)), 유전자 등록번호(Genebank) AI200373(HIST1H2AL, Histone 1, H2al), 유전자 등록번호(Genebank) AK001594(AKAP8L, A kinase(PRKA) anchor protein 8-like), 유전자 등록번호(Genebank) AK057577(IRF3, Interferon regulatory factor 3), 유전자 등록번호(Genebank) AL832659(FLJ22833, Hypothetical protein FLJ22833), 유전자 등록번호(Genebank) BC034487(HIST1H2AK, Histone 1, H2ak), 유전자 등록번호(Genebank) BC034569(ZNF337, Zinc finger protein 337), 유전자 등록번호(Genebank) BC038432(RARA, Retinoic acid receptor, alpha), 유전자 등록번호(Genebank) BC067782(HIST1H2AG, Histone 1, H2ag), 유전자 등록번호(Genebank) BC069193(HIST2H2BE, Histone 2, H2be), 유전자 등록번호(Genebank) BC071638(HIST2H2BE, Histone 2, H2be), 유전자 등록번호(Genebank) BC082232(HIST1H2BG, Histone 1, H2bg), 유전자 등록번호(Genebank) BC101655(HIST1H2BI, Histone 1, H2bi), 유전자 등록번호(Genebank) BE741093(HIST1H2AE ,Histone 1, H2ae), 유전자 등록번호(Genebank) BE973853(HIST1H4J, Histone 1, H4j), 유전자 등록번호(Genebank) BM752802(HIST1H2BM, Histone 1, H2bm), 유전자 등록번호(Genebank) BM919305(POLR2L, Polymerase(RNA) II(DNA directed) polypeptide L, 7.6kDa), 유전자 등록번호(Genebank) BU603483(HIST1H1E, Histone 1, H1e), 유전자 등록번호(Genebank) BX436525(HIST1H2BH, Histone 1, H2bh), 유전자 등록번호(Genebank) BX647290(HIST1H2BO, Histone 1, H2bo), 유전자 등록번호(Genebank) CB529694(HIST2H2BE, Histone 2, H2be), 유전자 등록번호(Genebank) CD710576(HIST2H2AC, Histone 2, H2ac), 유전자 등록번호(Genebank) CK000930(HIST1H2AI, Histone 1, H2ai), 유전자 등록번호(Genebank) CR608156(HIST1H2AC, Histone 1, H2ac), 유전자 등록번호(Genebank) NM_002515(NOVA1, Neuro-oncological ventral antigen 1), 유전자 등록번호(Genebank) NM_003516(HIST2H2AA, Histone 2, H2aa), 유전자 등록번호(Genebank) NM_003519(HIST1H2BL, Histone 1, H2bl), 유전자 등록번호(Genebank) NM_003670(BHLHB2, Basic helix-loop-helix domain containing, class B, 2), 유전 자 등록번호(Genebank) NM_004660(DDX3Y, DEAD(Asp-Glu-Ala-Asp) box polypeptide 3, Y-linked), 유전자 등록번호(Genebank) NM_005319(HIST1H1C, Histone 1, H1c), 유전자 등록번호(Genebank) NM_005320(HIST1H1D, Histone 1, H1d), 유전자 등록번호(Genebank) NM_005524(HES1, Hairy and enhancer of split 1,(Drosophila)), 유전자 등록번호(Genebank) NM_006442(DRAP1, DR1-associated protein 1(negative cofactor 2 alpha)), 유전자 등록번호(Genebank) NM_021035(KIAA1404, KIAA1404 protein), 유전자 등록번호(Genebank) U86136(TEP1, Telomerase-associated protein 1), 유전자 등록번호(Genebank) AB209586(MAPK13, Mitogen-activated protein kinase 13), 유전자 등록번호(Genebank) AK074652(SERTAD1, SERTA domain containing 1), 유전자 등록번호(Genebank) AK122829(GAS2L1, Growth arrest-specific 2 like 1), 유전자 등록번호(Genebank) AK129595(GADD45B, Growth arrest and DNA-damage-inducible, beta), 유전자 등록번호(Genebank) BC018266(CDC42, Cell division cycle 42(GTP binding protein, 25kDa)), 유전자 등록번호(Genebank) BC041022(SCAND1, SCAN domain containing 1), 유전자 등록번호(Genebank) BM904612(S100A6, S100 calcium binding protein A6(calcyclin)), 유전자 등록번호(Genebank) BM913048(TIMP1, TIMP metallopeptidase inhibitor 1), 유전자 등록번호(Genebank) CR612719(GADD45A, Growth arrest and DNA-damage-inducible, alpha), 유전자 등록번호(Genebank) NM_001007271(DUSP13, Dual specificity phosphatase 13), 유전자 등록번호(Genebank) NM_001015053(HDAC5, Histone deacetylase 5), 유전자 등록번호(Genebank) NM_001953(ECGF1, Endothelial cell growth factor 1(platelet-derived)), 유전자 등록번호(Genebank) NM_003255(TIMP2, TIMP metallopeptidase inhibitor 2), 유전자 등록번호(Genebank) NM_005072(SLC12A4, Solute carrier family 12(potassium/chloride transporters), member 4), 유전자 등록번호(Genebank) NM_005343(HRAS, V-Ha-ras Harvey rat sarcoma viral oncogene homolog), 유전자 등록번호(Genebank) NM_005736(ACTR1A, ARP1 actin-related protein 1 homolog A, centractin alpha(yeast)), 유전자 등록번호(Genebank) NM_007065(CDC37, CDC37 cell division cycle 37 homolog(S. cerevisiae)), 유전자 등록번호(Genebank) NM_078467(CDKN1A, Cyclin-dependent kinase inhibitor 1A(p21, Cip1)), 유전자 등록번호(Genebank) U68019(SMAD3, SMAD, mothers against DPP homolog 3(Drosophila)), 유전자 등록번호(Genebank) X02812(TGFB1, Transforming growth factor, beta 1(Camurati-Engelmann disease)), 유전자 등록번호(Genebank) AB033060(PDCD6, Aryl-hydrocarbon receptor repressor), 유전자 등록번호(Genebank) AB209361(FAS, Fas(TNF receptor superfamily, member 6)), 유전자 등록번호(Genebank) AF332558(BBC3, BCL2 binding component 3), 유전자 등록번호(Genebank) AY028896(CARD10, Caspase recruitment domain family, member 10), 유전자 등록번호(Genebank) BC063507(HSPA1B, Heat shock 70kDa protein 1B), 유전자 등록번호(Genebank) BM557864(HSPB1, Heat shock 27kDa protein 1), 유전자 등록번호(Genebank) NM_001003940(BMF ,Bcl2 modifying factor), 유전자 등록번호(Genebank) NM_001165(BIRC3, Baculoviral IAP repeat-containing 3), 유전자 등록번호(Genebank) NM_001197(BIK, BCL2-interacting killer(apoptosis-inducing)), 유전자 등록번호(Genebank) NM_002305(LGALS1, Lectin, galactoside-binding, soluble, 1(galectin 1)), 유전자 등록번호(Genebank) NM_003311(PHLDA2, Pleckstrin homology-like domain, family A, member 2), 유전자 등록번호(Genebank) NM_003639(IKBKG, Inhibitor of kappa light polypeptide gene enhancer in B-cells, kinase gamma), 유전자 등록번호(Genebank) NM_003820(TNFRSF14, Tumor necrosis factor receptor superfamily, member 14(herpesvirus entry mediator)), 유전자 등록번호(Genebank) NM_003897(IER3, Immediate early response 3), 유전자 등록번호(Genebank) NM_004401(DFFA, DNA fragmentation factor, 45kDa, alpha polypeptide), 유전자 등록번호(Genebank) NM_016639(TNFRSF12A, Tumor necrosis factor receptor superfamily, member 12A), 유전자 등록번호(Genebank) BC048334(MT1G, Metallothionein 1G), 유전자 등록번호(Genebank) BC053882(MT1X, Metallothionein 1X), 유전자 등록번호(Genebank) BI488702(MT1K, Metallothionein 1M), 유전자 등록번호(Genebank) NM_005947(MT1B, Metallothionein 1B(functional)), 유전자 등록번호(Genebank) AK055088(CYP2J2, Cytochrome P450, family 2, subfamily J, polypeptide 2), 유전자 등록번호(Genebank) AK094474(RHOC, Ras homolog gene family, member C), 유전자 등록번호(Genebank) BC015041(VAT1, Family with sequence similarity 82, member C), 유전자 등록번호(Genebank) NM_000499(CYP1A1, Cytochrome P450, family 1, subfamily A, polypeptide 1), 유전자 등록번호(Genebank) NM_004881(TP53I3, Tumor protein p53 inducible protein 3), 유전자 등록번호(Genebank) NM_201397(GPX1, Glutathione peroxidase 1), 유전자 등록번호(Genebank) XM_498018(LOC391827, Similar to Keratin, type I cytoskeletal 18(Cytokeratin 18)(K18)(CK 18)), 유전자 등록번호(Genebank) AF524864(AKR1B10, Aldo-keto reductase family 1, member B10(aldose reductase)), 유전자 등록번호(Genebank) AL833205(ETFB, Electron-transfer-flavoprotein, beta polypeptide), 유전자 등록번호(Genebank) BC034763(FDXR, Ferredoxin reductase), 유전자 등록번호(Genebank) CR610878(AKR1B1, Aldo-keto reductase family 1, member B1(aldose reductase)), 유전자 등록번호(Genebank) NM_003330(TXNRD1, Thioredoxin reductase 1), 유전자 등록번호(Genebank) NM_004199(P4HA2, Procollagen-proline, 2-oxoglutarate 4-dioxygenase(proline 4-hydroxylase), alpha polypeptide II), 유전자 등록번호(Genebank) NM_004753(DHRS3, Dehydrogenase/reductase(SDR family) member 3), 유전자 등록번호(Genebank) NM_031226(CYP19A1, Cytochrome P450, family 19, subfamily A, polypeptide 1), 유전자 등록번호(Genebank) NM_032468(ASPH, Aspartate beta-hydroxylase), 유전자 등록번호(Genebank) AB209112(SLC2A8, Solute carrier family 2,(facilitated glucose transporter) member 8), 유전자 등록번호(Genebank) BC011409(UGT1A6, UDP glucuronosyltransferase 1 family, polypeptide A9), 유전자 등록번호(Genebank) H18681(C20orf139, Sulfiredoxin 1 homolog(S. cerevisiae)), 유전자 등록번 호(Genebank) NM_002658(PLAU, Plasminogen activator, urokinase), 유전자 등록번호(Genebank) NM_005064(CCL23, Chemokine(C-C motif) ligand 23), 유전자 등록번호(Genebank) NM_032965(CCL14, Chemokine(C-C motif) ligand 15), 유전자 등록번호(Genebank) Y11307(CYR61, Cysteine-rich, angiogenic inducer, 61), 유전자 등록번호(Genebank) AB209808(AP1M1, Adaptor-related protein complex 1, mu 1 subunit), 유전자 등록번호(Genebank) AK074154(SYTL1, Synaptotagmin-like 1), 유전자 등록번호(Genebank) AK098475(GRPEL1, GrpE-like 1, mitochondrial(E. coli)), 유전자 등록번호(Genebank) AK123405(GDI1, GDP dissociation inhibitor 1), 유전자 등록번호(Genebank) BC000786(ARFGAP1, ADP-ribosylation factor GTPase activating protein 1), 유전자 등록번호(Genebank) BC042390(VTI1B, Vesicle transport through interaction with t-SNAREs homolog 1B(yeast)), 유전자 등록번호(Genebank) BG036385(RAMP1, Receptor(calcitonin) activity modifying protein 1), 유전자 등록번호(Genebank) BX648781(GABARAPL1, GABA(A) receptor-associated protein like 1), 유전자 등록번호(Genebank) NM_001013839(EXOC7, Exocyst complex component 7), 유전자 등록번호(Genebank) NM_002926(RGS12, Regulator of G-protein signalling 12), 유전자 등록번호(Genebank) NM_007097(CLTB, Clathrin, light polypeptide(Lcb)), 유전자 등록번호(Genebank) NM_013336(SEC61A1, Sec61 alpha 1 subunit(S. cerevisiae)), 유전자 등록번호(Genebank) NM_024101(MLPH, Melanophilin), 유전자 등록번호(Genebank) NM_032872(SYTL1, Synaptotagmin-like 1), 유전자 등록번호(Genebank) NM_000596(IGFBP1, Insulin-like growth factor binding protein 1), 유전자 등록번호(Genebank) NM_001553(IGFBP7, Insulin-like growth factor binding protein 7), 유전자 등록번호(Genebank) NM_001712(CEACAM1, Carcinoembryonic antigen-related cell adhesion molecule 1(biliary glycoprotein)), 유전자 등록번호(Genebank) NM_012396(PHLDA3, Pleckstrin homology-like domain, family A, member 3), 유전자 등록번호(Genebank) Y12692(WNT11, Wingless-type MMTV integration site family, member 11), 유전자 등록번호(Genebank) BC014470(AZGP1, Alpha-2-glycoprotein 1, zinc), 유전자 등록번호(Genebank) BQ683841(S100A11, S100 calcium binding protein A11(calgizzarin)), 유전자 등록번호(Genebank) NM_002337(LRPAP1, Low density lipoprotein receptor-related protein associated protein 1), 유전자 등록번호(Genebank) AF059617(PLK2, Polo-like kinase 2(Drosophila)), 유전자 등록번호(Genebank) AK128553(ZZANK1, Mindbomb homolog 2(Drosophila)), 유전자 등록번호(Genebank) BX649164(PAI; PAI1; PAI-1; PLANH1, serpin peptidase inhibitor, clade E(nexin, plasminogen activator inhibitor type 1), member 1), 유전자 등록번호(Genebank) NM_000602(SERPINE1, Serpin peptidase inhibitor, clade E(nexin, plasminogen activator inhibitor type 1), member 1), 유전자 등록번호(Genebank) BI767815(GP9, Glycoprotein IX(platelet)), 유전자 등록번호(Genebank) BM918324(LY96, Lymphocyte antigen 96), 유전자 등록번호(Genebank) NM_006404(PROCR, Protein C receptor, endothelial(EPCR)), 유전자 등록번 호(Genebank) AF031469(MR1, Major histocompatibility complex, class I-related), 유전자 등록번호(Genebank) BF569086(NK4, Interleukin 32), 유전자 등록번호(Genebank) BG564326(SAA4, Serum amyloid A4, constitutive), 유전자 등록번호(Genebank) NM_001633(AMBP, Alpha-1-microglobulin/bikunin precursor), 유전자 등록번호(Genebank) NM_005532(IFI27, Interferon, alpha-inducible protein 27), 유전자 등록번호(Genebank) NM_017670(OTUB1, OTU domain, ubiquitin aldehyde binding 1), 유전자 등록번호(Genebank) AK130130(CAPG, Capping protein(actin filament), gelsolin-like), 유전자 등록번호(Genebank) BX648190(WDR1, WD repeat domain 1), 유전자 등록번호(Genebank) CF552540(TNNI2, Troponin I type 2(skeletal, fast)), 유전자 등록번호(Genebank) NM_001006946(SDC1, Syndecan 1), 유전자 등록번호(Genebank) NM_007284(PTK9L, PTK9L protein tyrosine kinase 9-like(A6-related protein)), 유전자 등록번호(Genebank) NM_015990(KLHL5, Kelch-like 5(Drosophila)), 유전자 등록번호(Genebank) BM467105(CIB1, Calcium and integrin binding 1(calmyrin)), 유전자 등록번호(Genebank) CF553054(TNNC1, Troponin C type 1(slow)), 유전자 등록번호(Genebank) NM_006384(CIB1, Calcium and integrin binding 1(calmyrin)), 유전자 등록번호(Genebank) NM_080388(S100A16, S100 calcium binding protein A16), 유전자 등록번호(Genebank) NM_005817(M6PRBP1, Mannose-6-phosphate receptor binding protein 1), 유전자 등록번호(Genebank) NM_006555(YKT6, SNARE protein Ykt6), 유전자 등록번호(Genebank) AK093461(ISYNA1, Myo-inositol 1-phosphate synthase A1), 유전자 등록번호(Genebank) AK097009(PLTP,phospholipid transfer protein), 유전자 등록번호(Genebank) BC030207(NR0B2, Nuclear receptor subfamily 0, group B, member 2), 유전자 등록번호(Genebank) BC035124(UNQ2541, MSFL2541), 유전자 등록번호(Genebank) NM_145323(OSBPL3, Oxysterol binding protein-like 3), 유전자 등록번호(Genebank) BC050455(DDB2, LIM homeobox 3), 유전자 등록번호(Genebank) BC068535(TP53AP1, TP53 activated protein 1), 유전자 등록번호(Genebank) NM_016440(VRK3, Vaccinia related kinase 3), 유전자 등록번호(Genebank) NM_001124(ADM, Adrenomedullin), 유전자 등록번호(Genebank) NM_170707(LMNA, Lamin A/C), 유전자 등록번호(Genebank) NM_004633(IL1R2, Interleukin 1 receptor, type II), 유전자 등록번호(Genebank) NM_004864(GDF15, Growth differentiation factor 15), 유전자 등록번호(Genebank) NM_017572(MKNK2, MAP kinase interacting serine/threonine kinase 2), 유전자 등록번호(Genebank) AA669162(AMPD3, Transcribed locus), 유전자 등록번호(Genebank) AB033073(SULF2, Sulfatase 2), 유전자 등록번호(Genebank) AB208949(LRDD, Leucine-rich repeats and death domain containing), 유전자 등록번호(Genebank) AK022712(FLJ12650, Family with sequence similarity 