KR20090027537A - Method and kit for diagnosis of abnormal keratinization - Google Patents

Method and kit for diagnosis of abnormal keratinization Download PDF

Info

Publication number
KR20090027537A
KR20090027537A KR1020070092824A KR20070092824A KR20090027537A KR 20090027537 A KR20090027537 A KR 20090027537A KR 1020070092824 A KR1020070092824 A KR 1020070092824A KR 20070092824 A KR20070092824 A KR 20070092824A KR 20090027537 A KR20090027537 A KR 20090027537A
Authority
KR
South Korea
Prior art keywords
keratinocytes
polynucleotide
group
gene
skin
Prior art date
Application number
KR1020070092824A
Other languages
Korean (ko)
Other versions
KR100947739B1 (en
Inventor
김수정
황재성
이증훈
김창덕
Original Assignee
(주)아모레퍼시픽
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by (주)아모레퍼시픽 filed Critical (주)아모레퍼시픽
Priority to KR1020070092824A priority Critical patent/KR100947739B1/en
Publication of KR20090027537A publication Critical patent/KR20090027537A/en
Application granted granted Critical
Publication of KR100947739B1 publication Critical patent/KR100947739B1/en

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6813—Hybridisation assays
    • C12Q1/6834—Enzymatic or biochemical coupling of nucleic acids to a solid phase
    • G—PHYSICS
    • G16—INFORMATION AND COMMUNICATION TECHNOLOGY [ICT] SPECIALLY ADAPTED FOR SPECIFIC APPLICATION FIELDS
    • G16B—BIOINFORMATICS, i.e. INFORMATION AND COMMUNICATION TECHNOLOGY [ICT] SPECIALLY ADAPTED FOR GENETIC OR PROTEIN-RELATED DATA PROCESSING IN COMPUTATIONAL MOLECULAR BIOLOGY
    • G16B25/00—ICT specially adapted for hybridisation; ICT specially adapted for gene or protein expression
    • G16B25/10—Gene or protein expression profiling; Expression-ratio estimation or normalisation

Abstract

An abnormal keratinization skin disease diagnosis kit is provided to diagnose rapidly abnormal keratinization skin disease and to screen a keratinocyte allotypic differentiation antisagging agent. An abnormal keratinization skin disease diagnosis kit comprises specific polynucleotide or polynucleotide thereof and a solid support. The specific polynucleotide is one or more selected from a group consisting of SEC24D, WASF1, MTFR1, STT3A, CDKN3, EIF2B3, PTPRZ1, TRIM37, GTF2H2, ATM, FST, G3BP2, TETRAN, MDFIC, ALG14, RPS7, OLFM1, RCN2, IGSF3, HS3ST1, ERLIN1, IL1A, SST, FHL1, PTGS2, BCAT1, DNAJC10, IBTK, ODC1, OR7E38P, TIMM17A, PLDN, TBPL1, PFAS, TTTY15, FAM91A1, SNRPG, SNRPB2, SLMO2, SCFD1, ATP11C, CYCS, CD9, CKS1B, DPM1, UQCRQ, CPSF2, RNF41, PDE4D, HLA-DOB, CSNK1G3, LYSMD3, DORA2B, SSR1, GALK2, GTF2H3, ZNF410, TXNL2, NUS1, MEF2B, GPD2, AMMECR1L, SLC3A2, MAD2L2, MGAT1, ATP5E, FXN, TAF7, DCK, NCOA1, AKAP8L, CA14, CRSP8, C7orf30, FAM126A, SEC23B, CTBS, BBS12, TRIM32, RAE1, PBEF1, TNFAIP8, C10orf104, PPP2R1B, RNF139, PRDX6, CBX5, ARG2, HOXD8 and C10orf11.

Description

각화 이상 피부질환의 진단키트 및 그를 이용하는 진단방법 {Method and kit for diagnosis of abnormal keratinization}Diagnostic kit for keratinized skin disease and diagnostic method using the same {Method and kit for diagnosis of abnormal keratinization}

본 발명은 각화 이상 피부질환의 진단키트 및 그를 이용하는 진단방법에 관한 것으로서, 구체적으로는, 각질형성세포 분화에 따라 발현 패턴이 변화되는 유전자를 확인하여 그 정보를 표피 분화 이상의 진단에 사용하기 위하여, 상기 유전자 서열의 폴리뉴클레오티드와 혼성화하는 프로브로서 하나 이상의 폴리뉴클레오티드 또는 그의 상보적 폴리뉴클레오티드; 상기 유전자 서열의 폴리뉴클레오티드의 프라이머 쌍; 또는 상기 유전자에 의하여 코딩되는 폴리펩티드에 대한 하나 이상의 모노클로날 항체를 포함하는 각화 이상 피부질환의 진단 키트 및 그를 이용하는 진단방법에 관한 것이다.The present invention relates to a diagnostic kit for keratinous skin diseases and a diagnostic method using the same. Specifically, in order to identify genes whose expression patterns change according to keratinocyte differentiation and use the information for diagnosis of epidermal differentiation abnormalities, At least one polynucleotide or a complementary polynucleotide thereof as a probe that hybridizes with the polynucleotide of the gene sequence; Primer pairs of polynucleotides of said gene sequence; Or it relates to a diagnostic kit for keratinized skin diseases comprising at least one monoclonal antibody to the polypeptide encoded by the gene and a diagnostic method using the same.

사람의 전 표면을 덮고 있는 표피는 인체의 최 외곽에 위치하여 외부로부터의 세균의 침입, 견인력, 장력 및 기계적 자극을 차단하여 사람 신체를 보호한다. 또한 체액 증발을 막는 역할을 통해 인체의 항상성을 유지해 준다. 이런 기능은 주로 표피를 구성하는 각질형성세포가 여러 단계의 분화 과정을 거쳐서 최종적으로 핵이 없으며, 아주 단단하고, 침투가 어려운 각질세포를 형성하여 이루어진다. 특 히 각질세포에는 수분을 유지하는 자연 보습제 (natural moisturizing factor, NMF)로 인해 다량의 수분이 함유되어 있어 피부의 탄력성과 장벽 기능을 수행하는데 결정적 역할을 담당한다. NMF는 여러 종류의 아미노산, 유기물, 요소 및 비유기물산 등으로 구성되어 있지만 그 구성 성분이 모두 밝혀진 것은 아니고, 어떤 성분이 더욱 효과적으로 수분을 유지하는지에 대해서도 분명하게 밝혀지지 않았다. NMF의 구성성분들은 각질형성세포가 분화하는 과정에서 형성되는 것이며, 각질형성세포의 분화 기전에 이상이 생길 경우 건선, 아토피 등과 같은 난치성 피부질환을 유발하게 된다.The epidermis covering the entire surface of a person is located at the outermost part of the human body to protect the human body by blocking the invasion, traction, tension and mechanical stimulation of bacteria from the outside. It also maintains homeostasis of the human body by preventing evaporation of body fluids. This function is mainly performed by keratinocytes, which make up the epidermis, through various stages of differentiation, and finally form keratinocytes without a nucleus, very hard, and difficult to penetrate. In particular, keratinocytes contain a large amount of water due to the natural moisturizing factor (NMF) that maintains moisture, which plays a crucial role in performing skin elasticity and barrier function. NMF is composed of various kinds of amino acids, organics, urea and inorganic acids, but not all of them are clarified, and it is not clear whether any component retains moisture more effectively. The components of NMF are formed during the differentiation of keratinocytes, and when abnormalities occur in the differentiation mechanism of keratinocytes, they cause intractable skin diseases such as psoriasis and atopy.

종래에는 이러한 피부질환의 치료나 예방에 있어서 메토트렉세이트 (methotrexate) 등과 같은 항암제, 사이클로스포린 에이 (cyclosporine A) 등과 같은 면역억제제, 프레드니소론 (prednisolone) 등과 같은 스테로이드 제제, 또는 세라마이드 (ceramide), 글리세롤 (glycerol), 천연보습제 등을 함유한 로션이나 크림 등이 사용 되어 왔으나, 간독성이나 신장독성 또는 피부 아트로피(atrophy) 등과 같은 부작용의 문제가 있거나 작용 기전에 대한 명확한 실험적 증거에 기반하지 않은 대중 치료 요법으로 사용 되고 있는 실정이다.Conventionally, in the treatment or prevention of such skin diseases, anticancer agents such as methotrexate, immunosuppressants such as cyclosporine A, steroid preparations such as prednisolone, or ceramide, glycerol Lotions and creams containing natural moisturizers have been used, but they are a popular treatment regimen that has problems with side effects such as hepatotoxicity, kidney toxicity or skin atrophy, or is not based on clear experimental evidence on the mechanism of action. It is used.

한편, 현재까지 각질형성세포 분화에 대한 기전이 명확히 밝혀져 있지 않으나, 각질형성세포의 분화 과정은 시, 공간적으로 수많은 유전자가 정교하게 발현 조절 되며 복합적인 유전자 상호작용에 의해 나타나는 현상으로 생각되고 있다. 현재 구미의 선진 연구 기관 및 대학 연구 기관 등에서 각질형성세포 분화에 관여하는 유전자의 동정 및 기능, 그리고 이를 이용한 각질형성세포 이상 관련 피부질환 의 치료 및 예방 방법에 대한 연구가 폭 넓게 진행되고는 있으나, 아직 피부각질형성세포 분화에 관여하는 모든 유전자의 프로파일이 확립되어 있지는 않다.On the other hand, the mechanism for differentiation of keratinocytes is not clear to date, but the process of differentiation of keratinocytes is thought to be a phenomenon that is expressed by complex gene interactions with precise expression control of numerous genes in time and space. At present, advanced research institutes and university research institutes have been widely studied on the identification and function of genes involved in the differentiation of keratinocytes and the treatment and prevention of skin diseases related to keratinocyte abnormalities. Not all genes involved in the exfoliation of keratinocytes have yet been established.

현재까지, 피부조직으로부터 각질형성세포를 분리하고 이를 시험관에서 배양하면서 칼슘을 처리할 경우 각질형성세포 분화가 생체 내(in vivo) 상황과 유사하게 유도됨이 알려져 있다 (Hennings et al. (1980) Cell 19:245-254, Yuspa et al. (1989) J. Cell Biol. 109:1207-1217). 즉, 각질형성세포를 0.03 mM 이하의 칼슘 농도에서 배양하면 기저막에 부착되어 있는 기저층 각질형성세포(keratinocytes in basal layer)와 형태적으로 유사하게 자라며 왕성히 분열이 유도 된다. 또한, 세포배양 배지에 칼슘의 농도를 0.1 mM 이상으로 올려주면 유극층 (spinous layer) 또는 과립층 (granular layer)에 존재하는 각질형성세포와 형태적, 기능적으로 유사한 각질형성세포로 분화가 일어나게 된다. To date, it has been known that keratinocyte differentiation is induced similarly to in vivo situations by separating keratinocytes from skin tissues and culturing them in vitro and in vitro (Hennings et al. (1980)). Cell 19: 245-254, Yuspa et al. (1989) J. Cell Biol. 109: 1207-1217). That is, when keratinocytes are cultured at a calcium concentration of 0.03 mM or less, they grow similarly to keratinocytes in basal layer attached to the basement membrane and actively induce division. In addition, when the concentration of calcium is increased to 0.1 mM or more in the cell culture medium, differentiation occurs into keratinocytes that are morphologically and functionally similar to keratinocytes present in the spinous layer or granular layer.

최근에는 세포 내 mRNA를 이용하여 유전자 발현의 차이를 알아내는 기법이 이용되고 있으며, 이는 각질형성세포의 분화 과정에서 발현에 차이를 나타내는 유전자를 동정하기 위한 기초적 실험법으로 사용될 수 있다. 이 중 cDNA 마이크로어레이 (microarray) 기법은 한 번의 실험으로 세포 내에서 수백 또는 수천 개의 유전자 발현 변화를 동시에 관찰할 수 있는 방법으로서, 현재 다양한 종류의 DNA 마이크로어레이 또는 cDNA 마이크로어레이 등이 여러 용도로 개발되어 널리 사용되며, 임상적으로는 암 등 질병의 진단, 약제 개발, 약독성 실험, 또는 세포에 화학적 또는 물리적 처치 후 세포 내 유전자 발현의 변화를 확인하는데 사용되고 있다. 또한 2차원적 전기영동장치 (two dimensional electrophoresis) 기법에 의해 새롭 게 발현되는 단백질을 정제, 분리하여 아미노산 서열을 알아낼 수 있는데, 이 결과를 DNA 마이크로어레이, cDNA 라이브러리(library) 및 생물정보학 (bioinformatics) 에서 얻은 정보와 비교함으로써 원하는 새로운 유전자를 찾을 수 있다. Recently, a technique for detecting a difference in gene expression using intracellular mRNA has been used, which can be used as a basic experimental method for identifying genes showing differences in expression during differentiation of keratinocytes. Among these, the cDNA microarray technique is a method that can simultaneously observe hundreds or thousands of gene expression changes in a cell in a single experiment. Currently, various types of DNA microarrays or cDNA microarrays have been developed for various purposes. It has been widely used and clinically used to diagnose changes in gene expression in cells after diagnosis of diseases such as cancer, drug development, drug toxicity experiments, or chemical or physical treatments on cells. In addition, the two-dimensional electrophoresis technique can be used to purify and isolate the newly expressed protein to determine the amino acid sequence. The results are obtained from DNA microarrays, cDNA libraries and bioinformatics. Comparing the information obtained from to can find new genes of interest.

이에 본 발명자는 각질형성세포의 분화 과정 중 발현에 변화를 보이는 유전자를 cDNA 마이크로어레이 기법으로 동정하여 이를 각화 이상 피부질환 진단 마커로 사용할 수 있다는 사실을 밝혀내었다. 따라서 본 발명은 각질형성세포 분화 과정 중 발현에 변화를 보이는 유전자를 찾아내어, 이를 이용하여 각질형성세포 이상을 판단하는 진단마커 및 진단 방법을 제공하는 것을 목적으로 한다. 또한 본 발명은 상기 동정된 유전자의 프로모터 염기 서열을 생물정보학 기술을 이용하여 분석함으로써 분화 과정을 조절하는 전사인자를 규명하여, 상기 전사 인자 유전자를 이용하여 알려진 약물 또는 새로 개발된 약물이 각질형성세포 이상에 대한 효과를 나타내는지를 판정하는 방법을 제공하는 것을 목적으로 한다. Accordingly, the present inventors have identified a gene showing a change in the expression of keratinocytes during the differentiation process by cDNA microarray technique and found that it can be used as a diagnostic marker for keratinous skin disease. Accordingly, an object of the present invention is to find a gene showing a change in expression during keratinocyte differentiation, and to provide a diagnostic marker and a diagnostic method for determining keratinocyte abnormality using the same. In addition, the present invention is to identify the transcription factor that regulates the differentiation process by analyzing the promoter nucleotide sequence of the identified gene using bioinformatics technology, a known drug or a newly developed drug using the transcription factor gene keratinocytes It is an object of the present invention to provide a method for determining whether the above effects are achieved.

상기 과제를 해결하기 위하여, 본 발명은 SEC24D, WASF1, MTFR1, STT3A, CDKN3, EIF2B3, PTPRZ1, TRIM37, GTF2H2, ATM, FST, G3BP2, TETRAN, MDFIC, ALG14, RPS7, OLFM1, RCN2, IGSF3, HS3ST1, ERLIN1, IL1A, SST, FHL1, PTGS2, BCAT1, DNAJC10, IBTK, ODC1, OR7E38P, TIMM17A, PLDN, TBPL1, PFAS, TTTY15, FAM91A1, SNRPG, SNRPB2, SLMO2, SCFD1, ATP11C, CYCS, CD9, CKS1B, DPM1, UQCRQ, CPSF2, RNF41, PDE4D, HLA-DOB, CSNK1G3, LYSMD3, ADORA2B, SSR1, GALK2, GTF2H3, ZNF410, TXNL2, NUS1, MEF2B, GPD2, AMMECR1L, SLC3A2, MAD2L2, MGAT1, ATP5E, FXN, TAF7, DCK, NCOA1, AKAP8L, CA14, CRSP8, C7orf30, FAM126A, SEC23B, CTBS, BBS12, TRIM32, RAE1, PBEF1, TNFAIP8, C10orf104, PPP2R1B, RNF139, PRDX6, CBX5, ARG2, HOXD8 및 C10orf11로 이루어진 군으로부터 선택된 하나 이상의 폴리뉴클레오티드 또는 그 단편으로서 10개 이상의 연속 뉴클레오티드를 포함하는 폴리뉴클레오티드, 또는 그의 상보적 폴리뉴클레오티드; 및 상기 폴리뉴클레오티드를 표면에 결합시킨 고상 지지체를 포함하며, 진단 대상 피부 유래 각질형성세포의 전사체 중에서 상기 폴리뉴클레오티드에 혼성화된 전사체의 양이 시간경과에 따라 2배 이상 감소하면 각질화 세포로 판단하는 것을 특징으로 하는 각화 이상 피부질환 진단 키트를 제공한다.In order to solve the above problems, the present invention is SEC24D, WASF1, MTFR1, STT3A, CDKN3, EIF2B3, PTPRZ1, TRIM37, GTF2H2, ATM, FST, G3BP2, TETRAN, MDFIC, ALG14, RPS7, OLFM1, RCN2, IGSF3, HS3ST ERLIN1, IL1A, SST, FHL1, PTGS2, BCAT1, DNAJC10, IBTK, ODC1, OR7E38P, TIMM17A, PLDN, TBPL1, PFAS, TTTY15, FAM91A1, SNRPG, SNRPB2, SLMO2, SCFD1, ATP11C9, CYCS1 UQCRQ, CPSF2, RNF41, PDE4D, HLA-DOB, CSNK1G3, LYSMD3, ADORA2B, SSR1, GALK2, GTF2H3, ZNF410, TXNL2, NUS1, MEF2B, GPD2, AMMECR1L, SLC3A2, MAD2L2K2 NCOA1, AKAP8L, CA14, CRSP8, C7orf30, FAM126A, SEC23B, CTBS, BBS12, TRIM32, RAE1, PBEF1, TNFAIP8, C10orf104, PPP2R1B, RNF139, PRDX6, CBX5, ARG2, HOXf11 and C10 or more selected from C10 Or a polynucleotide comprising 10 or more consecutive nucleotides as a fragment thereof, or a complementary polynucleotide thereof; And a solid support that binds the polynucleotide to the surface, wherein the amount of the transcript hybridized to the polynucleotide in the transcript of the skin-derived keratinocytes to be diagnosed is determined to be a keratinocyte if the amount of the transcript hybridized over time decreases by two or more times. It provides a diagnostic kit for keratinosis skin disease, characterized in that.

본 발명은 Sox9, HSPB1,CEPT1, WRN, CYP3A5, CREG1, KLK8, CSTA, TGM1, SPRR1A, FABP5, LOC728641, BAG3, ADAMTS7, RAB5B, ID3, CBR1, LOC128977, WBP2, SMAP1L, CCNE1, GSN, PIK3C2B, ULK1, FOXD1, ECM1, CLN3, KDELR1, MOBP, PI3, SLPI, GRN, ARPC1A, KLK5, KLK10, GLRX, LCN2, DUSP3, KLK7, TIMP2, RAB11FIP1, SH3KBP1, DDX24, NEU1, CSTB, LOH11CR2A, YPEL2, MMD, MKRN1, HTATIP, IRF6, MYD88, HCFC1R1, PSD4, SEMG1, CDKN1C, COX6B1, JUP, CELSR2, RAI16, PLCD1, ALOX15B, FAT2, SREBF2, ATP8B1, C22orf25, AHCYL1, PARD3, PRPF8, TBC1D9, ANKHD1, SMARCA2 및MAP3K4 로 이루어진 군으로부터 선택된 하나 이상의 폴리뉴클레오티드 또는 그 단편으로서 10개 이상의 연속 뉴클레오티드를 포함하는 폴리뉴클레오티드, 또는 그의 상보적 폴리뉴클레오티드; 및 상기 폴리뉴클레오티드를 표면에 결합시킨 고상 지지체를 포함하며, 진단 대상 피부 유래 각질형성세포의 전사체 중에서 상기 폴리뉴클레오티드에 혼성화된 전사체의 양이 시간경과에 따라 2배 이상 증가하면 각질화 세포로 판단하는 것을 특징으로 하는 각화 이상 피부질환 진단 키트를 제공한다.The invention is Sox9, HSPB1, CEPT1, WRN, CYP3A5, CREG1, KLK8, CSTA, TGM1, SPRR1A, FABP5, LOC728641, BAG3, ADAMTS7, RAB5B, ID3, CBR1, LOC128977, WBP2, SMAP1L, CCNEK1, GSN1, GSN , FOXD1, ECM1, CLN3, KDELR1, MOBP, PI3, SLPI, GRN, ARPC1A, KLK5, KLK10, GLRX, LCN2, DUSP3, KLK7, TIMP2, RAB11FIP1, SH3KBP1, ABX24, NEU1, CSTB, LOH11KRN MMD , Consisting of HTATIP, IRF6, MYD88, HCFC1R1, PSD4, SEMG1, CDKN1C, COX6B1, JUP, CELSR2, RAI16, PLCD1, ALOX15B, FAT2, SREBF2, ATP8B1, C22orf25, AHCYL1, PARD3, PRPF9, ANK2D3, AK2MA and TBC2MA One or more polynucleotides selected from the group or fragments thereof, the polynucleotide comprising ten or more consecutive nucleotides, or a complementary polynucleotide thereof; And a solid support that binds the polynucleotide to the surface, wherein the amount of the transcript hybridized to the polynucleotide in the transcript of the skin-derived keratinocytes to be diagnosed is determined to be a keratinocyte when the amount of the transcript is increased more than two times over time. It provides a diagnostic kit for keratinosis skin disease, characterized in that.

