KR102635297B1 - A composition for skin barrier function comprising LINC00302 promoting materials and a method for screening LINC00302 promoting materials - Google Patents

Abstract

Disclosed herein are a composition for strengthening skin barrier function containing a LINC00302 expression or activity promoting substance as an active ingredient and a screening method for the LINC00302 expression or activity promoting substance. A composition containing the LINC00302 expression or activity promoting substance as an active ingredient can strengthen the skin barrier function and provide skin moisturizing or antioxidant effects. In addition, according to the above screening method, it is possible to easily screen for substances that enhance skin barrier function by confirming the relative expression promotion level of the LINC00302 gene.

Description

Composition for strengthening skin barrier function comprising LINC00302 expression promoting material and screening method for LINC00302 promoting material {A composition for skin barrier function comprising LINC00302 promoting materials and a method for screening LINC00302 promoting materials}

This specification relates to a composition for strengthening the skin barrier function and a method for screening substances for enhancing the skin barrier function.

The most important function of the epidermis, located in the outermost layer of skin, is to protect the skin from various external stimuli, such as physical and chemical irritants such as chemicals, air pollutants, dry environments, and ultraviolet rays. It is a protective function that prevents excessive dissipation of body moisture through the body, and this protective function can be maintained only when the stratum corneum, composed of keratinocytes, is normally formed. The stratum corneum (horney layer), the outermost layer of the epidermis, is formed from keratinocytes and consists of fully differentiated keratinocytes and a lipid layer surrounding them. Keratinocytes are characteristic cells that rise to the surface of the skin as basal cells that continuously proliferate in the lowest layer of the epidermis undergo gradual changes in form and function. After a certain period of time, old keratinocytes are removed from the skin. They fall off and new keratinocytes take over their function. This repetitive series of changes is called differentiation or keratinization of epidermal cells. However, if this keratinization process occurs abnormally excessively or new cells rise from the basal cells and become keratinocytes repeatedly, the skin loses its skin barrier function, resulting in increased moisture evaporation from the skin and dryness. It becomes ruined.

Republic of Korea Patent Publication No. 10-0947739 (March 17, 2010) Republic of Korea Patent Publication No. 10-2015-0139298 (2015.12.11)

In one aspect, the purpose of the present invention is to provide a marker for identifying a novel skin barrier function enhancing material that regulates skin keratin differentiation.

In another aspect, an object of the present invention is to provide a method for screening a skin barrier function enhancing substance using the skin barrier function enhancing substance discrimination marker.

In another aspect, an object of the present invention is to provide a composition for strengthening the skin barrier function that includes a substance that promotes the expression or activity of the skin barrier function enhancing substance discrimination marker as an active ingredient.

In another aspect, the purpose of the present invention is to provide a method of providing basic information for diagnosing skin conditions related to skin barrier function using the skin barrier function enhancing substance discrimination marker.

In another aspect, an object of the present invention is to provide a composition or kit for diagnosing skin conditions related to skin barrier function using the skin barrier function enhancing substance discrimination marker.

One aspect of the present invention provides a method for screening substances that enhance skin barrier function, comprising treating skin cells with a test substance and measuring the relative expression level of LINC00302 in skin cells treated with the test substance.

One aspect of the present invention provides a composition for strengthening the skin barrier function containing a substance that promotes the expression or activity of LINC00302 as an active ingredient.

One aspect of the present invention provides a method of providing basic information for diagnosing skin conditions related to skin barrier function, including measuring the expression level of LINC00302 in skin cells isolated from a test subject.

One aspect of the present invention provides a kit for diagnosing skin conditions related to skin barrier function, including the RNA detection reagent of LINC00302.

One aspect of the present invention provides a composition for diagnosing skin conditions related to skin barrier function, including the RNA detection reagent of LINC00302.

The expression level of LINC00302, a marker for identifying a novel skin barrier function enhancing material according to one aspect of the present invention, increases with the differentiation of keratinocytes. Therefore, using the technology disclosed in this specification, it is possible to simply and efficiently screen for skin barrier function enhancing substances by treating the skin with a test substance and confirming the relative expression promotion level of the LINC00302 gene. In addition, the screened skin barrier function enhancing substances can be usefully used to strengthen the skin barrier function, moisturize the skin, or improve and strengthen the skin antioxidant function. In addition, according to one aspect of the present invention, skin conditions related to skin barrier function can be quickly and simply diagnosed through detection of the LINC00302 gene contained in the skin, and through this, problems with skin barrier function can be predicted or determined early and responded to. You can.