77, member C), 유전자 등록번호(Genebank) AK095363(AQP3, Aquaporin 3), 유전자 등록번호(Genebank) AY368150(CHR2SYT, Family with sequence similarity 62(C2 domain containing) member B), 유전자 등록번호(Genebank) BU587578(RGS10, Regulator of G-protein signalling 10), 유전자 등록번호(Genebank) BU945318(MT2A, Hypothetical gene supported by X97260; BC070289), 유전자 등록번호(Genebank) NM_001013632(LOC343521, Similar to hypothetical protein 4833401D15), 유전자 등록번호(Genebank) NM_006426(DPYSL4, Dihydropyrimidinase-like 4), 유전자 등록번호(Genebank) NM_133493(CD109, CD109 antigen(Gov platelet alloantigens)), 유전자 등록번호(Genebank) NM_145256(LRRC25, Leucine rich repeat containing 25).Genebank Number AB209605 (SKIV2L, Superkiller viralicidic activity 2-like (S. cerevisiae), Genebank Number AI200373 (HIST1H2AL, Histone 1, H2al), Genebank Number AK001594 (AKAP8L, A kinase (PRKA) anchor protein 8-like), Genebank AK057577 (IRF3, Interferon regulatory factor 3), Genebank AL832659 (FLJ22833, Hypothetical protein FLJ22833), Genebank BC034487 (Genebank) HIST1H2AK, Histone 1, H2ak), Genebank BC034569 (ZNF337, Zinc finger protein 337), Genebank BC038432 (RARA, Retinoic acid receptor, alpha), Genebank BC067782 (HIST1H2AG , Histone 1, H2ag), Gene Registration Number (Genebank) BC069193 (HIST2H2BE, Histone 2, H2be), Gene Registration Number (Genebank) BC071638 (HIST2H2BE, Histone 2, H2be), Gene Registration Number (Genebank) BC082232 (HIST1H2BG, Histone 1, H2bg), Genebank BC101655 (HIST1H2BI, His tone 1, H2bi, Genebank BE741093 (HIST1H2AE, Histone 1, H2ae), Genebank BE973853 (HIST1H4J, Histone 1, H4j), Genebank BM752802 (HIST1H2BM, Histone 1 , H2bm), Genebank BM919305 (POLR2L, Polymerase (RNA) II (DNA directed) polypeptide L, 7.6kDa), Genebank (Benebank) BU603483 (HIST1H1E, Histone 1, H1e), Gene Registry Number ( Genebank) BX436525 (HIST1H2BH, Histone 1, H2bh), Gene Registration Number (Genebank) BX647290 (HIST1H2BO, Histone 1, H2bo), Gene Registration Number (Genebank) CB529694 (HIST2H2BE, Histone 2, H2be), Gene Registration Number (Genebank) CD710576 (HIST2H2AC, Histone 2, H2ac), Gene Registration Number (Genebank) CK000930 (HIST1H2AI, Histone 1, H2ai), Gene Registration Number (Genebank) CR608156 (HIST1H2AC, Histone 1, H2ac), Gene Registration Number (Genebank) NM_002515 ( NOVA1, Neuro-oncological ventral antigen 1), Genebank NM_003516 (HIST2H2AA, Histone 2, H2aa), gene Genebank NM_003519 (HIST1H2BL, Histone 1, H2bl), Gene Registration Number (Genebank) NM_003670 (BHLHB2, Basic helix-loop-helix domain containing, class B, 2), Genebank NM_004660 (DDX3Y , DEAD (Asp-Glu-Ala-Asp) box polypeptide 3, Y-linked), gene registration number (Genebank) NM_005319 (HIST1H1C, Histone 1, H1c), gene registration number (Genebank) NM_005320 (HIST1H1D, Histone 1, H1d ), Genebank NM_005524 (HES1, Hairy and enhancer of split 1, (Drosophila)), Genebank NM_006442 (DRAP1, DR1-associated protein 1 (negative cofactor 2 alpha), Gene accession number (Genebank) NM_021035 (KIAA1404, KIAA1404 protein), Genebank (Uenebank) U86136 (TEP1, Telomerase-associated protein 1), Genebank (Genebank) AB209586 (MAPK13, Mitogen-activated protein kinase 13), Gene Registration Number ( Genebank) AK074652 (SERTAD1, SERTA domain containing 1), Genebank AK122829 (GAS2L1, Growth arrest-specific 2 like 1), Genebank AK129595 (GADD45B, Growth arrest and DNA-damage-inducible, beta), Genebank BC018266 (CDC42, Cell division cycle 42 (GTP binding protein, 25kDa)), Gene Genebank BC041022 (SCAND1, SCAN domain containing 1), Genebank BM904612 (S100A6, S100 calcium binding protein A6 (calcyclin)), Genebank BM913048 (TIMP1, TIMP metallopeptidase inhibitor 1) , Gene Registration Number (Genebank) CR612719 (GADD45A, Growth arrest and DNA-damage-inducible, alpha), Gene Registration Number (Genebank) NM_001007271 (DUSP13, Dual specificity phosphatase 13), Gene Registration Number (Genebank) NM_001015053 (HDAC5, Histone deacetylase 5), Genebank NM_001953 (ECGF1, Endothelial cell growth factor 1 (platelet-derived)), Genebank NM_003255 (TIMP2, TIMP metallopeptidase inhibitor 2), Genebank NM_005072 (Genebank) SLC12A4, Solute carrier family 12 (po tassium / chloride transporters), member 4), Genebank NM_005343 (HRAS, V-Ha-ras Harvey rat sarcoma viral oncogene homolog), Genebank NM_005736 (ACTR1A, ARP1 actin-related protein 1 homolog A, centractin alpha (yeast), Genebank NM_007065 (CDC37, CDC37 cell division cycle 37 homolog (S. cerevisiae)), Genebank NM_078467 (CDKN1A, Cyclin-dependent kinase inhibitor 1A (p21, Cip1)), Genebank U68019 (SMAD3, SMAD, mothers against DPP homolog 3 (Drosophila)), Gene Genebank X02812 (TGFB1, Transforming growth factor, beta 1 (Camurati-Engelmann disease), Genebank AB033060 (PDCD6, Aryl-hydrocarbon receptor repressor), Genebank AB209361 (FAS, Fas (TNF receptor superfamily, member 6)), Genebank AF332558 (BBC3, BCL2 binding component 3), Genebank AY028896 (CARD10, Caspase recruitment domain family, member 10), Gene entry number ( Genebank) BC063507 (HSPA1B, Heat shock 70kDa protein 1B), Gene Registration Number (Genebank) BM557864 (HSPB1, Heat Shock 27kDa protein 1), Gene Registration Number (Genebank) NM_001003940 (BMF, Bcl2 modifying factor), Gene Registration Number (Genebank) NM_001165 (BIRC3, Baculoviral IAP repeat-containing 3), heredity Genebank NM_001197 (BIK, BCL2-interacting killer (apoptosis-inducing)), Genebank (Genebank) NM_002305 (LGALS1, Lectin, galactoside-binding, soluble, 1 (galectin 1)), Gene Registration Number ( Genebank) NM_003311 (PHLDA2, Pleckstrin homology-like domain, family A, member 2), Genebank NM_003639 (IKBKG, Inhibitor of kappa light polypeptide gene enhancer in B-cells, kinase gamma), Gene accession number (Genebank ) NM_003820 (TNFRSF14, Tumor necrosis factor receptor superfamily, member 14 (herpesvirus entry mediator), Genebank NM_003897 (IER3, Immediate early response 3), Genebank NM_004401 (DFFA, DNA fragmentation factor, 45 kDa, alpha polypeptide), Genebank NM_016639 (TNFRSF12A, Tumor necrosis factor receptor superfamily, member 12A), Genebank BC048334 (MT1G, Metallothionein 1G), Genebank BC053882 (MT1X, Metallothionein 1X), heredity Genebank BI488702 (MT1K, Metallothionein 1M), Gene Registration Number (Genebank) NM_005947 (MT1B, Metallothionein 1B (functional)), Gene Registration Number (Genebank) AK055088 (CYP2J2, Cytochrome P450, family 2, subfamily J, polypeptide 2), Genebank AK094474 (RHOC, Ras homolog gene family, member C), Genebank BC015041 (VAT1, Family with sequence similarity 82, member C), Genebank NM_000499 ( CYP1A1, Cytochrome P450, family 1, subfamily A, polypeptide 1), gene registration number (Genebank) NM_004881 (TP53I3, Tumor protein p53 inducible protein 3), gene registration number (Genebank) NM_201397 (GPX1, Glutathione peroxidase 1), gene registration Genebank XM_498018 (LOC391827, Similar to Keratin, type I cytoskeletal 18 (Cytokeratin 18) (K18) (CK 18)), Gene accession number (Genebank) AF524864 (AKR1B10, Aldo-keto reductase family 1, member B10 (aldose) reductase), Genebank AL833205 (ETFB, Electron- transfer-flavoprotein, beta polypeptide), genebank (Genebank) BC034763 (FDXR, Ferredoxin reductase), genebank (Genebank) CR610878 (AKR1B1, Aldo-keto reductase family 1, member B1 (aldose reductase), gene registration number (Genebank) NM_003330 (TXNRD1, Thioredoxin reductase 1), gene registration number (Genebank) NM_004199 (P4HA2, Procollagen-proline, 2-oxoglutarate 4-dioxygenase (proline 4-hydroxylase), alpha polypeptide II), gene registration number (Genebank) NM_004753 (DHRS3, Dehydrogenase / reductase (SDR family) member 3), gene registration number (Genebank) NM_031226 (CYP19A1, Cytochrome P450, family 19, subfamily A, polypeptide 1), gene registration number (Genebank) NM_032468 (ASPH, Aspartate beta -hydroxylase), Genebank AB209112 (SLC2A8, Solute carrier family 2, (facilitated glucose transporter) member 8), Genebank (Genebank) BC011409 (UGT1A6, UDP glucuronosyltransferase 1 family, polypeptide A9) (Genebank) H18681 (C20or f139, Sulfiredoxin 1 homolog (S. cerevisiae)), Genebank NM_002658 (PLAU, Plasminogen activator, urokinase), Genebank NM_005064 (CCL23, Chemokine (CC motif) ligand 23), Genebank NM_032965 (CCL14, Chemokine (CC motif) ligand 15), Genebank Y11307 (CYR61, Cysteine-rich, angiogenic inducer, 61), Genebank AB209808 (AP1M1, Adaptor-related protein complex 1, mu 1 subunit) , Gene Registration Number (Genebank) AK074154 (SYTL1, Synaptotagmin-like 1), Gene Registration Number (Genebank) AK098475 (GRPEL1, GrpE-like 1, mitochondrial (E. coli)), Gene Registration Number (Genebank) AK123405 (GDI1, GDP dissociation inhibitor 1), Genebank BC000786 (ARFGAP1, ADP-ribosylation factor GTPase activating protein 1), Genebank BC042390 (VTI1B, Vesicle transport through interaction with t-SNAREs homolog 1B (yeast) Genebank BG036385 (RAMP1, Receptor (calcitonin) activity modif ying protein 1), gene registration number (Genebank) BX648781 (GABARAPL1, GABA (A) receptor-associated protein like 1), gene registration number (Genebank) NM_001013839 (EXOC7, Exocyst complex component 7), gene registration number (Genebank) NM_002926 (RGS12, Regulator of G-protein signaling 12), Genebank NM_007097 (CLTB, Clathrin, light polypeptide (Lcb)), Genebank NM_013336 (SEC61A1, Sec61 alpha 1 subunit (S. cerevisiae)), gene accession number (Genebank) NM_024101 (MLPH, Melanophilin), gene accession number (Genebank) NM_032872 (SYTL1, Synaptotagmin-like 1), gene accession number (Genebank) NM_000596 (IGFBP1, Insulin-like growth factor binding protein 1), gene registration number (Genebank) NM_001553 (IGFBP7, Insulin-like growth factor binding protein 7), gene registration number (Genebank) NM_001712 (CEACAM1, Carcinoembryonic antigen-related cell adhesion molecule 1 (biliary glycoprotein)), gene registration number (Genebank) NM_012396 (PHLDA3, Pleckstrin homology-like domain, family A, member 3), Genebank Number Y12692 (WNT11, Wingless-type MMTV integration site family, member 11), Genebank Number BC014470 ( AZGP1, Alpha-2-glycoprotein 1, zinc), Genebank BG683841 (S100A11, S100 calcium binding protein A11 (calgizzarin)), Genebank NM_002337 (LRPAP1, Low density lipoprotein receptor-related protein associated protein 1), heredity Registration Number (Genebank) AF059617 (PLK2, Polo-like kinase 2 (Drosophila)), gene registration number (Genebank) AK128553 (ZZANK1, Mindbomb homolog 2 (Drosophila)), gene registration number (Genebank) BX649164 (PAI; PAI1; PAI-1; PLANH1, serpin peptidase inhibitor, clade E (nexin, plasminogen activator inhibitor type 1), member 1), gene accession number (Genebank) NM_000602 (SERPINE1, Serpin peptidase inhibitor, clade E (nexin, plasminogen activator inhibitor type 1), member 1 Genebank BI767815 (GP9, Glycoprotein IX (platelet)), Genebank (Genebank) BM918324 (LY96, Lymphocyte Antigen 96), Genebank NM_006404 (PROCR, Protein C receptor, endothelial ( EPCR)), Genebank AF031469 (MR1, Major histocompatibility complex, class I-related), Genebank BF569086 (NK4, Interleukin 32), Genebank BG564326 (SAA4, Serum amyloid A4, constitutive), gene registration number (Genebank) NM_001633 (AMBP, Alpha-1-microglobulin / bikunin precursor), gene registration number (Genebank) NM_005532 (IFI27, Interferon, alpha-inducible protein 27), gene registration number (Genebank) NM_017670 (OTUB1, OTU domain, ubiquitin aldehyde bind ing 1), Gene Registration Number (Genebank) AK130130 (CAPG, Capping protein (actin filament), gelsolin-like), Gene Registration Number (Genebank) BX648190 (WDR1, WD repeat domain 1), Gene Registration Number (Genebank) CF552540 ( TNNI2, Troponin I type 2 (skeletal, fast)), Gene Registration Number (Genebank) NM_001006946 (SDC1, Syndecan 1), Gene Registration Number (Genebank) NM_007284 (PTK9L, PTK9L protein tyrosine kinase 9-like (A6-related protein) ), Gene Registration Number (Genebank) NM_015990 (KLHL5, Kelch-like 5 (Drosophila)), Gene Registration Number (Genebank) BM467105 (CIB1, Calcium and integrin binding 1 (calmyrin)), Gene Registration Number (Genebank) CF553054 (TNNC1) , Troponin C type 1 (slow)), Gene Registration Number (Genebank) NM_006384 (CIB1, Calcium and