또한, 본 발명은 SEC24D, WASF1, MTFR1, STT3A, CDKN3, EIF2B3, PTPRZ1, TRIM37, GTF2H2, ATM, FST, G3BP2, TETRAN, MDFIC, ALG14, RPS7, OLFM1, RCN2, IGSF3, HS3ST1, ERLIN1, IL1A, SST, FHL1, PTGS2, BCAT1, DNAJC10, IBTK, ODC1, OR7E38P, TIMM17A, PLDN, TBPL1, PFAS, TTTY15, FAM91A1, SNRPG, SNRPB2, SLMO2, SCFD1, ATP11C, CYCS, CD9, CKS1B, DPM1, UQCRQ, CPSF2, RNF41, PDE4D, HLA-DOB, CSNK1G3, LYSMD3, ADORA2B, SSR1, GALK2, GTF2H3, ZNF410, TXNL2, NUS1, MEF2B, GPD2, AMMECR1L, SLC3A2, MAD2L2, MGAT1, ATP5E, FXN, TAF7, DCK, NCOA1, AKAP8L, CA14, CRSP8, C7orf30, FAM126A, SEC23B, CTBS, BBS12, TRIM32, RAE1, PBEF1, TNFAIP8, C10orf104, PPP2R1B, RNF139, PRDX6, CBX5, ARG2, HOXD8 및 C10orf11로 이루어진 군으로부터 선택된 폴리뉴클레오티드의 단편으로서 18-22개의 연속 뉴클레오티드를 포함하는 하나 이상의 폴리뉴클레오티드; 및 상기 군으로부터 선택된 폴리뉴클레오티드에 상보적인 폴리뉴클레오티드의 단편으로서 18-22개의 연속 뉴클레오티드를 포함하는 하나 이상의 폴리뉴클레오티드를 포함하며, 진단 대상 피부 유래 각질형성세포에서 상기 폴리뉴클레오티드들을 프라이머로 하여 증폭된 DNA 양이 시간경과에 따라 2배 이상 감소하면 각질화 세포로 판단하는 것을 특징으로 하는 각화 이상 피부질환 진단 키트를 제공한다.In addition, the present invention is SEC24D, WASF1, MTFR1, STT3A, CDKN3, EIF2B3, PTPRZ1, TRIM37, GTF2H2, ATM, FST, G3BP2, TETRAN, MDFIC, ALG14, RPS7, OLFM1, RCN2, IGSF3, HS3ST1, ERLIN1 , FHL1, PTGS2, BCAT1, DNAJC10, IBTK, ODC1, OR7E38P, TIMM17A, PLDN, TBPL1, PFAS, TTTY15, FAM91A1, SNRPG, SNRPB2, SLMO2, SCFD1, ATP11C, CYCS, CD9, CKS1B, DPMF, DPMF , PDE4D, HLA-DOB, CSNK1G3, LYSMD3, ADORA2B, SSR1, GALK2, GTF2H3, ZNF410, TXNL2, NUS1, MEF2B, GPD2, AMMECR1L, SLC3A2, MAD2L2, MGAT1, ATP5E, FXL, TAK, AKK, TAK , Fragments of poly22 selected from the group consisting of CRSP8, C7orf30, FAM126A, SEC23B, CTBS, BBS12, TRIM32, RAE1, PBEF1, TNFAIP8, C10orf104, PPP2R1B, RNF139, PRDX6, CBX5, ARG2, HOXD8 and C10orf11 One or more polynucleotides including contiguous nucleotides; And one or more polynucleotides comprising 18-22 contiguous nucleotides as fragments of polynucleotides complementary to the polynucleotides selected from the group, wherein the DNA amplified using the polynucleotides as primers in the skin-derived keratinocytes to be diagnosed. It provides a keratinized skin disease diagnostic kit, characterized in that if the amount is reduced more than two times over time, it is determined as keratinocytes.

본 발명은 Sox9, HSPB1,CEPT1, WRN, CYP3A5, CREG1, KLK8, CSTA, TGM1, SPRR1A, FABP5, LOC728641, BAG3, ADAMTS7, RAB5B, ID3, CBR1, LOC128977, WBP2, SMAP1L, CCNE1, GSN, PIK3C2B, ULK1, FOXD1, ECM1, CLN3, KDELR1, MOBP, PI3, SLPI, GRN, ARPC1A, KLK5, KLK10, GLRX, LCN2, DUSP3, KLK7, TIMP2, RAB11FIP1, SH3KBP1, DDX24, NEU1, CSTB, LOH11CR2A, YPEL2, MMD, MKRN1, HTATIP, IRF6, MYD88, HCFC1R1, PSD4, SEMG1, CDKN1C, COX6B1, JUP, CELSR2, RAI16, PLCD1, ALOX15B, FAT2, SREBF2, ATP8B1, C22orf25, AHCYL1, PARD3, PRPF8, TBC1D9, ANKHD1, SMARCA2 및MAP3K4로 이루어진 군으로부터 선택된 폴리뉴클레오티드의 단편으로서 18-22개의 연속 뉴클레오티드를 포함하는 하나 이상의 폴리뉴클레오티드; 및 상기 군으로부터 선택된 폴리뉴클레오티드에 상보적인 폴리뉴클레오티드의 단편으로서 18-22개의 연속 뉴클레오티드를 포함하는 하나 이상의 폴리뉴클레오티드를 포함하며, 진단 대상 피부 유래 각질형성세포에서 상기 폴리뉴클레오티드들을 프라이머로 하여 증폭된 DNA 양이 시간경과에 따라 2배 이상 증가하면 각질화 세포로 판단하는 것을 특징으로 하는 각화 이상 피부질환 진단 키트를 제공한다.The invention is Sox9, HSPB1, CEPT1, WRN, CYP3A5, CREG1, KLK8, CSTA, TGM1, SPRR1A, FABP5, LOC728641, BAG3, ADAMTS7, RAB5B, ID3, CBR1, LOC128977, WBP2, SMAP1L, CCNEK1, GSN1, GSN , FOXD1, ECM1, CLN3, KDELR1, MOBP, PI3, SLPI, GRN, ARPC1A, KLK5, KLK10, GLRX, LCN2, DUSP3, KLK7, TIMP2, RAB11FIP1, SH3KBP1, ABX24, NEU1, CSTB, LOH11KRN MMD Consisting of, HTATIP, IRF6, MYD88, HCFC1R1, PSD4, SEMG1, CDKN1C, COX6B1, JUP, CELSR2, RAI16, PLCD1, ALOX15B, FAT2, SREBF2, ATP8B1, C22orf25, AHCYL1, PARD3, PRPF9, ANK2D3, AK2MA and TBC2MA At least one polynucleotide comprising 18-22 consecutive nucleotides as a fragment of a polynucleotide selected from the group; And one or more polynucleotides comprising 18-22 contiguous nucleotides as fragments of polynucleotides complementary to the polynucleotides selected from the group, wherein the DNA amplified using the polynucleotides as primers in the skin-derived keratinocytes to be diagnosed. It provides a keratinized skin disease diagnostic kit, characterized in that the amount is increased more than two times over time to determine the keratinocytes.

본 발명은 SEC24D, WASF1, MTFR1, STT3A, CDKN3, EIF2B3, PTPRZ1, TRIM37, GTF2H2, ATM, FST, G3BP2, TETRAN, MDFIC, ALG14, RPS7, OLFM1, RCN2, IGSF3, HS3ST1, ERLIN1, IL1A, SST, FHL1, PTGS2, BCAT1, DNAJC10, IBTK, ODC1, OR7E38P, TIMM17A, PLDN, TBPL1, PFAS, TTTY15, FAM91A1, SNRPG, SNRPB2, SLMO2, SCFD1, ATP11C, CYCS, CD9, CKS1B, DPM1, UQCRQ, CPSF2, RNF41, PDE4D, HLA-DOB, CSNK1G3, LYSMD3, ADORA2B, SSR1, GALK2, GTF2H3, ZNF410, TXNL2, NUS1, MEF2B, GPD2, AMMECR1L, SLC3A2, MAD2L2, MGAT1, ATP5E, FXN, TAF7, DCK, NCOA1, AKAP8L, CA14, CRSP8, C7orf30, FAM126A, SEC23B, CTBS, BBS12, TRIM32, RAE1, PBEF1, TNFAIP8, C10orf104, PPP2R1B, RNF139, PRDX6, CBX5, ARG2, HOXD8 및 C10orf11로 이루어진 군으로부터 선택된 유전자에 의하여 코딩되는 폴리펩티드에 대한 하나 이상의 모노클로날 항체를 포함하며, 진단 대상 피부 유래 각질형성세포에서 상기 항체에 결합된 항원의 양이 시간경과에 따라 2배 이상 감소하면 각질화 세포로 판단하는 것을 특징으로 하는 각화 이상 피부질환 진단 키트를 제공한다.The present invention is SEC24D, WASF1, MTFR1, STT3A, CDKN3, EIF2B3, PTPRZ1, TRIM37, GTF2H2, ATM, FST, G3BP2, TETRAN, MDFIC, ALG14, RPS7, OLFM1, RCN2, IGSF3, HS3ST1, ERLIN1, ILHL , PTGS2, BCAT1, DNAJC10, IBTK, ODC1, OR7E38P, TIMM17A, PLDN, TBPL1, PFAS, TTTY15, FAM91A1, SNRPG, SNRPB2, SLMO2, SCFD1, ATP11C, CYCS, CD9, CKS1B, DPM1, UQCR4, PQD4 , HLA-DOB, CSNK1G3, LYSMD3, ADORA2B, SSR1, GALK2, GTF2H3, ZNF410, TXNL2, NUS1, MEF2B, GPD2, AMMECR1L, SLC3A2, MAD2L2, MGAT1, ATP5E, FXN, TAFCO, DCAK14 , C7orf30, FAM126A, SEC23B, CTBS, BBS12, TRIM32, RAE1, PBEF1, TNFAIP8, C10orf104, PPP2R1B, RNF139, PRDX6, CBX5, ARG2, HOXD8 and C10orf11. It includes a local antibody, and when the amount of antigen bound to the antibody in the skin-derived keratinocytes to be diagnosed decreases more than two times over time, it is determined as keratinocytes. It provides a diagnostic kit for keratinosis skin disease, characterized in that.

본 발명은 Sox9, HSPB1,CEPT1, WRN, CYP3A5, CREG1, KLK8, CSTA, TGM1, SPRR1A, FABP5, LOC728641, BAG3, ADAMTS7, RAB5B, ID3, CBR1, LOC128977, WBP2, SMAP1L, CCNE1, GSN, PIK3C2B, ULK1, FOXD1, ECM1, CLN3, KDELR1, MOBP, PI3, SLPI, GRN, ARPC1A, KLK5, KLK10, GLRX, LCN2, DUSP3, KLK7, TIMP2, RAB11FIP1, SH3KBP1, DDX24, NEU1, CSTB, LOH11CR2A, YPEL2, MMD, MKRN1, HTATIP, IRF6, MYD88, HCFC1R1, PSD4, SEMG1, CDKN1C, COX6B1, JUP, CELSR2, RAI16, PLCD1, ALOX15B, FAT2, SREBF2, ATP8B1, C22orf25, AHCYL1, PARD3, PRPF8, TBC1D9, ANKHD1, SMARCA2 및MAP3K4로 이루어진 군으로부터 선택된 유전자에 의하여 코딩되는 폴리펩티드에 대한 하나 이상의 모노클로날 항체를 포함하며, 진단 대상 피부 유래 각질형성세포에서 상기 항체에 결합된 항원의 양이 시간경과에 따라 2배 이상 증가하면 각질화 세포로 판단하는 것을 특징으로 하는 각화 이상 피부질환 진단 키트를 제공한다.The invention is Sox9, HSPB1, CEPT1, WRN, CYP3A5, CREG1, KLK8, CSTA, TGM1, SPRR1A, FABP5, LOC728641, BAG3, ADAMTS7, RAB5B, ID3, CBR1, LOC128977, WBP2, SMAP1L, CCNEK1, GSN1, GSN , FOXD1, ECM1, CLN3, KDELR1, MOBP, PI3, SLPI, GRN, ARPC1A, KLK5, KLK10, GLRX, LCN2, DUSP3, KLK7, TIMP2, RAB11FIP1, SH3KBP1, ABX24, NEU1, CSTB, LOH11KRN MMD Consisting of, HTATIP, IRF6, MYD88, HCFC1R1, PSD4, SEMG1, CDKN1C, COX6B1, JUP, CELSR2, RAI16, PLCD1, ALOX15B, FAT2, SREBF2, ATP8B1, C22orf25, AHCYL1, PARD3, PRPF9, ANK2D3, AK2MA and TBC2MA At least one monoclonal antibody against a polypeptide encoded by a gene selected from the group, wherein the amount of antigen bound to the antibody in the skin-derived keratinocytes to be diagnosed is increased to the keratinocytes by doubling over time. It provides a diagnostic kit for keratinosis skin disease, characterized in that judging.

또한 본 발명은 각화 이상 피부질환을 진단하는 방법으로서, 진단 대상 각질형성세포 중의 SEC24D, WASF1, MTFR1, STT3A, CDKN3, EIF2B3, PTPRZ1, TRIM37, GTF2H2, ATM, FST, G3BP2, TETRAN, MDFIC, ALG14, RPS7, OLFM1, RCN2, IGSF3, HS3ST1, ERLIN1, IL1A, SST, FHL1, PTGS2, BCAT1, DNAJC10, IBTK, ODC1, OR7E38P, TIMM17A, PLDN, TBPL1, PFAS, TTTY15, FAM91A1, SNRPG, SNRPB2, SLMO2, SCFD1, ATP11C, CYCS, CD9, CKS1B, DPM1, UQCRQ, CPSF2, RNF41, PDE4D, HLA-DOB, CSNK1G3, LYSMD3, ADORA2B, SSR1, GALK2, GTF2H3, ZNF410, TXNL2, NUS1, MEF2B, GPD2, AMMECR1L, SLC3A2, MAD2L2, MGAT1, ATP5E, FXN, TAF7, DCK, NCOA1, AKAP8L, CA14, CRSP8, C7orf30, FAM126A, SEC23B, CTBS, BBS12, TRIM32, RAE1, PBEF1, TNFAIP8, C10orf104, PPP2R1B, RNF139, PRDX6, CBX5, ARG2, HOXD8 및 C10orf11 유전자로 이루어진 군으로부터 선택되는 하나 이상의 유전자의 발현량이 시간경과에 따라 2배 이상 감소하면 각질화 세포로 판단하는 것을 특징으로 하는 각화 이상 피부질환 진단 방법을 제공한다.In addition, the present invention is a method for diagnosing keratinous skin diseases, SEC24D, WASF1, MTFR1, STT3A, CDKN3, EIF2B3, PTPRZ1, TRIM37, GTF2H2, ATM, FST, G3BP2, TETRAN, MDFIC, ALG14, RPS7, OLFM1, RCN2, IGSF3, HS3ST1, ERLIN1, IL1A, SST, FHL1, PTGS2, BCAT1, DNAJC10, IBTK, ODC1, OR7E38P, TIMM17A, PLDN, TBPL1, PFAS, TTTY15, FAM91A1, SCFD, SLFG SL ATP11C, CYCS, CD9, CKS1B, DPM1, UQCRQ, CPSF2, RNF41, PDE4D, HLA-DOB, CSNK1G3, LYSMD3, ADORA2B, SSR1, GALK2, GTF2H3, ZNF410, TXNL2, NUS1, MEF2B2, M2L2, GP2 MGAT1, ATP5E, FXN, TAF7, DCK, NCOA1, AKAP8L, CA14, CRSP8, C7orf30, FAM126A, SEC23B, CTBS, BBS12, TRIM32, RAE1, PBEF1, TNFAIP8, C10orf104, PPP2R1B, RNF139, CXD H8 Keratinocytes, characterized in that if the amount of expression of one or more genes selected from the group consisting of C10orf11 gene is reduced more than two times over time Provide disease diagnosis.

본 발명은 각화 이상 피부질환을 진단하는 방법으로서, 진단 대상 각질형성세포 중의 Sox9, HSPB1,CEPT1, WRN, CYP3A5, CREG1, KLK8, CSTA, TGM1, SPRR1A, FABP5, LOC728641, BAG3, ADAMTS7, RAB5B, ID3, CBR1, LOC128977, WBP2, SMAP1L, CCNE1, GSN, PIK3C2B, ULK1, FOXD1, ECM1, CLN3, KDELR1, MOBP, PI3, SLPI, GRN, ARPC1A, KLK5, KLK10, GLRX, LCN2, DUSP3, KLK7, TIMP2, RAB11FIP1, SH3KBP1, DDX24, NEU1, CSTB, LOH11CR2A, YPEL2, MMD, MKRN1, HTATIP, IRF6, MYD88, HCFC1R1, PSD4, SEMG1, CDKN1C, COX6B1, JUP, CELSR2, RAI16, PLCD1, ALOX15B, FAT2, SREBF2, ATP8B1, C22orf25, AHCYL1, PARD3, PRPF8, TBC1D9, ANKHD1, SMARCA2 및MAP3K4 유전자로 이루어진 군으로부터 선택되는 하나 이상의 유전자의 발현량이 시간경과에 따라 2배 이상 증가하면 각질화 세포로 판단하는 것을 특징으로 하는 각화 이상 피부질환 진단 방법을 제공한다. The present invention is a method for diagnosing keratinous abnormal skin diseases, Sox9, HSPB1, CEPT1, WRN, CYP3A5, CREG1, KLK8, CSTA, TGM1, SPRR1A, FABP5, LOC728641, BAG3, ADAMTS7, RAB5B, ID3 , CBR1, LOC128977, WBP2, SMAP1L, CCNE1, GSN, PIK3C2B, ULK1, FOXD1, ECM1, CLN3, KDELR1, MOBP, PI3, SLPI, GRN, ARPC1A, KLK5, KLK10, GLRX, LCN2, DUSP3, KLK7 , SH3KBP1, DDX24, NEU1, CSTB, LOH11CR2A, YPEL2, MMD, MKRN1, HTATIP, IRF6, MYD88, HCFC1R1, PSD4, SEMG1, CDKN1C, COX6B1, JUP, CELSR2, RAI16, PLCD1, ALOXTPBB2, ALOXTPB , AHCYL1, PARD3, PRPF8, TBC1D9, ANKHD1, SMARCA2 and MAP3K4 gene expression of at least one gene selected from the group of keratinocytes, characterized in that the increase in the expression of keratinocytes over time Provide a method.