Figure 1 is a diagram showing the relative LINC00302 RNA expression level according to differentiation of keratinocytes.
Figure 2 is a diagram confirming the decrease in skin barrier function markers filaggrin (FLG), involucrin (IVL), and loricrin (LOR) in keratinocytes due to inhibition of expression of the LINC00302 gene.
Figure 3 is a diagram confirming that the relative expression level of the LINC00302 gene increases when a skin barrier function enhancing substance (red rice extract) is applied to keratinocytes.

Hereinafter, the present invention will be described in detail.

In this specification, “skin” refers to an organ that covers the outside of a living thing, and is composed of the epidermis, dermis, and subcutaneous fat layer, and is the broadest concept to include the scalp and hair as well as tissues covering the outside of the face or the entire body. am.

In this specification, “gene expression” is the broadest concept including transcription, translation, and post-translational modification.

One embodiment of the present invention can provide a method for screening skin barrier function enhancing substances using LINC00302.

As an example, the method includes (a) treating skin cells with a test substance; and

(b) It may include measuring the relative expression level of LINC00302 (Long intergenic non-protein coding RNA 302) in skin cells treated with the test substance.

As an example, the skin cells may be skin cells derived from humans, mice, guinea pigs, pigs, birds, etc. The skin cells may include keratinocytes. In another aspect, the skin cells may include normal human skin keratinocytes.

In one embodiment of the present invention, the "relative expression level" is a comparison of the expression level of LINC00302 in keratinocytes after treatment with the test substance to the expression level of LINC00302 in keratinocytes before treatment with the test substance. It may be that the expression is promoted. Alternatively, “relative expression level” may be the degree to which expression is promoted when comparing the expression level of LINC00302 in keratinocytes treated with the test substance with the expression level of LINC00302 in keratinocytes not treated with the test substance. The relative expression level may include, for example, the relative expression level of RNA.

From the above perspective, step (b) according to one embodiment may include comparing the expression level of LINC00302 before and after treatment of the test substance in keratinocytes. Alternatively, as an example, step (b) may include comparing the expression level of LINC00302 in keratinocytes treated with the test substance and keratinocytes not treated with the test substance.

In addition, one embodiment may further include the step of determining the test substance as a skin barrier function enhancing substance when the expression level of LINC00302 increases as a result of measuring the relative expression level in step (b).

As an example, the RNA sequence of LINC00302 (Long intergenic non-protein coding RNA 302) is ENST00000536536.1 and can be more specifically represented by the nucleotide sequence of SEQ ID NO: 1 below. (http://www.lncipedia.org/db/transcript/LINC00302:1)

GCCTGCTCCACACCTGGGTCTGACCAGGGTGAGTGGATCTTTTGGAACCTAGACAGAGCACAACTGAAAGGGTTGACTGAACTCCCACAAAGATGTCCTGCACCAGTCTCATGCATCTCGTTCATCAGTGCCTTTCATACCTTCAAGAGCTCTTGCCTCAGAGCATTGCTATGCCTGAGGTGTGTCTCAGAAGCAGCCATTGGCACAGTGGCTTGGGGCTGGGCTCAAAAATTTGCTCTCTTGAAGTTTGGATGTGATT GCTCTGAACAAGCTGCTGCTTTGCCACAATAAATATTTTCAAGTTT

The method for screening substances for enhancing skin barrier function according to an embodiment of the present invention is to detect at least one selected from the group consisting of Filaggrin, Involucrin, and Loricrin from skin cells treated with the test substance. A step of measuring the relative expression level of genes may be further included. In addition, as an example, when the relative expression level of one or more genes selected from the group consisting of Filaggrin, Involucrin, and Loricrin increases, the test substance is used as a skin barrier function strengthening substance. A judgment step may be further included.