integrin binding 1 (calmyrin)), Gene Registration Number (Genebank) NM_080388 (S100A16, S100 calcium binding protein A16), Gene Registration Number (Genebank) NM_005817 (M6PRBP1, Mannose-6-phosphate receptor binding protein 1), gene accession number (Genebank) NM_006555 (Y KT6, SNARE protein Ykt6), gene registration number (Genebank) AK093461 (ISYNA1, Myo-inositol 1-phosphate synthase A1), gene registration number (Genebank) AK097009 (PLTP, phospholipid transfer protein), gene registration number (Genebank) BC030207 ( NR0B2, Nuclear receptor subfamily 0, group B, member 2), Genebank BC035124 (UNQ2541, MSFL2541), Genebank NM_145323 (OSBPL3, Oxysterol binding protein-like 3), Genebank (Genebank) ) BC050455 (DDB2, LIM homeobox 3), Genebank BC068535 (TP53AP1, TP53 activated protein 1), Genebank NM_016440 (VRK3, Vaccinia related kinase 3), Genebank NM_001124 ( ADM, Adrenomedullin), Gene Registration Number (Genebank) NM_170707 (LMNA, Lamin A / C), Gene Registration Number (Genebank) NM_004633 (IL1R2, Interleukin 1 receptor, type II), Gene Registration Number (Genebank) NM_004864 (GDF15, Growth differentiation factor 15), Genebank NM_017572 ( MKNK2, MAP kinase interacting serine / threonine kinase 2), gene accession number (Genebank) AA669162 (AMPD3, Transcribed locus), gene accession number (Genebank) AB033073 (SULF2, Sulfatase 2), gene accession number (Genebank) AB208949 (LRDD, Leucine-rich repeats and death domain containing), Genebank AK022712 (FLJ12650, Family with sequence similarity 77, member C), Genebank AK095363 (AQP3, Aquaporin 3), Gene Registration Number (Genebank) AY368150 (CHR2SYT, Family with sequence similarity 62 (C2 domain containing) member B), Genebank BU587578 (RGS10, Regulator of G-protein signaling 10), Genebank BU945318 (MT2A, Hypothetical gene supported by X97260; BC070289), Gene Registration Number (Genebank) NM_001013632 (LOC343521, Similar to hypothetical protein 4833401D15), Gene Registration Number (Genebank) NM_006426 (DPYSL4, Dihydropyrimidinase-like 4), Gene Registration Number (Genebank) NM_133493 (CD109, CD109 antigen (Gov) platelet alloantigens)), Genebank NM_145256 (LRRC25, Leucine rich repeat containing 25). 제 1항에 있어서, 하기 유전자가 다이벤조에이에이취안트라센의 노출에 의해 발현이 감소하는 것을 특징으로 하는 바이오마커:The biomarker according to claim 1, wherein the following genes are reduced in expression by exposure to dibenzoAh-anthracene. 유전자 등록번호(Genebank) AB033337(MPHOSPH1,M-phase phosphoprotein 1), 유전자 등록번호(Genebank) AB208875(Septin 10,Septin 10), 유전자 등록번호(Genebank) AF053305(BUB1,BUB1 budding uninhibited by benzimidazoles 1 homolog(yeast)), 유전자 등록번호(Genebank) AF053306(BUB1B,BUB1 budding uninhibited by benzimidazoles 1 homolog beta(yeast)), 유전자 등록번호(Genebank) AF345347(SPAG5,Sperm associated antigen 5), 유전자 등록번호(Genebank) AK222819(NUSAP1,Nucleolar and spindle associated protein 1), 유전자 등록번호(Genebank) AY367065(ASPM,Asp(abnormal spindle)-like, microcephaly associated(Drosophila)), 유전자 등록번호(Genebank) BC004352(KIF22,Kinesin family member 22), 유전자 등록번호(Genebank) BC010607(IGF1R,Insulin-like growth factor 1 receptor), 유전자 등록번 호(Genebank) BC011000(CDCA5,Cell division cycle associated 5), 유전자 등록번호(Genebank) BC013326(GAS2,Growth arrest-specific 2), 유전자 등록번호(Genebank) BC032677(UBE2C,Ubiquitin-conjugating enzyme E2C), 유전자 등록번호(Genebank) BC040991(TFDP2,Transcription factor Dp-2(E2F dimerization partner 2)), 유전자 등록번호(Genebank) BC050384(SUPT3H,Suppressor of Ty 3 homolog(S. cerevisiae)), 유전자 등록번호(Genebank) BC068483(RINT-1,Rad50-interacting protein 1), 유전자 등록번호(Genebank) BQ278454(CKS1B,CDC28 protein kinase regulatory subunit 1B), 유전자 등록번호(Genebank) BX647885(STMN1,Stathmin 1/oncoprotein 18), 유전자 등록번호(Genebank) CR604810(CCNA2,Cyclin A2), 유전자 등록번호(Genebank) CR933728(CDC2,Cell division cycle 2, G1 to S and G2 to M), 유전자 등록번호(Genebank) D42045(DCLRE1A,DNA cross-link repair 1A(PSO2 homolog, S. cerevisiae)), 유전자 등록번호(Genebank) NM_00089(HK2,Hexokinase 2), 유전자 등록번호(Genebank) NM_001005414(ZWINT,ZW10 interactor antisense), 유전자 등록번호(Genebank) NM_001018159(APPBP1,Amyloid beta precursor protein binding protein 1), 유전자 등록번호(Genebank) NM_001239(CCNH,Cyclin H), 유전자 등록번호(Genebank) NM_001790(CDC25C,Cell division cycle 25C), 유전자 등록번호(Genebank) NM_001827(CKS2,CDC28 protein kinase regulatory subunit 2), 유전자 등록번호(Genebank) NM_002431(MNAT1,Menage a trois 1(CAK assembly factor)), 유전자 등록번호(Genebank) NM_002467(MYC,V-myc myelocytomatosis viral oncogene homolog(avian)), 유전자 등록번호(Genebank) NM_002709(PPP1CB,Protein phosphatase 1, catalytic subunit, beta isoform), 유전자 등록번호(Genebank) NM_002737(PRKCA,Protein kinase C, alpha), 유전자 등록번호(Genebank) NM_002894(RBBP8,Retinoblastoma binding protein 8), 유전자 등록번호(Genebank) NM_003318(TTK,TTK protein kinase), 유전자 등록번호(Genebank) NM_003478(CUL5,Cullin 5), 유전자 등록번호(Genebank) NM_003981(PRC1,Protein regulator of cytokinesis 1), 유전자 등록번호(Genebank) NM_004064(CDKN1B,Cyclin-dependent kinase inhibitor 1B(p27, Kip1)), 유전자 등록번호(Genebank) NM_004354(CCNG2,Cyclin G2), 유전자 등록번호(Genebank) NM_004365(CETN3,Centrin, EF-hand protein, 3(CDC31 homolog, yeast)), 유전자 등록번호(Genebank) NM_004523(KIF11,Kinesin family member 11), 유전자 등록번호(Genebank) NM_004701(CCNB2,Cyclin B2), 유전자 등록번호(Genebank) NM_005504(BCAT1,Branched chain aminotransferase 1, cytosolic), 유전자 등록번호(Genebank) NM_005915(MCM6,MCM6 minichromosome maintenance deficient 6(MIS5 homolog, S. pombe)(S. cerevisiae)), 유전자 등록번호(Genebank) NM_006101(KNTC2,Kinetochore associated 2), 유전자 등록번호(Genebank) NM_006265(RAD21,RAD21 homolog(S. pombe)), 유전자 등록번호(Genebank) NM_014750(DLG7,Discs, large homolog 7(Drosophila)), 유전자 등록번호(Genebank) NM_014751(MTSS1,Metastasis suppressor 1), 유전자 등록번호(Genebank) NM_016343(CENPF,Centromere protein F, 350/400ka(mitosin)), 유전자 등록번 호(Genebank) NM_018492(PBK,PDZ binding kinase), 유전자 등록번호(Genebank) NM_018685(ANLN,Anillin, actin binding protein(scraps homolog, Drosophila)), 유전자 등록번호(Genebank) NM_019001(XRN1,5'-3' exoribonuclease 1), 유전자 등록번호(Genebank) NM_019063(EML4,Echinoderm microtubule associated protein like 4), 유전자 등록번호(Genebank) NM_020242(KNSL7,Kinesin family member 15), 유전자 등록번호(Genebank) U65410(MAD2L1,MAD2 mitotic arrest deficient-like 1(yeast)), 유전자 등록번호(Genebank) AB096175(SP5,Sp5 transcription factor), 유전자 등록번호(Genebank) AB209086(ZNF493,Zinc finger protein 493), 유전자 등록번호(Genebank) AB209334(SP3,Sp3 transcription factor), 유전자 등록번호(Genebank) AB209892(ZFX,Zinc finger protein, X-linked), 유전자 등록번호(Genebank) AF279145(ANTXR1,Anthrax toxin receptor 1), 유전자 등록번호(Genebank) AK095600(FLJ38281,Zinc finger protein 564), 유전자 등록번호(Genebank) AK123010(RRM2,Ribonucleotide reductase M2 polypeptide), 유전자 등록번호(Genebank) AK126180(DTYMK,Deoxythymidylate kinase(thymidylate kinase)), 유전자 등록번호(Genebank) AK130071(HSPC063,BTB(POZ) domain containing 15), 유전자 등록번호(Genebank) AK131420(ZNF66,Zinc finger protein 66), 유전자 등록번호(Genebank) AK131472(Homo sapiens cDNA FLJ16640 fis, clone TESTI4028938, moderately similar to Zinc finger protein 85. [AK131472],CDNA FLJ16640 fis, clone TESTI4028938, moderately similar to Zinc finger protein 85), 유전자 등록번호(Genebank) AK131527(ZNF15L1,Zinc finger protein 708(KOX8)), 유전자 등록번호(Genebank) AK160373(DKFZp547K1113,Zinc finger protein 710), 유전자 등록번호(Genebank) AL832422(ZNF430,Zinc finger protein 430), 유전자 등록번호(Genebank) AY269786(ZNF429,Zinc finger protein 429), 유전자 등록번호(Genebank) BC035579(ZNF100,Zinc finger protein 100), 유전자 등록번호(Genebank) BC036394(ZNF85,Zinc finger protein 85(HPF4, HTF1)), 유전자 등록번호(Genebank) BM466459(DGKI,Diacylglycerol kinase, iota), 유전자 등록번호(Genebank) BX537574(FREM1,FRAS1 related extracellular matrix 1), 유전자 등록번호(Genebank) BX537987(TRIM59,Tripartite motif-containing 59), 유전자 등록번호(Genebank) BX648469(ATF2,Activating transcription factor 2), 유전자 등록번호(Genebank) CR608275(CBLL1,Cas-Br-M(murine) ecotropic retroviral transforming sequence-like 1), 유전자 등록번호(Genebank) CR749233(ZNF626,Zinc finger protein 626), 유전자 등록번호(Genebank) CR749832(IMPDH1,IMP(inosine monophosphate) dehydrogenase 1), 유전자 등록번호(Genebank) CR936615(MATR3,Matrin 3), 유전자 등록번호(Genebank) NM_000946(PRIM1,Primase, polypeptide 1, 49kDa), 유전자 등록번호(Genebank) NM_001123(ADK,Adenosine kinase), 유전자 등록번호(Genebank) NM_002317(LOX,Lysyl oxidase), 유전자 등록번호(Genebank) NM_002655(PLAG1,Pleiomorphic adenoma gene 1), 유전자 등록번호(Genebank) NM_003423(ZNF43,Zinc finger protein 43(HTF6)), 유전자 등록번호(Genebank) NM_005180(PCGF4,Polycomb group ring finger 4), 유전자 등록번호(Genebank) NM_014615(KIAA0182,KIAA0182 protein), 유전자 등록번호(Genebank) NM_014919(WHSC1,Wolf-Hirschhorn syndrome candidate 1), 유전자 등록번호(Genebank) NM_015040(PIP5K3, Phosphatidylinositol-3-phosphate/ phosphatidylinositol 5-kinase, type III), 유전자 등록번호(Genebank) NM_015387(PREI3,Preimplantation protein 3), 유전자 등록번호(Genebank) NM_015905(TIF1,Tripartite motif-containing 24), 유전자 등록번호(Genebank) NM_016513(ICK,Intestinal cell(MAK-like) kinase), 유전자 등록번호(Genebank) NM_016626(RKHD2,Ring finger and KH domain containing 2), 유전자 등록번호(Genebank) NM_018660(ZNF395,Zinc finger protein 395), 유전자 등록번호(Genebank) NM_021129(PP,Pyrophosphatase(inorganic) 1), 유전자 등록번호(Genebank) NM_025074(FRAS1,Fraser syndrome 1), 유전자 등록번호(Genebank) NM_173694(ATP11C,ATPase, Class VI, type 11C), 유전자 등록번호(Genebank) NM_176869(PPA2,Pyrophosphatase(inorganic) 2), 유전자 등록번호(Genebank) NM_182851(CCNB1IP1,Cyclin B1 interacting protein 1), 유전자 등록번호(Genebank) NM_199040(NUDT4,Nudix(nucleoside diphosphate linked moiety X)-type motif 4 pseudogene 2), 유전자 등록번호(Genebank) AK122869(LOC148213,Zinc finger protein 681), 유전자 등록번호(Genebank) BC042500(MGC42493,Hypothetical protein MGC15634), 유전자 등록번호(Genebank) BC043147(ZNF539,Zinc finger protein 254), 유전자 등록번호(Genebank) BC044060(ZNF650,Zinc finger protein 650), 유전자 등록번호(Genebank) BC050340(ZNF230,Zinc finger protein 230), 유전자 등록번호(Genebank) CR749800(ZNFN1A5,Zinc finger protein, subfamily 1A, 5), 유전자 등록번호(Genebank) CR936695(ZNF468,Zinc finger protein ZNF468), 유전자 등록번호(Genebank) NM_001009881(ZCCHC11,Zinc finger, CCHC domain containing 11), 유전자 등록번호(Genebank) NM_003441(ZNF141,Zinc finger protein 141(clone pHZ-44)), 유전자 등록번호(Genebank) NM_006526(ZNF217,Zinc finger protein 217), 유전자 등록번호(Genebank) NM_007146(ZNF161,Zinc finger protein 161), 유전자 등록번호(Genebank) NM_015336(ZDHHC17,Zinc finger, DHHC-type containing 17), 유전자 등록번호(Genebank) NM_016220(ZNF588,Zinc finger protein 588), 유전자 등록번호(Genebank) NM_017742(ZCCHC2,Zinc finger, CCHC domain containing 2), 유전자 등록번호(Genebank) NM_021994(ZNF277,Zinc finger protein 277), 유전자 등록번호(Genebank) NM_024733(FLJ14345,Zinc finger protein 665), 유전자 등록번호(Genebank) NM_032367(ZBED3,Zinc finger, BED-type containing 3), 유전자 등록번호(Genebank) NM_033114(MADP-1,MADP-1 protein), 유전자 등록번호(Genebank) NM_133473(ZNF431,Zinc finger protein 431), 유전자 등록번호(Genebank) NM_152626(ZNF92,Zinc finger protein 92(HTF12)), 유전자 등록번호(Genebank) NM_178558(FLJ90430,Zinc finger protein 680), 유전자 등록번호(Genebank) NM_198893(ZNF160,Zinc finger protein 160), 유전자 등록번호(Genebank) XM_047550(ZNF492,Zinc finger protein 492), 유전자 등록번호(Genebank) XM_290865(LOC163233,Similar to Zinc finger protein 93(Zinc finger protein HTF34)), 유전자 등록번호(Genebank) XM_371174(ZNF283,Zinc finger protein 283), 유전자 등록번호(Genebank) AB023141(ZNF652,Zinc finger protein 652), 유전자 등록번호(Genebank) AB209245(HMGN1,High-mobility group nucleosome binding domain 1), 유전자 등록번호(Genebank) AB209389(GTF2IRD1,GTF2I repeat domain containing 1), 유전자 등록번호(Genebank) AB209562(HNRPK,Heterogeneous nuclear ribonucleoprotein K), 유전자 등록번호(Genebank) AB209753(RBM7,RNA binding motif protein 7), 유전자 등록번호(Genebank) AF136171(EAP; HBP15; HBP15/L22,ribosomal protein L22), 유전자 등록번호(Genebank) AK001230(POT1,POT1 protection of telomeres 1 homolog(S. pombe)), 유전자 등록번호(Genebank) AK022942(LOC58486,Transposon-derived Buster1 transposase-like protein gene), 유전자 등록번호(Genebank) AK025758(NFATC2,Nuclear factor of activated T-cells, cytoplasmic, calcineurin-dependent 2), 유전자 등록번호(Genebank) AK056803(H2AFZ,H2A histone family, member Z), 유전자 등록번호(Genebank) AK074119(ZZZ3,Zinc finger, ZZ-type containing 3), 유전자 등록번호(Genebank) AK091927(SFRS3,Splicing factor, arginine/serine-rich 3), 유전자 등록번호(Genebank) AK095937(GC20,Translation factor sui1 homolog), 유전자 등록번호(Genebank) AK124178(EIF3S6,Eukaryotic translation initiation factor 