본 발명의 각화 이상 피부질환 진단 방법에 있어서, 상기 각화 이상 피부질환 진단 방법은 노던블로팅(Northern Blot analysis), 역전사중합효소연쇄반응(reverse transcriptase polymerase chain reaction), 웨스턴블로팅(Western blot analysis) 및 엘라이자 (ELISA) 로 구성된 군으로부터 선택되는 하나 이상의 방법을 사용하여 유전자의 발현량을 측정하는 것을 특징으로 한다.In the method for diagnosing keratinous aberrant skin disease of the present invention, the method for diagnosing keratinous aberrant skin disease is Northern Blot analysis, reverse transcriptase polymerase chain reaction, Western blot analysis. And ELISA, characterized in that the expression level of the gene is measured using at least one method selected from the group consisting of.

본 발명은 이상 분화 방지제의 스크리닝 방법으로서, SEC24D, WASF1, MTFR1, STT3A, CDKN3, EIF2B3, PTPRZ1, TRIM37, GTF2H2, ATM, FST, G3BP2, TETRAN, MDFIC, ALG14, RPS7, OLFM1, RCN2, IGSF3, HS3ST1, ERLIN1, IL1A, SST, FHL1, PTGS2, BCAT1, DNAJC10, IBTK, ODC1, OR7E38P, TIMM17A, PLDN, TBPL1, PFAS, TTTY15, FAM91A1, SNRPG, SNRPB2, SLMO2, SCFD1, ATP11C, CYCS, CD9, CKS1B, DPM1, UQCRQ, CPSF2, RNF41, PDE4D, HLA-DOB, CSNK1G3, LYSMD3, ADORA2B, SSR1, GALK2, GTF2H3, ZNF410, TXNL2, NUS1, MEF2B, GPD2, AMMECR1L, SLC3A2, MAD2L2, MGAT1, ATP5E, FXN, TAF7, DCK, NCOA1, AKAP8L, CA14, CRSP8, C7orf30, FAM126A, SEC23B, CTBS, BBS12, TRIM32, RAE1, PBEF1, TNFAIP8, C10orf104, PPP2R1B, RNF139, PRDX6, CBX5, ARG2, HOXD8 및 C10orf11 로 이루어진 군으로부터 선택되는 하나 이상의 유전자에 의하여 코딩되는 단백질에 시험 화합물을 결합시키는 단계; 및 상기 시험 화합물이 상기 단백질의 작용을 촉진하는지를 확인하는 단계를 포함하는 것을 특징으로 하는 이상 분화 방지제 스크리닝 방법을 제공한다.The present invention is a screening method of an anti-differentiation agent, SEC24D, WASF1, MTFR1, STT3A, CDKN3, EIF2B3, PTPRZ1, TRIM37, GTF2H2, ATM, FST, G3BP2, TETRAN, MDFIC, ALG14, RPS7, OLFMST1, RCN2, IGSF3 , ERLIN1, IL1A, SST, FHL1, PTGS2, BCAT1, DNAJC10, IBTK, ODC1, OR7E38P, TIMM17A, PLDN, TBPL1, PFAS, TTTY15, FAM91A1, SNRPG, SNRPB2, SLMO2, SCFD1, ATPB, CYCS1, CYCS , UQCRQ, CPSF2, RNF41, PDE4D, HLA-DOB, CSNK1G3, LYSMD3, ADORA2B, SSR1, GALK2, GTF2H3, ZNF410, TXNL2, NUS1, MEF2B, GPD2, AMMECR1L, SLC3A2, MFAT FX, TA , Consisting of NCOA1, AKAP8L, CA14, CRSP8, C7orf30, FAM126A, SEC23B, CTBS, BBS12, TRIM32, RAE1, PBEF1, TNFAIP8, C10orf104, PPP2R1B, RNF139, PRDX6, CBX5, ARG2, Horf11, and HOXf11 Binding the test compound to the protein encoded by the gene; And identifying whether the test compound promotes the action of the protein.

본 발명은 이상 분화 방지제의 스크리닝 방법으로서, Sox9, HSPB1, CEPT1, WRN, CYP3A5, CREG1, KLK8, CSTA, TGM1, SPRR1A, FABP5, LOC728641, BAG3, ADAMTS7, RAB5B, ID3, CBR1, LOC128977, WBP2, SMAP1L, CCNE1, GSN, PIK3C2B, ULK1, FOXD1, ECM1, CLN3, KDELR1, MOBP, PI3, SLPI, GRN, ARPC1A, KLK5, KLK10, GLRX, LCN2, DUSP3, KLK7, TIMP2, RAB11FIP1, SH3KBP1, DDX24, NEU1, CSTB, LOH11CR2A, YPEL2, MMD, MKRN1, HTATIP, IRF6, MYD88, HCFC1R1, PSD4, SEMG1, CDKN1C, COX6B1, JUP, CELSR2, RAI16, PLCD1, ALOX15B, FAT2, SREBF2, ATP8B1, C22orf25, AHCYL1, PARD3, PRPF8, TBC1D9, ANKHD1, SMARCA2 및 MAP3K4로 이루어진 군으로부터 선택되는 하나 이상의 유전자에 의하여 코딩되는 단백질에 시험 화합물을 결합시키는 단계; 및 상기 시험 화합물이 상기 단백질의 작용을 억제하는지를 확인하는 단계를 포함하는 것을 특징으로 하는 이상 분화 방지제 스크리닝 방법을 제공한다.The present invention is a screening method for the anti-differentiation agent, Sox9, HSPB1, CEPT1, WRN, CYP3A5, CREG1, KLK8, CSTA, TGM1, SPRR1A, FABP5, LOC728641, BAG3, ADAMTS7, RAB5B, ID3, CBR1, LOC1289AP, WL2, , CCNE1, GSN, PIK3C2B, ULK1, FOXD1, ECM1, CLN3, KDELR1, MOBP, PI3, SLPI, GRN, ARPC1A, KLK5, KLK10, GLRX, LCN2, DUSP3, KLK7, TIMP2, RAB11FIP1, SH3KBTBPEU, , LOH11CR2A, YPEL2, MMD, MKRN1, HTATIP, IRF6, MYD88, HCFC1R1, PSD4, SEMG1, CDKN1C, COX6B1, JUP, CELSR2, RAI16, PLCD1, ALOX15B, FAT2, SREBF2, ATP1B2, CBC Binding the test compound to a protein encoded by at least one gene selected from the group consisting of ANKHD1, SMARCA2 and MAP3K4; And confirming whether the test compound inhibits the action of the protein.

또한, 본 발명은 각질형성세포 이상 분화 방지제를 스크리닝하는 방법으로서, Nrf-2, Nkx-2.5, AP-1, MEIS1A/HOXA9, MEIS1B/HOXA9, CREB, ISRE-BP, Hand1/E47, Pax-6, c-Myb, v-Maf, Elk-1, E47, CRE-BP1, IRF-1, IRF-2, c-Rel, c-Ets-1(p54), USF, VBP, Hox-1.3, Brn-2, COMP1-factor, CDP_CR1, CP2 및 NF-kB (p50) 로 이루어진 군으로부터 선택된 유전자 및 유니버설(universal) 프로모터를 포함하는 플라스미드, 및 상기 선택된 유전자에 의해 코딩되는 전사인자가 결합하는 DNA서열 및 리포터 유전자를 포함하는 플라스미드를 세포에 트랜스펙션시키는 단계; 상기 세포에 시험 화합물을 처리하는 단계; 및 상기 시험 화합물이 상기리포터 유전자의 발현을 촉진하는지 여부를 확인하는 단계를 포함하는 것을 특징으로 하는각질형성세포 이상 분화 방지제 스크리닝 방법을 제공한다. 본 발명의 각질형성세포 이상 분화 방지제 스크리닝 방법에 있어서, 상기 선택된 유전자는 Pax-6또는 Nkx-2.5이고, 상기 각질형성세포 이상 분화방지제는 건선 치료제인 것을 특징으로 한다.In addition, the present invention is a method for screening keratinocyte aberrant differentiation inhibitor, Nrf-2, Nkx-2.5, AP-1, MEIS1A / HOXA9, MEIS1B / HOXA9, CREB, ISRE-BP, Hand1 / E47, Pax-6 , c-Myb, v-Maf, Elk-1, E47, CRE-BP1, IRF-1, IRF-2, c-Rel, c-Ets-1 (p54), USF, VBP, Hox-1.3, Brn- 2, a plasmid comprising a universal promoter and a gene selected from the group consisting of COMP1-factor, CDP_CR1, CP2 and NF-kB (p50), and a DNA sequence and reporter to which the transcription factor encoded by the selected gene binds Transfecting the cells with the plasmid containing the gene; Treating the cell with a test compound; And it provides a method for screening keratinocyte abnormality differentiation inhibitor comprising the step of confirming whether the test compound promotes the expression of the reporter gene. In the method for screening a keratinocyte abnormality differentiation inhibitor of the present invention, the selected gene is Pax-6 or Nkx-2.5, and the keratinocyte abnormality differentiation agent is a psoriasis treatment.

본 발명에 따르면 각질형성세포 분화 과정에 따라 발현이 증가되는 76종의 유전자 및 발현이 감소되는 92종의 유전자, 이들 유전자의 프로모터 영역에 존재하는 전사인자 결합 부위로부터 생물정보학 기술을 이용해 추출한 전사 조절인자 31종을 각화 이상 피부질환의 진단 마커 유전자로 이용하여 각화 이상 피부질환을 빠르게 진단하고 각질형성세포 이상 분화 방지제를 스크리닝할 수 있다. 또한 이들 유전자를 각화 이상 피부 질환 치료제를 개발하는 유전자 타겟으로 활용하고, 개발된 각화 이상 피부 질환 치료제를 평가하는 방법으로 활용할 수 있다.According to the present invention, transcriptional regulation extracted by bioinformatics technology from 76 genes with increased expression and 92 genes with reduced expression and transcription factor binding sites present in the promoter region of these genes according to keratinocyte differentiation. 31 factors can be used as diagnostic marker genes for keratinous aberrant skin diseases to quickly diagnose keratinous aberrant skin diseases and screen for keratinocyte dysplasia. In addition, these genes can be used as a gene target for developing a therapeutic agent for keratinous skin diseases, and can be used as a method for evaluating the developed therapeutic agents for keratinous skin diseases.

이하 본 발명을 더욱 상세하게 설명한다.Hereinafter, the present invention will be described in more detail.

피부의 각질형성세포는 피부장벽 기능을 획득하기 위해 기저막으로부터 상층부로 이동하면서 각질형성세포 분화과정을 거친다. 본 발명자들은 그 과정에서 나타나는 유전자 발현 변화를 관찰한 결과, 분화과정에서 발현이 증가되는 76종의 유전자 및 발현이 감소되는 92종의 유전자, 이들 유전자의 프로모터 영역에 존재하는 전사인자 결합 부위로부터 생물정보학 기술을 이용해 추출한 전사 조절인자 31종을 찾아내었다. 상기 찾아낸 유전자 중 각질형성세포와 관련이 있는 것으로 아직 밝혀 지지 않은 유전자 및 발현 정보가 없는 유전자의 경우, 5'RACE와 3'RACE 또는 cDNA 라이브러리 스크리닝 (library screening)을 통해 각 유전자의 전장 cDNA의 서열을 확인할 수 있다.The keratinocytes of the skin undergo keratinocyte differentiation as they move from the basement membrane to the upper layer to obtain skin barrier function. As a result of observing the gene expression changes appearing in the process, the inventors found that 76 genes with increased expression during differentiation, 92 genes with reduced expression, and a transcription factor binding site present in the promoter region of these genes were identified. Thirty-one transcriptional regulators were extracted using information technology. For those genes that have not yet been found to be related to keratinocytes and genes that do not have expression information, the sequence of full-length cDNA of each gene is determined by 5'RACE and 3'RACE or cDNA library screening. can confirm.

본 발명은 상기 유전자를 각화 이상 피부질환의 진단 마커 유전자로 이용하여, 각화 이상 피부질환을 빠르게 진단할 수 있는 진단 키트 및 진단 방법을 제공하고자 한다.The present invention is to provide a diagnostic kit and diagnostic method for quickly diagnosing keratinized skin diseases by using the gene as a diagnostic marker gene for keratinized skin diseases.

본 발명의 진단 키트에서 프로브로 사용되는 폴리뉴클레오티드는 발현이 증가하거나 감소하는 분화 마커 유전자의 전장(full length) 또는 그의 단편을 포함한다. 단편의 길이는 10개 이상의 연속 뉴클레오티드를 포함하는 것이 바람직한데, 이는 프로브의 길이가 10bps이하이면 비특이적으로 결합되기 때문이다.Polynucleotides used as probes in the diagnostic kits of the invention include full length or fragments of differentiation marker genes with increased or decreased expression. The length of the fragment preferably includes 10 or more contiguous nucleotides, since non-specifically bound probes of 10 bps or less.

본 발명의 진단 키트에서 프라이머로 사용되는 폴리뉴클레오티드는 그 길이가 18-22개인 것이 바람직하다. 이는 프라이머의 길이가 18bps미만이면 비특이적으로 결합되고, 22bps를 초과하면 프라이머끼리 자체 결합하여 효율성이 떨어지며, 제작시에도 비용과 기술적인 면에서 비생산적이기 때문이다. The polynucleotide used as a primer in the diagnostic kit of the present invention is preferably 18-22 in length. This is because if the length of the primer is less than 18bps non-specific binding, if it exceeds 22bps, the primers are self-combining with each other, the efficiency is lowered, and even in production, it is unproductive in terms of cost and technical.

본 발명의 진단 키트에 포함된, 분화 마커 유전자에 의하여 코딩되는 폴리펩티드에 대한 모노클로날 항체는 일반적인 모노클로날 항체 제조방법으로 제조된다.Monoclonal antibodies to the polypeptides encoded by the differentiation marker genes included in the diagnostic kits of the present invention are prepared by a general monoclonal antibody production method.

또한 상기 발현 패턴이 변화하는 유전자들의 프로모터에서 과다 관찰되는 전사인자 결합 부위로부터 생물정보학 기술을 이용해 추출한 전사인자인 Nrf-2, Nkx-2.5, AP-1, MEIS1A/HOXA9, MEIS1B/HOXA9, CREB, ISRE-BP, Hand1/E47, Pax-6, c-Myb, v-Maf, Elk-1, E47, CRE-BP1, IRF-1, IRF-2, c-Rel, c-Ets-1(p54), USF, VBP, Hox-1.3, Brn-2, COMP1-factor, CDP_CR1, CP2 또는 NF-kB (p50) 의 활성을 측정하여 각질형성세포 이상 분화 방지제를 스크리닝하는 리포터 유전자 분석(assay)법은 일반적인 분자생물학 기법에 의해 제조된 리포터 유전자 벡터를 이용한다. 구체적으로는 일반적인 배양 조건에서도 발현되는 유니버설(universal) 프로모터에 Nrf-2, Nkx-2.5, AP-1, MEIS1A/HOXA9, MEIS1B/HOXA9, CREB, ISRE-BP, Hand1/E47, Pax-6, c-Myb, v-Maf, Elk-1, E47, CRE-BP1, IRF-1, IRF-2, c-Rel, c-Ets-1(p54), USF, VBP, Hox-1.3, Brn-2, COMP1-factor, CDP_CR1, CP2 또는 NF-kB (p50) 유전자가 결합된 플라스미드(플라스미드 1), 및 상기 전사인자들이 결합하여 전사를 활성화시킬 수 있는 DNA 서열인 TRE (Transcription Response Element)를 가지는 프로모터에 리포터 역할을 하는 반딧불(firefly) 루시퍼라제(luciferase) 유전자가 결합된 플라스미드(플라스미드 2)를 사용한다. 플라스미드 2의 TRE 부분은, MatInspector (Quandt et al., 1995) 및 Transfac (Knuppel et al., 1994)과 같은, 모티프(motif)를 예측, 발견, 분석하는프로그램에 대상 유전자들의 accession ID를 입력하여 TRE 서열을 검색한 후 검색된 서열에 따라 올리고뉴클레오타이드 합성법으로 합성하여 준비한다. 플라스미드 1의 전사인자 유전자 부분은, 미국 NCBI 데이터베이스에 저장된 cDNA 서열을 참고하여, 인간 cDNA 라이브러리로부터 PCR 기법으로 증폭하여 준비한다. COS7 세포에 상기 전사인자 유전자를 지닌 플라스미드 1과 해당 TRE 프로모터-리포터 플라스미드 2를 동시에 트랜스펙션시킨 후 24시간 경과 시점에 각질형성세포 이상 분화 방지제 후보 약물을 처리하고 세포를 수확하여 루시퍼라제 활성을 측정하면, 각질형성세포 이상 분화 방지제 후보 약물이 상기 전사인 자의 활성에 미치는 영향을 확인할 수 있다. In addition, transcription factors Nrf-2, Nkx-2.5, AP-1, MEIS1A / HOXA9, MEIS1B / HOXA9, CREB, which are extracted by bioinformatics techniques from transcription factor binding sites that are excessively observed in the promoters of genes whose expression patterns are changed. ISRE-BP, Hand1 / E47, Pax-6, c-Myb, v-Maf, Elk-1, E47, CRE-BP1, IRF-1, IRF-2, c-Rel, c-Ets-1 (p54) Reporter gene assays that screen for keratinocyte aberrant differentiation inhibitors by measuring activity of USF, VBP, Hox-1.3, Brn-2, COMP1-factor, CDP_CR1, CP2, or NF-kB (p50) are common. Reporter gene vectors prepared by molecular biology techniques are used. Specifically, universal promoters expressed in general culture conditions include Nrf-2, Nkx-2.5, AP-1, MEIS1A / HOXA9, MEIS1B / HOXA9, CREB, ISRE-BP, Hand1 / E47, Pax-6, c. Myb, v-Maf, Elk-1, E47, CRE-BP1, IRF-1, IRF-2, c-Rel, c-Ets-1 (p54), USF, VBP, Hox-1.3, Brn-2, To a promoter having a plasmid (Plasmid 1) to which a COMP1-factor, CDP_CR1, CP2 or NF-kB (p50) gene is bound, and a Transcription Response Element (TRE), a DNA sequence to which the transcription factors bind to activate transcription A plasmid (plasmid 2) to which a firefly luciferase gene serving as a reporter is bound is used. The TRE portion of plasmid 2 is obtained by entering the accession IDs of the genes of interest in a program that predicts, discovers, and analyzes motifs, such as MatInspector (Quandt et al., 1995) and Transfac (Knuppel et al., 1994). After searching for the TRE sequence, the oligonucleotide synthesis method according to the retrieved sequence is prepared. The transcription factor gene portion of plasmid 1 is prepared by amplification by PCR technique from a human cDNA library with reference to the cDNA sequence stored in the US NCBI database. After transfection of the plasmid 1 carrying the transcription factor gene and the corresponding TRE promoter-reporter plasmid 2 into COS7 cells at the same time, treatment with a keratinocyte apoptosis inhibitor candidate drug and harvesting the cells were performed for luciferase activity. By measuring, the effect of the keratinocyte aberration differentiation inhibitor candidate drug on the activity of the transcription factor can be confirmed.

이하 본 발명을 하기 실시예에 의거하여 더욱 상세하게 설명하는 바, 이들 실시예로 본 발명의 기술적 범위가 한정되는 것은 아니다.Hereinafter, the present invention will be described in more detail with reference to the following examples, which are not intended to limit the technical scope of the present invention.

<실시예 1. 피부 각질형성세포로부터 총RNA분리>Example 1 Total RNA Separation from Skin Keratinocytes

사람의 피부조직을 0.1% 디스페이즈 (dispase, GIBCO) 용액에 침적 시키고 4℃ 에서 12-16 시간 정도 처리한 후 표피와 진피를 미세한 핀셋을 이용하여 분리 하였다. 표피 층 만을 회수 하여 0.2% 트립신 (trypsin, GIBCO) 용액에 침적하여 5분간 처리한 후 피페팅 (pipetting)을 이용하여 단일세포로 분리하였다. 이를 5분간 1,500 rpm에서 원심분리하고 상청액을 제거한 후 각질형성세포 배양배지(keratinocyte growth medium, GIBCO)를 이용하여 부유시킨 후 배양접시에 접종하였다. 칼슘을 최종농도 1.2 mM이 되도록 처리하고 시간 별로 세포를 회수한 후 Easy blue (Intron) 용액을 이용하여 총RNA를 분리 하였다. Human skin tissue was immersed in 0.1% dispase (GIBCO) solution and treated for 12-16 hours at 4 ° C. The epidermis and dermis were separated using fine tweezers. Only the epidermal layer was recovered, soaked in 0.2% trypsin (GIBCO) solution, treated for 5 minutes, and then separated into single cells by pipetting. This was centrifuged at 1,500 rpm for 5 minutes, the supernatant was removed, suspended in keratinocyte growth medium (GIBCO), and then inoculated in a culture dish. Calcium was treated to a final concentration of 1.2 mM and cells were recovered by time, and total RNA was isolated using Easy blue (Intron) solution.