The stratum corneum, which forms the outermost layer of the skin barrier, is composed of natural moisturizing factors and lipids. Filaggrin is a protein related to attachment to keratin fibers present in epidermal cells and promotes the final differentiation of the epidermis. It is decomposed into various types of hydrophilic amino acids through a post-transcriptional modification process, and the amino acid pool constitutes natural moisturizing factor (NMF), which helps maintain moisture in the stratum corneum. It is known. In addition, filaggrin gene mutation reduces skin moisturizing factors, impairs skin barrier function, reduces skin defense ability against allergens and microbes, and activates T cell population, resulting in chronic inflammation caused by an autoimmune mechanism. It is also known to be an important genetic risk factor that causes chronic inflammation and induces atopic eczema. Involucrin is one of the elements that form the crosslink of keratinocytes and is found in the cytoplasm, and is connected to membrane proteins by transglutaminase. Loricrin is one of the major proteins found in the cornified envelope and is mainly expressed in terminally differentiated epidermal cells.

The relationship between LINC00302 and skin barrier function has not yet been known, but through research, the inventors of the present invention found that the expression of the LINC00302 gene increases as skin keratinocytes differentiate. In addition, as an example, when LINC00302 is knocked down from differentiated keratinocytes, skin barrier function markers such as Filaggrin, Involucrin, and Loricrin The expression level of etc. is reduced. This means that LINC00302 can function as a marker for determining skin barrier function enhancing substances.

As an embodiment of the present invention, the step of determining that the substance is a skin barrier function enhancing substance may include determining that the substance is a skin barrier function enhancing substance when the "relative expression level" increases by about 1.1 to 2 times or more. That is, when comparing the expression level of LINC00302 in keratinocytes after treatment with the expression level of LINC00302 in keratinocytes before treatment with the test substance, if the expression increases by about 1.1 to 2 times or more, the skin It can be judged as a barrier function enhancing material. Alternatively, when the expression level of LINC00302 in keratinocytes treated with the test substance is compared with the expression level of LINC00302 in keratinocytes not treated with the test substance, if the expression increases by about 1.1 to 2 times or more, the skin barrier It can be judged as a functional enhancing substance. For example, the degree of increase in the relative expression level of LINC00302 is 1.1-fold or more, 1.2-fold or more, 1.3-fold or more, 1.4-fold or more, 1.5-fold or more, 1.6-fold or more, 1.7-fold or more, 1.8-fold or more, 1.9-fold or more, Or it may be twice or more, but is not limited thereto. The expression level is a result measured with statistical significance secured. The concept of statistical significance refers to cases where a significant difference is shown through biological statistical analysis methods, and in quantitative cases, it includes cases where the p value is less than 0.05.

In step (a) according to one embodiment, the test substance may be transfected into a liposome or vector of a cell, and the cell may be a keratinocyte, that is, a keratinocyte. . The transfection may be performed using microinjection, calcium phosphate co-precipitation, electroporation, or liposome use, but is not limited thereto.

In addition, as an example, the expression level of LINC00302 can be confirmed using known techniques, such as reverse transcription polymerase chain reaction (RT-PCR), ELISA, Western blot or immune blot. It can be done, but is not limited to this.

As an example, a decrease in skin barrier function may indicate poor skin cell differentiation, which may mean that the stratum corneum of the skin cannot function normally and antioxidant capacity is reduced. In this case, the skin's ability to retain moisture may decrease, and skin inflammation and skin dryness may occur. Therefore, the substance that promotes skin cell differentiation can have the effect of moisturizing the skin, strengthening the skin barrier function, and alleviating or treating atopic symptoms. That is, the skin barrier function enhancing material according to an embodiment of the present invention may mean a skin moisturizing material, a skin antioxidant material, etc.

One embodiment of the present invention can provide a composition for strengthening the skin barrier function containing a substance that promotes the expression or activity of LINC00302 as an active ingredient.

In one embodiment, the material that promotes the expression or activity of LINC00302 may include a material that promotes translation of LINC00302 RNA. In another embodiment, the substance that promotes the expression or activity of LINC00302 may include a skin barrier function enhancing substance screened according to the skin barrier function enhancing substance screening method described above.

The composition according to an embodiment of the present invention may include 0.00001 to 30% by weight of a substance that promotes the expression or activity of LINC00302 based on the total weight of the composition.