3, subunit 6 48kDa), 유전자 등록번호(Genebank) AL110212(H2AFV,H2A histone family, member V), 유전자 등록번호(Genebank) BC010266(HNRNPA1; MGC102835,Heterogeneous nuclear ribonucleoprotein A1), 유전자 등록번호(Genebank) BM464978(HMGN2,High-mobility group nucleosomal binding domain 2), 유전자 등록번호(Genebank) BM800367(RPL21,Ribosomal protein L21), 유전자 등록번호(Genebank) BU677381(RPL21,Ribosomal protein L21), 유전자 등록번호(Genebank) BX647205(HNRPH1,Heterogeneous nuclear ribonucleoprotein H1(H)), 유전자 등록번호(Genebank) BX647217(HNRPA3,Heterogeneous nuclear ribonucleoprotein A3), 유전자 등록번호(Genebank) CR625990(PC4,SUB1 homolog(S. cerevisiae)), 유전자 등록번호(Genebank) CR627133(LOC342892,Hypothetical protein LOC342892), 유전자 등록번호(Genebank) NM_000947(PRIM2A,Primase, polypeptide 2A, 58kDa), 유전자 등록번호(Genebank) NM_000983(RPL22,Ribosomal protein L22), 유전자 등록번호(Genebank) NM_001015886(HMGA2,High mobility group AT-hook 2), 유전자 등록번호(Genebank) NM_001017430(RBM3,RNA binding motif(RNP1, RRM) protein 3), 유전자 등록번호(Genebank) NM_001018067(PAI-RBP1,SERPINE1 mRNA binding protein 1), 유전자 등록번호(Genebank) NM_001412(EIF1AX,Eukaryotic translation initiation factor 1A, X-linked), 유전자 등록번호(Genebank) NM_001809(CENPA,Centromere protein A, 17kDa), 유전자 등록번호(Genebank) NM_002139(RBMX,RNA binding motif protein, X-linked), 유전자 등록번호(Genebank) NM_002568(PABPC1,Poly(A) binding protein, cytoplasmic 1), 유전자 등록번호(Genebank) NM_003972(BTAF1,BTAF1 RNA polymerase II, B-TFIID transcription factor-associated, 170kDa(Mot1 homolog, S. cerevisiae)), 유전자 등록번호(Genebank) NM_004454(ETV5,Ets variant gene 5(ets-related molecule)), 유전자 등록번호(Genebank) NM_005463(HNRPDL,Heterogeneous nuclear ribonucleoprotein D-like), 유전자 등록번호(Genebank) NM_006047(CPNE1,RNA binding motif protein 12), 유전자 등록번호(Genebank) NM_006345(SLC30A9,Solute carrier family 30(zinc transporter), member 9), 유전자 등록번호(Genebank) NM_006451(PAIP1,Poly(A) binding protein interacting protein 1), 유전자 등록번호(Genebank) NM_006546(IMP-1,IGF-II mRNA-binding protein 1), 유전자 등록번호(Genebank) NM_006716(ASK,DBF4 homolog(S. cerevisiae)), 유전자 등록번호(Genebank) NM_006775(QKI,Quaking homolog, KH domain RNA binding(mouse)), 유전자 등록번호(Genebank) NM_007080(LSM6,LSM6 homolog, U6 small nuclear RNA associated(S. cerevisiae)), 유전자 등록번호(Genebank) NM_007208(MRPL3,Mitochondrial ribosomal protein L3), 유전자 등록번호(Genebank) NM_012207(HNRPH3,Heterogeneous nuclear ribonucleoprotein H3(2H9)), 유전자 등록번호(Genebank) NM_014321(ORC6L,Origin recognition complex, subunit 6 homolog-like(yeast)), 유전자 등록번호(Genebank) NM_014393(STAU2,Staufen, RNA binding protein, homolog 2(Drosophila)), 유전자 등록번호(Genebank) NM_014892(RBM16,RNA binding motif protein 16), 유전자 등록번호(Genebank) NM_015361(R3HDM,R3H domain containing 1), 유전자 등록번호(Genebank) NM_015975(TAF9L,TAF9-like RNA polymerase II, TATA box binding protein(TBP)-associated factor, 31kDa), 유전자 등록번호(Genebank) NM_016200(LSM8,LSM8 homolog, U6 small nuclear RNA associated(S. cerevisiae)), 유전자 등록번호(Genebank) NM_017437(CPSF2,Cleavage and polyadenylation specific factor 2, 100kDa), 유전자 등록번호(Genebank) NM_018048(FLJ10292,Mago-nashi homolog), 유전자 등록번호(Genebank) NM_018237(CCAR1,Cell division cycle and apoptosis regulator 1), 유전자 등록번호(Genebank) NM_031157(HNRPA1,Heterogeneous nuclear ribonucleoprotein A1), 유전자 등록번호(Genebank) NM_032390(MKI67IP,MKI67(FHA domain) interacting nucleolar phosphoprotein), 유전자 등록번호(Genebank) NM_033222(PSIP1,PC4 and SFRS1 interacting protein 1), 유전자 등록번호(Genebank) NM_054016(FUSIP1,FUS interacting protein(serine/arginine-rich) 1), 유전자 등록번호(Genebank) NM_145018(FLJ25416,Hypothetical protein FLJ25416), 유전자 등록번호(Genebank) NM_153333(TCEAL8,Transcription elongation factor A(SII)-like 8), 유전자 등록번호(Genebank) NM_203463(LASS6,LAG1 longevity assurance homolog 6(S. cerevisiae)), 유전자 등록번호(Genebank) NM_206866(BACH1,BTB and CNC homology 1, basic leucine zipper transcription factor 1), 유전자 등록번호(Genebank) U38847(TARBP1,TAR(HIV) RNA binding protein 1), 유전자 등록번호(Genebank) XM_371470(LOC388907,Similar to ribosomal protein L5; 60S ribosomal protein L5), 유전자 등록번호(Genebank) XM_372050(LOC389674,Heterogeneous nuclear ribonucleoprotein A1 pseudogene 4), 유전자 등록번호(Genebank) XM_372396(LOC390158,Olfactory receptor, family 8, subfamily K, member 1), 유전자 등록번호(Genebank) XM_496355(LOC440577,Similar to nucleophosmin 1; nucleolar phosphoprotein B23; numatrin; nucleophosmin/nucleoplasmin family, member 1), 유전자 등록번호(Genebank) XM_498328(LOC392345,Similar to PRED65), 유전자 등록번호(Genebank) XM_499298(FLJ46189,similar to Zinc finger protein 479(Zinc finger protein Kr19)(HKr19)), 유전자 등록번호(Genebank) XM_499343(PEG10,Paternally expressed 10), 유전자 등록번호(Genebank) AB013380(ABCB10,ATP-binding cassette, sub-family B(MDR/TAP), member 10), 유전자 등록번호(Genebank) AB018342(MYO10,Myosin X), 유전자 등록번호(Genebank) AK025258(UMP-CMPK,Cytidylate kinase), 유전자 등록번호(Genebank) AK098205(AK3L1,Adenylate kinase 3), 유전자 등록번호(Genebank) AK122685(GLUD1,Glutamate dehydrogenase 1), 유전자 등록번호(Genebank) AK122695(RRM1,Ribonucleotide reductase M1 polypeptide), 유전자 등록번호(Genebank) AK126343(STK39,Serine threonine kinase 39(STE20/SPS1 homolog, yeast)), 유전자 등록번호(Genebank) BC051861(SPATA5L1,Spermatogenesis associated 5-like 1), 유전자 등록번호(Genebank) BC064610(SEPHS1,Selenophosphate synthetase 1), 유전자 등록번호(Genebank) BX640965(SLC22A3,Solute carrier family 22(extraneuronal monoamine transporter), member 3), 유전자 등록번호(Genebank) D86550(DYRK1A,Dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 1A), 유전자 등록번호(Genebank) NM_006343(MERTK,C-mer proto-oncogene tyrosine kinase), 유전자 등록번호(Genebank) NM_012073(CCT5,Chaperonin containing TCP1, subunit 5(epsilon)), 유전자 등록번호(Genebank) NM_020326(ABCD4,ATP-binding cassette, sub-family D(ALD), member 4), 유전자 등록번호(Genebank) NM_030752(TCP1,T-complex 1), 유전자 등록번호(Genebank) NM_030919(C20orf129,Chromosome 20 open reading frame 129), 유전자 등록번호(Genebank) NM_182964(NAV2,Neuron navigator 2), 유전자 등록번호(Genebank) AF020038(IDH1,Isocitrate dehydrogenase 1(NADP+), soluble), 유전자 등록번호(Genebank) AK093311(ACAA2,Acetyl-Coenzyme A acyltransferase 2(mitochondrial 3-oxoacyl-Coenzyme A thiolase)), 유전자 등록번호(Genebank) BC008366(DDC,Dopa decarboxylase(aromatic L-amino acid decarboxylase)), 유전자 등록번호(Genebank) BC012616(BHMT,Betaine-homocysteine methyltransferase), 유전자 등록번호(Genebank) BC015062(MTHFD2,Methylenetetrahydrofolate dehydrogenase(NADP+ dependent) 2, methenyltetrahydrofolate cyclohydrolase), 유전자 등록번호(Genebank) BC033320(TAF9,TAF9 RNA polymerase II, TATA box binding protein(TBP)-associated factor, 32kDa), 유전자 등록번호(Genebank) BC033517(ACOX2,Acyl-Coenzyme A oxidase 2, branched chain), 유전자 등록번호(Genebank) BC034481(BCKDHB,Branched chain keto acid dehydrogenase E1, beta polypeptide(maple syrup urine disease)), 유전자 등록번호(Genebank) BC035654(NR1H4,Nuclear receptor subfamily 1, group H, member 4), 유전자 등록번호(Genebank) BC042453(MCCC1,Methylcrotonoyl-Coenzyme A carboxylase 1(alpha)), 유전자 등록번호(Genebank) BC045541(LOC200895,Dihydrofolate reductase-like 1), 유전자 등록번호(Genebank) CR609484(KYNU,Kynureninase(L- kynurenine hydrolase)), 유전자 등록번호(Genebank) CR749593(GLS,Glutaminase), 유전자 등록번호(Genebank) NM_000016(ACADM,Acyl-Coenzyme A dehydrogenase, C-4 to C-12 straight chain), 유전자 등록번호(Genebank) NM_000277(PAH,Phenylalanine hydroxylase), 유전자 등록번호(Genebank) NM_001801(CDO1,Cysteine dioxygenase, type I), 유전자 등록번호(Genebank) NM_002860(ALDH18A1,Aldehyde dehydrogenase 18 family, member A1), 유전자 등록번호(Genebank) NM_004169(SHMT1,Serine hydroxymethyltransferase 1(soluble)), 유전자 등록번호(Genebank) NM_004457(ACSL3,Acyl-CoA synthetase long-chain family member 3), 유전자 등록번호(Genebank) NM_005589(ALDH6A1,Aldehyde dehydrogenase 6 family, member A1), 유전자 등록번호(Genebank) NM_013261(PPARGC1A,Peroxisome proliferative activated receptor, gamma, coactivator 1, alpha), 유전자 등록번호(Genebank) NM_018122(FLJ10514,Aspartyl-tRNA synthetase 2(mitochondrial)), 유전자 등록번호(Genebank) NM_080820(HARS2,Histidyl-tRNA synthetase 2), 유전자 등록번호(Genebank) U73338(MTR,5-methyltetrahydrofolate-homocysteine methyltransferase), 유전자 등록번호(Genebank) AK001676(NUP133,Nucleoporin 133kDa), 유전자 등록번호(Genebank) AK002165(DKFZP564O123,Chromatin modifying protein 2B), 유전자 등록번호(Genebank) AK023143(C10orf119,Chromosome 10 open reading frame 119), 유전자 등록번호(Genebank) AK094603(Homo sapiens cDNA FLJ37284 fis, clone BRAMY2013590. [AK094603],unnamed protein product; Homo sapiens cDNA FLJ37284 fis, clone BRAMY2013590.), 유전자 등록번호(Genebank) AK124768(TNPO1,Transportin 1), 유전자 등록번호(Genebank) BC000100(SNX5,Sorting nexin 5), 유전자 등록번호(Genebank) BC039468(NUP50,Nucleoporin 50kDa), 유전자 등록번호(Genebank) BC064351(SRP9,Signal recognition particle 9kDa), 유전자 등록번호(Genebank) BX091259(UNQ9438,TIMM9), 유전자 등록번호(Genebank) BX641063(DEK,DEK oncogene(DNA binding)), 유전자 등록번호(Genebank) BX648363(SNX10,Sorting nexin 10), 유전자 등록번호(Genebank) CR618609(NOP5/NOP58,Nucleolar protein NOP5/NOP58), 유전자 등록번호(Genebank) NM_002156(HSPD1,Heat shock 60kDa protein 1(chaperonin)), 유전자 등록번호(Genebank) NM_006380(APPBP2,Amyloid beta precursor protein(cytoplasmic tail) binding protein 2), 유전자 등록번호(Genebank) NM_007214(SEC63,SEC63-like(S. cerevisiae)), 유전자 등록번호(Genebank) NM_012460(TIMM9,Translocase of inner mitochondrial membrane 9 homolog(yeast)), 유전자 등록번호(Genebank) NM_014765(TOMM20,Translocase of outer mitochondrial membrane 20 homolog(yeast)), 유전자 등록번호(Genebank) NM_020401(NUP107,Nucleoporin 107kDa), 유전자 등록번호(Genebank) NM_021807(SEC8L1,Exocyst complex component 4), 유전자 등록번호(Genebank) NM_031296(RAB33B,RAB33B, member RAS oncogene family), 유전자 등록번호(Genebank) NM_145261(TIM14,DnaJ(Hsp40) homolog, subfamily C, member 19), 유전자 등록번호(Genebank) NM_173827(FLJ38991,Mitochondrial COX18), 유전자 등록 번호(Genebank) AL162068(NAP1L1,Nucleosome assembly protein 1-like 1), 유전자 등록번호(Genebank) AL834186(CDCA7,Cell division cycle associated 7), 유전자 등록번호(Genebank) BC065520(TCFL5,Transcription factor-like 5(basic helix-loop-helix)), 유전자 등록번호(Genebank) CR620626(FGG,Fibrinogen gamma chain), 유전자 등록번호(Genebank) M58569(Homo sapiens fibrinogen, A alpha polypeptide(FGA), transcript variant alpha-E, mRNA [NM_000508]), 유전자 등록번호(Genebank) NM_002291(LAMB1,Laminin, beta 1), 유전자 등록번호(Genebank) NM_005141(FGB,Fibrinogen beta chain), 유전자 등록번호(Genebank) NM_005746(PBEF1,Pre-B-cell colony enhancing factor 1), 유전자 등록번호(Genebank) AK002156(WDR33,WD repeat domain 33), 유전자 등록번호(Genebank) AK074377(UHRF1,Chromosome 19 open reading frame 31), 유전자 등록번호(Genebank) AK122825(HMGB1,High-mobility group box 1), 유전자 등록번호(Genebank) BC032617(POLI,Polymerase(DNA directed) iota), 유전자 등록번호(Genebank) CR600021(HMGB2,High-mobility group box 2), 유전자 등록번호(Genebank) NM_001067(TOP2A,Topoisomerase(DNA) II alpha 170kDa), 유전자 등록번호(Genebank) NM_002916(RFC4,Replication factor C(activator 1) 4, 37kDa), 유전자 등록번호(Genebank) NM_003368(USP1,Ubiquitin specific peptidase 1), 유전자 등록번호(Genebank) NM_006904(PRKDC,Protein kinase, DNA-activated, catalytic polypeptide), 유전자 등록번호(Genebank) NM_138271(ATRX,Alpha thalassemia/mental retardation syndrome X-linked(RAD54 homolog, S. cerevisiae)), 유전자 등록번호(Genebank) AF285167(ABCA1,ATP-binding cassette, sub-family A(ABC1), member 1), 유전자 등록번호(Genebank) AK124635(PCSK9,Proprotein convertase subtilisin/kexin type 9), 유전자 등록번호(Genebank) NM_000236(LIPC,Lipase, hepatic), 유전자 등록번호(Genebank) AF062341(CTNND1,Catenin(cadherin-associated protein), delta 1), 유전자 등록번호(Genebank) AF480883(PPAP2B,Phosphatidic acid phosphatase type 2B), 유전자 등록번호(Genebank) BC035638(LSS,Lanosterol synthase(2,3-oxidosqualene-lanosterol cyclase)), 유전자 등록번호(Genebank) BX648473(PIGK,Phosphatidylinositol glycan, class K), 유전자 등록번호(Genebank) NM_001444(FABP5,Fatty acid binding protein 5(psoriasis-associated)), 유전자 등록번호(Genebank) NM_003129(SQLE,Squalene epoxidase), 유전자 등록번호(Genebank) NM_003580(NSMAF,Neutral sphingomyelinase(N-SMase) activation associated factor), 유전자 등록번호(Genebank) NM_018361(AGPAT5,1-acylglycerol-3-phosphate O-acyltransferase 5(lysophosphatidic acid acyltransferase, epsilon)), 유전자 등록번호(Genebank) NM_020918(GPAM,Glycerol-3-phosphate acyltransferase, mitochondrial), 유전자 등록번호(Genebank) AB209031(C5,Complement component 5), 유전자 등록번호(Genebank) AF130100(SERPINC1,Serpin peptidase inhibitor, clade C(antithrombin), member 1), 유전자 등록번호(Genebank) AK122686(IF,I factor(complement)), 유전자 등록번호(Genebank) BC022312(C4BPA,Complement component 4 