<실시예2. cDNA 마이크로어레이를 이용한 각질형성세포 분화 관련 유전자의 동정><Example 2. Identification of genes related to keratinocyte differentiation using cDNA microarray>

본 발명에서는 Genomic tree 사의 2.7 K cDNA마이크로어레이를 사용하였다. 우선, 100 μg의 상기 총RNA를 Cy3및 Cy5 형광물질 존재 하에서 역전사 하는데, GIBCO사에서 구매한Superscript cDNA system을 이용하였다. 총 RNA 로는 각질형성세포 분화를 시간경과에 따라 분석하기 위하여 칼슘 미처리군 (0일), 칼슘처리 후 1일, 3일, 7일, 14일에 회수한 총RNA를 사용 하였다. 대조군으로 0일차의 총RNA는 Cy3(초록색) 형광물질 하에서 역전사하여 프로브를 만들었으며, 각각 1일, 3일, 7 일, 14일차에 추출한 총RNA는 Cy5(빨간색) 형광물질 하에서 역전사 하여 프로브를 만들었다. In the present invention, 2.7 K cDNA microarray of Genomic tree was used. First, 100 μg of the total RNA was reverse transcribed in the presence of Cy3 and Cy5 fluorescent materials, using a Superscript cDNA system purchased from GIBCO. As total RNA, total RNA recovered on the untreated calcium group (day 0), 1, 3, 7, and 14 days after calcium treatment was used to analyze keratinocyte differentiation over time. As a control, the total RNA of day 0 was reverse-transcribed under Cy3 (green) fluorescent material, and the total RNA extracted at day 1, 3, 7, and 14, respectively, was reverse transcribed under Cy5 (red) fluorescent material. made.

그 후, 유전자 차등발현을 확인하기 위하여 혼성화를 수행하였으며, 이때 동량의 Cy3 및Cy5로 표지된 상기 역전사 반응물(프로브)에 40 μl의 혼성화 (hybridization) 용액 (5×SSC 0.1% SDS 20 μg 의 Cot-1 DNA (Gibco BRL, Rockville, MD) 20 μg 의 poly A RNA (Promega, Madison, WI) 20 μg 의 이스트 tRNA (Gibco BRL, Rockville, MD))을 첨가하여 녹인 후 95℃에서 3분간 반응시켜 이중가닥 DNA를 단일가닥으로 분리하고 마이크로어레이 슬라이드 위에서 혼성화 반응을 수행하였다. 혼성화 조건은 42℃에서 16시간 수행하였으며, 반응 후 슬라이드를 0.1% SSC, 0.1% SDS로 3회 세척하고, 최종적으로 증류수로 1회 더 세척 후 건조시키고 데이터 분석을 위해 스캐닝을 실시하였다. 재현성 평가 및 더욱 정확한 각질형성세포분화 관련 유전자의 동정을 위하여 실험은 각기 다른 배치 (batch)의 각질형성세포를 사용하여 3회 반복 하였다. Hybridization was then performed to confirm gene differential expression, wherein 40 μl of hybridization solution (5 × SSC 0.1% SDS 20 μg Cot) was added to the reverse transcription reaction (probe) labeled with the same amount of Cy3 and Cy5. -1 DNA (Gibco BRL, Rockville, MD) 20 μg of poly A RNA (Promega, Madison, WI) 20 μg of yeast tRNA (Gibco BRL, Rockville, MD) was added to dissolve and reacted at 95 ° C for 3 minutes. Double stranded DNA was separated into single strands and hybridization was performed on a microarray slide. Hybridization conditions were carried out at 42 ° C. for 16 hours. After the reaction, the slides were washed three times with 0.1% SSC, 0.1% SDS, finally washed once more with distilled water, dried and scanned for data analysis. The experiment was repeated three times using different batches of keratinocytes for reproducibility evaluation and more precise identification of genes related to keratinocyte differentiation.

<실시예 3. 각질형성세포 분화관련 유전자의 발현양상 분석><Example 3. Analysis of expression patterns of keratinocyte differentiation-related genes>

상기 마이크로어레이에서의 혼성화 반응 결과는 도 1에 나타나 있다. 상기 마이크로어레이 결과 데이터를 GenePix 4000B (Axon) 스캐너로 스캐닝하고 GenePix pro 3.0 software (Axon)을 이용하여 분석하였는데, 혼성화 시그날이 50 이하로 나온 실험군은 데이터 분석 전에 모두 제거 하였다. 그리고 각각의 혼성화 스폿 (hybridization spot)에 대하여 백그라운드 값을 빼고 global median normalization 방법 (Yang et al, Nucleic Acids Res 2002;30:e15)으로 평준화 하 였다. Cy5와 Cy3 사이의 강도 비율에 따라 유전자 발현값(gene expression value, GEV)을 할당하였고 유전자 발현의 증감은 폴드비 (fold ratio)로 표시하였다. 통계 결과 유의미한 발현 변화를 보인 199 개 유전자를 대상으로 히어라키알 클러스터링 (hierachial clustering)을 수행하고, 이러한 분석 결과, 총 4개의 시간 포인트 (1일, 3일, 7일, 14일) 중 한 번의 시간 포인트에서라도 유전자 발현 변화가 2배 이상 증가 또는 감소하는 유전자를 선별하였으며, 동정된 각질형성세포분화 관련 유전자의 시간경과에 따른 발현 변화를 도 2 및 도 3에 나타내었다. 하기 표 1 에는 각질형성세포의 분화 과정 동안 발현이 감소하는 유전자 리스트, 표 2에는 각질형성세포의 분화 과정 동안 발현이 증가하는 유전자 리스트를 나타내었다. GBAcc는 NCBI의 genebank accession ID를 의미하고, symbol은 공식 유전자 심볼을 의미한다.Hybridization results in the microarray are shown in FIG. 1. The microarray result data was scanned with a GenePix 4000B (Axon) scanner and analyzed using GenePix pro 3.0 software (Axon). All experimental groups with hybridization signals below 50 were removed before data analysis. For each hybridization spot, the background value was subtracted and equalized by global median normalization method (Yang et al, Nucleic Acids Res 2002; 30: e15). Gene expression values (GEVs) were assigned according to the intensity ratio between Cy5 and Cy3, and the increase and decrease of gene expression was expressed in fold ratios. Statistical results show that hierachial clustering is performed on 199 genes with significant expression changes, and this analysis shows that one of four time points (1 day, 3 days, 7 days, 14 days) Genes whose gene expression changes were increased or decreased more than two times even at time points were selected, and the expression changes over time of the identified keratinocyte differentiation-related genes are shown in FIGS. 2 and 3. Table 1 shows a list of genes whose expression decreases during differentiation of keratinocytes, and Table 2 shows a list of genes whose expression increases during differentiation of keratinocytes. GBAcc refers to the NCBI genebank accession ID, and symbol refers to the official gene symbol.

GBAccGBAcc SymbolSymbol 유전자 이름 Gene name AA449107AA449107 SEC24DSEC24D SEC24 related gene family, member D (S. cerevisiae)SEC24 related gene family, member D (S. cerevisiae) R56096R56096 WASF1WASF1 WAS protein family, member 1WAS protein family, member 1 AA459109AA459109 MTFR1MTFR1 Mitochondrial fission regulator 1Mitochondrial fission regulator 1 R68805R68805 STT3ASTT3A STT3, subunit of the oligosaccharyltransferase complex, homolog A (S. cerevisiae)STT3, subunit of the oligosaccharyltransferase complex, homolog A (S. cerevisiae) AA284072AA284072 CDKN3CDKN3 Cyclin-dependent kinase inhibitor 3 (CDK2-associated dual specificity phosphatase)Cyclin-dependent kinase inhibitor 3 (CDK2-associated dual specificity phosphatase) W58368W58368 EIF2B3EIF2B3 Eukaryotic translation initiation factor 2B, subunit 3 gamma, 58kDaEukaryotic translation initiation factor 2B, subunit 3 gamma, 58kDa AA476461AA476461 PTPRZ1PTPRZ1 Protein tyrosine phosphatase, receptor-type, Z polypeptide 1Protein tyrosine phosphatase, receptor-type, Z polypeptide 1 AA875957AA875957 TRIM37TRIM37 Tripartite motif-containing 37Tripartite motif-containing 37 W72437W72437 GTF2H2GTF2H2 General transcription factor IIH, polypeptide 2, 44kDaGeneral transcription factor IIH, polypeptide 2, 44kDa AA016254AA016254 ATMATM Ataxia telangiectasia mutated (includes complementation groups A, C and D)Ataxia telangiectasia mutated (includes complementation groups A, C and D) AI214697AI214697 FSTFST FollistatinFollistatin AA701860AA701860 FSTFST FollistatinFollistatin AW058594AW058594 G3BP2G3BP2 GTPase activating protein (SH3 domain) binding protein 2GTPase activating protein (SH3 domain) binding protein 2 AA291773AA291773 TETRANTETRAN Tetracycline transporter-like proteinTetracycline transporter-like protein AI769827AI769827 MDFICMDFIC MyoD family inhibitor domain containingMyoD family inhibitor domain containing AA962236AA962236 ALG14ALG14 Asparagine-linked glycosylation 14 homolog (S. cerevisiae)Asparagine-linked glycosylation 14 homolog (S. cerevisiae) AW005693AW005693 RPS7RPS7 Ribosomal protein S7Ribosomal protein S7 AW005795AW005795 OLFM1OLFM1 Olfactomedin 1Olfactomedin 1 AA598676AA598676 RCN2RCN2 Reticulocalbin 2, EF-hand calcium binding domainReticulocalbin 2, EF-hand calcium binding domain AI002566AI002566 IGSF3IGSF3 Immunoglobulin superfamily, member 3Immunoglobulin superfamily, member 3 T55714T55714 HS3ST1HS3ST1 Heparan sulfate (glucosamine) 3-O-sulfotransferase 1Heparan sulfate (glucosamine) 3-O-sulfotransferase 1 N74700N74700 ERLIN1ERLIN1 ER lipid raft associated 1ER lipid raft associated 1 AA936768AA936768 IL1AIL1A Interleukin 1, alphaInterleukin 1, alpha R51912R51912 SSTSST SomatostatinSomatostatin AA455925AA455925 FHL1FHL1 Four and a half LIM domains 1Four and a half LIM domains 1 AA644211AA644211 PTGS2PTGS2 Prostaglandin-endoperoxide synthase 2 (prostaglandin G/H synthase and cyclooxygenase)Prostaglandin-endoperoxide synthase 2 (prostaglandin G / H synthase and cyclooxygenase) AA865590AA865590 BCAT1BCAT1 Branched chain aminotransferase 1, cytosolicBranched chain aminotransferase 1, cytosolic AA504844AA504844 DNAJC10DNAJC10 DnaJ (Hsp40) homolog, subfamily C, member 10DnaJ (Hsp40) homolog, subfamily C, member 10 AI140997AI140997 IBTKIBTK Inhibitor of Bruton agammaglobulinemia tyrosine kinaseInhibitor of Bruton agammaglobulinemia tyrosine kinase AA461467AA461467 ODC1ODC1 Ornithine decarboxylase 1Ornithine decarboxylase 1 AA974112AA974112 OR7E38POR7E38P Olfactory receptor, family 7, subfamily E, member 38 pseudogeneOlfactory receptor, family 7, subfamily E, member 38 pseudogene AA708446AA708446 TIMM17ATIMM17A Translocase of inner mitochondrial membrane 17 homolog A (yeast)Translocase of inner mitochondrial membrane 17 homolog A (yeast) N67702N67702 PLDNPLDN Pallidin homolog (mouse)Pallidin homolog (mouse) AA448001AA448001 TBPL1TBPL1 TBP-like 1TBP-like 1 AI651080AI651080 PFASPFAS Phosphoribosylformylglycinamidine synthase (FGAR amidotransferase)Phosphoribosylformylglycinamidine synthase (FGAR amidotransferase) AI580306AI580306 TTTY15TTTY15 Testis-specific transcript, Y-linked 15Testis-specific transcript, Y-linked 15 AI273738AI273738 FAM91A1FAM91A1 Family with sequence similarity 91, member A1Family with sequence similarity 91, member A1 AA133577AA133577 SNRPGSNRPG Small nuclear ribonucleoprotein polypeptide GSmall nuclear ribonucleoprotein polypeptide G AA521249AA521249 SNRPB2SNRPB2 Small nuclear ribonucleoprotein polypeptide B''Small nuclear ribonucleoprotein polypeptide B '' AA488433AA488433 SLMO2SLMO2 Slowmo homolog 2 (Drosophila)Slowmo homolog 2 (Drosophila) AA027992AA027992 SCFD1SCFD1 Sec1 family domain containing 1Sec1 family domain containing 1 AI261566AI261566 ATP11CATP11C ATPase, Class VI, type 11CATPase, Class VI, type 11C R52654R52654 CYCSCYCS Cytochrome c, somaticCytochrome c, somatic AA412053AA412053 CD9CD9 CD9 moleculeCD9 molecule AA459292AA459292 CKS1BCKS1B CDC28 protein kinase regulatory subunit 1BCDC28 protein kinase regulatory subunit 1B AA004759AA004759 DPM1DPM1 Dolichyl-phosphate mannosyltransferase polypeptide 1, catalytic subunitDolichyl-phosphate mannosyltransferase polypeptide 1, catalytic subunit AA133191AA133191 UQCRQUQCRQ Ubiquinol-cytochrome c reductase, complex III subunit VII, 9.5kDaUbiquinol-cytochrome c reductase, complex III subunit VII, 9.5 kDa N69466N69466 CPSF2CPSF2 Cleavage and polyadenylation specific factor 2, 100kDaCleavage and polyadenylation specific factor 2, 100 kDa AI299601AI299601 RNF41RNF41 Ring finger protein 41Ring finger protein 41 AA878635AA878635 PDE4DPDE4D Phosphodiesterase 4D, cAMP-specific (phosphodiesterase E3 dunce homolog, Drosophila)Phosphodiesterase 4D, cAMP-specific (phosphodiesterase E3 dunce homolog, Drosophila) AA158396AA158396 HLA-DOBHLA-DOB Major histocompatibility complex, class II, DO betaMajor histocompatibility complex, class II, DO beta AA398116AA398116 CSNK1G3CSNK1G3 Casein kinase 1, gamma 3Casein kinase 1, gamma 3 AA902494AA902494 LYSMD3LYSMD3 LysM, putative peptidoglycan-binding, domain containing 3LysM, putative peptidoglycan-binding, domain containing 3 AA055350AA055350 ADORA2BADORA2B Adenosine A2b receptorAdenosine A2b receptor AA450360AA450360 SSR1SSR1 Signal sequence receptor, alpha (translocon-associated protein alpha)Signal sequence receptor, alpha (translocon-associated protein alpha) AI887515AI887515 GALK2GALK2 Galactokinase 2Galactokinase 2 AA460838AA460838 GTF2H3GTF2H3 General transcription factor IIH, polypeptide 3, 34kDaGeneral transcription factor IIH, polypeptide 3, 34kDa R40324R40324 ZNF410ZNF410 Zinc finger protein 410Zinc finger protein 410 H17927H17927 TXNL2TXNL2 Thioredoxin-like 2Thioredoxin-like 2 AA287318AA287318 NUS1NUS1 Nuclear undecaprenyl pyrophosphate synthase 1 homolog (S. cerevisiae)Nuclear undecaprenyl pyrophosphate synthase 1 homolog (S. cerevisiae) AA282537AA282537 MEF2BMEF2B Myocyte enhancer factor 2BMyocyte enhancer factor 2B AA005219AA005219 GPD2GPD2 Glycerol-3-phosphate dehydrogenase 2 (mitochondrial)Glycerol-3-phosphate dehydrogenase 2 (mitochondrial) AI299421AI299421 AMMECR1LAMMECR1L AMME chromosomal region gene 1-likeAMME chromosomal region gene 1-like AA630794AA630794 SLC3A2SLC3A2 Solute carrier family 3 (activators of dibasic and neutral amino acid transport), member 2Solute carrier family 3 (activators of dibasic and neutral amino acid transport), member 2 AI652019AI652019 MAD2L2MAD2L2 MAD2 mitotic arrest deficient-like 2 (yeast)MAD2 mitotic arrest deficient-like 2 (yeast) AA858059AA858059 MGAT1MGAT1 Mannosyl (alpha-1,3-)-glycoprotein beta-1,2-N-acetylglucosaminyltransferaseMannosyl (alpha-1,3-)-glycoprotein beta-1,2-N-acetylglucosaminyltransferase AA700688AA700688 ATP5EATP5E ATP synthase, H+ transporting, mitochondrial F1 complex, epsilon subunitATP synthase, H + transporting, mitochondrial F1 complex, epsilon subunit AA253413AA253413 FXNFXN FrataxinFrataxin AA063580AA063580 TAF7TAF7 TAF7 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 55kDaTAF7 RNA polymerase II, TATA box binding protein (TBP) -associated factor, 55kDa AA448685AA448685 DCKDCK Deoxycytidine kinaseDeoxycytidine kinase AA489785AA489785 NCOA1NCOA1 Nuclear receptor coactivator 1Nuclear receptor coactivator 1 AA678308AA678308 AKAP8LAKAP8L A kinase (PRKA) anchor protein 8-likeA kinase (PRKA) anchor protein 8-like AA700811AA700811 CA14CA14 Carbonic anhydrase XIVCarbonic anhydrase XIV AA490614AA490614 CRSP8CRSP8 Cofactor required for Sp1 transcriptional activation, subunit 8, 34kDaCofactor required for Sp1 transcriptional activation, subunit 8, 34kDa AI004316AI004316 C7orf30C7orf30 Chromosome 7 open reading frame 30Chromosome 7 open reading frame 30 AA863470AA863470 FAM126AFAM126A Family with sequence similarity 126, member AFamily with sequence similarity 126, member A AA634360AA634360 SEC23BSEC23B Sec23 homolog B (S. cerevisiae)Sec23 homolog B (S. cerevisiae) W35203W35203 CTBSCTBS Chitobiase, di-N-acetyl-Chitobiase, di-N-acetyl- AI241210AI241210 BBS12BBS12 Bardet-Biedl syndrome 12Bardet-Biedl syndrome 12 AA055504AA055504 TRIM32TRIM32 Tripartite motif-containing 32Tripartite motif-containing 32 AI380028AI380028 SCFD1SCFD1 Sec1 family domain containing 1Sec1 family domain containing 1 AA504128AA504128 RAE1RAE1 RAE1 RNA export 1 homolog (S. pombe)RAE1 RNA export 1 homolog (S. pombe) AA489629AA489629 PBEF1PBEF1 Pre-B-cell colony enhancing factor 1Pre-B-cell colony enhancing factor 1 AA190825AA190825 TNFAIP8TNFAIP8 Tumor necrosis factor, alpha-induced protein 8Tumor necrosis factor, alpha-induced protein 8 AA465533AA465533 C10orf104C10orf104 Chromosome 10 open reading frame 104Chromosome 10 open reading frame 104 AA490971AA490971 PPP2R1BPPP2R1B Protein phosphatase 2 (formerly 2A), regulatory subunit A, beta isoformProtein phosphatase 2 (formerly 2A), regulatory subunit A, beta isoform AA455970AA455970 RNF139RNF139 Ring finger protein 139Ring finger protein 139 AA598874AA598874 PRDX6PRDX6 Peroxiredoxin 6Peroxiredoxin 6 AA948055AA948055 CBX5CBX5 Chromobox homolog 5 (HP1 alpha homolog, Drosophila)Chromobox homolog 5 (HP1 alpha homolog, Drosophila) H17612H17612 ARG2ARG2 Arginase, type IIArginase, type II W81371W81371 HOXD8HOXD8 Homeobox D8Homeobox d8 AA478298AA478298 C10orf116C10orf116 Chromosome 10 open reading frame 116Chromosome 10 open reading frame 116