By promoting the expression or activity of LINC00302 according to the embodiments described herein, the differentiation of keratinocytes can be regulated to restore the skin's normal skin barrier function. Accordingly, as an example, the composition may include one or more of skin moisturizing and antioxidant purposes.

Additionally, the composition according to an embodiment of the present invention may be a composition for external application to the skin, and more specifically, may include a cosmetic composition or a pharmaceutical composition.

As an example, the cosmetic composition may be provided in any formulation suitable for topical application. For example, it may be provided in the form of a solution, an emulsion obtained by dispersing an oil phase in an aqueous phase, an emulsion obtained by dispersing an aqueous phase in an oil phase, a suspension, solid, gel, powder, paste, foam, or aerosol composition. Compositions of this dosage form can be prepared according to conventional methods in the art.

As an example, the cosmetic composition may contain other ingredients in addition to the above-mentioned substances, preferably within a range that does not impair the main effect, and can have a synergistic effect on the main effect. The cosmetic composition according to the present invention may contain a substance selected from the group consisting of vitamins, high molecular weight peptides, high molecular weight polysaccharides, and sphingolipids. In addition, the cosmetic composition may include, as an example, a moisturizer, an emollient, a surfactant, an ultraviolet absorber, a preservative, a disinfectant, an antioxidant, a pH adjuster, an organic and inorganic pigment, a fragrance, a coolant, or an antiperspirant. You can. The mixing amount of the above components can be easily selected by a person skilled in the art within the range that does not impair the purpose and effect of the present invention, and the mixing amount may be 0.01 to 5% by weight, specifically 0.01 to 3% by weight, based on the total weight of the composition. there is.

As an example, the pharmaceutical composition may be used for the prevention or treatment of diseases caused by weakened skin barrier function, for example, for the prevention or treatment of dry skin, atopy, etc.

Additionally, as an example, the pharmaceutical composition may be provided in any formulation suitable for topical application. For example, it can be administered orally, transdermally, intravenously, intramuscularly, or by subcutaneous injection. As an example, the pharmaceutical composition may be an injection, a solution for external use on the skin, a suspension, an emulsion, a gel, a patch, or a spray, but is not limited thereto. The formulation can be easily prepared according to conventional methods in the field, and contains surfactants, excipients, wetting agents, emulsification accelerators, suspending agents, salts or buffers for adjusting osmotic pressure, colorants, flavorings, stabilizers, preservatives, preservatives or Other commonly used supplements can be used appropriately.

The active ingredient of the pharmaceutical composition according to an embodiment of the present invention will vary depending on the subject's age, gender, weight, pathological condition and severity, route of administration, or the judgment of the prescriber. Determination of application dosage based on these factors is within the level of one skilled in the art, the daily usage dosage being, for example, 0.1 mg/kg/day to 5000 mg/kg/day, more specifically 50 mg/kg/day to 500 mg/kg. /It may be work, but is not limited to this.

Since one embodiment of the present invention can provide LINC00302 as a biomarker capable of diagnosing the degree of skin condition related to skin barrier function, another embodiment of the present invention uses it to prepare a composition for diagnosing skin condition related to skin barrier function or A kit for diagnosing skin conditions related to skin barrier function can be provided. In addition, another embodiment of the present invention can provide a method of providing basic information for diagnosing skin conditions related to skin barrier function or a method of diagnosing skin conditions related to skin barrier function using the same.

Specifically, one embodiment of the present invention includes measuring the expression level of LINC00302 in skin cells isolated from a test subject, and the expression level of LINC00302 is the RNA expression level of LINC00302, which is basic information for diagnosing skin conditions related to skin barrier function. A method of providing or a method of diagnosing skin conditions related to skin barrier function can be provided.

As an example, the methods may further include comparing the expression level of LINC00302 in skin cells isolated from the test subject with the expression level of LINC00302 in normal control skin cells. At this time, as an example, the skin cells isolated from the test subject and the normal control skin cells may be keratinocytes.