binding protein, alpha), 유전자 등록번호(Genebank) M75106(CPB2,Carboxypeptidase B2(plasma, carboxypeptidase U)), 유전자 등록번호(Genebank) NM_000893(KNG1,Kininogen 1), 유전자 등록번호(Genebank) AK055619(GNAQ,Guanine nucleotide binding protein(G protein), q polypeptide), 유전자 등록번호(Genebank) AL832747(GNAQ,Guanine nucleotide binding protein(G protein), q polypeptide), 유전자 등록번호(Genebank) CR596712(IL17D,Interleukin 17D), 유전자 등록번호(Genebank) AK000972(C9orf40,Chromosome 9 open reading frame 40), 유전자 등록번호(Genebank) AK023675(UTRN,Utrophin(homologous to dystrophin)), 유전자 등록번호(Genebank) AK026095(SNTB1,Syntrophin, beta 1(dystrophin-associated protein A1, 59kDa, basic component 1)), 유전자 등록번호(Genebank) AL117472(SORBS1,Sorbin and SH3 domain containing 1), 유전자 등록번호(Genebank) NM_018728(MYO5C,Myosin VC), 유전자 등록번호(Genebank) XM_371116(MYO5B,Myosin VB), 유전자 등록번호(Genebank) BC026320(OGDHL,Oxoglutarate dehydrogenase-like), 유전자 등록번호(Genebank) BC033391(PP1665,Glycerophosphodiester phosphodiesterase domain containing 5), 유전자 등록번호(Genebank) BC042421(GK,Glycerol kinase), 유전자 등록번호(Genebank) M15943(ADH4,Alcohol dehydrogenase 4(class II), pi polypeptide), 유전자 등록번호(Genebank) NM_000671(ADH5,Alcohol dehydrogenase 5(class III), chi polypeptide), 유전자 등록번호(Genebank) NM_002610(PDK1,Pyruvate dehydrogenase kinase, isozyme 1), 유전자 등록번호(Genebank) AK026927(MGC5297,Hypothetical protein MGC5297), 유전자 등록번호(Genebank) AK127326(PHF17,PHD finger protein 17), 유전자 등록번호(Genebank) BC039110(SMNDC1,Survival motor neuron domain containing 1), 유전자 등록번호(Genebank) BC041849(ROCK1,Rho-associated, coiled-coil containing protein kinase 1), 유전자 등록번호(Genebank) BX537500(PDCD4,Programmed cell death 4(neoplastic transformation inhibitor)), 유전자 등록번호(Genebank) CR596268(ITGB3BP,Integrin beta 3 binding protein(beta3-endonexin)), 유전자 등록번호(Genebank) NM_004938(DAPK1,Death-associated protein kinase 1), 유전자 등록번호(Genebank) NM_012238(SIRT1,Sirtuin(silent mating type information regulation 2 homolog) 1(S. cerevisiae)), 유전자 등록번호(Genebank) NM_130837(OPA1,Optic atrophy 1(autosomal dominant)), 유전자 등록번호(Genebank) NM_148957(TNFRSF19,Tumor necrosis factor receptor superfamily, member 19), 유전자 등록번호(Genebank) AB208919(FGFR1,Fibroblast growth factor receptor 1(fms-related tyrosine kinase 2, Pfeiffer syndrome)), 유전자 등록번호(Genebank) AB209601(TIZ,Zinc finger protein 675), 유전자 등록번호(Genebank) AK125150(MAPK8,Mitogen-activated protein kinase 8), 유전자 등록번호(Genebank) BC027881(AFP,Alpha-fetoprotein), 유전자 등록번호(Genebank) NM_020995(HPR,Haptoglobin-related protein), 유전자 등록번호(Genebank) AF167706(CRIM1,Cysteine rich transmembrane BMP regulator 1(chordin-like)), 유 전자 등록번호(Genebank) BC045655(MAC30,Hypothetical protein MAC30), 유전자 등록번호(Genebank) BX537509(NET1,Neuroepithelial cell transforming gene 1), 유전자 등록번호(Genebank) BX640958(YEATS4,YEATS domain containing 4), 유전자 등록번호(Genebank) BX647757(Homo sapiens sex comb on midleg-like 1(Drosophila)(SCML1), mRNA [NM_006746],sex comb on midleg-like 1(Drosophila)), 유전자 등록번호(Genebank) NM_006548(IMP-2,IGF-II mRNA-binding protein 2), 유전자 등록번호(Genebank) AY376439(ECT2,Epithelial cell transforming sequence 2 oncogene), 유전자 등록번호(Genebank) AY596970(GARNL1,GTPase activating Rap/RanGAP domain-like 1), 유전자 등록번호(Genebank) BC050630(RAB3-GAP150,RAB3 GTPase activating protein subunit 2(non-catalytic)), 유전자 등록번호(Genebank) NM_001001132(ITSN1,Intersectin 1(SH3 domain protein)), 유전자 등록번호(Genebank) NM_016340(KIAA1961,KIAA1961 gene), 유전자 등록번호(Genebank) NM_145290(GPR125,G protein-coupled receptor 125), 유전자 등록번호(Genebank) NM_003574(VAPA,VAMP(vesicle-associated membrane protein)-associated protein A, 33kDa), 유전자 등록번호(Genebank) M28016(cytochrome b,Human mitochondrial cytochrome b gene, partial cds.), 유전자 등록번호(Genebank) NM_013277(RACGAP1,Rac GTPase activating protein 1), 유전자 등록번호(Genebank) AB096248(SNF1LK2,SNF1-like kinase 2), 유전자 등록번호(Genebank) NM_001698(AUH,AU RNA binding protein/enoyl-Coenzyme A hydratase), 유전자 등록번호(Genebank) AB091343(C10orf3,Centrosomal protein 55kDa).Genebank No. AB033337 (MPHOSPH1, M-phase phosphoprotein 1), Genebank No. AB208875 (Septin 10, Septin 10), Genebank No. AF053305 (BUB1, BUB1 budding uninhibited by benzimidazoles 1 homolog ( yeast)), Genebank AF053306 (BUB1B, BUB1 budding uninhibited by benzimidazoles 1 homolog beta (yeast), Genebank AF345347 (SPAG5, Sperm associated antigen 5), Genebank AK222819 (NUSAP1, Nucleolar and spindle associated protein 1), Genebank AY367065 (ASPM, Abnormal spindle) -like, microcephaly associated (Drosophila), Genebank BC004352 (KIF22, Kinesin family member 22) ), Genebank BC010607 (IGF1R, Insulin-like growth factor 1 receptor), Genebank BC011000 (CDCA5, Cell division cycle associated 5), Genebank BC013326 (GAS2, Groth arrest-specific 2), gene registration number (Geneba) nk) BC032677 (UBE2C, Ubiquitin-conjugating enzyme E2C), Gene Registration Number (Genebank) BC040991 (TFDP2, Transcription factor Dp-2 (E2F dimerization partner 2)), Gene Registration Number (Genebank) BC050384 (SUPT3H, Suppressor of Ty 3 homolog (S. cerevisiae)), Gene Banking Number BC068483 (RINT-1, Rad50-interacting protein 1), Gene Banking Number (Genebank) BQ278454 (CKS1B, CDC28 protein kinase regulatory subunit 1B), Gene Banking Number (Genebank) BX647885 (STMN1 , Stathmin 1 / oncoprotein 18), Genebank CR604810 (CCNA2, Cyclin A2), Genebank CR933728 (CDC2, Cell division cycle 2, G1 to S and G2 to M), Gene registry number ( Genebank) D42045 (DCLRE1A, DNA cross-link repair 1A (PSO2 homolog, S. cerevisiae)), gene accession number (Genebank) NM_00089 (HK2, Hexokinase 2), gene accession number (Genebank) NM_001005414 (ZWINT, ZW10 interactor antisense) , Gene Registration Number (Genebank) NM_001018159 (APPBP1, Amyloid beta precursor protein binding protein 1), Gene Registration Number (Genebank) NM_001239 (CCNH, Cyclin H), Gene Registration Number (Genebank) NM_001790 (CDC25C, Cell division cycle 25C), Genebank NM_001827 (CKS2, CDC28 protein kinase regulatory subunit 2), gene Genebank NM_002431 (MNAT1, Menage a trois 1 (CAK assembly factor)), Genebank NM_002467 (MYC, V-myc myelocytomatosis viral oncogene homolog (avian)), Genebank NM_002709 (Genebank) PPP1CB, Protein phosphatase 1, catalytic subunit, beta isoform), Gene Registration Number (Genebank) NM_002737 (PRKCA, Protein kinase C, alpha), Gene Registration Number (Genebank) NM_002894 (RBBP8, Retinoblastoma binding protein 8), Gene Registration Number ( Genebank) NM_003318 (TTK, TTK protein kinase), Genebank NM_003478 (CUL5, Cullin 5), Genebank NM_003981 (PRC1, Protein regulator of cytokinesis 1), Genebank NM_004064 ( CDKN1B, Cyclin-dependent kinase inhibitor 1B (p27, Kip1)), Gene Registration Number (Genebank) NM_004354 (CCNG2, Cyclin G2), Gene Registration Number (Genebank) NM_004365 (CETN3, Centrin, EF-hand protein, 3 (CDC31 homolog) , yeast)), Genebank NM_004523 (KIF11, Kinesin family member 11), Genebank NM_004701 (CCNB2, Cyclin B2), Genebank NM_005504 (BCAT1, Branched chain aminotransferase 1, cytosolic), Genebank NM_005915 (MCM6, MCM6 minichromosome maintenance deficient 6 (MIS5 homolog) , S. pombe (S. cerevisiae)), Genebank NM_006101 (KNTC2, Kinetochore associated 2), Genebank NM_006265 (RAD21, RAD21 homolog (S. pombe)), Genebank NM_014750 (DLG7, Discs, large homolog 7 (Drosophila)), gene registration number (Genebank) NM_014751 (MTSS1, Metastasis suppressor 1), gene registration number (Genebank) NM_016343 (CENPF, Centromere protein F, 350 / 400ka (mitosin)), gene registration number ( Genebank) NM_018492 (PBK, PDZ binding kinase), Genebank (Genebank) NM_018685 (ANLN, Anillin, actin binding protein (scraps homolog, Drosophila)), Genebank (Menebank) NM_019001 (XRN1,5'-3 'exoribonuclease 1), Gene Registration Number (Genebank) NM_019063 (EML4, Echinoderm microtubule associated protein like 4), Gene Registration Number (Genebank) NM_020242 (KNSL7, Kinesin family member 15), Gene Registration Number (Genebank) U65410 (MAD2L1, MAD2 mitotic arrest deficient-like 1 (yeast), Genebank AB096175 (SP5, Sp5 transcription) factor), Genebank AB209086 (ZNF493, Zinc finger protein 493), Genebank AB209334 (SP3, Spp transcription factor), Genebank AB209892 (ZFX, Zinc finger protein, X- linked), Genebank AF279145 (ANTXR1, Anthrax toxin receptor 1), Genebank AK095600 (FLJ38281, Zinc finger protein 564), Genebank AK123010 (RRM2, Ribonucleotide reductase M2 polypeptide) , Genebank AK126180 (DTYMK, Deoxythymidylate kinase (thymidylate kinase)), Genebank A (Genebank) AK130071 (HSPC063, BTB (POZ) domain containing 15), Genebank AK131420 (ZNF66, Zinc finger protein 66), Genebank AK131472 (Homo sapiens cDNA FLJ16640 fis, clone TESTI4028938, moderately similar to Zinc finger protein 85. [AK131472], CDNA FLJ16640 fis, clone TESTI4028938, moderately similar to Zinc finger protein 85), gene Registration Number (Genebank) AK 131527 (ZNF15L1, Zinc finger protein 708 (KOX8)), Gene Registration Number (Genebank) AK160373 (DKFZp547K1113, Zinc Finger Protein 710), Gene Registration Number (Genebank) AL832422 (ZNF430, Zinc finger protein 430), Gene Registration Number (Genebank) ) AY269786 (ZNF429, Zinc finger protein 429), Genebank BC035579 (ZNF100, Zinc finger protein 100), Genebank BC036394 (ZNF85, Zinc finger protein 85 (HPF4, HTF1)), Gene Registration Genebank BM466459 (DGKI, Diacylglycerol kinase, iota), Gene Registration Number (Genebank) BX537574 (FREM1, FRAS1 related extracellular matrix 1), Genebank BX537987 (TRIM59, Tripartite motif-containing 59), Gene Registration Genebank BX648469 (ATF2, activating transcription factor 2), Genebank (Genebank) CR608275 (CBLL1, Cas-Br-M (murine) ecotropic retroviral transforming sequence-like 1), Genebank (Genebank) CR749233 (ZNF626 , Zinc finger protein 626), Genebank CR7498 32 (IMPDH1, IMP (inosine monophosphate) dehydrogenase 1), Gene Registration Number (Genebank) CR936615 (MATR3, Matrin 3), Gene Registration Number (Genebank) NM_000946 (PRIM1, Primase, polypeptide 1, 49kDa), Gene Registration Number (Genebank ) NM_001123 (ADK, Adenosine kinase), Genebank (Genebank) NM_002317 (LOX, Lysyl oxidase), Genebank (Genebank) NM_002655 (PLAG1, Pleiomorphic adenoma gene 1), Genebank (Genebank) NM_003423 (ZNF43, Zinc finger protein 43 (HTF6)), Genebank NM_005180 (PCGF4, Polycomb group ring finger 4), Genebank NM_014615 (KIAA0182, KIAA0182 protein), Genebank NM_014919 (WHSC1, Wolf Hirschhorn syndrome candidate 1), gene registration number (Genebank) NM_015040 (PIP5K3, Phosphatidylinositol-3-phosphate / phosphatidylinositol 5-kinase, type III), gene registration number (Genebank) NM_015387 (PREI3, Preimplantation protein 3), gene registration number (Genebank) NM_015905 (TIF1, Tripartite motif-containi ng 24), Genebank NM_016513 (ICK, Intestinal cell (MAK-like) kinase), Genebank (Genebank) NM_016626 (RKHD2, Ring finger and KH domain containing 2), Genebank NM_018660 (ZNF395, Zinc finger protein 395), Genebank NM_021129 (PP, Pyrophosphatase (inorganic) 1), Genebank NM_025074 (FRAS1, Fraser syndrome 1), Genebank NM_173694 (ATP11C , ATPase, Class VI, type 11C), Gene Registration Number (Genebank) NM_176869 (PPA2, Pyrophosphatase (inorganic) 2), Gene Registration Number (Genebank) NM_182851 (CCNB1IP1, Cyclin B1 interacting protein 1), Gene Registration Number (Genebank) NM_199040 (NUDT4, Nudix (nucleoside diphosphate linked moiety X) -type motif 4 pseudogene 2), gene accession number (Genebank) AK122869 (LOC148213, Zinc finger protein 681), gene accession number (Genebank) BC042500 (MGC42493, Hypothetical protein MGC15634) , Genebank BC043147 (ZNF539, Zinc finger protein 2 54), Genebank BC044060 (ZNF650, Zinc finger protein 650), Genebank BC050340 (ZNF230, Zinc finger protein 230), Genebank (Genebank) CR749800 (ZNFN1A5, Zinc finger protein, subfamily 1A, 5), Genebank CR936695 (ZNF468, Zinc finger protein ZNF468), Genebank NM_001009881 (ZCCHC11, Zinc finger, CCHC domain containing 11), Genebank NM_003441 (ZNF141, Zinc finger protein 141 (clone pHZ-44)), Genebank NM_006526 (ZNF217, Zinc finger protein 217), Genebank NM_007146 (ZNF161, Zinc finger protein 161), Genebank (Genebank) NM_015336 (ZDHHC17, Zinc finger, DHHC-type containing 17), gene registration number (Genebank) NM_016220 (ZNF588, Zinc finger protein 588), gene registration number (Genebank) NM_017742 (ZCCHC2, Zinc finger, CCHC domain containing 2), gene Genebank NM_021994 (ZNF277, Zinc finger protein 277), heredity Genebank NM_024733 (FLJ14345, Zinc finger protein 665), Genebank NM_032367 (ZBED3, Zinc finger, BED-type containing 3), Genebank NM_033114 (MADP-1, MADP-1 protein, Genebank NM_133473 (ZNF431, Zinc finger protein 431), Genebank NM_152626 (ZNF92, Zinc finger protein 92 (HTF12)), Genebank NM_178558 (FLJ90430, Zinc finger protein 680), Genebank NM_198893 (ZNF160, Zinc finger protein 160), Genebank XM_047550 (ZNF492, Zinc finger protein 492), Genebank XM_290865 (LOC163233, Similar to Zinc finger protein 93 (Zinc finger protein HTF34), Genebank XM_371174 (ZNF283, Zinc finger protein 283), Genebank AB023141 (ZNF652, Zinc finger protein 652), Genebank AB209245 (Genebank) HMGN1, high-mobility group nucleosome binding domain 1), gene registration number (G enebank) AB209389 (GTF2IRD1, GTF2I repeat domain containing 1), Gene Registration Number (Genebank) AB209562 (HNRPK, Heterogeneous nuclear ribonucleoprotein K), Gene Registration Number (Genebank) AB209753 (RBM7, RNA binding motif protein 7), Gene Registration Number ( Genebank) AF136171 (EAP; HBP15; HBP15 / L22, ribosomal protein L22), Genebank AK001230 (POT1, POT1 protection of telomeres 1 homolog (S. pombe)), Gene Accession Number (Genebank) AK022942 (LOC58486, Transposon-derived Buster1 transposase-like protein gene), genebank AK025758 (NFATC2, Nuclear factor of activated T-cells, cytoplasmic, calcineurin-dependent 2), genebank AK056803 (H2AFZ, H2A histone family, member Z), gene registry number (Genebank) AK074119 (ZZZ3, Zinc finger, ZZ-type containing 3), Gene Registration Number (Genebank) AK091927 (SFRS3, Splicing factor, arginine / serine-rich 3), Gene Registration Number (Genebank) AK095937 (GC20, Translation factor sui1 homolog), Genebank AK124178 (EIF3S6, Eukaryotic translation initiation factor 3, subunit 6 48kDa), Genebank AL110212 (H2AFV, H2A histone family, member V), Genebank BC010266 (HNRNPA1; MGC102835, Heterogeneous nuclear ribonucleoprotein A1), Genebank BM464978 (HMGN2, high-mobility group nucleosomal binding domain 2), Genebank BM800367 (RPL21, Ribosomal protein L21), Genebank BU677381 (RPL21, Ribosomal protein L21), Genebank (Genebank) BX647205 (HNRPH1, Heterogeneous nuclear ribonucleoprotein H1 (H)), Gene Registry Number (Genebank) BX647217 (HNRPA3, Heterogeneous nuclear ribonucleoprotein A3), Gene accession number (Genebank) CR625990 (PC4, SUB1 homolog (S. cerevisiae)), Gene Registration Number (Genebank) CR627133 (LOC342892, Hypothetical protein LOC342892), Gene Registration Number (Genebank) NM_000947 (PRIM2A, Primase, polypeptide 2A, 58 kDa), Gene Registration Number (Genebank) NM_000983 (RPL22, Ribosomal protein L22) ), Gene registration number (Genebank) NM_001015886 (HMGA2, High mobility group AT-hook 2), gene registration number (Genebank) NM_001017430 (RBM3, RNA binding motif (RNP1, RRM) protein 3), gene registration number (Genebank) NM_001018067 (PAI-RBP1, SERPINE1 mRNA binding protein 1), Genebank NM_001412 (EIF1AX, Eukaryotic translation initiation factor 1A, X-linked), Genebank NM_001809 (CENPA, Centromere protein A, 17kDa), Genebank (Genebank) NM_002139 (RBMX, RNA binding motif protein, X-linked), Genebank (Genebank) NM_002568 (PABPC1, Poly (A) binding protein, cytoplasmic 1), Genebank (Menebank) NM_003972 (BTAF1 , BTAF1 RNA polymerase II, B-TFIID transcription factor-associated, 170 kDa (Mot1 homolog, S. cerevisiae)), Genebank NM_004454 (ETV5, Ets variant gene 5 (ets-related molecule)), Genebank NM_005463 (HNRPDL, Heterogeneous nuclear ribonucleoprotein D-like) , Gene Registration Number (Genebank) NM_006047 (CPNE1, RNA binding motif protein 12), Gene Registration Number (Genebank) NM_006345 (SLC30A9, Solute carrier family 30 (zinc transporter), member 9), Gene Registration Number (Genebank) NM_006451 (PAIP1 , Poly (A) binding protein interacting protein 1), Genebank NM_006546 (IMP-1, IGF-II mRNA-binding protein 1), Genebank NM_006716 (ASK, DBF4 homolog (S. cerevisiae)), Genebank NM_006775 (QKI, Quaking homolog, KH domain RNA binding (mouse)), Genebank NM_007080 (LSM6, LSM6 homolog, U6 small nuclear RNA associated (S. cerevisiae)) , Gene Registration Number (Genebank) NM_007208 (MRPL3, Mitochondrial ribosomal protein L3), Gene Registration Number (Genebank) NM_012207 (HNRPH3, Heterogeneous nuclear ribonucleoprotein H3 (2H9)), Gene Registration Number (Genebank) NM_014321 (ORC6L, Origin recognition complex, subunit 6 homolog-like (yeast)), gene registration number (Genebank) NM_014393 (STAU2, Staufen, RNA binding protein, homolog 2 (Drosophila)), gene registration number (Genebank) NM_014892 (RBM16, RNA binding motif protein 16), Genebank NM_015361 (R3HDM, R3H domain containing 1), Genebank NM_015975 (TAF9L, TAF9-like RNA polymerase II, TATA box binding protein (TBP) -associated factor, 31kDa), Gene Registry Number (Genebank) NM_016200 (LSM8, LSM8 homolog, U6 small nuclear RNA associate d (S. cerevisiae)), Genebank NM_017437 (CPSF2, Cleavage and polyadenylation specific factor 2, 100kDa), Genebank NM_018048 (FLJ10292, Mago-nashi homolog), Gene accession number (Genebank) NM_018237 (CCAR1, Cell division cycle and apoptosis regulator 1), gene registration number (Genebank) NM_031157 (HNRPA1, heterogeneous nuclear ribonucleoprotein A1), gene registration number (Genebank) NM_032390 (MKI67IP, MKI67 (FHA domain) interacting nucleolar phosphoprotein), gene Genebank NM_033222 (PSIP1, PC4 and SFRS1 interacting protein 1), Gene Registration Number (Genebank) NM_054016 (FUSIP1, FUS interacting protein (serine / arginine-rich) 1), Gene Registration Number (Genebank) NM_145018 (FLJ25416, Hypothetical protein FLJ25416), Genebank NM_153333 (TCEAL8, Transcription elongation factor A (SII) -like 8), Genebank NM_203463 (LASS6, LAG1 longevity assurance homolog 6 (S. cerevisiae)), Genebank NM_206866 (BACH1, BTB and CNC homology 1, basic leucine zipper transcription factor 1), Genebank U38847 (TARBP1, TAR (HIV) RNA binding protein 1), Gene registration Number (Genebank) XM_371470 (LOC388907, Simullar to ribosomal protein L5; 60S ribosomal protein L5), Gene accession number (Genebank) XM_372050 (LOC389674, Heterogeneous nuclear ribonucleoprotein A1 pseudogene 4), Gene accession number (Genebank) XM_372396 (LOC390158, Ol) , family 8, subfamily K, member 1), Genebank XM_496355 (LOC440577, Similar to nucleophosmin 1; nucleolar phosphoprotein B23; numatrin; nucleophosmin / nucleoplasmin family, member 1), Genebank XM_498328 (LOC392345 , Similar to PRED65), Genebank XM_499298 (FLJ46189, similar to Zinc finger protein 479 (Zinc finger protein Kr19) (HKr19)), Genebank XM_499343 (PEG10, Paternally expressed 10), Gene Registration Genebank AB013380 (ABCB10, ATP-binding cassette, sub-family B (MDR / TAP), member 10), Gene Registration Number (Genebank) AB018342 (MYO10, Myosin X), Gene Registration Number (Genebank) AK025258 (UMP -CMPK, Cyidylate kinase, Genebank AK098205 (AK3L1, Adenylate kinase 3), Gene Accession Number (Genebank) AK122685 (GLUD1, Glutamate dehydrogenase 1), Gene Accession Number (Genebank) AK122695 (RRM1, Ribonucleotide reductase M1 polypeptide), Genebank AK126343 (STK39, Serine threonine kinase 39 (STE20 / SPS1 homolog, yeast)), Genebank (Genebank) BC051861 (SPATA5L1, Spermatogenesis associated 5-like 1), Gene accession number (Genebank) ) BC064610 (SEPHS1, Selenophosphate synthetase 1), Gene Registration Number (Genebank) BX640965 (SLC22A3, Solute carrier family 22 (extraneuronal monoamine transporter), member 3), Gene Registration Number (Genebank) D86550 (DYRK1A, Dual-specificity tyrosine- ( Y) -phosphorylation regulated kinase 1A), Genebank NM _006343 (MERTK, C-mer proto-oncogene tyrosine kinase), gene registration number (Genebank) NM_012073 (CCT5, Chaperonin containing TCP1, subunit 5 (epsilon)), gene registration number (Genebank) NM_020326 (ABCD4, ATP-binding cassette, sub-family D (ALD), member 4), Genebank NM_030752 (TCP1, T-complex 1), Genebank NM_030919 (C20orf129, Chromosome 20 open reading frame 129), Gene Registry Number ( Genebank) NM_182964 (NAV2, Neuron navigator 2), Gene Registration Number (Genebank) AF020038 (IDH1, Isocitrate dehydrogenase 1 (NADP +), Soluble), Gene Registration Number (Genebank) AK093311 (ACAA2, Acetyl-Coenzyme A acyltransferal 2 3mitochon -oxoacyl-Coenzyme A thiolase)), Gene Registration Number (Genebank) BC008366 (DDC, Dopa decarboxylase (aromatic L-amino acid decarboxylase)), Gene Registration Number (Genebank) BC012616 (BHMT, Betaine-homocysteine methyltransferase), Gene Registration Number Genebank BC015062 (MTHFD2, Methylenetetrahydrofolate dehydrogenase (NADP + dependent) 2, m ethenyltetrahydrofolate cyclohydrolase), Genebank BC033320 (TAF9, TAF9 RNA polymerase II, TATA box binding protein (TBP) -associated factor, 32kDa), Genebank BC033517 (ACOX2, Acyl-Coenzyme A oxidase 2, branched chain, Genebank BC034481 (BCKDHB, Branched chain keto acid dehydrogenase E1, beta polypeptide (maple syrup urine disease)), Gene accession (Genebank) BC035654 (NR1H4, Nuclear receptor subfamily 1, group H, member 4) Gene Registration Number (Genebank) BC042453 (MCCC1, Methylcrotonoyl-Coenzyme A carboxylase 1 (alpha)), Gene Registration Number (Genebank) BC045541 (LOC200895, Dihydrofolate reductase-like 1), Gene Registration Number (Genebank) CR609484 (KYNU Kynureninase (L- kynurenine hydrolase), Genebank (Genebank) CR749593 (GLS, Glutaminase), Genebank (Genebank) NM_000016 (ACADM, Acyl-Coenzyme A dehydrogenase, C-4 to C-12 straight chain), Genebank Number (Genebank) NM_000277 (PAH, Phenylalanine hyd roxylase), Gene Registration Number (Genebank) NM_001801 (CDO1, Cysteine dioxygenase, type I), Gene Registration Number (Genebank) NM_002860 (ALDH18A1, Aldehyde dehydrogenase 18 family, member A1), Gene Registration Number (Genebank) NM_004169 (SHMT1, Serrine hydroxymethyltransferase 1 (soluble)), gene registration number (Genebank) NM_004457 (ACSL3, Acyl-CoA synthetase long-chain family member 3), gene registration number (Genebank) NM_005589 (ALDH6A1, Aldehyde dehydrogenase 6 family, member A1), gene registration Number (Genebank) NM_013261 (PPARGC1A, Peroxisome proliferative activated receptor, gamma, coactivator 1, alpha), Gene Registration Number (Genebank) NM_018122 (FLJ10514, Aspartyl-tRNA synthetase 2 (mitochondrial)), Gene Registration Number (Genebank) NM_080820 (HARS2 , Histidyl-tRNA synthetase 2), Gene Registration Number (Genebank) U73338 (MTR, 5-methyltetrahydrofolate-homocysteine methyltransferase), Gene Registration Number (Genebank) AK001676 (NUP133, Nucleoporin 133kDa), Gene Registration Number (Genebank) AK002165 (DKFZP564O 123, Chromatin modifying protein 2B, Genebank AK023143 (C10orf119, Chromosome 10 open reading frame 119), Genebank AK094603 (Homo sapiens cDNA FLJ37284 fis, clone BRAMY2013590. [AK094603], unnamed protein product; Homo sapiens cDNA FLJ37284 fis, clone BRAMY2013590.), Gene Registration Number (Genebank) AK124768 (TNPO1, Transportin 1), Gene Registration Number (Genebank) BC000100 (SNX5, Sorting nexin 5), Gene Registration Number (Genebank) BC039468 (NUP50, Nucleoporin 50kDa), Genebank BC064351 (SRP9, Signal recognition particle 9kDa), Genebank BX091259 (UNQ9438, TIMM9), Genebank BX641063 (DEK, DEK oncogene (DNA binding)) , Gene Registration Number (Genebank) BX648363 (SNX10, Sorting nexin 10), Gene Registration Number (Genebank) CR618609 (NOP5 / NOP58, Nucleolar protein NOP5 / NOP58), Gene Registration Number (Genebank) NM_002156 (HSPD1, Heat shock 60kDa protein 1 (chaperonin)), gene registration number (Genebank) NM_006380 (APPBP2, Amyloid beta precursor protein (cytoplasmic tail) binding protein 2), gene registration number (Genebank) NM_007214 (SEC63, SEC63-like (S. cerevisiae)), gene registration Number (Genebank) NM_012460 (TIMM9, Translocase of inner mitochondrial membrane 9 ho molog (yeast), Genebank NM_014765 (TOMM20, Translocase of outer mitochondrial membrane 20 homolog (yeast)), Genebank NM_020401 (NUP107, Nucleoporin 107kDa), Genebank NM_021807 (Genebank) SEC8L1, Exocyst complex component 4), gene registration number (Genebank) NM_031296 (RAB33B, RAB33B, member RAS oncogene family), gene registration number (Genebank) NM_145261 (TIM14, DnaJ (Hsp40) homolog, subfamily C, member 19), gene Genebank NM_173827 (FLJ38991, Mitochondrial COX18), Gene Registration Number (Genebank) AL162068 (NAP1L1, Nucleosome assembly protein 1-like 1), Genebank AL834186 (CDCA7, Cell division cycle associated 7), Gene Genebank BC065520 (TCFL5, Transcription factor-like 5 (basic helix-loop-helix), Genebank CR620626 (FGG, Fibrinogen gamma chain), Genebank M58569 (Homo sapiens fibrinogen , A alpha polypeptide (FGA), transcript variant alpha-E, mRNA [NM_000508]), gene registration number (Genebank) NM_002291 (LAMB1, Laminin, beta 1), gene registration number (Genebank) NM_005141 (FGB, Fibrinogen beta chain), gene registration number (Genebank) NM_005746 (PBEF1, Pre-B -cell colony enhancing factor 1), Genebank AK002156 (WDR33, WD repeat domain 33), Genebank AK074377 (UHRF1, Chromosome 19 open reading frame 31), Genebank AK122825 ( HMGB1, High-mobility group box 1), Genebank (Genebank) BC032617 (POLI, Polymerase (DNA directed) iota), Genebank (Genebank) CR600021 (HMGB2, High-mobility group box 2), Gene Registration Number ( Genebank) NM_001067 (TOP2A, Topoisomerase (DNA) II alpha 170kDa), Gene Registration Number (Genebank) NM_002916 (RFC4, Replication factor C (activator 1) 4, 37kDa), Gene Registration Number (Genebank) NM_003368 (USP1, Ubiquitin specific peptidase 1), Genebank NM_006904 (PRKDC, Protein kinase, DNA-activated, catalytic polypeptide), Genebank NM_138271 (ATRX, Alpha thalassemia / mental retardation syndrome X-linked (RAD54 homolog, S. cerevisiae)), Genebank AF285167 (ABCA1, ATP-binding cassette, sub-family A (ABC1) ), member 1), Gene Registration Number (Genebank) AK124635 (PCSK9, Proprotein convertase subtilisin / kexin type 9), Gene Registration Number (Genebank) NM_000236 (LIPC, Lipase, hepatic), Gene Registration Number (Genebank) AF062341 (CTNND1, Catenin (cadherin-associated protein), delta 1), Genebank (Genebank) AF480883 (PPAP2B, Phosphatidic acid phosphatase type 2B), Genebank (Genebank) BC035638 (LSS, Lanosterol synthase (2,3-oxidosqualene-lanosterol cyclase) Genebank BX648473 (PIGK, Phosphhatidylinositol glycan, class K), Genebank NM_001444 (FABP5, Fatty acid binding protein 5 (psoriasis-associated), Genebank NM_003129 ( SQLE, Squalene epoxidase, Genebank NM_003580 (NSMAF, Neutral sphingomyelinase (N-SMase) activation associated factor), genebank (Genebank) NM_018361 (AGPAT5,1-acylglycerol-3-phosphate O-acyltransferase 5 (lysophosphatidic acid acyltransferase, epsilon)), gene accession number (Genebank) NM_020918 (GPAM , Glycerol-3-phosphate acyltransferase, mitochondrial), Genebank AB209031 (C5, Complement component 5), Genebank AF130100 (SERPINC1, Serpin peptidase inhibitor, clade C (antithrombin), member 1), Genebank AK122686 (IF, I factor (complement), Genebank BC022312 (C4BPA, Complement component 4 binding protein, alpha), Genebank M75106 (CPB2, Carboxypeptidase B2 (plasma) , carboxypeptidase U)), Genebank NM_000893 (KNG1, Kininogen 1), Genebank AK055619 (GNAQ, Guanine nucleotide binding protein (G protein), q polypeptide), Genebank (Genebank) AL832747 (GNAQ, Guanine nucleotide binding prot ein (G protein), q polypeptide), Genebank CR596712 (IL17D, Interleukin 17D), Genebank AK000972 (C9orf40, Chromosome 9 open reading frame 40), Genebank AK023675 (Genebank) UTRN, Utrophin (homologous to dystrophin), Genebank AK026095 (SNTB1, Syntrophin, beta 1 (dystrophin-associated protein A1, 59kDa, basic component 1)), Genebank AL117472 (SORBS1, Sorbin) and SH3 domain containing 1), gene accession number (Genebank) NM_018728 (MYO5C, Myosin VC), gene accession number (Genebank) XM_371116 (MYO5B, Myosin VB), gene accession number (Genebank) BC026320 (OGDHL, Oxoglutarate dehydrogenase-like) , Gene Registration Number (Genebank) BC033391 (PP1665, Glycerophosphodiester phosphodiesterase domain containing 5), Gene Registration Number (Genebank) BC042421 (GK, Glycerol kinase), Gene Registration Number (Genebank) M15943 (ADH4, Alcohol dehydrogenase 4 (class II), pi polypeptide), Gene Accession Number (Genebank) NM_00067 1 (ADH5, Alcohol dehydrogenase 5 (class III), chi polypeptide), gene registration number (Genebank) NM_002610 (PDK1, Pyruvate dehydrogenase kinase, isozyme 1), gene registration number (Genebank) AK026927 (MGC5297, Hypothetical protein MGC5297), gene Genebank AK127326 (PHF17, PHD finger protein 17), Genebank BC039110 (SMNDC1, Survival motor neuron domain containing 1), Genebank BC041849 (ROCK1, Rho-associated, coiled-coil containing protein kinase 1), genebank BX537500 (PDCD4, Programmed cell death 4 (neoplastic transformation inhibitor)), genebank (Genebank) CR596268 (ITGB3BP, Integrin beta 3 binding protein (beta3-endonexin)), gene Genebank NM_004938 (DAPK1, Death-associated protein kinase 1), Genebank NM_012238 (SIRT1, Sirtuin (silent mating type information regulation 2 homolog) 1 (S. cerevisiae)), gene registration number (Genebank) NM_130837 (OPA1, Optic atrophy 1 (autosomal dominant)), gene registration number (Genebank) NM_148957 (TNFRSF19, Tumor necrosis factor receptor superfamily, member 19), gene registration number (Genebank) AB208919 (FGFR1, Fibroblast growth factor receptor 1 (fms-related tyrosine kinase 2, Pfeiffer syndrome)), Genebank AB209601 (TIZ, Zinc finger protein 675), Genebank AK125150 (MAPK8, Mitogen-activated) protein kinase 8), gene bank number (Genebank) BC027881 (AFP, Alpha-fetoprotein), gene bank number (Genebank) NM_020995 (HPR, Hipgloglobin-related protein), gene bank number (Genebank) AF167706 (CRIM1, Cysteine rich transmembrane BMP) regulator 1 (chordin-like), Genebank BC045655 (MAC30, Hypothetical protein MAC30), Genebank BX537509 (NET1, Neuroepithelial cell transforming gene 1), Genebank BX640958 (Genebank) YEATS 4, YEATS domain containing 4) Genebank BX647757 (Homo sapiens sex comb on midleg-like 1 (Drosophila) (SCML1), mRNA [NM_006746], sex comb on midleg-like 1 (Drosophila), gene registration number (Genebank) NM_006548 (IMP -2, IGF-II mRNA-binding protein 2), Genebank AY376439 (ECT2, Epithelial cell transforming sequence 2 oncogene), Genebank AY596970 (GARNL1, GTPase activating Rap / RanGAP domain-like 1 ), Genebank BC050630 (RAB3-GAP150, RAB3 GTPase activating protein subunit 2 (non-catalytic)), Genebank NM_001001132 (ITSN1, Intersectin 1 (SH3 domain protein)), Gene registry number ( Genebank) NM_016340 (KIAA1961, KIAA1961 gene), Genebank NM_145290 (GPR125, G protein-coupled receptor 125), Genebank NM_003574 (VAPA, VAMP (vesicle-associated membrane protein) -associated protein A , 33kDa), Genebank M28016 (cytochrome b, Human mitochondrial cytochrome b gene, partial c ds.), Genebank NM_013277 (RACGAP1, Rac GTPase activating protein 1), Genebank AB096248 (SNF1LK2, SNF1-like kinase 2), Genebank NM_001698 (AUH, AU RNA binding protein / enoyl-Coenzyme A hydratase), Genebank AB091343 (C10orf3, Centrosomal protein 55kDa). 제 1항의 바이오마커 유전자 서열의 전부 또는 일부를 포함하는 올리고뉴클레오티드 또는 그의 상보가닥 분자가 집적된 다이벤조에이에이취안트라센에 대한 노출 여부 확인용 DNA 마이크로어레이 칩.A DNA microarray chip for confirming exposure to an oligonucleotide comprising all or a part of the biomarker gene sequence of claim 1 or a dibenzoaichanthracene integrated with its complementary strand molecule. 1) 인간 체세포에 피검화합물을 처리하는 단계;1) treating the test compound to human somatic cells; 2) 단계 1)의 피검화합물을 처리한 실험군 세포와 피검화합물을 처리하지 않은 대조군 세포에서 RNA를 분리하는 단계;2) separating RNA from the test cell treated with the test compound of step 1) and the control cell not treated with the test compound; 3) 단계 2)의 실험군 및 대조군의 RNA를 cDNA로 합성하면서 실험군과 대조군을 각기 다른 형광물질로 표지하는 단계;3) labeling the experimental group and the control group with different fluorescent materials while synthesizing the RNA of the experimental group and the control group of step 2) with cDNA; 4) 단계 3)의 각기 다른 형광물질로 표지된 cDNA를 제 5항의 DNA 마이크로어레이칩과 혼성화시키는 단계;4) hybridizing cDNA labeled with different fluorescent materials of step 3) with DNA microarray chip of claim 5; 5) 단계 4)의 반응한 DNA 마이크로어레이칩을 분석하는 단계; 및5) analyzing the reacted DNA microarray chip of step 4); And 6) 단계 5)의 분석한 데이터에서 제 1항의 바이오마커의 발현 정도를 대조군과 비교하여 확인하는 단계를 포함하는 다이벤조에이에이취안트라센에 대한 노출 여부를 확인하는 방법.6) A method of confirming the exposure to dibenzoAh anthracene comprising the step of confirming the expression level of the biomarker of claim 1 in the analyzed data of step 5) compared to the control. 제 5항에 있어서, 단계 1)의 인간 체세포는 인간의 간 또는 간암의 세포 및 조직에서 유래한 세포인 것을 특징으로 하는 다이벤조에이에이취안트라센에 대한 노출 여부를 확인하는 방법.The method of claim 5, wherein the human somatic cells of step 1) are cells derived from cells and tissues of human liver or liver cancer. 제 6항에 있어서, 상기 인간 간암 세포는 HepG2인 것을 특징으로 하는 다이벤조에이에이취안트라센에 대한 노출 여부를 확인하는 방법.The method of claim 6, wherein the human liver cancer cells are HepG2. 제 5항에 있어서, 단계 3)의 형광물질은 Cy3, Cy5, FITC(poly L-lysine-fluorescein isothiocyanate), RITC(rhodamine-B-isothiocyanate) 및 로다민(rhodamine)으로 이루어진 군으로부터 선택하여 사용하는 것을 다이벤조에이에이취안트라센에 대한 노출 여부를 확인하는 방법.The method of claim 5, wherein the fluorescent material of step 3) is selected from the group consisting of Cy3, Cy5, poly L-lysine-fluorescein isothiocyanate (FITC), rhodamine-B-isothiocyanate (RITC) and rhodamine (rhodamine) How to determine whether or not the exposure to dibenzoaquaanthracene. 1) 인간 체세포에 피검화합물을 처리하는 단계;1) treating the test compound to human somatic cells; 2) 단계 1)의 피검화합물을 처리한 실험군 세포와 피검화합물을 처리하지 않은 대조군 세포에서 RNA를 분리하는 단계;2) separating RNA from the test cell treated with the test compound of step 1) and the control cell not treated with the test compound; 3) 단계 2)의 RNA를, 제 1항의 바이오마커 유전자에 상보적이고 바이오마커 유전자를 증폭할 수 있는 프라이머를 사용하여 실시간 RT-PCR(Real-time reverse transcript polymerase chain reaction)을 수행하는 단계; 및3) real-time reverse transcript polymerase chain reaction (RT-PCR) using the RNA of step 2) using primers complementary to the biomarker gene of claim 1 and capable of amplifying the biomarker gene; And 4) 단계 3)의 유전자 산물을 대조군과 비교하여 발현 정도를 확인하는 단계를 포함하는 다이벤조에이에이취안트라센에 대한 노출 여부를 확인하는 방법.4) A method for confirming the exposure to dibenzoaichanthracene comprising the step of comparing the gene product of step 3) with the control to confirm the expression level. 제 9항에 있어서, 단계 1)의 인간 체세포는 간 또는 간암의 세포 및 조직에서 유래한 세포인 것을 특징으로 하는 다이벤조에이에이취안트라센에 대한 노출 여부를 확인하는 방법.10. The method of claim 9, wherein the human somatic cells of step 1) are cells derived from cells and tissues of liver or liver cancer. 제 10항에 있어서, 상기 인간 간암 세포는 HepG2인 것을 특징으로 하는 다이벤조에이에이취안트라센에 대한 노출 여부를 확인하는 방법.The method of claim 10, wherein the human liver cancer cells are HepG2. 제 4항의 DNA 마이크로어레이 칩을 포함하는 것을 특징으로 하는 다이벤조에이에이취안트라센에 대한 노출 여부 확인용 키트.Claim 4 kit for confirming the exposure to the dibenzo aquaanthracene comprising the DNA microarray chip. 제 12항에 있어서, 인간 간 세포 또는 간암 세포를 추가적으로 포함하는 것 을 특징으로 하는 다이벤조에이에이취안트라센에 대한 노출 여부 확인용 키트.The kit according to claim 12, further comprising human liver cells or liver cancer cells. 제 12항에 있어서, 제 1항의 바이오마커 유전자에 상보적이고 바이오마커 유전자를 증폭할 수 있는 프라이머를 추가적으로 포함하는 것을 특징으로 하는 다이벤조에이에이취안트라센에 대한 노출 여부 확인용 키트.The kit according to claim 12, further comprising a primer which is complementary to the biomarker gene of claim 1 and further comprises a primer capable of amplifying the biomarker gene. 제 14항에 있어서, 프라이머는 서열번호 1 내지 96으로 기재되는 서열로 구성된 군으로부터 선택되는 2개 이상의 정방향 및 역방향인 것을 특징으로 하는 다이벤조에이에이취안트라센에 대한 노출 여부 확인용 키트.15. The kit according to claim 14, wherein the primers are at least two forward and reverse directions selected from the group consisting of sequences represented by SEQ ID NOs: 1 to 96.
KR1020070099135A 2007-10-02 2007-10-02 Biomarker for identification of exposure to dibenzo?a, h?anthracene and the method of identification using thereof KR100961487B1 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
KR1020070099135A KR100961487B1 (en) 2007-10-02 2007-10-02 Biomarker for identification of exposure to dibenzo?a, h?anthracene and the method of identification using thereof