GBAccGBAcc SymbolSymbol 유전자 이름 Gene name AI001010AI001010 ADAMTS7ADAMTS7 ADAM metallopeptidase with thrombospondin type 1 motif, 7ADAM metallopeptidase with thrombospondin type 1 motif, 7 AA663102AA663102 AHCYL1AHCYL1 S-adenosylhomocysteine hydrolase-like 1S-adenosylhomocysteine hydrolase-like 1 AI858088AI858088 ALOX15BALOX15B Arachidonate 15-lipoxygenase, type BArachidonate 15-lipoxygenase, type B AI474406AI474406 ALOX15BALOX15B Arachidonate 15-lipoxygenase, type BArachidonate 15-lipoxygenase, type B AA968829AA968829 ANKHD1ANKHD1 Ankyrin repeat and KH domain containing 1Ankyrin repeat and KH domain containing 1 AA490209AA490209 ARPC1AARPC1A Actin related protein 2/3 complex, subunit 1A, 41kDaActin related protein 2/3 complex, subunit 1A, 41kDa AI368479AI368479 ATP8B1ATP8B1 ATPase, Class I, type 8B, member 1ATPase, Class I, type 8B, member 1 AI371684AI371684 BAG3BAG3 BCL2-associated athanogene 3BCL2-associated athanogene 3 AI358915AI358915 C22orf25C22orf25 Chromosome 22 open reading frame 25Chromosome 22 open reading frame 25 AA280846AA280846 CBR1CBR1 Carbonyl reductase 1Carbonyl reductase 1 T54121T54121 CCNE1CCNE1 Cyclin E1Cyclin E1 AI828088AI828088 CDKN1CCDKN1C Cyclin-dependent kinase inhibitor 1C (p57, Kip2)Cyclin-dependent kinase inhibitor 1C (p57, Kip2) H39187H39187 CELSR2CELSR2 Cadherin, EGF LAG seven-pass G-type receptor 2 (flamingo homolog, Drosophila)Cadherin, EGF LAG seven-pass G-type receptor 2 (flamingo homolog, Drosophila) AA459010AA459010 CEPT1CEPT1 Choline/ethanolamine phosphotransferase 1Choline / ethanolamine phosphotransferase 1 AI937385AI937385 CLN3CLN3 Ceroid-lipofuscinosis, neuronal 3, juvenile (Batten, Spielmeyer-Vogt disease)Ceroid-lipofuscinosis, neuronal 3, juvenile (Batten, Spielmeyer-Vogt disease) N71160N71160 COX6B1COX6B1 Cytochrome c oxidase subunit Vib polypeptide 1 (ubiquitous)Cytochrome c oxidase subunit Vib polypeptide 1 (ubiquitous) AA872391AA872391 COX6B1COX6B1 Cytochrome c oxidase subunit Vib polypeptide 1 (ubiquitous)Cytochrome c oxidase subunit Vib polypeptide 1 (ubiquitous) T71991T71991 CREG1CREG1 Cellular repressor of E1A-stimulated genes 1Cellular repressor of E1A-stimulated genes 1 W72207W72207 CSTACSTA Cystatin A (stefin A)Cystatin A (stefin A) H22919H22919 CSTBCSTB Cystatin B (stefin B)Cystatin B (stefin B) AA873089AA873089 CYP3A5CYP3A5 Cytochrome P450, family 3, subfamily A, polypeptide 5Cytochrome P450, family 3, subfamily A, polypeptide 5 H93121H93121 DDX24DDX24 DEAD (Asp-Glu-Ala-Asp) box polypeptide 24DEAD (Asp-Glu-Ala-Asp) box polypeptide 24 AA190339AA190339 DUSP3DUSP3 Dual specificity phosphatase 3 (vaccinia virus phosphatase VH1-related)Dual specificity phosphatase 3 (vaccinia virus phosphatase VH1-related) N79484N79484 ECM1ECM1 Extracellular matrix protein 1Extracellular matrix protein 1 N47717N47717 FABP5FABP5 Fatty acid binding protein 5 (psoriasis-associated)Fatty acid binding protein 5 (psoriasis-associated) H10939H10939 FAT2FAT2 FAT tumor suppressor homolog 2 (Drosophila)FAT tumor suppressor homolog 2 (Drosophila) AA069372AA069372 FOXD1FOXD1 Forkhead box D1Forkhead box D1 AA291163AA291163 GLRXGLRX Glutaredoxin (thioltransferase)Glutaredoxin (thioltransferase) AW075163AW075163 GRNGRN GranulinGranulin H72028H72028 GSNGSN Gelsolin (amyloidosis, Finnish type)Gelsolin (amyloidosis, Finnish type) AA454563AA454563 HCFC1R1HCFC1R1 Host cell factor C1 regulator 1 (XPO1 dependent)Host cell factor C1 regulator 1 (XPO1 dependent) AA017043AA017043 HTATIPHTATIP HIV-1 Tat interacting protein, 60kDaHIV-1 Tat interacting protein, 60 kDa AA482119AA482119 ID3ID3 Inhibitor of DNA binding 3, dominant negative helix-loop-helix proteinInhibitor of DNA binding 3, dominant negative helix-loop-helix protein AA043343AA043343 IRF6IRF6 Interferon regulatory factor 6Interferon regulatory factor 6 AA035637AA035637 JUPJUP Junction plakoglobinJunction plakoglobin H27912H27912 KDELR1KDELR1 KDEL (Lys-Asp-Glu-Leu) endoplasmic reticulum protein retention receptor 1KDEL (Lys-Asp-Glu-Leu) endoplasmic reticulum protein retention receptor 1 AA459401AA459401 KLK10KLK10 Kallikrein-related peptidase 10Kallikrein-related peptidase 10 W73140W73140 KLK5KLK5 Kallikrein-related peptidase 5Kallikrein-related peptidase 5 AI139437AI139437 KLK7KLK7 Kallikrein-related peptidase 7Kallikrein-related peptidase 7 AI963941AI963941 KLK8KLK8 Kallikrein-related peptidase 8Kallikrein-related peptidase 8 AA400973AA400973 LCN2LCN2 Lipocalin 2 (oncogene 24p3)Lipocalin 2 (oncogene 24p3) AA927761AA927761 LOC128977LOC128977 Hypothetical protein LOC128977Hypothetical protein LOC128977 AI359037AI359037 LOC728641LOC728641 Similar to Fatty acid-binding protein, epidermal (E-FABP) (Psoriasis-associated fatty acid-binding protein homolog) (PA-FABP)Similar to Fatty acid-binding protein, epidermal (E-FABP) (Psoriasis-associated fatty acid-binding protein homolog) (PA-FABP) AW008721AW008721 LOH11CR2ALOH11CR2A Loss of heterozygosity, 11, chromosomal region 2, gene ALoss of heterozygosity, 11, chromosomal region 2, gene A AA402447AA402447 MAP3K4MAP3K4 Mitogen-activated protein kinase kinase kinase 4Mitogen-activated protein kinase kinase kinase 4 AA669451AA669451 MKRN1MKRN1 Makorin, ring finger protein, 1Makorin, ring finger protein, 1 AA487434AA487434 MMDMMD Monocyte to macrophage differentiation-associatedMonocyte to macrophage differentiation-associated H23197H23197 MOBPMOBP Myelin-associated oligodendrocyte basic proteinMyelin-associated oligodendrocyte basic protein H40681H40681 MYD88MYD88 Myeloid differentiation primary response gene (88)Myeloid differentiation primary response gene (88) AA401883AA401883 NEU1NEU1 Sialidase 1 (lysosomal sialidase)Sialidase 1 (lysosomal sialidase) AI369277AI369277 PARD3PARD3 Par-3 partitioning defective 3 homolog (C. elegans)Par-3 partitioning defective 3 homolog (C. elegans) AI582329AI582329 PI3PI3 Peptidase inhibitor 3, skin-derived (SKALP)Peptidase inhibitor 3, skin-derived (SKALP) AA699876AA699876 PIK3C2BPIK3C2B Phosphoinositide-3-kinase, class 2, beta polypeptidePhosphoinositide-3-kinase, class 2, beta polypeptide R55490R55490 PLCD1PLCD1 Phospholipase C, delta 1Phospholipase C, delta 1 AA679414AA679414 PRPF8PRPF8 PRP8 pre-mRNA processing factor 8 homolog (S. cerevisiae)PRP8 pre-mRNA processing factor 8 homolog (S. cerevisiae) AA424782AA424782 PSD4PSD4 Pleckstrin and Sec7 domain containing 4Pleckstrin and Sec7 domain containing 4 AI420820AI420820 RAB11FIP1RAB11FIP1 RAB11 family interacting protein 1 (class I)RAB11 family interacting protein 1 (class I) R06712R06712 RAB5BRAB5B RAB5B, member RAS oncogene familyRAB5B, member RAS oncogene family AI371743AI371743 RAI16RAI16 Retinoic acid induced 16Retinoic acid induced 16 AI927131AI927131 SEMG1SEMG1 Semenogelin ISemenogelin i AA989257AA989257 SH3KBP1SH3KBP1 SH3-domain kinase binding protein 1SH3-domain kinase binding protein 1 AI970057AI970057 SLPISLPI Secretory leukocyte peptidase inhibitorSecretory leukocyte peptidase inhibitor AI418200AI418200 SMAP1LSMAP1L Stromal membrane-associated protein 1-likeStromal membrane-associated protein 1-like AA481026AA481026 SMARCA2SMARCA2 SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 2SWI / SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 2 AI923984AI923984 SPRR1ASPRR1A Small proline-rich protein 1ASmall proline-rich protein 1A AA053886AA053886 SREBF2SREBF2 Sterol regulatory element binding transcription factor 2Sterol regulatory element binding transcription factor 2 AI628353AI628353 TBC1D9TBC1D9 TBC1 domain family, member 9 (with GRAM domain)TBC1 domain family, member 9 (with GRAM domain) AI652954AI652954 TGM1TGM1 Transglutaminase 1 (K polypeptide epidermal type I, protein-glutamine-gamma-glutamyltransferase)Transglutaminase 1 (K polypeptide epidermal type I, protein-glutamine-gamma-glutamyltransferase) AW005791AW005791 TIMP2TIMP2 TIMP metallopeptidase inhibitor 2TIMP metallopeptidase inhibitor 2 AA917374AA917374 TIMP2TIMP2 TIMP metallopeptidase inhibitor 2TIMP metallopeptidase inhibitor 2 AA455505AA455505 ULK1ULK1 Unc-51-like kinase 1 (C. elegans)Unc-51-like kinase 1 (C. elegans) T71990T71990 WBP2WBP2 WW domain binding protein 2WW domain binding protein 2 AI277125AI277125 WRNWRN Werner syndromeWerner syndrome AA903218AA903218 YPEL2YPEL2 Yippee-like 2 (Drosophila)Yippee-like 2 (Drosophila) AA400464AA400464 Sox9Sox9 SRY (sex determining region Y)-box 9 (campomelic dysplasia, autosomal sex-reversal)SRY (sex determining region Y) -box 9 (campomelic dysplasia, autosomal sex-reversal) AA954353 .1 AA954353 .1 HSPB1HSPB1 heat shock 27kDa protein 1heat shock 27kDa protein 1

<실시예 4. 각질형성세포분화 관련 유전자의 프로모터 서열 분석 및 조절인자 규명> <Example 4. Promoter sequence analysis and identification of regulatory factors of keratinocyte differentiation related genes>

각질형성세포의 분화 과정 중에 발현의 변화를 보이는 유전자들의 발현 조절을 담당하는 전사조절 인자를 파악하고자 하였다. NCBI Accession No 기준으로 변화된 유전자의 프로모터 서열을 수집하였다. 업스트림(Upstream) 유전자 서열을 Ensembl genome database 로부터 확보한 후 전사 개시 사이트(transcription start site)로부터 2000 bp 업스트림 영역을 포함하는 게놈 서열을 확보하였다. The aim of this study was to identify transcriptional regulators that regulate the expression of genes that change expression during keratinocyte differentiation. Promoter sequences of changed genes were collected on NCBI Accession No criteria. After obtaining the upstream gene sequence from the Ensembl genome database, the genomic sequence including the 2000 bp upstream region was obtained from the transcription start site.

MatInspector (Quandt et al., 1995)와 Transfac (Knuppel et al., 1994)같은 motif를 예측, 발견, 분석하는 프로그램을 이용해 전사인자 결합 부위 (transcription factor binding site, TFBS)를 검색하고, 하이퍼지오메트리 통계 방법으로 과다 출현 혹은 과소출현하는 전사인자 결합 부위를 선별하였다. 하기 표 3 및 표 4는 발현 변화를 보이는 유전자의 5' upstream 2000 bp 까지를 조사한 결과 이들 유전자의 발현을 조절할 것으로 추정되는 전사조절 인자를 표시한 것이다. 표 3은 분화 과정에 따라 발현이 감소하는 유전자의 프로모터에서 과다 관찰되는 전사인자, 표 4는 분화 과정에 따라 발현이 증가하는 유전자의 프로모터에서 과다 관찰되는 전사인자를 표시한 것이다. GBAcc는 NCBI의 genebank accession ID를 의미한다.Search for transcription factor binding sites (TFBS) using programs that predict, find, and analyze motifs such as MatInspector (Quandt et al., 1995) and Transfac (Knuppel et al., 1994). By using the method, the transcription factor binding sites were over- or under-expressed. Table 3 and Table 4 show transcription control factors that are supposed to regulate the expression of these genes by examining up to 2000 bp of 5 'upstream genes showing expression changes. Table 3 shows the transcription factors excessively observed in the promoters of genes whose expression decreases according to differentiation process, and Table 4 shows the transcription factors that are excessively observed in the promoters of genes whose expression increases with differentiation process. GBAcc means NCBI genebank accession ID.

그리고 발현 변화를 보이는 유전자 클러스터와 그 유전자 클러스터를 조절한 것으로 예측되는 전사인자 간의 조절 네트워크의 연결 고리를 추출하여, 히트맵과 그래프로 시각화한 것을 도 4 및 도 5에 나타내었다. 도 4는 각질형성세포의 분화 과정 중 발현이 감소하는 유전자와 그 프로모터에 과다 관찰되는 전사인자와의 상관 관계 매트릭스(도 4a) 및 네트워크(도 4b)를 도시한 것이고, 도 5는 각질형성세포의 분화 과정 중 발현이증가하는 유전자와 그 프로모터에 과다 관찰되는 전사인자와의 상관 관계 매트릭스(도 5a) 및 네트워크(도 5b)를 도시한 것이다. 상기 상관 관계 매트릭스에 의하면, 발현 변화를 보이는 상기 유전자 클러스터 (세로 변)와 그 유전자 클러스터를 조절한 것으로 예측되는 전사인자(가로 변) 간의 조절 네트워크 연결 고리를 확인할 수 있다.4 and 5 illustrate the extraction of the linkage of the regulatory network between the gene cluster showing the expression change and the transcription factor predicted to control the gene cluster, and visualizing the heat map and the graph. FIG. 4 shows a correlation matrix (FIG. 4A) and a network (FIG. 4B) between genes with reduced expression during differentiation of keratinocytes and transcription factors excessively observed in their promoters, and FIG. 5 shows keratinocytes. The correlation matrix (FIG. 5A) and the network (FIG. 5B) between genes with increased expression during the differentiation process and transcription factors excessively observed in the promoter are shown. According to the correlation matrix, the regulatory network linkage between the gene cluster (vertical side) showing the expression change and the transcription factor (horizontal side) predicted to control the gene cluster can be identified.

GBAccGBAcc 전사인자와 그 결합 부위Transcription Factors and Their Binding Sites p-p- valuevalue AB209047AB209047 Elk-1/V$ELK1_02Elk-1 / V $ ELK1_02 0.000950.00095 BC107698BC107698 CRE-BP1/c-Jun/V$CREBP1CJUN_01CRE-BP1 / c-Jun / V $ CREBP1CJUN_01 0.003570.00357 AB209624AB209624 IRF-1/V$IRF1_01IRF-1 / V $ IRF1_01 0.004290.00429 NM_134442NM_134442 CREB/V$CREB_01CREB / V $ CREB_01 0.010690.01069 BX648934BX648934 IRF-2/V$IRF2_01IRF-2 / V $ IRF2_01 0.01670.0167 NM_002908NM_002908 c-Rel/V$CREL_01c-Rel / V $ CREL_01 0.022140.02214 NM_005238NM_005238 c-Ets-1(p54)/V$CETS1P54_01c-Ets-1 (p54) / V $ CETS1P54_01 0.024410.02441 AL832119AL832119 USF/V$USF_Q6USF / V $ USF_Q6 0.025460.02546 AB051442AB051442 VBP/V$VBP_01VBP / V $ VBP_01 0.031330.03133 BM920882BM920882 Hox-1.3/V$HOX13_01Hox-1.3 / V $ HOX13_01 0.038550.03855 BC107698BC107698 CRE-BP1/V$CREBP1_01CRE-BP1 / V $ CREBP1_01 0.051470.05147 NM_005604NM_005604 Brn-2/V$BRN2_01Brn-2 / V $ BRN2_01 0.055050.05505 AJ606319AJ606319 c-Myb/V$CMYB_01c-Myb / V $ CMYB_01 0.059120.05912 COMP1/V$COMP1_01COMP1 / V $ COMP1_01 0.065320.06532 NM_181552.2NM_181552.2 CDP CR1/V$CDPCR1_01CDP CR1 / V $ CDPCR1_01 0.067390.06739 U03494U03494 CP2/V$CP2_01CP2 / V $ CP2_01 0.067460.06746 NM_003998NM_003998 NF-kappaB (p50)/V$NFKAPPAB50_01NF-kappaB (p50) / V $ NFKAPPAB50_01 0.080870.08087 NM_002228NM_002228 AP-1/V$AP1_Q4AP-1 / V $ AP1_Q4 0.082180.08218

GBAccGBAcc 전사인자와 그 결합 부위Transcription Factors and Their Binding Sites p-valuep-value NM_002228NM_002228 AP-1/V$AP1_Q2AP-1 / V $ AP1_Q2 0.006230.00623 NM_002398.2NM_002398.2 MEIS1A/HOXA9/V$MEIS1A/HOXA9_01MEIS1A / HOXA9 / V $ MEIS1A / HOXA9_01 0.018330.01833 NM_152739NM_152739 MEIS1B/HOXA9/V$MEIS1B/HOXA9_01MEIS1B / HOXA9 / V $ MEIS1B / HOXA9_01 0.024590.02459 NM_134442NM_134442 CREB/V$CREB_02CREB / V $ CREB_02 0.030140.03014 NM_006084 NM_001571NM_006084 NM_001571 ISRE-binding proteins/V$ISRE_01ISRE-binding proteins / V $ ISRE_01 0.030140.03014 BC011558 BC011558 Nrf-2/V$NRF2_01Nrf-2 / V $ NRF2_01 0.046960.04696 BC025711BC025711 Nkx2-5/V$NKX25_02Nkx2-5 / V $ NKX25_02 0.047960.04796 AF061756AF061756 Hand1/E47/V$HAND1E47_01Hand1 / E47 / V $ HAND1E47_01 0.057530.05753 AB209177AB209177 Pax-6/V$PAX6_01Pax-6 / V $ PAX6_01 0.076350.07635 AJ606319AJ606319 c-Myb/V$CMYB_01c-Myb / V $ CMYB_01 0.082640.08264 NM_001031804NM_001031804 v-Maf/V$VMAF_01v-Maf / V $ VMAF_01 0.086570.08657 AB209047AB209047 Elk-1/V$ELK1_02Elk-1 / V $ ELK1_02 0.091310.09131 NM_003200.1NM_003200.1 E47/V$E47_01E47 / V $ E47_01 0.096960.09696

<실시예 5. 규명된 전사인자의 발현 변화 양상 확인> <Example 5. Confirmation of the change pattern of the identified transcription factor>

상기 규명된 전사 인자의 발현 변화 양상을 확인하기 위해서 각질형성세포 분화에 따른 전사 인자의 발현 변화를 RT-PCR로 확인하고 그 결과를 도 6에 나타내었다. 우선 각질형성세포 분화를 시간경과에 따라 분석하기 위하여 칼슘 미처리군(0일), 칼슘처리 후 1일, 3일, 7일, 10일에 회수한 총RNA를 각각 사용하였다. 총RNA 각 1 ㎍을 올리고-dT프라이머(24 mer) 100 pmol (Bioneer)과 함께 70℃에서 10분(총용량 20 ㎕) 반응시켰다. 그 후, 5x제1쇄 반응 버퍼 4 ㎕, 0.1M DTT 2 ㎕, 2.5 mMdNTP 믹스 4 ㎕, SuperscriptII 1 ㎕(전부 invitrogen)를 첨가하여 42℃에서 1시간 반응시켰다. 마지막으로 70℃에서 10분 반응시켜 신장시키고, cDNA 템플릿을 조제하였다. rTaq용 10×버퍼 5 ㎕, 25 mM MgCl2 3 ㎕, 2.0 mM dNTP 믹스 5㎕, rTaq 0.5 ㎕(전부 Bioneer사), ddH2 0 33.5 ㎕, cDNA 템플릿 각 1 ㎕, 하기 표 5의 프라이머 센스 및 안티센스 각 20 mM 1 ㎕(총용량 50 ㎕)를 전부 첨가하여 PCR 반응[94℃ 2분, (94℃ 30초, 55℃ 30초, 72℃ 1분)을 30사이클, 72℃ 10분]을 행하였다.In order to confirm the expression change pattern of the transcription factor identified above, the expression change of transcription factor according to keratinocyte differentiation was confirmed by RT-PCR and the results are shown in FIG. 6. First, in order to analyze keratinocyte differentiation over time, total RNA recovered on the untreated calcium group (day 0), 1, 3, 7 and 10 days after calcium treatment were used. Each 1 μg of total RNA was reacted with 100 pmol (Bioneer) of oligo-dT primer (24 mer) for 10 minutes at 70 ° C. (total dose 20 μl). Thereafter, 4 µl of 5x first chain reaction buffer, 2 µl of 0.1M DTT, 4 µl of 2.5 mM dNTP mix, and 1 µl of SuperscriptII (all invitrogen) were added and reacted at 42 ° C for 1 hour. Finally, the mixture was allowed to react at 70 ° C for 10 minutes to stretch, and a cDNA template was prepared. 5 μl of 10 × buffer for rTaq, 3 μl of 25 mM MgCl 2, 5 μl of 2.0 mM dNTP mix, 0.5 μl of rTaq (all from Bioneer), 33.5 μl of ddH2 0, 1 μl of cDNA template, primer sense and antisense of Table 5 below 1 mu l of 20 mM (50 mu l of total volume) were all added to carry out PCR reaction [30 DEG C, 72 DEG C for 10 minutes] at 94 DEG C for 2 minutes (94 DEG C for 30 seconds, 55 DEG C for 30 seconds, and 72 DEG C for 1 minute).