In addition, as an example, the methods provide information that there is an abnormality in the skin condition related to skin barrier function when the expression level of LINC00302 in skin cells isolated from the test subject is lower than the expression level of LINC00302 in normal control skin cells, or A diagnosis step may be further included. For example, if the expression level of LINC00302 in skin cells isolated from the test subject is about 1.1 to 2 times lower than the expression level of LINC00302 in normal control skin cells, it can be determined that there is an abnormality in the skin condition related to skin barrier function. there is. More specifically, for example, the expression level of LINC00302 in skin cells isolated from the test subject is 1.1 times more, 1.2 times more, 1.3 times more, 1.4 times more, 1.5 times more, and 1.6 times more than normal control skin cells. If it is two or more times, 1.7 times or more, 1.8 times or more, 1.9 times or more, or 2 times or more lower, it can be judged that there is a problem with the skin condition related to the skin barrier function. The expression level is a result measured with statistical significance secured. The concept of statistical significance refers to cases where a significant difference is shown through biological statistical analysis methods, and in quantitative cases, it includes cases where the p value is less than 0.05.

One embodiment of the present invention can provide a composition for diagnosing skin conditions related to skin barrier function, including the RNA detection reagent of LINC00302.

Another embodiment of the present invention may provide a kit for diagnosing skin conditions related to skin barrier function including the RNA detection reagent of LINC00302, and the kit may be used as a method of providing basic information for diagnosing skin conditions related to skin barrier function as described above or the skin condition. It may further include instructions that describe methods for diagnosing skin conditions related to barrier function.

As an example, the LINC00302 RNA detection reagent included in the composition for diagnosing skin conditions related to skin barrier function or the kit for diagnosing skin conditions related to skin barrier function may include one or more of a primer and a probe that specifically binds to LINC00302.

As used herein, “probe” means a polynucleotide having a base sequence capable of complementary binding to the target site of a gene, a variant thereof, or a polynucleotide and a labeling substance bound thereto.

As used herein, “primer” refers to a polynucleotide having a base sequence that can bind complementary to the end of a specific region of a gene used to amplify a specific region corresponding to the target region of a gene using PCR, or It means that variant. The primer is not required to be completely complementary to the end of a specific region, and can be used as long as it is complementary enough to hybridize to the end to form a double chain structure.

As used herein, “hybridization” means forming a duplex structure by pairing complementary base sequences of two single-stranded nucleic acids. Hybridization can occur not only when the complementarity between single-stranded nucleic acid sequences is perfect (perfect match), but also when some mismatched bases exist.

As used herein, “polynucleotide” refers to a polymer of a plurality of nucleotides, and refers to a polynucleotide in the broad sense including oligonucleotides, which are polymers of dozens of nucleotides in the conventional sense.

Hereinafter, the configuration and effects of the present invention will be described in more detail through examples. However, the examples below are provided only for illustrative purposes to aid understanding of the present invention, and the scope and scope of the present invention are not limited thereto.

[Experimental Example 1]

In order to confirm the RNA expression pattern of LINC00302 according to the differentiation of skin keratinocytes, the following experiment was performed.

First, human primary keratinocytes were purchased from Lonza, Inc. Walkersville, MD, USA, distributed in 60 pi dishes, and then cultured in keratinocyte growth medium (KGM-Gold™). , http://www.lonza.com/products-services/bio-research/primary-cells/human-cells-and-media/keratinocytes-and-media/kgm-gold-keratinocyte-growth-medium.aspx) Differentiation was used. At this time, cell proliferating occurs until confluency reaches 100%, so the time when confluency reaches 100% is considered '0 day'. At 'day 0', culture began with KGM-Gold™ keratinogenesis medium containing 1.2mM CaCl ₂ and differentiation was induced from then on.

RNA was extracted from the keratinocytes on the 0th, 4th, and 7th day after differentiation began (0D, 4D, 7D). After dissolving the cells using 1 ml of Trizol (Invitrogen, Carlsbad, CA, USA), the supernatant was separated using a centrifuge, and 0.35 ml of isopropanol was added to form a nucleic acid pellet. After washing with % EtOH, the pellet was dissolved in water to isolate RNA. Approximately 1 μg of RNA was made into cDNA using oligo dT and reverse transcripase, and then RT-qPCR using Applied biosystems' taqman method using a primer specific for LINC00302 RNA (assay ID: Hs03665776_g1). A quantitative analysis was performed.

The PCR was carried out for a total of 45 cycles according to the temperature cycle below.