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
KR1020070099135A KR100961487B1 (en) 2007-10-02 2007-10-02 Biomarker for identification of exposure to dibenzo?a, h?anthracene and the method of identification using thereof

Publications (2)

Publication Number Publication Date
KR20090034011A true KR20090034011A (en) 2009-04-07
KR100961487B1 KR100961487B1 (en) 2010-06-08

Family

ID=40760065

Family Applications (1)

Application Number Title Priority Date Filing Date
KR1020070099135A KR100961487B1 (en) 2007-10-02 2007-10-02 Biomarker for identification of exposure to dibenzo?a, h?anthracene and the method of identification using thereof

Country Status (1)

Country Link
KR (1) KR100961487B1 (en)

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2014046706A1 (en) * 2012-09-24 2014-03-27 Duke University Signatures of radiation response
CN106924758A (en) * 2017-04-24 2017-07-07 刘志国 A kind of biomarker for Huppert's disease
US10316365B2 (en) 2008-04-02 2019-06-11 Duke University Signatures of radiation response

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR101460530B1 (en) 2013-03-26 2014-11-10 한국과학기술연구원 Methylation marker for identification of exposure to perfluorooctane sulfonates and the method of identification using thereof

Cited By (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US10316365B2 (en) 2008-04-02 2019-06-11 Duke University Signatures of radiation response
WO2014046706A1 (en) * 2012-09-24 2014-03-27 Duke University Signatures of radiation response
US10370712B2 (en) 2012-09-24 2019-08-06 Duke University Signatures of radiation response
CN106924758A (en) * 2017-04-24 2017-07-07 刘志国 A kind of biomarker for Huppert's disease
CN106924758B (en) * 2017-04-24 2020-07-10 陈霞 Biomarker for multiple myeloma

Also Published As

Publication number Publication date
KR100961487B1 (en) 2010-06-08

Similar Documents

Publication Publication Date Title
KR100985090B1 (en) Biomarker for identification of exposure to chrysene and the method of identification using thereof
Hu et al. Identification of a gene expression profile that discriminates indirect-acting genotoxins from direct-acting genotoxins
KR101008385B1 (en) Biomarker for identification of exposure to Polycyclic Aromatic Hydrocarbons and the method of identification using thereof
KR100994996B1 (en) Biomarkers for identification of exposure to phenanthrene and the method of identification using the same
KR100961487B1 (en) Biomarker for identification of exposure to dibenzo?a, h?anthracene and the method of identification using thereof
KR100968762B1 (en) Biomarker for identification of exposure to naphthalene and the method of identification using thereof
KR101398548B1 (en) Specific biomarker for identification of exposure to Lower aliphatic saturated aldehydes and the method of identification using the same
KR100967546B1 (en) Biomarker for identification of exposure to benzo[a]anthracene and the method of identification using thereof
IL223816A (en) Gene expression analyses for characterizing and identifying genotoxic compounds
KR101749566B1 (en) Biomarker for identification of genes related to inflammatory response after exposure to diesel exhaust particle and the method of identification using thesame
KR100962185B1 (en) Marker genes based on daunorubicin treatment for screening of drug inducing cardio toxicity and screening method using thereof
KR101018788B1 (en) Biomarker for identification of exposure to chlordane and the method of identification using thereof
KR100974228B1 (en) A biomarker and screening method of drug having teratogenicity and side effects using thereof
KR100915898B1 (en) Biomarker for diagonosis of exposure to 3-methylcholanthrene and the method of diagonosis using thereof
KR100936286B1 (en) Marker genes based on Amiodarone treatment for screening of drug inducing pulmonary toxicity and screening method using thereof
KR101773408B1 (en) METHOD FOR PREPARING aRNA AND METHOD FOR ASSAYING GENE EXPRESSION
KR101138954B1 (en) The biomarkers for identification of exposure to disruptors inhibiting thyroid peroxidase and the identification method of disruptors inhibiting thyroid peroxidase exposure using the same biomarkers
KR20130029566A (en) Micrornas for identification of exposure to benzo[k]fluoranthene and the method of identification using thereof
KR101108694B1 (en) A Biomarker based on methotrexate treatment for screening of drug inducing teratogenicity and screening method using thereof
KR101386075B1 (en) Biomarkers for identification of exposure to Hexachlorobenzene and the method of identification using thereof
KR101062784B1 (en) Biomarker for Identifying Mirex Specific Exposure and Identification Method Using the Same
KR101457481B1 (en) The biomarkers for identification of exposure to deiodinase inhibiting disruptors and the identification method of deiodinase inhibiting disruptors exposure using the same biomarkers
KR20100006834A (en) Marker genes based on amiodarone and carbamazepine treatment for screening of drug inducing pulmonary toxicity and screening method using the same
KR101138953B1 (en) The biomarkers for identification of exposure to disruptors activating thyroid peroxidase and the identification method of disruptors activating thyroid peroxidase exposure using the same biomarkers
KR20130117298A (en) Specific biomarker for identification of exposure to propionaldehyde and the method of identification using thesame

Legal Events

Date Code Title Description
A201 Request for examination
E902 Notification of reason for refusal
E902 Notification of reason for refusal
E701 Decision to grant or registration of patent right
GRNT Written decision to grant
FPAY Annual fee payment

Payment date: 20130430

Year of fee payment: 4

FPAY Annual fee payment

Payment date: 20140507

Year of fee payment: 5

LAPS Lapse due to unpaid annual fee