유전자 기호Genetic symbol 프라이머 종류Primer Type 프라이머 서열Primer sequence Nrf-2Nrf-2 센스(서열번호1)Sense (SEQ ID NO: 1) GAGAGCCCAGTCTTCATTGCGAGAGCCCAGTCTTCATTGC 안티센스(서열번호2)Antisense (SEQ ID NO: 2) CTGTCAACTGGTTGGGGTCTCTGTCAACTGGTTGGGGTCT Ets-1Ets-1 센스(서열번호3)Sense (SEQ ID NO: 3) GTTAATGGAGTCAACCCAGCGTTAATGGAGTCAACCCAGC 안티센스(서열번호4)Antisense (SEQ ID NO: 4) GGGTGACGACTTCTTGTTTGGGGTGACGACTTCTTGTTTG PAX-6PAX-6 센스(서열번호5)Sense (SEQ ID NO: 5) CCGGCAGAAGATTGTAGAGCCCGGCAGAAGATTGTAGAGC 안티센스(서열번호6)Antisense (SEQ ID NO: 6) CTAGCCAGGTTGCGAAGAACCTAGCCAGGTTGCGAAGAAC Nkx-2.5Nkx-2.5 센스(서열번호7)Sense (SEQ ID NO: 7) ACGCCCTTCTCAGTCAAAGAACGCCCTTCTCAGTCAAAGA 안티센스(서열번호8)Antisense (SEQ ID NO: 8) TTTTCGGCTCTAGGGTCCTTTTTTCGGCTCTAGGGTCCTT

도 6에서 확인되는 바와 같이, 일부 인자는 시간에 따라 일정한 방식으로 발현 변화를 보이는 것을 확인하였다. 예를 들어, 칼슘 첨가로 인한 각질형성세포의 분화 이전에는 주로 Nrf-2 전사인자가 발현되다가 분화가 시작된 후 초기에는 Ets-1, 다음에는 Pax6, 마지막으로 Nkx-2.5가 발현되어 각질형성세포의 분화를 최종적으로 조절한다. As confirmed in Figure 6, it was confirmed that some factors show a change in expression in a constant manner over time. For example, before the differentiation of keratinocytes due to the addition of calcium, Nrf-2 transcription factors are mainly expressed. After differentiation, Ets-1, Pax6, and Nkx-2.5 are expressed initially. Finally control differentiation.

도 7 내지 9는 표 1 내지 2의 유전자, 및 표 3 내지 4의 전사조절 인자 유전자들 중 대표적인 유전자에 대한 발현 변화를 실제로 검증한 결과이다. 7 to 9 are results of actually verifying the expression changes for the genes of Tables 1 to 2, and representative genes of the transcriptional regulator factor genes of Tables 3 to 4.

도 7은 각질형성세포 분화 과정 동안 발현이 증가하는 것으로 밝혀진 HSPB1(HSP27) 유전자의 발현 변화를 검증한 결과로서, (7a) 칼슘에 따른 HSPB1(HSP27) mRNA의 발현 변화 (7b) 정상 표피에서의 HSPB1(HSP27)(1-a) 및 인과 화합된(phosphorated) HSPB1(HSP27)(1-b) 단백질의 발현 양상 및 (7c) 여러 피부 질환에서의 HSPB1(HSP27) 및 phosphorated HSPB1 (HSP27)단백질의 발현 양상을 나타낸다. 도 7b에 의하면, 정상 조직에서 HSPB1 (HSP27)은 주로 상부 가시층(upper spinous layer) 및 각질층(stratum corneum)에서 발현되고, HSPB1 (HSP27)의 활성화 형태인 phosphorated-HSPB1 (HSP27)은 상부 가시층(upper spinous layer) 및 과립층에서 발현되므로, 표피 분화 지표로서 사용하기에는 인과 화합된(phosphorated) HSPB1이 더욱 적절하다. 도 7c에 의하면, 건선(psoriasis), 아토피, 편평태선(lichen planus), 비강진(pityriasis), 기저세포암(basal cell carcinoma), 편평상피세포암(squamous cell carcinoma), 악성흑색종(malignant melanoma), 각질극세포종 (keratoacanthoma) 등의 피부질환에 걸린 표피에서 HSPB1 (HSP27) 및 phosphorated-HSPB1 (HSP27)이 발현된 것을 확인할 수 있다. 특히, HSPB1 (HSP27)의 발현은 표피의 여러 세포층에 넓게 분포되어 있고 phosphorated-HSPB1 (HSP27)의 발현은 특정 세포층인 상부 가시층(upper spinous layer) 및 과립층에 편재되어 있었다.7 is a result of verifying the expression change of the HSPB1 (HSP27) gene was found to increase expression during keratinocyte differentiation process, (7a) changes in the expression of HSPB1 (HSP27) mRNA according to calcium (7b) in normal epidermis Expression patterns of HSPB1 (HSP27) (1-a) and phosphorusated HSPB1 (HSP27) (1-b) proteins and (7c) Proteins of HSPB1 (HSP27) and phosphorated HSPB1 (HSP27) proteins in various skin diseases The expression pattern is shown. According to FIG. 7B, in normal tissues, HSPB1 (HSP27) is mainly expressed in the upper spinous layer and stratum corneum, and the activated form of HSPB1 (HSP27) is phosphorated-HSPB1 (HSP27) in the upper visible layer. Since it is expressed in the upper spinous layer and granule layer, phosphorus HSPB1 is more suitable for use as an indicator of epidermal differentiation. According to Figure 7c, psoriasis, atopy, lichen planus, pityriasis, basal cell carcinoma, squamous cell carcinoma, malignant melanoma It can be seen that HSPB1 (HSP27) and phosphorated-HSPB1 (HSP27) were expressed in the epidermis with skin diseases such as keratoacanthoma. In particular, the expression of HSPB1 (HSP27) was widely distributed in various cell layers of the epidermis and the expression of phosphorated-HSPB1 (HSP27) was localized in the upper spinous layer and granule layer, which are specific cell layers.

도 8은 각질형성세포 분화 과정동안 발현이 증가하는 것으로 확인된 SOX9 유전자의 발현 변화를 검증한 결과로서, 정상 모낭, 정상 피부, 건선, 아토피 피부염, 기저세포암 및 극세포암 환자의 피부에서 관찰되는 발현 변화를 나타낸다. Sox9는 모발의 외모근초(outer root sheath, ORS)와 피지선(sebaceous gland) 세포의 핵 내에서 발현되는 유전자이다. 정상 표피의 핵 내에서는 거의 발현되지 않았지만 극세포층의 세포질 내에서 주로 발현되었고, 특이하게도 아토피 피부염과는 달리 건선 조직의 대부분 세포의 핵 내에서 발현되었다. 또한 여러 피부암, 기저세포암과 극세포암에서도 발현이 증가된 것으로 나타난 것을 보아 Sox9은 건선, 피부암 진단의 마커로 활용될 수 있을 것이다. 8 is a result of verifying the expression changes of the SOX9 gene that is found to increase expression during keratinocyte differentiation process, which is observed in the skin of normal hair follicles, normal skin, psoriasis, atopic dermatitis, basal cell carcinoma and polar cell carcinoma Expression changes. Sox9 is a gene expressed in the nucleus of hair outer root sheath (ORS) and sebaceous gland cells. Although rarely expressed in the nucleus of the normal epidermis, it was mainly expressed in the cytoplasm of the polar cell layer. Specifically, unlike atopic dermatitis, it was expressed in the nucleus of most cells of psoriasis tissue. In addition, Sox9 may be used as a marker for psoriasis and skin cancer, as expression is increased in various skin cancers, basal cell carcinoma and polar cell carcinoma.

도 9는 각질형성세포의 분화 과정 중에 발현의 변화를 보이는 유전자들의 발현 조절을 담당하는 전사조절 인자인 (9a) Nrf-2 (9b) PAX-6 및 (9c) Nkx2.5가 정상 피부, 건선 및 아토피 피부염 환자의 피부에서 발현되는 양상을 나타낸다. Nrf-2 의 발현은 정상 피부의 기저층(basal layer)과 상부기저층(supra basal layer)에서 관찰되었으며, 주로 세포질 내에서 발현되었다. 건선과 아토피 피부염에서는 기저층부터 중부 가시층(mid-spinous layer)까지 넓게 발현되었지만 발현양은 정상보다 적었다. PAX-6는 면역 염색에서는 정상 피부에서 거의 발현되지 않았으나, 건선의 경우 표피 가시층(spinous layer)에서 세포질에 발현이 증가된 양상을 보였다. 한편 아토피 피부염에서는 발현되지 않았다. 따라서 PAX-6는 건선 발병과 연관 있는 것으로 보이므로 건선 치료제 개발의 표적이나 건선 진단을 위한 지표로활용될 수 있을 것이다. Nkx2.5 는 정상 피부에서는 기저층의 세포질과 핵에서 발현되다가 극세포 위층으로 갈수록 핵에서만 발현되었다. 건선에서는 표피(epidermis) 전 층에 걸쳐 발현을 보이면서, 특히상부 가시층(upper spinous layer) 및 과립층(granular layer)에서는 핵이 강하게 염색되었다. 한편 아토피 피부염에서는 발현을 나타내지 않은 것으로 보아, 건선 치료의 표적 및 진단 마커로 활용될 수 있을 것이다. Figure 9 shows that the transcriptional regulators (9a) Nrf-2 (9b) PAX-6 and (9c) Nkx2.5, which are responsible for the regulation of expression of genes that change expression during keratinocyte differentiation, are normal skin and psoriasis. And in the skin of atopic dermatitis patients. Nrf-2 expression was observed in the basal and supra basal layers of normal skin, mainly in the cytoplasm. In psoriasis and atopic dermatitis, it was expressed widely from the basal layer to the mid-spinous layer, but its expression was less than normal. PAX-6 was hardly expressed in normal skin by immunostaining, but psoriasis showed increased expression in cytoplasm in the epidermal spinal layer. It was not expressed in atopic dermatitis. Therefore, PAX-6 seems to be associated with the development of psoriasis, so it may be used as a target for the development of psoriasis treatment or as an indicator for psoriasis diagnosis. Nkx2.5 was expressed in the cytoplasm and nucleus of the basal layer in normal skin, but only in the nucleus toward the upper layers of the polar cells. In psoriasis, the nucleus was strongly stained, especially in the upper spinous and granular layers. On the other hand, since atopic dermatitis does not show expression, it may be used as a target and diagnostic marker for psoriasis treatment.

도 1은 칼슘에 의한 각질형성세포분화 과정에서의 유전자 발현 패턴을 알아보기 위하여 수행한 마이크로어레이에서의 혼성화 반응 결과를 나타내는 사진이다.Figure 1 is a photograph showing the results of the hybridization reaction in the microarray performed to determine the gene expression pattern in the process of keratinocyte differentiation by calcium.

도 2는 각질형성세포의 분화 과정 중 발현이 감소하는 유전자의 시간 경과에 따른 유전자 발현 패턴을 나타내는 그래프이다.Figure 2 is a graph showing the gene expression pattern over time of the gene expression is reduced during differentiation of keratinocytes.

도 3은 각질형성세포의 분화 과정 중 발현이 증가하는 유전자의 시간 경과에 따른 유전자 발현 패턴을 나타내는 그래프이다.Figure 3 is a graph showing the gene expression pattern over time of the gene of which expression is increased during differentiation of keratinocytes.

도 4는 각질형성세포의 분화 과정 중 발현이 감소하는 유전자와 그 프로모터에 과다 관찰되는 전사인자와의 상관 관계 매트릭스(도 4a) 및 네트워크(도 4b)를 도시한 것이다.4 shows a correlation matrix (FIG. 4A) and a network (FIG. 4B) between genes with reduced expression during differentiation of keratinocytes and transcription factors excessively observed in their promoters.

도 5는 각질형성세포의 분화 과정 중 발현이 증가하는 유전자와 그 프로모터에 과다 관찰되는 전사인자와의 상관 관계 매트릭스(도 5a) 및 네트워크(도 5b)를 도시한 것이다.FIG. 5 illustrates a correlation matrix (FIG. 5A) and a network (FIG. 5B) between genes with increased expression during differentiation of keratinocytes and transcription factors excessively observed in their promoters.

도 6은 각질형성세포의 분화 과정에서 발현 변화를 나타내는 유전자를 조절하는 전사 인자의 유전자 발현 패턴을 확인하기 위해서 수행한 RT-PCR 결과를 나타내는 사진이다.Figure 6 is a photograph showing the results of RT-PCR performed to confirm the gene expression pattern of the transcription factor that regulates the gene representing the expression change in the differentiation process of keratinocytes.

도 7은 각질형성세포 분화 과정 동안 발현이 증가하는 것으로 밝혀진 HSPB1 (HSP27) 유전자의 발현 변화를 검증한 결과로서, (7a) 칼슘에 따른HSPB1 mRNA의 발현 변화, (7b) 정상 표피에서의 HSPB1 (1-a)및 인과 화합된(phosphorated) HSPB1 (1-b)단백질의 발현 양상, (7c) 여러 피부 질환에서의 HSPB1 (1-a)및 phosphorated HSPB1 (1-b) 단백질의 발현 양상을 나타내는 그래프 및 사진이다.7 is a result of verifying the expression changes of the HSPB1 (HSP27) gene was found to increase expression during the process of keratinocyte differentiation, (7a) changes in the expression of HSPB1 mRNA according to calcium, (7b) HSPB1 in normal epidermis ( 1-a) and expression patterns of phosphorusated HSPB1 (1-b) proteins, (7c) expression of HSPB1 (1-a) and phosphorated HSPB1 (1-b) proteins in various skin diseases Graph and picture.

도 8은 각질형성세포 분화 과정 동안 발현이 증가하는 것으로 밝혀진 SOX9 유전자의 발현 변화를 검증한 결과로서, 정상 모낭, 정상 피부, 건선, 아토피 피부염, 기저세포암 및 극세포암 환자의 피부에서 관찰되는 발현 변화를 나타내는 사진이다.8 is a result of verifying the expression changes of the SOX9 gene found to increase expression during keratinocyte differentiation process, expression observed in the skin of patients with normal hair follicles, normal skin, psoriasis, atopic dermatitis, basal cell carcinoma and polar cell carcinoma It is photograph showing change.

도 9는 각질형성세포의 분화 과정 중에 발현의 변화를 보이는 유전자들의 발현 조절을 담당하는 전사조절 인자인 (9a) Nrf-2, (9b) PAX-6, (9c) Nkx2.5가 정상 피부, 건선 및 아토피 피부염 환자의 피부에서 발현되는 양상을 나타내는 사진이다.9 is a transcriptional regulatory factor (9a) Nrf-2, (9b) PAX-6, (9c) Nkx2.5 which is responsible for expression control of genes showing expression changes during differentiation of keratinocytes, It is a photograph showing the appearance in the skin of psoriasis and atopic dermatitis patients.