- Pre-denaturation: 95℃, 10min,

- Denaturation: 95℃, 10sec,

- Annealing and Extension: 60℃, 1min

The LINC00302 RNA expression level was normalized to the RNA (Genebank Accession No.: NM_001002.3) expression level (assay ID: Hs99999902_m1) of the housekeeping gene RPLP0, which is shown in Figure 1.

As a result, as shown in Figure 1, it can be confirmed that the expression of LINC00302 RNA increases as keratinocytes differentiate.

[Experimental Example 2]

In order to confirm that skin barrier markers decrease when the expression of LINC00302 is suppressed in keratinocytes, the following experiment was performed.

First, keratinocytes were cultured in the same manner as described in [Experimental Example 1], and then the following two types of siRNA were introduced to knock down the expression of LINC00302 in the keratinocytes.

-si-LINC00302 #1

(sense) 5’- ACUGAACUCCCACAAAGAU - 3’ (SEQ ID NO. 2)

(antisense) 5’- A UCU UUG UGG GAG UUC AGU - 3’ (SEQ ID NO: 3)

-si-LINC00302 #2

(sense) 5’- GAGCACAACUGAAAGGGUU - 3’ (SEQ ID NO: 4)

(antisense) 5’- AACCCUUUCAGUUGUGCUC - 3’ (SEQ ID NO: 5)

Next, the keratinocytes were cultured in an incubator at 37°C and 5% CO ₂ for 7 days, and then RNA was extracted and cDNA was synthesized in the same manner as described in [Experimental Example 1].

LINC00302 Primer specific to RNA (assay ID: Hs03665776_g1), primer specific to filaggrin (FLG) mRNA (Genebank Accession No.: NM_002016), a skin barrier function marker gene (assay ID: Hs00856927_g1), involucrin (IVL) Applied Biosystems using primers specific for mRNA (Genebank Accession No.: NM_005547) (assay ID: Hs00846307_s1) and primers specific for loricrin (LOR) mRNA (Genebank Accession No.: NM_000427) (assay ID: Hs01894962_s1). RT-qPCR was performed under the same conditions as [Experimental Example 1] using the TaqMan gene expression assay kit (Applied Biosystems, FosterCity, CA) from Applied Biosystems and quantitative analysis was performed.

The LINC00302 RNA expression level was normalized to the mRNA (Genebank Accession No.: NM_001002.3) expression level (assay ID: Hs99999902_m1) of the housekeeping gene RPLP0, and this is shown in Figure 2.

As a result, as shown in Figure 2, when LINC00302 was removed from keratinocytes (si-LINC00302 #1, si-LINC00302 #2), the gene expression levels of filaggrin, involucrin, and loricrin, which are skin barrier function marker genes, were also increased. It can be confirmed that it has decreased.

[Experimental Example 3]

The relative expression level of LINC00302 of the test substance was measured according to the screening method according to an embodiment of the present invention.

First, keratinocytes were cultured in the same manner as described in [Experimental Example 1], and then the cells were treated with 300 ppm of red rice extract, known as a skin barrier strengthening substance, as a test substance. After 3 days, RNA was extracted using the same method as described in [Experimental Example 1], cDNA was created, and RT-qPCR was performed using LINC00302-specific primers.

The red rice extract was prepared according to the method disclosed in Korean Patent Publication No. 10-2015-0139298, which is incorporated herein by reference in its entirety.

As a result, as shown in Figure 3, the relative expression level of LINC00302 in cells treated with the red rice extract was approximately 1.5 times higher compared to the control group that was not treated with the red rice extract, so the red rice extract It was confirmed that it was a skin barrier strengthening substance.

A formulation example of a composition according to an embodiment of the present invention will be described below, but it can be applied to various other formulations, and this is not intended to limit the present invention, but is only intended to provide a detailed explanation.

[Formulation example 1] Nutritional lotion

Nutritional lotion can be prepared by a conventional method according to the composition shown in Table 1 below.

Raw material name and content Content (% by weight) glycerin 3.0 Butylene glycol 3.0 propylene glycol 3.0 Carboxy vinyl polymer 0.1 LINC00302 expression or activity promoting substance 0.01 beeswax 4.0 Polysorbate 60 1.5 Caprylic/Capric Liglyceride 5.0 squalane 5.0 Sorvitasequiolate 1.5 cetearyl alcohol 1.0 Triethanolamine 0.2 Preservatives, flavorings Appropriate amount Purified water remaining amount total 100

[Formulation example 2] Nutritional lotion

Nutritional lotion can be prepared by conventional methods according to the composition shown in Table 2 below.