<110> Amorepacific Corporation <120> Method and kit for diagnosis of abnormal keratinization <160> 8 <170> KopatentIn 1.71 <210> 1 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 1 gagagcccag tcttcattgc 20 <210> 2 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 2 ctgtcaactg gttggggtct 20 <210> 3 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 3 gttaatggag tcaacccagc 20 <210> 4 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 4 gggtgacgac ttcttgtttg 20 <210> 5 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 5 ccggcagaag attgtagagc 20 <210> 6 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 6 ctagccaggt tgcgaagaac 20 <210> 7 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 7 acgcccttct cagtcaaaga 20 <210> 8 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 8 ttttcggctc tagggtcctt 20 <110> Amorepacific Corporation <120> Method and kit for diagnosis of abnormal keratinization <160> 8 <170> KopatentIn 1.71 <210> 1 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 1 gagagcccag tcttcattgc 20 <210> 2 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 2 ctgtcaactg gttggggtct 20 <210> 3 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 3 gttaatggag tcaacccagc 20 <210> 4 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 4 gggtgacgac ttcttgtttg 20 <210> 5 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 5 ccggcagaag attgtagagc 20 <210> 6 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 6 ctagccaggt tgcgaagaac 20 <210> 7 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 7 acgcccttct cagtcaaaga 20 <210> 8 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 8 ttttcggctc tagggtcctt 20  

Claims (13)

SEC24D, WASF1, MTFR1, STT3A, CDKN3, EIF2B3, PTPRZ1, TRIM37, GTF2H2, ATM, FST, G3BP2, TETRAN, MDFIC, ALG14, RPS7, OLFM1, RCN2, IGSF3, HS3ST1, ERLIN1, IL1A, SST, FHL1, PTGS2, BCAT1, DNAJC10, IBTK, ODC1, OR7E38P, TIMM17A, PLDN, TBPL1, PFAS, TTTY15, FAM91A1, SNRPG, SNRPB2, SLMO2, SCFD1, ATP11C, CYCS, CD9, CKS1B, DPM1, UQCRQ, CPSF2, RNF41, PDE4D, HLA-DOB, CSNK1G3, LYSMD3, ADORA2B, SSR1, GALK2, GTF2H3, ZNF410, TXNL2, NUS1, MEF2B, GPD2, AMMECR1L, SLC3A2, MAD2L2, MGAT1, ATP5E, FXN, TAF7, DCK, NCOA1, AKAP8L, CA14, CRSP8, C7orf30, FAM126A, SEC23B, CTBS, BBS12, TRIM32, RAE1, PBEF1, TNFAIP8, C10orf104, PPP2R1B, RNF139, PRDX6, CBX5, ARG2, HOXD8 및 C10orf11로 이루어진 군으로부터 선택된 하나 이상의 폴리뉴클레오티드 또는 그 단편으로서 10개 이상의 연속 뉴클레오티드를 포함하는 폴리뉴클레오티드, SEC24D, WASF1, MTFR1, STT3A, CDKN3, EIF2B3, PTPRZ1, TRIM37, GTF2H2, ATM, FST, G3BP2, TETRAN, MDFIC, ALG14, RPS7, OLFM1, RCN2, IGSF3, HS3ST1, ERLIN1, IL1HL, IL1HL BCAT1, DNAJC10, IBTK, ODC1, OR7E38P, TIMM17A, PLDN, TBPL1, PFAS, TTTY15, FAM91A1, SNRPG, SNRPB2, SLMO2, SCFD1, ATP11C, CYCS, CD9, CKS1B, DPM1, UQCRQ, CPSF2, CPSF2 DOB, CSNK1G3, LYSMD3, ADORA2B, SSR1, GALK2, GTF2H3, ZNF410, TXNL2, NUS1, MEF2B, GPD2, AMMECR1L, SLC3A2, MAD2L2, MGAT1, ATP5E, FXN, TAF7, DCK, NCOSP8 10 or more consecutive nucleotides as one or more polynucleotides or fragments thereof selected from the group consisting of FAM126A, SEC23B, CTBS, BBS12, TRIM32, RAE1, PBEF1, TNFAIP8, C10orf104, PPP2R1B, RNF139, PRDX6, CBX5, ARG2, HOXD8 and C10orf11 Polynucleotides, 또는 그의 상보적 폴리뉴클레오티드; 및 Or a complementary polynucleotide thereof; And 상기 폴리뉴클레오티드를 표면에 결합시킨 고상 지지체를 포함하며, It comprises a solid support that bound the polynucleotide to the surface, 진단 대상 피부 유래 각질형성세포의 전사체 중에서 상기 폴리뉴클레오티드에 혼성화된 전사체의 양이 시간경과에 따라 2배 이상 감소하면 각질화 세포로 판단하는 것을 특징으로 하는 각화 이상 피부질환 진단 키트.A keratinizing skin disease diagnostic kit, characterized in that the amount of transcript hybridized to the polynucleotide in the transcripts of the skin-derived keratinocytes to be diagnosed is determined as keratinized cells if the amount of the transcript hybridized to the polynucleotide decreases over time. Sox9, HSPB1, CEPT1, WRN, CYP3A5, CREG1, KLK8, CSTA, TGM1, SPRR1A, FABP5, LOC728641, BAG3, ADAMTS7, RAB5B, ID3, CBR1, LOC128977, WBP2, SMAP1L, CCNE1, GSN, PIK3C2B, ULK1, FOXD1, ECM1, CLN3, KDELR1, MOBP, PI3, SLPI, GRN, ARPC1A, KLK5, KLK10, GLRX, LCN2, DUSP3, KLK7, TIMP2, RAB11FIP1, SH3KBP1, DDX24, NEU1, CSTB, LOH11CR2A, YPEL2, MMD, MKRN1, HTATIP, IRF6, MYD88, HCFC1R1, PSD4, SEMG1, CDKN1C, COX6B1, JUP, CELSR2, RAI16, PLCD1, ALOX15B, FAT2, SREBF2, ATP8B1, C22orf25, AHCYL1, PARD3, PRPF8, TBC1D9, ANKHD1, SMARCA2 및MAP3K4 로 이루어진 군으로부터 선택된 하나 이상의 폴리뉴클레오티드 또는 그 단편으로서 10개 이상의 연속 뉴클레오티드를 포함하는 폴리뉴클레오티드, Sox9, HSPB1, CEPT1, WRN, CYP3A5, CREG1, KLK8, CSTA, TGM1, SPRR1A, FABP5, LOC728641, BAG3, ADAMTS7, RAB5B, ID3, CBR1, LOC128977, WBP2, SMAP1L, CCNE1, GSNB, PIK3C ECM1, CLN3, KDELR1, MOBP, PI3, SLPI, GRN, ARPC1A, KLK5, KLK10, GLRX, LCN2, DUSP3, KLK7, TIMP2, RAB11FIP1, SH3KBP1, DDX24, NEU1, CSTB, LOH11CR2A, YPMKRN, MMDTA2 A group consisting of IRF6, MYD88, HCFC1R1, PSD4, SEMG1, CDKN1C, COX6B1, JUP, CELSR2, RAI16, PLCD1, ALOX15B, FAT2, SREBF2, ATP8B1, C22orf25, AHCYL1, PARD3, PRPF8, TBC1D9, ANK2MA3 and ANKHDMA, ANK2MA3 Polynucleotides comprising at least 10 contiguous nucleotides as one or more polynucleotides or fragments thereof, 또는 그의 상보적 폴리뉴클레오티드; 및 Or a complementary polynucleotide thereof; And 상기 폴리뉴클레오티드를 표면에 결합시킨 고상 지지체를 포함하며, It comprises a solid support that bound the polynucleotide to the surface, 진단 대상 피부 유래 각질형성세포의 전사체 중에서 상기 폴리뉴클레오티드에 혼성화된 전사체의 양이 시간경과에 따라 2배 이상 증가하면 각질화 세포로 판단하는 것을 특징으로 하는 각화 이상 피부질환 진단 키트.A keratinized skin disease diagnostic kit, characterized in that the amount of transcript hybridized to the polynucleotide in the transcripts of the skin-derived keratinocytes to be diagnosed is determined to be keratinocytes over time. SEC24D, WASF1, MTFR1,STT3A, CDKN3, EIF2B3, PTPRZ1, TRIM37, GTF2H2, ATM, FST, G3BP2, TETRAN, MDFIC, ALG14, RPS7, OLFM1, RCN2, IGSF3, HS3ST1, ERLIN1, IL1A, SST, FHL1, PTGS2, BCAT1, DNAJC10, IBTK, ODC1, OR7E38P, TIMM17A, PLDN, TBPL1, PFAS, TTTY15, FAM91A1, SNRPG, SNRPB2, SLMO2, SCFD1, ATP11C, CYCS, CD9, CKS1B, DPM1, UQCRQ, CPSF2, RNF41, PDE4D, HLA-DOB, CSNK1G3, LYSMD3, ADORA2B, SSR1, GALK2, GTF2H3, ZNF410, TXNL2, NUS1, MEF2B, GPD2, AMMECR1L, SLC3A2, MAD2L2, MGAT1, ATP5E, FXN, TAF7, DCK, NCOA1, AKAP8L, CA14, CRSP8, C7orf30, FAM126A, SEC23B, CTBS, BBS12, TRIM32, RAE1, PBEF1, TNFAIP8, C10orf104, PPP2R1B, RNF139, PRDX6, CBX5, ARG2, HOXD8 및 C10orf11로 이루어진 군으로부터 선택된 폴리뉴클레오티드의 단편으로서 18-22개의 연속 뉴클레오티드를 포함하는 하나 이상의 폴리뉴클레오티드; 및SEC24D, WASF1, MTFR1, STT3A, CDKN3, EIF2B3, PTPRZ1, TRIM37, GTF2H2, ATM, FST, G3BP2, TETRAN, MDFIC, ALG14, RPS7, OLFM1, RCN2, IGSF3, HS3ST1, ERLIN1, IL1HL, IL1HL BCAT1, DNAJC10, IBTK, ODC1, OR7E38P, TIMM17A, PLDN, TBPL1, PFAS, TTTY15, FAM91A1, SNRPG, SNRPB2, SLMO2, SCFD1, ATP11C, CYCS, CD9, CKS1B, DPM1, UQCRQ, CPSF2, CPSF2 DOB, CSNK1G3, LYSMD3, ADORA2B, SSR1, GALK2, GTF2H3, ZNF410, TXNL2, NUS1, MEF2B, GPD2, AMMECR1L, SLC3A2, MAD2L2, MGAT1, ATP5E, FXN, TAF7, DCK, NCOSP8 FAM126A, SEC23B, CTBS, BBS12, TRIM32, RAE1, PBEF1, TNFAIP8, C10orf104, PPP2R1B, RNF139, PRDX6, CBX5, ARG2, HOXD8 and C10orf11 as fragments of polynucleotides selected from the group consisting of 18-22 consecutive nucleotides One or more polynucleotides; And 상기 군으로부터 선택된 폴리뉴클레오티드에 상보적인 폴리뉴클레오티드의 단편으로서 18-22개의 연속 뉴클레오티드를 포함하는 하나 이상의 폴리뉴클레오티드를 포함하며, A fragment of a polynucleotide complementary to a polynucleotide selected from the group comprising one or more polynucleotides comprising 18-22 contiguous nucleotides, 진단 대상 피부 유래 각질형성세포에서 상기 폴리뉴클레오티드들을 프라이머로 하여 증폭된 DNA 양이 시간경과에 따라 2배 이상 감소하면 각질화 세포로 판단하는 것을 특징으로 하는 각화 이상 피부질환 진단 키트.A keratinized skin disease diagnostic kit, characterized in that it is determined as keratinocytes if the amount of DNA amplified by the polynucleotides as primers in the skin-derived keratinocytes to be diagnosed decreases over time. Sox9, HSPB1, CEPT1, WRN, CYP3A5, CREG1, KLK8, CSTA, TGM1, SPRR1A, FABP5, LOC728641, BAG3, ADAMTS7, RAB5B, ID3, CBR1, LOC128977, WBP2, SMAP1L, CCNE1, GSN, PIK3C2B, ULK1, FOXD1, ECM1, CLN3, KDELR1, MOBP, PI3, SLPI, GRN, ARPC1A, KLK5, KLK10, GLRX, LCN2, DUSP3, KLK7, TIMP2, RAB11FIP1, SH3KBP1, DDX24, NEU1, CSTB, LOH11CR2A, YPEL2, MMD, MKRN1, HTATIP, IRF6, MYD88, HCFC1R1, PSD4, SEMG1, CDKN1C, COX6B1, JUP, CELSR2, RAI16, PLCD1, ALOX15B, FAT2, SREBF2, ATP8B1, C22orf25, AHCYL1, PARD3, PRPF8, TBC1D9, ANKHD1, SMARCA2 및MAP3K4로 이루어진 군으로부터 선택된 폴리뉴클레오티드의 단편으로서 18-22개의 연속 뉴클레오티드를 포함하는 하나 이상의 폴리뉴클레오티드; 및 Sox9, HSPB1, CEPT1, WRN, CYP3A5, CREG1, KLK8, CSTA, TGM1, SPRR1A, FABP5, LOC728641, BAG3, ADAMTS7, RAB5B, ID3, CBR1, LOC128977, WBP2, SMAP1L, CCNE1, GSNB, PIK3C ECM1, CLN3, KDELR1, MOBP, PI3, SLPI, GRN, ARPC1A, KLK5, KLK10, GLRX, LCN2, DUSP3, KLK7, TIMP2, RAB11FIP1, SH3KBP1, DDX24, NEU1, CSTB, LOH11CR2A, YPMKRN, MMDTA2 Group consisting of IRF6, MYD88, HCFC1R1, PSD4, SEMG1, CDKN1C, COX6B1, JUP, CELSR2, RAI16, PLCD1, ALOX15B, FAT2, SREBF2, ATP8B1, C22orf25, AHCYL1, PARD3, PRPF8, TBC1D9, ANK2MA3, ANK2MA3, ANK2MA3 At least one polynucleotide comprising 18-22 consecutive nucleotides as a fragment of a polynucleotide; And 상기 군으로부터 선택된 폴리뉴클레오티드에 상보적인 폴리뉴클레오티드의 단편으로서 18-22개의 연속 뉴클레오티드를 포함하는 하나 이상의 폴리뉴클레오티드를 포함하며, A fragment of a polynucleotide complementary to a polynucleotide selected from the group comprising one or more polynucleotides comprising 18-22 contiguous nucleotides, 진단 대상 피부 유래 각질형성세포에서 상기 폴리뉴클레오티드들을 프라이머로 하여 증폭된 DNA 양이 시간경과에 따라 2배 이상 증가하면 각질화 세포로 판단하는 것을 특징으로 하는 각화 이상 피부질환 진단 키트.A keratinized skin disease diagnostic kit, characterized in that the amount of DNA amplified in the skin-derived keratinocytes to be diagnosed as a primer increases more than two times over time. SEC24D, WASF1, MTFR1, STT3A, CDKN3, EIF2B3, PTPRZ1, TRIM37, GTF2H2, ATM, FST, G3BP2, TETRAN, MDFIC, ALG14, RPS7, OLFM1, RCN2, IGSF3, HS3ST1, ERLIN1, IL1A, SST, FHL1, PTGS2, BCAT1, DNAJC10, IBTK, ODC1, OR7E38P, TIMM17A, PLDN, TBPL1, PFAS, TTTY15, FAM91A1, SNRPG, SNRPB2, SLMO2, SCFD1, ATP11C, CYCS, CD9, CKS1B, DPM1, UQCRQ, CPSF2, RNF41, PDE4D, HLA-DOB, CSNK1G3, LYSMD3, ADORA2B, SSR1, GALK2, GTF2H3, ZNF410, TXNL2, NUS1, MEF2B, GPD2, AMMECR1L, SLC3A2, MAD2L2, MGAT1, ATP5E, FXN, TAF7, DCK, NCOA1, AKAP8L, CA14, CRSP8, C7orf30, FAM126A, SEC23B, CTBS, BBS12, TRIM32, RAE1, PBEF1, TNFAIP8, C10orf104, PPP2R1B, RNF139, PRDX6, CBX5, ARG2, HOXD8 및 C10orf11로 이루어진 군으로부터 선택된 유전자에 의하여 코딩되는 폴리펩티드에 대한 하나 이상의 모노클로날 항체를 포함하며, SEC24D, WASF1, MTFR1, STT3A, CDKN3, EIF2B3, PTPRZ1, TRIM37, GTF2H2, ATM, FST, G3BP2, TETRAN, MDFIC, ALG14, RPS7, OLFM1, RCN2, IGSF3, HS3ST1, ERLIN1, IL1HL, IL1HL BCAT1, DNAJC10, IBTK, ODC1, OR7E38P, TIMM17A, PLDN, TBPL1, PFAS, TTTY15, FAM91A1, SNRPG, SNRPB2, SLMO2, SCFD1, ATP11C, CYCS, CD9, CKS1B, DPM1, UQCRQ, CPSF2, CPSF2 DOB, CSNK1G3, LYSMD3, ADORA2B, SSR1, GALK2, GTF2H3, ZNF410, TXNL2, NUS1, MEF2B, GPD2, AMMECR1L, SLC3A2, MAD2L2, MGAT1, ATP5E, FXN, TAF7, DCK, NCOSP8 At least one monoclonal antibody to a polypeptide encoded by a gene selected from the group consisting of FAM126A, SEC23B, CTBS, BBS12, TRIM32, RAE1, PBEF1, TNFAIP8, C10orf104, PPP2R1B, RNF139, PRDX6, CBX5, ARG2, HOXD8 and C10orf11 Including; 진단 대상 피부 유래 각질형성세포에서 상기 항체에 결합된 항원의 양이 시 간경과에 따라 2배 이상 감소하면 각질화 세포로 판단하는 것을 특징으로 하는 각화 이상 피부질환 진단 키트.In the skin-derived keratinocytes to be diagnosed, the amount of antigen bound to the antibody is reduced by two or more times according to the time. Sox9, HSPB1, CEPT1, WRN, CYP3A5, CREG1, KLK8, CSTA, TGM1, SPRR1A, FABP5, LOC728641, BAG3, ADAMTS7, RAB5B, ID3, CBR1, LOC128977, WBP2, SMAP1L, CCNE1, GSN, PIK3C2B, ULK1, FOXD1, ECM1, CLN3, KDELR1, MOBP, PI3, SLPI, GRN, ARPC1A, KLK5, KLK10, GLRX, LCN2, DUSP3, KLK7, TIMP2, RAB11FIP1, SH3KBP1, DDX24, NEU1, CSTB, LOH11CR2A, YPEL2, MMD, MKRN1, HTATIP, IRF6, MYD88, HCFC1R1, PSD4, SEMG1, CDKN1C, COX6B1, JUP, CELSR2, RAI16, PLCD1, ALOX15B, FAT2, SREBF2, ATP8B1, C22orf25, AHCYL1, PARD3, PRPF8, TBC1D9, ANKHD1, SMARCA2 및 MAP3K4로 이루어진 군으로부터 선택된 유전자에 의하여 코딩되는 폴리펩티드에 대한 하나 이상의 모노클로날 항체를 포함하며, Sox9, HSPB1, CEPT1, WRN, CYP3A5, CREG1, KLK8, CSTA, TGM1, SPRR1A, FABP5, LOC728641, BAG3, ADAMTS7, RAB5B, ID3, CBR1, LOC128977, WBP2, SMAP1L, CCNE1, GSNB, PIK3C ECM1, CLN3, KDELR1, MOBP, PI3, SLPI, GRN, ARPC1A, KLK5, KLK10, GLRX, LCN2, DUSP3, KLK7, TIMP2, RAB11FIP1, SH3KBP1, DDX24, NEU1, CSTB, LOH11CR2A, YPMKRN, MMDTA2 Group consisting of IRF6, MYD88, HCFC1R1, PSD4, SEMG1, CDKN1C, COX6B1, JUP, CELSR2, RAI16, PLCD1, ALOX15B, FAT2, SREBF2, ATP8B1, C22orf25, AHCYL1, PARD3, PRPF8, TBC1D9, ANK2, SMK2, ANK2, ANK2 One or more monoclonal antibodies against the polypeptide encoded by the gene, 진단 대상 피부 유래 각질형성세포에서 상기 항체에 결합된 항원의 양이 시간경과에 따라 2배 이상 증가하면 각질화 세포로 판단하는 것을 특징으로 하는 각화 이상 피부질환 진단 키트.A keratinized skin disease diagnostic kit, characterized in that the determination of the keratinocytes when the amount of antigen bound to the antibody in the skin-derived keratinocytes to be diagnosed increases more than two times over time. 각화 이상 피부질환을 진단하는 방법으로서,As a method of diagnosing keratinous skin diseases, 진단 대상 각질형성세포 중의 SEC24D, WASF1, MTFR1, STT3A, CDKN3, EIF2B3, PTPRZ1, TRIM37, GTF2H2, ATM, FST, G3BP2, TETRAN, MDFIC, ALG14, RPS7, OLFM1, RCN2, IGSF3, HS3ST1, ERLIN1, IL1A, SST, FHL1, PTGS2, BCAT1, DNAJC10, IBTK, ODC1, OR7E38P, TIMM17A, PLDN, TBPL1, PFAS, TTTY15, FAM91A1, SNRPG, SNRPB2, SLMO2, SCFD1, ATP11C, CYCS, CD9, CKS1B, DPM1, UQCRQ, CPSF2, RNF41, PDE4D, HLA-DOB, CSNK1G3, LYSMD3, ADORA2B, SSR1, GALK2, GTF2H3, ZNF410, TXNL2, NUS1, MEF2B, GPD2, AMMECR1L, SLC3A2, MAD2L2, MGAT1, ATP5E, FXN, TAF7, DCK, NCOA1, AKAP8L, CA14, CRSP8, C7orf30, FAM126A, SEC23B, CTBS, BBS12, TRIM32, RAE1, PBEF1, TNFAIP8, C10orf104, PPP2R1B, RNF139, PRDX6, CBX5, ARG2, HOXD8 및 C10orf11 유전자로 이루어진 군으로부터 선택되는 하나 이상의 유전자의 발현량이 시간경과에 따라 2배 이상 감소하면 각질화 세포로 판단하는 것을 특징으로 하는 각화 이상 피부질환 진단 방법. SEC24D, WASF1, MTFR1, STT3A, CDKN3, EIF2B3, PTPRZ1, TRIM37, GTF2H2, ATM, FST, G3BP2, TETRAN, MDFIC, ALG14, RPS7, OLFM1, RCN2, IGSF3, HS1ST1, ERL SST, FHL1, PTGS2, BCAT1, DNAJC10, IBTK, ODC1, OR7E38P, TIMM17A, PLDN, TBPL1, PFAS, TTTY15, FAM91A1, SNRPG, SNRPB2, SLMO2, SCFD1, ATP11C, CYCS, CD9, CKSSFB, DPM RNF41, PDE4D, HLA-DOB, CSNK1G3, LYSMD3, ADORA2B, SSR1, GALK2, GTF2H3, ZNF410, TXNL2, NUS1, MEF2B, GPD2, AMMECR1L, SLC3A2, MAD2L2, MGAT1, ATPNF, AKN, NF Expression amounts of one or more genes selected from the group consisting of one or more genes selected from the group consisting of CA14, CRSP8, C7orf30, FAM126A, SEC23B, CTBS, BBS12, TRIM32, RAE1, PBEF1, TNFAIP8, C10orf104, PPP2R1B, RNF139, PRDX6, CBX5, ARG2, HOXD8 and C10orf11 genes A method for diagnosing keratinous skin disease, characterized in that if the reduction is more than two times as time passes, it is determined as keratinocytes. 각화 이상 피부질환을 진단하는 방법으로서, As a method of diagnosing keratinous skin diseases, 진단 대상 각질형성세포 중의 Sox9, HSPB1, CEPT1, WRN, CYP3A5, CREG1, KLK8, CSTA, TGM1, SPRR1A, FABP5, LOC728641, BAG3, ADAMTS7, RAB5B, ID3, CBR1, LOC128977, WBP2, SMAP1L, CCNE1, GSN, PIK3C2B, ULK1, FOXD1, ECM1, CLN3, KDELR1, MOBP, PI3, SLPI, GRN, ARPC1A, KLK5, KLK10, GLRX, LCN2, DUSP3, KLK7, TIMP2, RAB11FIP1, SH3KBP1, DDX24, NEU1, CSTB, LOH11CR2A, YPEL2, MMD, MKRN1, HTATIP, IRF6, MYD88, HCFC1R1, PSD4, SEMG1, CDKN1C, COX6B1, JUP, CELSR2, RAI16, PLCD1, ALOX15B, FAT2, SREBF2, ATP8B1, C22orf25, AHCYL1, PARD3, PRPF8, TBC1D9, ANKHD1, SMARCA2 및MAP3K4 유전자로 이루어진 군으로부터 선택되는 하나 이상의 유전자의 발현량이 시간경과에 따라 2배 이상 증가하면 각질화 세포로 판단 하는 것을 특징으로 하는 각화 이상 피부질환 진단 방법. Sox9, HSPB1, CEPT1, WRN, CYP3A5, CREG1, KLK8, CSTA, TGM1, SPRR1A, FABP5, LOC728641, BAG3, ADAMTS7, RAB5B, ID3, CBR1, LOC128977, WBP2, SMAP1LSN, CCNE1 PIK3C2B, ULK1, FOXD1, ECM1, CLN3, KDELR1, MOBP, PI3, SLPI, GRN, ARPC1A, KLK5, KLK10, GLRX, LCN2, DUSP3, KLK7, TIMP2, RAB11FIP1, SH3KBP1, DDX24, NEUEL 2TB MMD, MKRN1, HTATIP, IRF6, MYD88, HCFC1R1, PSD4, SEMG1, CDKN1C, COX6B1, JUP, CELSR2, RAI16, PLCD1, ALOX15B, FAT2, SREBF2, ATP8B1, C22orf25, AHCYL1, PARNK, DARCABC A method for diagnosing keratinous skin disease, characterized in that it is determined as keratinocytes when the expression level of one or more genes selected from the group consisting of MAP3K4 gene increases more than two times with time. 제7항 또는 제8항에 있어서, 상기 각화 이상 피부질환 진단 방법은 노던블로팅 (Northern Blot analysis), 역전사중합효소연쇄반응 (reverse transcriptase polymerase chain reaction), 웨스턴블로팅 (Western blot analysis) 및 엘라이자 (ELISA) 로 구성된 군으로부터 선택되는 하나 이상의 방법을 사용하여 유전자의 발현량을 측정하는 것을 특징으로 하는 각화 이상 피부질환 진단 방법.The method of claim 7 or 8, wherein the method for diagnosing keratinous skin disease is performed by Northern Blot analysis, reverse transcriptase polymerase chain reaction, Western blot analysis, and Ella. A method for diagnosing keratinous skin disease, characterized in that the expression level of the gene is measured using at least one method selected from the group consisting of ELISA. 각질형성세포 이상 분화 방지제의 스크리닝 방법으로서,As a method of screening an agent for preventing differentiation of keratinocytes, SEC24D, WASF1, MTFR1, STT3A, CDKN3, EIF2B3, PTPRZ1, TRIM37, GTF2H2, ATM, FST, G3BP2, TETRAN, MDFIC, ALG14, RPS7, OLFM1, RCN2, IGSF3, HS3ST1, ERLIN1, IL1A, SST, FHL1, PTGS2, BCAT1, DNAJC10, IBTK, ODC1, OR7E38P, TIMM17A, PLDN, TBPL1, PFAS, TTTY15, FAM91A1, SNRPG, SNRPB2, SLMO2, SCFD1, ATP11C, CYCS, CD9, CKS1B, DPM1, UQCRQ, CPSF2, RNF41, PDE4D, HLA-DOB, CSNK1G3, LYSMD3, ADORA2B, SSR1, GALK2, GTF2H3, ZNF410, TXNL2, NUS1, MEF2B, GPD2, AMMECR1L, SLC3A2, MAD2L2, MGAT1, ATP5E, FXN, TAF7, DCK, NCOA1, AKAP8L, CA14, CRSP8, C7orf30, FAM126A, SEC23B, CTBS, BBS12, TRIM32, RAE1, PBEF1, TNFAIP8, C10orf104, PPP2R1B, RNF139, PRDX6, CBX5, ARG2, HOXD8 및 C10orf11 로 이루어진 군으로부터 선택되는 하나 이상의 유전자에 의하여 코딩되는 단백질에 시험 화합물을 결합시키는 단계; 및SEC24D, WASF1, MTFR1, STT3A, CDKN3, EIF2B3, PTPRZ1, TRIM37, GTF2H2, ATM, FST, G3BP2, TETRAN, MDFIC, ALG14, RPS7, OLFM1, RCN2, IGSF3, HS3ST1, ERLIN1, IL1HL, IL1HL BCAT1, DNAJC10, IBTK, ODC1, OR7E38P, TIMM17A, PLDN, TBPL1, PFAS, TTTY15, FAM91A1, SNRPG, SNRPB2, SLMO2, SCFD1, ATP11C, CYCS, CD9, CKS1B, DPM1, UQCRQ, CPSF2, CPSF2 DOB, CSNK1G3, LYSMD3, ADORA2B, SSR1, GALK2, GTF2H3, ZNF410, TXNL2, NUS1, MEF2B, GPD2, AMMECR1L, SLC3A2, MAD2L2, MGAT1, ATP5E, FXN, TAF7, DCK, NCOSP8 Test compounds are bound to proteins encoded by one or more genes selected from the group consisting of FAM126A, SEC23B, CTBS, BBS12, TRIM32, RAE1, PBEF1, TNFAIP8, C10orf104, PPP2R1B, RNF139, PRDX6, CBX5, ARG2, HOXD8 and C10orf11. Making a step; And 상기 시험 화합물이 상기 단백질의 작용을 촉진하는지를 확인하는 단계를 포함하는 것을 특징으로 하는 각질형성세포 이상 분화 방지제 스크리닝 방법.A method for screening keratinocyte abnormality differentiation inhibitors, the method comprising: checking whether the test compound promotes the action of the protein. 각질형성세포 이상 분화 방지제의 스크리닝 방법으로서,As a method of screening an agent for preventing differentiation of keratinocytes, Sox9, HSPB1, CEPT1, WRN, CYP3A5, CREG1, KLK8, CSTA, TGM1, SPRR1A, FABP5, LOC728641, BAG3, ADAMTS7, RAB5B, ID3, CBR1, LOC128977, WBP2, SMAP1L, CCNE1, GSN, PIK3C2B, ULK1, FOXD1, ECM1, CLN3, KDELR1, MOBP, PI3, SLPI, GRN, ARPC1A, KLK5, KLK10, GLRX, LCN2, DUSP3, KLK7, TIMP2, RAB11FIP1, SH3KBP1, DDX24, NEU1, CSTB, LOH11CR2A, YPEL2, MMD, MKRN1, HTATIP, IRF6, MYD88, HCFC1R1, PSD4, SEMG1, CDKN1C, COX6B1, JUP, CELSR2, RAI16, PLCD1, ALOX15B, FAT2, SREBF2, ATP8B1, C22orf25, AHCYL1, PARD3, PRPF8, TBC1D9, ANKHD1, SMARCA2 및MAP3K4로 이루어진 군으로부터 선택되는 하나 이상의 유전자에 의하여 코딩되는 단백질에 시험 화합물을 결합시키는 단계; 및Sox9, HSPB1, CEPT1, WRN, CYP3A5, CREG1, KLK8, CSTA, TGM1, SPRR1A, FABP5, LOC728641, BAG3, ADAMTS7, RAB5B, ID3, CBR1, LOC128977, WBP2, SMAP1L, CCNE1, GSNB, PIK3C ECM1, CLN3, KDELR1, MOBP, PI3, SLPI, GRN, ARPC1A, KLK5, KLK10, GLRX, LCN2, DUSP3, KLK7, TIMP2, RAB11FIP1, SH3KBP1, DDX24, NEU1, CSTB, LOH11CR2A, YPMKRN, MMDTA2 Group consisting of IRF6, MYD88, HCFC1R1, PSD4, SEMG1, CDKN1C, COX6B1, JUP, CELSR2, RAI16, PLCD1, ALOX15B, FAT2, SREBF2, ATP8B1, C22orf25, AHCYL1, PARD3, PRPF8, TBC1D9, ANK2MA3 and ANK2MA3 Binding the test compound to a protein encoded by one or more genes; And 상기 시험 화합물이 상기 단백질의 작용을 억제하는지를 확인하는 단계를 포함하는 것을 특징으로 하는 각질형성세포 이상 분화 방지제 스크리닝 방법.Method for screening a keratinocyte abnormality differentiation inhibitor comprising the step of confirming whether the test compound inhibits the action of the protein. 각질형성세포 이상 분화 방지제를스크리닝하는 방법으로서,As a method of screening an agent for differentiating keratinocyte abnormalities, Nrf-2, Nkx-2.5, AP-1, MEIS1A/HOXA9, MEIS1B/HOXA9, CREB, ISRE-BP, Hand1/E47, Pax-6, c-Myb, v-Maf, Elk-1, E47, CRE-BP1, IRF-1, IRF-2, c-Rel, c-Ets-1(p54), USF, VBP, Hox-1.3, Brn-2, COMP1-factor, CDP_CR1, CP2 및 NF-kB (p50) 로 이루어진 군으로부터 선택된 유전자 및 유니버설(universal) 프로모터를 포함하는 플라스미드, 및Nrf-2, Nkx-2.5, AP-1, MEIS1A / HOXA9, MEIS1B / HOXA9, CREB, ISRE-BP, Hand1 / E47, Pax-6, c-Myb, v-Maf, Elk-1, E47, CRE- With BP1, IRF-1, IRF-2, c-Rel, c-Ets-1 (p54), USF, VBP, Hox-1.3, Brn-2, COMP1-factor, CDP_CR1, CP2 and NF-kB (p50) Plasmids comprising genes selected from the group consisting of and universal promoters, and 상기 선택된 유전자에 의해 코딩되는 전사인자가 결합하는 DNA서열 및 리포터 유전자를 포함하는 플라스미드를 세포에 트랜스펙션시키는 단계;Transfecting a cell with a plasmid comprising a DNA sequence and a reporter gene to which the transcription factor encoded by the selected gene binds; 상기 세포에 시험 화합물을 처리하는 단계; 및Treating the cell with a test compound; And 상기 시험 화합물이 상기 리포터 유전자의 발현을 촉진하는지 여부를 확인하는 단계를 포함하는 것을 특징으로 하는 각질형성세포 이상 분화 방지제 스크리닝 방법. Method for screening a keratinocyte aberration differentiation inhibitor, characterized in that it comprises the step of confirming whether the test compound promotes the expression of the reporter gene. 제12항에 있어서, 상기 선택된 유전자는 Pax-6또는 Nkx-2.5이고, 상기 각질형성세포 이상 분화방지제는 건선 치료제인 것을 특징으로 하는 각질형성세포 이상 분화 방지제 스크리닝 방법. The method of claim 12, wherein the selected gene is Pax-6 or Nkx-2.5, and the keratinocyte dysplasia inhibitor is a psoriasis treatment agent.
KR1020070092824A 2007-09-12 2007-09-12 Method and kit for diagnosis of abnormal keratinization KR100947739B1 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
KR1020070092824A KR100947739B1 (en) 2007-09-12 2007-09-12 Method and kit for diagnosis of abnormal keratinization

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
KR1020070092824A KR100947739B1 (en) 2007-09-12 2007-09-12 Method and kit for diagnosis of abnormal keratinization

Related Child Applications (1)

Application Number Title Priority Date Filing Date
KR1020100005900A Division KR101231544B1 (en) 2010-01-22 2010-01-22 Method and kit for diagnosis of abnormal keratinization

Publications (2)

Publication Number Publication Date
KR20090027537A true KR20090027537A (en) 2009-03-17
KR100947739B1 KR100947739B1 (en) 2010-03-17

Family

ID=40695127

Family Applications (1)

Application Number Title Priority Date Filing Date
KR1020070092824A KR100947739B1 (en) 2007-09-12 2007-09-12 Method and kit for diagnosis of abnormal keratinization

Country Status (1)

Country Link
KR (1) KR100947739B1 (en)

Cited By (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN102735831A (en) * 2012-05-21 2012-10-17 中国人民解放军第二军医大学 Uses of truncated retinoic acid induced protein 16 (tRAI16) as hepatocellular carcinoma marker
CN102749453A (en) * 2012-05-09 2012-10-24 中国人民解放军第二军医大学 Applications of retinoic acid induced protein 16 (RAI16) as hepatocellular carcinoma marker
CN108913767A (en) * 2018-07-20 2018-11-30 中南大学湘雅医院 A kind of Parkinson's disease Disease-causing gene, kit and application
CN109942685A (en) * 2019-03-13 2019-06-28 中山大学附属第五医院 Using the polypeptide of bacterial display library screening specific bond DDX24 unwindase
WO2021118243A1 (en) * 2019-12-10 2021-06-17 아주대학교산학협력단 Composition employing wasf2 autoantibody for early diagnosis of hepatocellular carcinoma
CN112980879A (en) * 2021-02-23 2021-06-18 四川省人民医院 Construction method and application of retinal vascular disease model
CN114164263A (en) * 2020-09-11 2022-03-11 复旦大学附属华山医院 Gene marker for predicting clinical curative effect of methotrexate by MAPK4 gene polymorphism and detection kit

Families Citing this family (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR102635297B1 (en) 2016-09-23 2024-02-13 (주)아모레퍼시픽 A composition for skin barrier function comprising LINC00302 promoting materials and a method for screening LINC00302 promoting materials
KR102610932B1 (en) 2016-09-23 2023-12-08 (주)아모레퍼시픽 A composition for skin barrier function comprising CARD18 promoting materials and a method for screening CARD18 promoting materials

Family Cites Families (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6989247B2 (en) 2000-11-28 2006-01-24 Celltech R & D, Inc. Compositions and methods for diagnosing or treating psoriasis
US20030232356A1 (en) 2002-02-08 2003-12-18 Dooley Thomas P. Skin cell biomarkers and methods for identifying biomarkers using nucleic acid microarrays

Cited By (9)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN102749453A (en) * 2012-05-09 2012-10-24 中国人民解放军第二军医大学 Applications of retinoic acid induced protein 16 (RAI16) as hepatocellular carcinoma marker
CN102749453B (en) * 2012-05-09 2014-07-23 中国人民解放军第二军医大学 Applications of retinoic acid induced protein 16 (RAI16) as hepatocellular carcinoma marker
CN102735831A (en) * 2012-05-21 2012-10-17 中国人民解放军第二军医大学 Uses of truncated retinoic acid induced protein 16 (tRAI16) as hepatocellular carcinoma marker
CN102735831B (en) * 2012-05-21 2014-07-23 中国人民解放军第二军医大学 Uses of truncated retinoic acid induced protein 16 (tRAI16) as hepatocellular carcinoma marker
CN108913767A (en) * 2018-07-20 2018-11-30 中南大学湘雅医院 A kind of Parkinson's disease Disease-causing gene, kit and application
CN109942685A (en) * 2019-03-13 2019-06-28 中山大学附属第五医院 Using the polypeptide of bacterial display library screening specific bond DDX24 unwindase
WO2021118243A1 (en) * 2019-12-10 2021-06-17 아주대학교산학협력단 Composition employing wasf2 autoantibody for early diagnosis of hepatocellular carcinoma
CN114164263A (en) * 2020-09-11 2022-03-11 复旦大学附属华山医院 Gene marker for predicting clinical curative effect of methotrexate by MAPK4 gene polymorphism and detection kit
CN112980879A (en) * 2021-02-23 2021-06-18 四川省人民医院 Construction method and application of retinal vascular disease model

Also Published As

Publication number Publication date
KR100947739B1 (en) 2010-03-17

Similar Documents

Publication Publication Date Title
KR100947739B1 (en) Method and kit for diagnosis of abnormal keratinization
US20200095642A1 (en) Grading of breast cancer
EP2518166B1 (en) Thyroid fine needle aspiration molecular assay
JP6174303B2 (en) Urine marker for detecting bladder cancer
EP2333112B1 (en) Breast cancer prognostics
DK2771481T3 (en) MARKET GENERATIONS FOR CLASSIFICATION OF PROSTATACANCES
Difilippantonio et al. Gene expression profiles in human non-small and small-cell lung cancers
US20110224313A1 (en) Compositions and methods for classifying lung cancer and prognosing lung cancer survival
US20120295815A1 (en) Diagnostic gene expression platform
Cohen et al. Transcriptomic analysis of postmortem brain identifies dysregulated splicing events in novel candidate genes for schizophrenia
Mohelnikova-Duchonova et al. Evaluation of reference genes and normalization strategy for quantitative real-time PCR in human pancreatic carcinoma
US6593084B2 (en) Carcinogen assay
WO2002031209A2 (en) Genes related to development of refractory prostate cancer
CA2806726A1 (en) Prediction of and monitoring cancer therapy response based on gene expression profiling
KR101109739B1 (en) Markers for detecting overproduction of melanin and use thereof
US20150038351A1 (en) Gene Signatures That Predispose Or Protect Individuals From Low-Dose Radiation Induced Breast Cancer Or Are Associated with Disease-Free Survival
KR101263140B1 (en) Method and kit for diagnosis of abnormal keratinization
KR101231544B1 (en) Method and kit for diagnosis of abnormal keratinization
EP2092087B1 (en) Prognostic markers for classifying colorectal carcinoma on the basis of expression profiles of biological samples
US10969390B2 (en) Method for evaluating efficacy of chemoradiotherapy against squamous cell carcinoma
KR101192923B1 (en) Method for diagnosis of abnormal keratinization
AU2010277532A1 (en) Processes and methods for diagnosis of Alzheimer&#39;s disease
KR100892587B1 (en) Composition For Cancer diagnosis Containing Methylated Promoters of Colon Cancer Specific Expression-decreased Genes and Use Thereof
Barraclough et al. Microarray analysis of suppression subtracted hybridisation libraries identifies genes associated with breast cancer progression
EP1682679B1 (en) Molecular marker

Legal Events

Date Code Title Description
A201 Request for examination
E902 Notification of reason for refusal
AMND Amendment
E601 Decision to refuse application
J201 Request for trial against refusal decision
A107 Divisional application of patent
AMND Amendment
B701 Decision to grant
GRNT Written decision to grant
FPAY Annual fee payment

Payment date: 20130227

Year of fee payment: 4

FPAY Annual fee payment

Payment date: 20140228

Year of fee payment: 5

FPAY Annual fee payment

Payment date: 20150302

Year of fee payment: 6

FPAY Annual fee payment

Payment date: 20160223

Year of fee payment: 7

FPAY Annual fee payment

Payment date: 20161228

Year of fee payment: 8

FPAY Annual fee payment

Payment date: 20171222

Year of fee payment: 9

FPAY Annual fee payment

Payment date: 20190102

Year of fee payment: 10

FPAY Annual fee payment

Payment date: 20200102

Year of fee payment: 11