Raw material name and content Content (% by weight) Purified water remaining amount glycerin 3.0 Butylene glycol 3.0 liquid paraffin 5.0 beta glucan 7.0 carbomer 0.1 LINC00302 expression or activity promoting substance 0.01 Caprylic/Capric Triglyceride 3.0 squalane 5.0 Cetearyl Glucoside 1.5 Sorbitan Stearate 0.4 Polysorbate 60 1.5 antiseptic Appropriate amount incense Appropriate amount pigment Appropriate amount Triethanolamine 0.1 total 100

[Formulation example 3] Nutrition cream

Nutritional cream can be prepared by a conventional method according to the composition shown in Table 3 below.

Raw material name and content Content (% by weight) glycerin 3.5 Butylene glycol 3.0 liquid paraffin 7.0 beta glucan 7.0 carbomer 0.1 LINC00302 expression or activity promoting substance 0.01 Caprylic/Capric Triglyceride 3.0 squalane 5.0 Cetearyl Glucoside 1.5 Sorbitan Stearate 0.4 Polysorbate 60 1.2 Triethanolamine 0.1 Preservatives, flavorings Appropriate amount Purified water remaining amount total 100

[Formulation Example 4] Injectable

Injections can be prepared by conventional methods according to the composition shown in Table 4 below.

Raw material name and content Weight ratio (per 1ml) sodium chloride 9.0mg Sodium Carboxymethylcellulose 30.0mg Tween 20 1.0mg LINC00302 expression or activity promoting substance 1.0mg distilled water for injection remaining amount

[Formulation Example 5] Ointment

The ointment can be prepared by a conventional method according to the composition shown in Table 5 below.

Raw material name and content Content (% by weight) glycerin 8.0 Butylene glycol 4.0 liquid paraffin 15.0 beta glucan 7.0 carbomer 0.1 LINC00302 expression or activity promoting substance 0.01 Caprylic/Capric Triglyceride 3.0 squalane 1.0 Cetearyl Glucoside 1.5 Sorbitan Stearate 0.4 cetearyl alcohol 1.0 antiseptic Appropriate amount incense Appropriate amount pigment Appropriate amount beeswax 4.0 Purified water remaining amount total 100

<110> AMOREPACIFIC CORPORATION <120> A composition for skin barrier function comprising LINC00302 promoting materials and a method for screening LINC00302 promoting materials <130> 16P556IND <160> 5 <170>CopatentIn 2.0 <210> 1 <211> 302 <212> RNA <213> Artificial Sequence <220> <223> RNA of LINC00302 <400> 1 gcctgctcca cacctgggtc tgaccagggt gagtggatct tttggaacct agacagagca 60 caactgaaag ggttgactga actcccacaa agatgtcctg caccagtctc atgcatctcg 120 ttcatcagtg cctttcatac cttcaagagc tcttgcctca gagcattgct atgcctgagg 180 tgtgtctcag aagcagccat tggcacagtg gcttggggct gggctcaaaa atttgctctc 240 ttgaagtttg gatgtgattg ctctgaacaa gctgctttgc cacaataaat attttcaagt 300 tt 302 <210> 2 <211> 19 <212> RNA <213> Artificial Sequence <220> <223> sense siRNA of LINC00302 #1 <400> 2 acugaacucc cacaaagau 19 <210> 3 <211> 19 <212> RNA <213> Artificial Sequence <220> <223> antisense siRNA of LINC00302 #1 <400> 3 aucuuuggg gaguucagu 19 <210> 4 <211> 19 <212> RNA <213> Artificial Sequence <220> <223> sense siRNA of LINC00302 #2 <400> 4 gagcacaacu gaaaggguu 19 <210> 5 <211> 19 <212> RNA <213> Artificial Sequence <220> <223> antisense siRNA of LINC00302 #2 <400> 5 aacccuuuca gugugcuc 19

Claims (24)

As a method for screening substances that enhance skin barrier function,
(a) treating skin cells with a test substance;
(b) measuring the expression level of LINC00302 (Long intergenic non-protein coding RNA 302) in skin cells treated with the test substance; and
(c) A screening method for skin barrier function enhancing substances, including the step of determining the test substance as a skin barrier function enhancing substance when the relative expression level of LINC00302 increases by more than 1.5 times. The method of claim 1, wherein the skin cells include keratinocytes. According to paragraph 1,
Step (b) includes measuring the relative expression level of LINC00302 RNA in skin cells treated with the test substance. The method of claim 1, wherein step (b) includes comparing the expression level of LINC00302 before and after treatment of skin cells with the test substance. The method of claim 1, wherein step (b) includes comparing the expression level of LINC00302 in skin cells treated with the test substance and skin cells not treated with the test substance. delete According to paragraph 1,
Skin barrier function further comprising measuring the relative expression level of one or more genes selected from the group consisting of Filaggrin, Involucrin, and Loricrin in skin cells treated with the test substance. Reinforcement material screening method. In clause 7,
When the relative expression level of one or more genes selected from the group consisting of Filaggrin, Involucrin, and Loricrin increases, the test substance is judged to be a skin barrier function enhancing substance. Screening method for substances that enhance skin barrier function. The method according to any one of claims 1 to 5, 7, and 8, wherein the skin barrier function enhancing material includes at least one of a skin moisturizing material and a skin antioxidant material. . A composition for strengthening the skin barrier function containing as an active ingredient a substance that promotes the expression or activity of LINC00302 (Long intergenic non-protein coding RNA 302). According to clause 10,
The expression or activity promoting material of LINC00302 is a composition for strengthening the skin barrier function, comprising a skin barrier function enhancing material screened according to the method according to any one of claims 1 to 5, 7, and 8. . According to clause 10,
The composition is a composition for strengthening the skin barrier function, comprising 0.00001 to 30% by weight of LINC00302 expression or activity promoting material, based on the total weight of the composition. The composition for strengthening the skin barrier function of claim 10, wherein the composition for strengthening the skin barrier function includes at least one of skin moisturizing and antioxidant use. According to clause 10,
The composition is a skin cosmetic composition, a composition for strengthening the skin barrier function. According to clause 10,
The composition is a pharmaceutical composition, a composition for strengthening the skin barrier function. According to clause 15,
The pharmaceutical composition is a composition for strengthening the skin barrier function, which is used to prevent or treat diseases caused by weakening the skin barrier function. As a method of providing basic information for diagnosing skin conditions related to skin barrier function,
(a) Measuring the expression level of LINC00302 (Long intergenic non-protein coding RNA 302) in skin cells isolated from the test subject; and
(b) As a result of measuring the expression level of LINC00302, if the expression level of LINC00302 in skin cells isolated from the test subject is more than 1.5 times lower than the expression level of LINC00302 in normal control skin cells, there is an abnormality in skin condition related to skin barrier function. A method of providing basic information for diagnosing skin conditions related to skin barrier function, including the step of providing information. According to clause 17,
A method of providing basic information for diagnosing skin conditions related to skin barrier function, further comprising comparing the expression level of LINC00302 in skin cells isolated from the test subject with the expression level of LINC00302 in normal control skin cells. The method of claim 17, wherein the LINC00302 expression level is the RNA expression level of LINC00302. A kit for diagnosing skin conditions related to skin barrier function, comprising an RNA detection reagent of LINC00302 (Long intergenic non-protein coding RNA 302) and further comprising instructions describing the method of any one of claims 17 to 19. According to clause 20,
The LINC00302 RNA detection reagent is a kit for diagnosing skin conditions related to skin barrier function, including at least one of a primer and a probe that specifically binds to LINC00302 RNA. delete Skin barrier function-related skin that contains an RNA detection reagent for LINC00302 (Long intergenic non-protein coding RNA 302), and is judged to have a skin condition related to skin barrier function if the LINC00302 RNA expression level is 1.5 times lower than the normal control group. Composition for diagnosing conditions. According to clause 23,
The RNA detection reagent of LINC00302 is a composition for diagnosing skin conditions related to skin barrier function, comprising at least one of a primer and a probe that specifically binds to LINC00302 RNA.